>Feature sequence0001 5010 2359 gene locus_tag LOCUS_00010 5010 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 8664 5137 gene locus_tag LOCUS_00020 8664 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 10600 8789 gene locus_tag LOCUS_00030 10600 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 11621 10845 gene locus_tag LOCUS_00040 11621 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 12392 11673 gene locus_tag LOCUS_00050 12392 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 15931 12557 gene locus_tag LOCUS_00060 15931 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 16554 15928 gene locus_tag LOCUS_00070 16554 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 18041 16695 gene locus_tag LOCUS_00080 gene ahcY 18041 16695 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_00080 18786 18139 gene locus_tag LOCUS_00090 18786 18139 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_00090 19006 19548 gene locus_tag LOCUS_00100 19006 19548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831025.1 protein_id gnl|my_center|LOCUS_00100 20557 19565 gene locus_tag LOCUS_00110 20557 19565 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_00110 21182 20592 gene locus_tag LOCUS_00120 21182 20592 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_00120 21623 21186 gene locus_tag LOCUS_00130 21623 21186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21856 21620 gene locus_tag LOCUS_00140 21856 21620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 21954 23894 gene locus_tag LOCUS_00150 gene selB 21954 23894 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_00150 23891 25285 gene locus_tag LOCUS_00160 gene selA 23891 25285 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_00160 27718 25298 gene locus_tag LOCUS_00170 27718 25298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 29301 28306 gene locus_tag LOCUS_00180 29301 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 29928 29389 gene locus_tag LOCUS_00190 29928 29389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 30278 30036 gene locus_tag LOCUS_00200 30278 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 33741 31402 gene locus_tag LOCUS_00210 33741 31402 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616162.1 protein_id gnl|my_center|LOCUS_00210 34369 33734 gene locus_tag LOCUS_00220 34369 33734 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_00220 34672 35568 gene locus_tag LOCUS_00230 34672 35568 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122336.1 protein_id gnl|my_center|LOCUS_00230 35606 37114 gene locus_tag LOCUS_00240 35606 37114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 37318 37506 gene locus_tag LOCUS_00250 37318 37506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 38392 37922 gene locus_tag LOCUS_00260 38392 37922 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941198.1 protein_id gnl|my_center|LOCUS_00260 >Feature sequence0002 2859 898 gene locus_tag LOCUS_00270 2859 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 4233 2965 gene locus_tag LOCUS_00280 4233 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 4992 4288 gene locus_tag LOCUS_00290 4992 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 5369 4989 gene locus_tag LOCUS_00300 5369 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 5988 5362 gene locus_tag LOCUS_00310 5988 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 6895 6263 gene locus_tag LOCUS_00320 6895 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 9947 7146 gene locus_tag LOCUS_00330 9947 7146 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_00330 11137 10043 gene locus_tag LOCUS_00340 11137 10043 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 protein_id gnl|my_center|LOCUS_00340 11446 11309 gene locus_tag LOCUS_00350 11446 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 13326 11860 gene locus_tag LOCUS_00360 13326 11860 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_00360 14922 13342 gene locus_tag LOCUS_00370 14922 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 15528 16037 gene locus_tag LOCUS_00380 15528 16037 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942971.1 protein_id gnl|my_center|LOCUS_00380 16093 18156 gene locus_tag LOCUS_00390 16093 18156 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_00390 18242 20698 gene locus_tag LOCUS_00400 18242 20698 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_00400 20695 21108 gene locus_tag LOCUS_00410 20695 21108 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_00410 21110 21457 gene locus_tag LOCUS_00420 21110 21457 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_00420 21454 22986 gene locus_tag LOCUS_00430 21454 22986 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_00430 22983 23462 gene locus_tag LOCUS_00440 22983 23462 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_00440 23459 23749 gene locus_tag LOCUS_00450 23459 23749 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_00450 23742 24095 gene locus_tag LOCUS_00460 gene mnhG 23742 24095 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 protein_id gnl|my_center|LOCUS_00460 24168 24608 gene locus_tag LOCUS_00470 24168 24608 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_00470 24605 24856 gene locus_tag LOCUS_00480 24605 24856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 25029 25232 gene locus_tag LOCUS_00490 25029 25232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 25802 25476 gene locus_tag LOCUS_00500 25802 25476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 26670 29246 gene locus_tag LOCUS_00510 26670 29246 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_00510 29243 31342 gene locus_tag LOCUS_00520 29243 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 31379 32755 gene locus_tag LOCUS_00530 31379 32755 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_00530 32822 34174 gene locus_tag LOCUS_00540 32822 34174 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_00540 34275 34799 gene locus_tag LOCUS_00550 34275 34799 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119049.1 protein_id gnl|my_center|LOCUS_00550 34796 36712 gene locus_tag LOCUS_00560 34796 36712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence0003 587 1993 gene locus_tag LOCUS_00570 587 1993 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_00570 2922 3371 gene locus_tag LOCUS_00580 2922 3371 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_00580 3394 4923 gene locus_tag LOCUS_00590 3394 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4968 6746 gene locus_tag LOCUS_00600 4968 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 7033 8058 gene locus_tag LOCUS_00610 7033 8058 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728543.1 protein_id gnl|my_center|LOCUS_00610 8068 9852 gene locus_tag LOCUS_00620 8068 9852 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_00620 9849 10400 gene locus_tag LOCUS_00630 9849 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 10397 11560 gene locus_tag LOCUS_00640 10397 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225642.1 protein_id gnl|my_center|LOCUS_00640 11542 12045 gene locus_tag LOCUS_00650 11542 12045 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 protein_id gnl|my_center|LOCUS_00650 12137 13780 gene locus_tag LOCUS_00660 12137 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 15786 14023 gene locus_tag LOCUS_00670 15786 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 15713 15889 gene locus_tag LOCUS_00680 15713 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 17057 16056 gene locus_tag LOCUS_00690 17057 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 17429 17172 gene locus_tag LOCUS_00700 17429 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 17917 17702 gene locus_tag LOCUS_00710 17917 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 18043 19026 gene locus_tag LOCUS_00720 18043 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 19214 19525 gene locus_tag LOCUS_00730 19214 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 19568 20989 gene locus_tag LOCUS_00740 19568 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 21256 21181 gene locus_tag LOCUS_t00010 21256 21181 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21378 21671 gene locus_tag LOCUS_00750 21378 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 25015 21851 gene locus_tag LOCUS_00760 25015 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 25215 25886 gene locus_tag LOCUS_00770 25215 25886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 27543 26374 gene locus_tag LOCUS_00780 27543 26374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 27654 28043 gene locus_tag LOCUS_00790 27654 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 28203 29510 gene locus_tag LOCUS_00800 28203 29510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 29661 30014 gene locus_tag LOCUS_00810 29661 30014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 30191 31963 gene locus_tag LOCUS_00820 30191 31963 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839145.1 protein_id gnl|my_center|LOCUS_00820 33547 32126 gene locus_tag LOCUS_00830 33547 32126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 33871 33575 gene locus_tag LOCUS_00840 33871 33575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 34430 33846 gene locus_tag LOCUS_00850 34430 33846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 35588 34437 gene locus_tag LOCUS_00860 35588 34437 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405465.1 protein_id gnl|my_center|LOCUS_00860 >Feature sequence0004 5326 2744 gene locus_tag LOCUS_00870 5326 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5342 5641 gene locus_tag LOCUS_00880 5342 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 5793 8339 gene locus_tag LOCUS_00890 5793 8339 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146524746.1 protein_id gnl|my_center|LOCUS_00890 8395 9747 gene locus_tag LOCUS_00900 8395 9747 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_00900 10859 9861 gene locus_tag LOCUS_00910 gene cysB 10859 9861 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 protein_id gnl|my_center|LOCUS_00910 11540 11746 gene locus_tag LOCUS_00920 11540 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00920 11940 12479 gene locus_tag LOCUS_00930 11940 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 12476 13453 gene locus_tag LOCUS_00940 12476 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 13490 14350 gene locus_tag LOCUS_00950 13490 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 14425 15591 gene locus_tag LOCUS_00960 14425 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 15817 17262 gene locus_tag LOCUS_00970 15817 17262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18599 17328 gene locus_tag LOCUS_00980 18599 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 19712 18621 gene locus_tag LOCUS_00990 19712 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 21425 19767 gene locus_tag LOCUS_01000 21425 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 22935 21565 gene locus_tag LOCUS_01010 22935 21565 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_01010 25560 22987 gene locus_tag LOCUS_01020 25560 22987 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146524746.1 protein_id gnl|my_center|LOCUS_01020 26057 25710 gene locus_tag LOCUS_01030 26057 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 26057 26212 gene locus_tag LOCUS_01040 26057 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 26979 28334 gene locus_tag LOCUS_01050 26979 28334 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_01050 28367 29155 gene locus_tag LOCUS_01060 28367 29155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 29435 31564 gene locus_tag LOCUS_01070 29435 31564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 31641 31880 gene locus_tag LOCUS_01080 31641 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 31877 32875 gene locus_tag LOCUS_01090 31877 32875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence0005 1260 385 gene locus_tag LOCUS_01100 1260 385 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_01100 2285 1389 gene locus_tag LOCUS_01110 2285 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 3733 2369 gene locus_tag LOCUS_01120 3733 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 5272 3980 gene locus_tag LOCUS_01130 5272 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5453 6604 gene locus_tag LOCUS_01140 5453 6604 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_01140 8841 7039 gene locus_tag LOCUS_01150 8841 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 9096 8860 gene locus_tag LOCUS_01160 9096 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 10856 9378 gene locus_tag LOCUS_01170 10856 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 13250 11013 gene locus_tag LOCUS_01180 gene pilM 13250 11013 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_01180 13134 13376 gene locus_tag LOCUS_01190 13134 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 14507 13596 gene locus_tag LOCUS_01200 gene hemC 14507 13596 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211465.1 protein_id gnl|my_center|LOCUS_01200 14586 15893 gene locus_tag LOCUS_01210 14586 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 18347 15912 gene locus_tag LOCUS_01220 18347 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 18733 18344 gene locus_tag LOCUS_01230 18733 18344 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_01230 21954 18730 gene locus_tag LOCUS_01240 21954 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 23190 22129 gene locus_tag LOCUS_01250 23190 22129 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_01250 23762 23187 gene locus_tag LOCUS_01260 23762 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 25161 23752 gene locus_tag LOCUS_01270 25161 23752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 25407 25862 gene locus_tag LOCUS_01280 25407 25862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 26231 27109 gene locus_tag LOCUS_01290 26231 27109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 27243 28658 gene locus_tag LOCUS_01300 27243 28658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 29584 28784 gene locus_tag LOCUS_01310 29584 28784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 29711 30310 gene locus_tag LOCUS_01320 29711 30310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 30806 30342 gene locus_tag LOCUS_01330 30806 30342 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_01330 31123 30806 gene locus_tag LOCUS_01340 31123 30806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 32676 31279 gene locus_tag LOCUS_01350 32676 31279 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence0006 776 129 gene locus_tag LOCUS_01360 776 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 3123 898 gene locus_tag LOCUS_01370 gene glgX 3123 898 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_01370 3663 5258 gene locus_tag LOCUS_01380 3663 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5515 6690 gene locus_tag LOCUS_01390 5515 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 6889 7389 gene locus_tag LOCUS_01400 6889 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7873 7628 gene locus_tag LOCUS_01410 7873 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8802 7942 gene locus_tag LOCUS_01420 8802 7942 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948181.1 protein_id gnl|my_center|LOCUS_01420 10204 8972 gene locus_tag LOCUS_01430 10204 8972 CDS product BBP7 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122127.1 protein_id gnl|my_center|LOCUS_01430 10534 11562 gene locus_tag LOCUS_01440 10534 11562 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_01440 11804 15283 gene locus_tag LOCUS_01450 11804 15283 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122837.1 protein_id gnl|my_center|LOCUS_01450 15743 15291 gene locus_tag LOCUS_01460 15743 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 16018 15743 gene locus_tag LOCUS_01470 16018 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 16981 16061 gene locus_tag LOCUS_01480 16981 16061 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120934.1 protein_id gnl|my_center|LOCUS_01480 17029 17532 gene locus_tag LOCUS_01490 17029 17532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 18260 17739 gene locus_tag LOCUS_01500 18260 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 18730 18431 gene locus_tag LOCUS_01510 18730 18431 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_01510 19464 18727 gene locus_tag LOCUS_01520 19464 18727 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088485.1 protein_id gnl|my_center|LOCUS_01520 20190 19483 gene locus_tag LOCUS_01530 20190 19483 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_01530 23064 20347 gene locus_tag LOCUS_01540 gene ppdK 23064 20347 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_01540 24182 23208 gene locus_tag LOCUS_01550 24182 23208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 24479 25747 gene locus_tag LOCUS_01560 24479 25747 CDS product BBP7 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921355.1 protein_id gnl|my_center|LOCUS_01560 26665 25937 gene locus_tag LOCUS_01570 26665 25937 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395831.1 protein_id gnl|my_center|LOCUS_01570 26732 27562 gene locus_tag LOCUS_01580 26732 27562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 27657 28400 gene locus_tag LOCUS_01590 27657 28400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 28510 29232 gene locus_tag LOCUS_01600 28510 29232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 29270 29839 gene locus_tag LOCUS_01610 29270 29839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 29857 30549 gene locus_tag LOCUS_01620 29857 30549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence0007 799 14 gene locus_tag LOCUS_01630 799 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1396 845 gene locus_tag LOCUS_01640 1396 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2510 1386 gene locus_tag LOCUS_01650 2510 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5612 3048 gene locus_tag LOCUS_01660 5612 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 5851 6096 gene locus_tag LOCUS_01670 5851 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7149 6370 gene locus_tag LOCUS_01680 7149 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7593 7240 gene locus_tag LOCUS_01690 7593 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 8303 7776 gene locus_tag LOCUS_01700 8303 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 10090 8525 gene locus_tag LOCUS_01710 10090 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 10633 10298 gene locus_tag LOCUS_01720 10633 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12371 10935 gene locus_tag LOCUS_01730 12371 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 13989 12715 gene locus_tag LOCUS_01740 13989 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 14805 15026 gene locus_tag LOCUS_01750 14805 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16080 15010 gene locus_tag LOCUS_01760 16080 15010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 16465 18378 gene locus_tag LOCUS_01770 16465 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 18560 19246 gene locus_tag LOCUS_01780 18560 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 19833 19594 gene locus_tag LOCUS_01790 19833 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 20596 20063 gene locus_tag LOCUS_01800 20596 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 20880 21272 gene locus_tag LOCUS_01810 20880 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 21396 21929 gene locus_tag LOCUS_01820 21396 21929 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668449.1 protein_id gnl|my_center|LOCUS_01820 21926 22966 gene locus_tag LOCUS_01830 21926 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 22963 24276 gene locus_tag LOCUS_01840 22963 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 24291 24740 gene locus_tag LOCUS_01850 24291 24740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 24761 27208 gene locus_tag LOCUS_01860 24761 27208 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_01860 27230 28627 gene locus_tag LOCUS_01870 27230 28627 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_01870 28694 28885 gene locus_tag LOCUS_01880 28694 28885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 28886 29917 gene locus_tag LOCUS_01890 28886 29917 CDS product Trx7/PDZ domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922213.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01890 >Feature sequence0008 86 403 gene locus_tag LOCUS_01900 86 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01900 400 654 gene locus_tag LOCUS_01910 400 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 1529 819 gene locus_tag LOCUS_01920 1529 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 2074 1634 gene locus_tag LOCUS_01930 2074 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4252 2117 gene locus_tag LOCUS_01940 4252 2117 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 protein_id gnl|my_center|LOCUS_01940 4640 4909 gene locus_tag LOCUS_01950 4640 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 5515 5087 gene locus_tag LOCUS_01960 5515 5087 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_01960 6088 5672 gene locus_tag LOCUS_01970 6088 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 6296 6838 gene locus_tag LOCUS_01980 6296 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6969 9467 gene locus_tag LOCUS_01990 6969 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10427 9471 gene locus_tag LOCUS_02000 gene cbiB 10427 9471 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 protein_id gnl|my_center|LOCUS_02000 12265 10748 gene locus_tag LOCUS_02010 12265 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 13347 12250 gene locus_tag LOCUS_02020 gene cobD 13347 12250 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_02020 14058 13594 gene locus_tag LOCUS_02030 14058 13594 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_02030 15332 14175 gene locus_tag LOCUS_02040 15332 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 15908 17287 gene locus_tag LOCUS_02050 15908 17287 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_02050 18777 17395 gene locus_tag LOCUS_02060 18777 17395 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_02060 20795 19107 gene locus_tag LOCUS_02070 20795 19107 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_02070 23323 20792 gene locus_tag LOCUS_02080 23323 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 24128 23367 gene locus_tag LOCUS_02090 24128 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 25612 24176 gene locus_tag LOCUS_02100 25612 24176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 25888 26754 gene locus_tag LOCUS_02110 25888 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 27746 26865 gene locus_tag LOCUS_02120 gene dapA 27746 26865 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_02120 28865 27804 gene locus_tag LOCUS_02130 28865 27804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 30190 28847 gene locus_tag LOCUS_02140 30190 28847 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057500.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence0009 2 1648 gene locus_tag LOCUS_02150 2 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 1659 2042 gene locus_tag LOCUS_02160 gene acpS 1659 2042 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 protein_id gnl|my_center|LOCUS_02160 2082 2972 gene locus_tag LOCUS_02170 2082 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4109 4228 gene locus_tag LOCUS_02180 4109 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4355 4203 gene locus_tag LOCUS_02190 4355 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4671 4865 gene locus_tag LOCUS_02200 4671 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4835 5779 gene locus_tag LOCUS_02210 4835 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5864 6232 gene locus_tag LOCUS_02220 5864 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02220 6275 7408 gene locus_tag LOCUS_02230 6275 7408 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02230 8796 7846 gene locus_tag LOCUS_02240 gene cysB 8796 7846 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 protein_id gnl|my_center|LOCUS_02240 9142 10440 gene locus_tag LOCUS_02250 9142 10440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_02250 10448 10975 gene locus_tag LOCUS_02260 10448 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11088 11345 gene locus_tag LOCUS_02270 11088 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11430 12365 gene locus_tag LOCUS_02280 11430 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 12435 14366 gene locus_tag LOCUS_02290 12435 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 14583 15938 gene locus_tag LOCUS_02300 14583 15938 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703460.1 protein_id gnl|my_center|LOCUS_02300 15965 17467 gene locus_tag LOCUS_02310 15965 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_02310 17494 18549 gene locus_tag LOCUS_02320 17494 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 18555 19787 gene locus_tag LOCUS_02330 18555 19787 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192249737.1 protein_id gnl|my_center|LOCUS_02330 19907 22363 gene locus_tag LOCUS_02340 19907 22363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 22533 23558 gene locus_tag LOCUS_02350 22533 23558 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_02350 23599 24615 gene locus_tag LOCUS_02360 23599 24615 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_02360 24619 25551 gene locus_tag LOCUS_02370 24619 25551 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_02370 25619 27868 gene locus_tag LOCUS_02380 25619 27868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence0010 230 988 gene locus_tag LOCUS_02390 230 988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_02390 1173 1970 gene locus_tag LOCUS_02400 1173 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2040 2306 gene locus_tag LOCUS_02410 2040 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2862 4676 gene locus_tag LOCUS_02420 2862 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4897 6405 gene locus_tag LOCUS_02430 4897 6405 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_02430 6473 8281 gene locus_tag LOCUS_02440 6473 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 8482 10860 gene locus_tag LOCUS_02450 8482 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12122 10905 gene locus_tag LOCUS_02460 12122 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 15083 12183 gene locus_tag LOCUS_02470 15083 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 16507 15134 gene locus_tag LOCUS_02480 16507 15134 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_02480 17622 16726 gene locus_tag LOCUS_02490 17622 16726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 22120 17633 gene locus_tag LOCUS_02500 22120 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 23462 22170 gene locus_tag LOCUS_02510 23462 22170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 27232 23459 gene locus_tag LOCUS_02520 27232 23459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 28501 27254 gene locus_tag LOCUS_02530 28501 27254 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence0011 237 998 gene locus_tag LOCUS_02540 237 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1786 1367 gene locus_tag LOCUS_02550 1786 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3655 2063 gene locus_tag LOCUS_02560 3655 2063 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_02560 7173 4120 gene locus_tag LOCUS_02570 7173 4120 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_02570 8573 7185 gene locus_tag LOCUS_02580 8573 7185 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_02580 11893 8600 gene locus_tag LOCUS_02590 11893 8600 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122155.1 protein_id gnl|my_center|LOCUS_02590 12038 13684 gene locus_tag LOCUS_02600 12038 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 13755 14162 gene locus_tag LOCUS_02610 13755 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 14170 15285 gene locus_tag LOCUS_02620 14170 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 15560 16351 gene locus_tag LOCUS_02630 15560 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 16467 16985 gene locus_tag LOCUS_02640 16467 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 19321 16988 gene locus_tag LOCUS_02650 19321 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 19727 20254 gene locus_tag LOCUS_02660 19727 20254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 20251 21615 gene locus_tag LOCUS_02670 20251 21615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 21670 23049 gene locus_tag LOCUS_02680 21670 23049 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_02680 23046 26492 gene locus_tag LOCUS_02690 23046 26492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 26500 27777 gene locus_tag LOCUS_02700 26500 27777 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_02700 27805 28938 gene locus_tag LOCUS_02710 27805 28938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence0012 230 2872 gene locus_tag LOCUS_02720 230 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3236 4477 gene locus_tag LOCUS_02730 3236 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4988 4569 gene locus_tag LOCUS_02740 4988 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5268 5510 gene locus_tag LOCUS_02750 5268 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6523 5789 gene locus_tag LOCUS_02760 6523 5789 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_02760 7413 6703 gene locus_tag LOCUS_02770 7413 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 8006 7479 gene locus_tag LOCUS_02780 8006 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8618 8169 gene locus_tag LOCUS_02790 8618 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 8848 8618 gene locus_tag LOCUS_02800 8848 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 9252 8842 gene locus_tag LOCUS_02810 9252 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 9894 9349 gene locus_tag LOCUS_02820 9894 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10898 10044 gene locus_tag LOCUS_02830 10898 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 11649 11044 gene locus_tag LOCUS_02840 11649 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 11855 11646 gene locus_tag LOCUS_02850 11855 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 14695 12149 gene locus_tag LOCUS_02860 gene cphA 14695 12149 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_02860 17976 15034 gene locus_tag LOCUS_02870 17976 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 18818 21052 gene locus_tag LOCUS_02880 18818 21052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_02880 21294 21785 gene locus_tag LOCUS_02890 21294 21785 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_02890 22207 24450 gene locus_tag LOCUS_02900 22207 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 24611 26053 gene locus_tag LOCUS_02910 24611 26053 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_02910 26475 27077 gene locus_tag LOCUS_02920 26475 27077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 27468 27695 gene locus_tag LOCUS_02930 27468 27695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence0013 <1 533 gene locus_tag LOCUS_02940 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007340206.1:DUF1501 domain-containing protein 581 1453 gene locus_tag LOCUS_02950 581 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1755 3755 gene locus_tag LOCUS_02960 1755 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 3752 5122 gene locus_tag LOCUS_02970 3752 5122 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 protein_id gnl|my_center|LOCUS_02970 5413 7608 gene locus_tag LOCUS_02980 5413 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7670 9064 gene locus_tag LOCUS_02990 7670 9064 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 protein_id gnl|my_center|LOCUS_02990 9301 9972 gene locus_tag LOCUS_03000 9301 9972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_03000 10397 10735 gene locus_tag LOCUS_03010 10397 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 10728 11252 gene locus_tag LOCUS_03020 10728 11252 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_03020 11249 13048 gene locus_tag LOCUS_03030 11249 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03030 13201 15675 gene locus_tag LOCUS_03040 13201 15675 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668005.1 protein_id gnl|my_center|LOCUS_03040 15734 17065 gene locus_tag LOCUS_03050 15734 17065 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326881.1 protein_id gnl|my_center|LOCUS_03050 17080 18039 gene locus_tag LOCUS_03060 17080 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 18207 20126 gene locus_tag LOCUS_03070 18207 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 20146 21420 gene locus_tag LOCUS_03080 20146 21420 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_03080 21420 22514 gene locus_tag LOCUS_03090 21420 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 25943 23001 gene locus_tag LOCUS_03100 25943 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 26374 27579 gene locus_tag LOCUS_03110 26374 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence0014 1887 1333 gene locus_tag LOCUS_03120 1887 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3137 1890 gene locus_tag LOCUS_03130 3137 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3658 3140 gene locus_tag LOCUS_03140 3658 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4659 3661 gene locus_tag LOCUS_03150 4659 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4886 5794 gene locus_tag LOCUS_03160 4886 5794 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_03160 7006 5810 gene locus_tag LOCUS_03170 7006 5810 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_03170 10429 7019 gene locus_tag LOCUS_03180 10429 7019 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_03180 11045 10419 gene locus_tag LOCUS_03190 11045 10419 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 protein_id gnl|my_center|LOCUS_03190 12510 11056 gene locus_tag LOCUS_03200 12510 11056 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_03200 13335 12658 gene locus_tag LOCUS_03210 13335 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531677.1 protein_id gnl|my_center|LOCUS_03210 14956 13349 gene locus_tag LOCUS_03220 14956 13349 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044334326.1 protein_id gnl|my_center|LOCUS_03220 16367 14997 gene locus_tag LOCUS_03230 16367 14997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 16831 17604 gene locus_tag LOCUS_03240 16831 17604 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869199.1 protein_id gnl|my_center|LOCUS_03240 17591 18013 gene locus_tag LOCUS_03250 17591 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 17914 18318 gene locus_tag LOCUS_03260 17914 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 18552 21155 gene locus_tag LOCUS_03270 18552 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 22777 21398 gene locus_tag LOCUS_03280 22777 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 22996 22907 gene locus_tag LOCUS_t00020 22996 22907 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23316 23089 gene locus_tag LOCUS_03290 23316 23089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 23787 24014 gene locus_tag LOCUS_03300 23787 24014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 24795 24190 gene locus_tag LOCUS_03310 24795 24190 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_03310 25280 24918 gene locus_tag LOCUS_03320 25280 24918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 25170 26699 gene locus_tag LOCUS_03330 25170 26699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence0015 <1 1060 gene locus_tag LOCUS_03340 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230225.1:AAA family ATPase 1136 2089 gene locus_tag LOCUS_03350 1136 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2140 2394 gene locus_tag LOCUS_03360 2140 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2493 3980 gene locus_tag LOCUS_03370 2493 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4557 5606 gene locus_tag LOCUS_03380 4557 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5678 5863 gene locus_tag LOCUS_03390 5678 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6079 8544 gene locus_tag LOCUS_03400 6079 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8549 9841 gene locus_tag LOCUS_03410 8549 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9909 11408 gene locus_tag LOCUS_03420 9909 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 12746 11472 gene locus_tag LOCUS_03430 12746 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 13063 15006 gene locus_tag LOCUS_03440 13063 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 15038 16423 gene locus_tag LOCUS_03450 15038 16423 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_03450 16460 18631 gene locus_tag LOCUS_03460 16460 18631 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921596.1 protein_id gnl|my_center|LOCUS_03460 18665 20041 gene locus_tag LOCUS_03470 18665 20041 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 protein_id gnl|my_center|LOCUS_03470 20154 21089 gene locus_tag LOCUS_03480 20154 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 21442 23256 gene locus_tag LOCUS_03490 21442 23256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 23305 24588 gene locus_tag LOCUS_03500 23305 24588 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_03500 24636 26045 gene locus_tag LOCUS_03510 24636 26045 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0016 620 207 gene locus_tag LOCUS_03520 620 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2114 939 gene locus_tag LOCUS_03530 2114 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2511 3887 gene locus_tag LOCUS_03540 2511 3887 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_03540 3971 5272 gene locus_tag LOCUS_03550 3971 5272 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_03550 5291 6508 gene locus_tag LOCUS_03560 5291 6508 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_03560 6600 8288 gene locus_tag LOCUS_03570 gene ggt 6600 8288 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_03570 10974 8302 gene locus_tag LOCUS_03580 10974 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 11585 10989 gene locus_tag LOCUS_03590 11585 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 11827 13152 gene locus_tag LOCUS_03600 11827 13152 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_03600 13199 14242 gene locus_tag LOCUS_03610 13199 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 14457 15758 gene locus_tag LOCUS_03620 14457 15758 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_03620 16856 15774 gene locus_tag LOCUS_03630 gene thrC 16856 15774 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141463.1 protein_id gnl|my_center|LOCUS_03630 18674 16878 gene locus_tag LOCUS_03640 18674 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 19591 18671 gene locus_tag LOCUS_03650 19591 18671 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836209.1 protein_id gnl|my_center|LOCUS_03650 19560 19769 gene locus_tag LOCUS_03660 19560 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 19762 20853 gene locus_tag LOCUS_03670 19762 20853 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_03670 20867 21907 gene locus_tag LOCUS_03680 20867 21907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 21951 22850 gene locus_tag LOCUS_03690 21951 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 24968 23133 gene locus_tag LOCUS_03700 24968 23133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 25401 25123 gene locus_tag LOCUS_03710 25401 25123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 25708 25508 gene locus_tag LOCUS_03720 25708 25508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence0017 767 225 gene locus_tag LOCUS_03730 gene mog 767 225 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_03730 894 2099 gene locus_tag LOCUS_03740 894 2099 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970145.1 protein_id gnl|my_center|LOCUS_03740 3688 2240 gene locus_tag LOCUS_03750 3688 2240 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263701.1 protein_id gnl|my_center|LOCUS_03750 3892 4287 gene locus_tag LOCUS_03760 3892 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5058 4456 gene locus_tag LOCUS_03770 5058 4456 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_03770 5434 5192 gene locus_tag LOCUS_03780 5434 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6439 5495 gene locus_tag LOCUS_03790 6439 5495 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_03790 8574 6724 gene locus_tag LOCUS_03800 8574 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 9931 8711 gene locus_tag LOCUS_03810 9931 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 12804 10072 gene locus_tag LOCUS_03820 12804 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 13128 14321 gene locus_tag LOCUS_03830 13128 14321 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965859.1 protein_id gnl|my_center|LOCUS_03830 14526 14924 gene locus_tag LOCUS_03840 14526 14924 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_03840 15386 16285 gene locus_tag LOCUS_03850 15386 16285 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_03850 17118 16432 gene locus_tag LOCUS_03860 17118 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 18548 17487 gene locus_tag LOCUS_03870 gene truD 18548 17487 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479835.1 protein_id gnl|my_center|LOCUS_03870 19947 18643 gene locus_tag LOCUS_03880 gene nuoD 19947 18643 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_03880 20820 20041 gene locus_tag LOCUS_03890 20820 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 21192 20851 gene locus_tag LOCUS_03900 21192 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 21453 21268 gene locus_tag LOCUS_03910 21453 21268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 22009 21479 gene locus_tag LOCUS_03920 22009 21479 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_03920 22668 22054 gene locus_tag LOCUS_03930 22668 22054 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_03930 23296 22715 gene locus_tag LOCUS_03940 gene ndhC 23296 22715 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_03940 23774 23340 gene locus_tag LOCUS_03950 23774 23340 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_03950 24394 23849 gene locus_tag LOCUS_03960 24394 23849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence0018 627 839 gene locus_tag LOCUS_03970 627 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 874 1188 gene locus_tag LOCUS_03980 874 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1472 1723 gene locus_tag LOCUS_03990 1472 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 1914 1786 gene locus_tag LOCUS_04000 1914 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2288 1941 gene locus_tag LOCUS_04010 2288 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2932 2420 gene locus_tag LOCUS_04020 2932 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2895 3167 gene locus_tag LOCUS_04030 2895 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3608 4726 gene locus_tag LOCUS_04040 3608 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5327 4959 gene locus_tag LOCUS_04050 5327 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8187 5491 gene locus_tag LOCUS_04060 8187 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8620 8270 gene locus_tag LOCUS_04070 8620 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8919 8680 gene locus_tag LOCUS_04080 8919 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 9054 9884 gene locus_tag LOCUS_04090 9054 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 10368 12002 gene locus_tag LOCUS_04100 10368 12002 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_04100 12062 11988 gene locus_tag LOCUS_t00030 12062 11988 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12952 12179 gene locus_tag LOCUS_04110 12952 12179 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_04110 14100 13015 gene locus_tag LOCUS_04120 14100 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 14818 14333 gene locus_tag LOCUS_04130 14818 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 15521 14724 gene locus_tag LOCUS_04140 15521 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 15606 16337 gene locus_tag LOCUS_04150 15606 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 19735 16760 gene locus_tag LOCUS_04160 19735 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 20701 19802 gene locus_tag LOCUS_04170 20701 19802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 23979 20764 gene locus_tag LOCUS_04180 23979 20764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence0019 <1 687 gene locus_tag LOCUS_04190 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731311.1:glycosyltransferase family 4 protein 942 1706 gene locus_tag LOCUS_04200 942 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 1734 2780 gene locus_tag LOCUS_04210 1734 2780 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_04210 3479 2787 gene locus_tag LOCUS_04220 3479 2787 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067164.1 protein_id gnl|my_center|LOCUS_04220 4386 3526 gene locus_tag LOCUS_04230 4386 3526 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532388.1 protein_id gnl|my_center|LOCUS_04230 5903 4506 gene locus_tag LOCUS_04240 5903 4506 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_04240 6216 6455 gene locus_tag LOCUS_04250 6216 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7408 6542 gene locus_tag LOCUS_04260 7408 6542 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687893.1 protein_id gnl|my_center|LOCUS_04260 8211 7480 gene locus_tag LOCUS_04270 8211 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9438 8632 gene locus_tag LOCUS_04280 9438 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11370 9628 gene locus_tag LOCUS_04290 11370 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 11385 11681 gene locus_tag LOCUS_04300 11385 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 11780 14797 gene locus_tag LOCUS_04310 11780 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 15435 15022 gene locus_tag LOCUS_04320 15435 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 16793 15432 gene locus_tag LOCUS_04330 16793 15432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 17171 16893 gene locus_tag LOCUS_04340 17171 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 17773 17168 gene locus_tag LOCUS_04350 17773 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 18128 19135 gene locus_tag LOCUS_04360 18128 19135 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_04360 19362 19937 gene locus_tag LOCUS_04370 gene dcd 19362 19937 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_04370 20011 20241 gene locus_tag LOCUS_04380 20011 20241 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_04380 20248 20616 gene locus_tag LOCUS_04390 20248 20616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 20759 24361 gene locus_tag LOCUS_04400 20759 24361 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_04400 24725 24865 gene locus_tag LOCUS_04410 24725 24865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence0020 418 1701 gene locus_tag LOCUS_04420 418 1701 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_04420 1900 4464 gene locus_tag LOCUS_04430 1900 4464 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615693.1 protein_id gnl|my_center|LOCUS_04430 4541 5848 gene locus_tag LOCUS_04440 4541 5848 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_04440 8505 6079 gene locus_tag LOCUS_04450 8505 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 9198 8728 gene locus_tag LOCUS_04460 9198 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 9505 13059 gene locus_tag LOCUS_04470 9505 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 13219 14664 gene locus_tag LOCUS_04480 13219 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_04480 14706 14945 gene locus_tag LOCUS_04490 14706 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 14994 15233 gene locus_tag LOCUS_04500 14994 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 15278 16984 gene locus_tag LOCUS_04510 15278 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 17102 17968 gene locus_tag LOCUS_04520 17102 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 18009 18254 gene locus_tag LOCUS_04530 18009 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 18247 18429 gene locus_tag LOCUS_04540 18247 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 18426 18746 gene locus_tag LOCUS_04550 18426 18746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 18746 21451 gene locus_tag LOCUS_04560 18746 21451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 21491 21865 gene locus_tag LOCUS_04570 21491 21865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21865 22098 gene locus_tag LOCUS_04580 21865 22098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 22095 22316 gene locus_tag LOCUS_04590 22095 22316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 22313 22522 gene locus_tag LOCUS_04600 22313 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 22524 22724 gene locus_tag LOCUS_04610 22524 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 22875 23189 gene locus_tag LOCUS_04620 22875 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 23294 23638 gene locus_tag LOCUS_04630 23294 23638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 23642 24163 gene locus_tag LOCUS_04640 23642 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 24115 24363 gene locus_tag LOCUS_04650 24115 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence0021 47 778 gene locus_tag LOCUS_04660 47 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 768 2000 gene locus_tag LOCUS_04670 768 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2091 5186 gene locus_tag LOCUS_04680 2091 5186 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533561.1 protein_id gnl|my_center|LOCUS_04680 5461 6411 gene locus_tag LOCUS_04690 5461 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6377 7396 gene locus_tag LOCUS_04700 6377 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 9138 7546 gene locus_tag LOCUS_04710 9138 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10868 9249 gene locus_tag LOCUS_04720 10868 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 11903 11049 gene locus_tag LOCUS_04730 11903 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 12114 11893 gene locus_tag LOCUS_04740 12114 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 13900 12425 gene locus_tag LOCUS_04750 13900 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 14075 15181 gene locus_tag LOCUS_04760 14075 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 15698 15456 gene locus_tag LOCUS_04770 15698 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 15697 17949 gene locus_tag LOCUS_04780 15697 17949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 18029 18682 gene locus_tag LOCUS_04790 18029 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 18809 19003 gene locus_tag LOCUS_04800 18809 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 19251 19024 gene locus_tag LOCUS_04810 19251 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 19397 20758 gene locus_tag LOCUS_04820 19397 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 20993 21343 gene locus_tag LOCUS_04830 20993 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 21446 22003 gene locus_tag LOCUS_04840 21446 22003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 22000 22254 gene locus_tag LOCUS_04850 22000 22254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 22316 22537 gene locus_tag LOCUS_04860 22316 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 22534 23607 gene locus_tag LOCUS_04870 22534 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence0022 3285 4256 gene locus_tag LOCUS_04880 3285 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4449 6119 gene locus_tag LOCUS_04890 gene ettA 4449 6119 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_04890 6452 6138 gene locus_tag LOCUS_04900 6452 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 6636 6361 gene locus_tag LOCUS_04910 6636 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 6794 8635 gene locus_tag LOCUS_04920 gene mnmG 6794 8635 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence0023 4082 84 gene locus_tag LOCUS_04930 4082 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4715 4119 gene locus_tag LOCUS_04940 4715 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7348 5009 gene locus_tag LOCUS_04950 7348 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7781 8965 gene locus_tag LOCUS_04960 7781 8965 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_04960 8953 11340 gene locus_tag LOCUS_04970 8953 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 11487 12893 gene locus_tag LOCUS_04980 11487 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 13142 13891 gene locus_tag LOCUS_04990 13142 13891 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_04990 14044 14400 gene locus_tag LOCUS_05000 14044 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 14703 15500 gene locus_tag LOCUS_05010 14703 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 16188 15622 gene locus_tag LOCUS_05020 16188 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 19146 16411 gene locus_tag LOCUS_05030 19146 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 20792 19413 gene locus_tag LOCUS_05040 20792 19413 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446851.1 protein_id gnl|my_center|LOCUS_05040 21690 20920 gene locus_tag LOCUS_05050 21690 20920 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965729.1 protein_id gnl|my_center|LOCUS_05050 22084 21725 gene locus_tag LOCUS_05060 22084 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence0024 481 3360 gene locus_tag LOCUS_05070 481 3360 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111012.1 protein_id gnl|my_center|LOCUS_05070 3477 4169 gene locus_tag LOCUS_05080 3477 4169 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389774.1 protein_id gnl|my_center|LOCUS_05080 5062 4469 gene locus_tag LOCUS_05090 5062 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 5354 5043 gene locus_tag LOCUS_05100 5354 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5833 5357 gene locus_tag LOCUS_05110 5833 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6073 5870 gene locus_tag LOCUS_05120 6073 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 6962 7402 gene locus_tag LOCUS_05130 6962 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 7468 9990 gene locus_tag LOCUS_05140 7468 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 10565 12961 gene locus_tag LOCUS_05150 10565 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 12951 13211 gene locus_tag LOCUS_05160 12951 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 13938 13615 gene locus_tag LOCUS_05170 13938 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 14203 14622 gene locus_tag LOCUS_05180 14203 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 14643 15092 gene locus_tag LOCUS_05190 14643 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 15815 16387 gene locus_tag LOCUS_05200 15815 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 16493 17209 gene locus_tag LOCUS_05210 16493 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 17202 17399 gene locus_tag LOCUS_05220 17202 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 18105 18380 gene locus_tag LOCUS_05230 18105 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 18454 19878 gene locus_tag LOCUS_05240 18454 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 20129 20056 gene locus_tag LOCUS_t00040 20129 20056 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20305 21120 gene locus_tag LOCUS_05250 gene cobS 20305 21120 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_05250 21964 21170 gene locus_tag LOCUS_05260 21964 21170 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667138.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence0025 2504 3883 gene locus_tag LOCUS_05270 2504 3883 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_05270 3944 5332 gene locus_tag LOCUS_05280 3944 5332 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_05280 5365 6264 gene locus_tag LOCUS_05290 5365 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 8599 6302 gene locus_tag LOCUS_05300 8599 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9215 8628 gene locus_tag LOCUS_05310 9215 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 11475 9550 gene locus_tag LOCUS_05320 11475 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 12862 11537 gene locus_tag LOCUS_05330 12862 11537 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_05330 14221 12905 gene locus_tag LOCUS_05340 14221 12905 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_05340 16823 14271 gene locus_tag LOCUS_05350 16823 14271 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615693.1 protein_id gnl|my_center|LOCUS_05350 17865 19148 gene locus_tag LOCUS_05360 17865 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 19207 20310 gene locus_tag LOCUS_05370 19207 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 20325 21596 gene locus_tag LOCUS_05380 20325 21596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 21639 22346 gene locus_tag LOCUS_05390 21639 22346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0026 <1 2298 gene locus_tag LOCUS_05400 <1 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922871.1:DUF1592 domain-containing protein 2357 3715 gene locus_tag LOCUS_05410 2357 3715 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_05410 3779 5698 gene locus_tag LOCUS_05420 3779 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5824 7197 gene locus_tag LOCUS_05430 5824 7197 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_05430 7852 7319 gene locus_tag LOCUS_05440 7852 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8580 7942 gene locus_tag LOCUS_05450 8580 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 9921 8617 gene locus_tag LOCUS_05460 9921 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10127 10927 gene locus_tag LOCUS_05470 10127 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05470 10961 11254 gene locus_tag LOCUS_05480 10961 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05480 12102 11260 gene locus_tag LOCUS_05490 12102 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 14326 12164 gene locus_tag LOCUS_05500 14326 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 15735 14326 gene locus_tag LOCUS_05510 15735 14326 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_05510 17359 15923 gene locus_tag LOCUS_05520 17359 15923 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_05520 19728 17377 gene locus_tag LOCUS_05530 19728 17377 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_05530 21414 19765 gene locus_tag LOCUS_05540 21414 19765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 21926 21414 gene locus_tag LOCUS_05550 21926 21414 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence0027 97 2166 gene locus_tag LOCUS_05560 97 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2707 2171 gene locus_tag LOCUS_05570 2707 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2839 4092 gene locus_tag LOCUS_05580 2839 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5961 5068 gene locus_tag LOCUS_05590 gene hemF 5961 5068 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172630.1 protein_id gnl|my_center|LOCUS_05590 6062 6829 gene locus_tag LOCUS_05600 6062 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 6957 8198 gene locus_tag LOCUS_05610 6957 8198 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_05610 8247 9077 gene locus_tag LOCUS_05620 8247 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9128 11674 gene locus_tag LOCUS_05630 9128 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11765 12328 gene locus_tag LOCUS_05640 11765 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 14070 12397 gene locus_tag LOCUS_05650 14070 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 14259 15746 gene locus_tag LOCUS_05660 14259 15746 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_05660 16542 16141 gene locus_tag LOCUS_05670 16542 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 16587 16916 gene locus_tag LOCUS_05680 16587 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 19265 17307 gene locus_tag LOCUS_05690 19265 17307 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_05690 19471 19854 gene locus_tag LOCUS_05700 19471 19854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 20378 19890 gene locus_tag LOCUS_05710 20378 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 22082 20397 gene locus_tag LOCUS_05720 gene ilvD 22082 20397 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence0028 151 1221 gene locus_tag LOCUS_05730 151 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 1203 2174 gene locus_tag LOCUS_05740 1203 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2339 3205 gene locus_tag LOCUS_05750 2339 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3264 4598 gene locus_tag LOCUS_05760 3264 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4721 7369 gene locus_tag LOCUS_05770 4721 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7404 8702 gene locus_tag LOCUS_05780 7404 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8029 7941 gene locus_tag LOCUS_t00050 8029 7941 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8976 8791 gene locus_tag LOCUS_05790 8976 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9511 9326 gene locus_tag LOCUS_05800 9511 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 10125 9940 gene locus_tag LOCUS_05810 10125 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 10611 10426 gene locus_tag LOCUS_05820 10611 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 11372 10899 gene locus_tag LOCUS_05830 11372 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 11812 11399 gene locus_tag LOCUS_05840 11812 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 12434 11844 gene locus_tag LOCUS_05850 12434 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_05850 12890 12465 gene locus_tag LOCUS_05860 12890 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 13632 12970 gene locus_tag LOCUS_05870 gene aat 13632 12970 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241684.1 protein_id gnl|my_center|LOCUS_05870 14270 13878 gene locus_tag LOCUS_05880 14270 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 14525 17263 gene locus_tag LOCUS_05890 gene gyrA 14525 17263 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_05890 17375 18358 gene locus_tag LOCUS_05900 17375 18358 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065050.1 protein_id gnl|my_center|LOCUS_05900 18355 19209 gene locus_tag LOCUS_05910 18355 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 19259 20161 gene locus_tag LOCUS_05920 19259 20161 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence0029 229 465 gene locus_tag LOCUS_05930 229 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1918 539 gene locus_tag LOCUS_05940 1918 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 2376 2038 gene locus_tag LOCUS_05950 2376 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2509 3120 gene locus_tag LOCUS_05960 2509 3120 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_05960 3737 3090 gene locus_tag LOCUS_05970 3737 3090 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_05970 3926 6784 gene locus_tag LOCUS_05980 3926 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 9423 7051 gene locus_tag LOCUS_05990 9423 7051 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_05990 9860 10297 gene locus_tag LOCUS_06000 9860 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 10311 11603 gene locus_tag LOCUS_06010 10311 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 12622 11672 gene locus_tag LOCUS_06020 12622 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 12822 13772 gene locus_tag LOCUS_06030 12822 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 14198 13812 gene locus_tag LOCUS_06040 14198 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 14390 15049 gene locus_tag LOCUS_06050 14390 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_06050 15367 15957 gene locus_tag LOCUS_06060 gene infC 15367 15957 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329878.1 protein_id gnl|my_center|LOCUS_06060 16098 16292 gene locus_tag LOCUS_06070 gene rpmI 16098 16292 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015481.1 protein_id gnl|my_center|LOCUS_06070 16370 16723 gene locus_tag LOCUS_06080 gene rplT 16370 16723 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_06080 16811 17833 gene locus_tag LOCUS_06090 gene pheS 16811 17833 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_06090 17859 20447 gene locus_tag LOCUS_06100 gene pheT 17859 20447 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_06100 20962 20531 gene locus_tag LOCUS_06110 20962 20531 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326136.1 protein_id gnl|my_center|LOCUS_06110 21812 21087 gene locus_tag LOCUS_06120 21812 21087 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121194.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence0030 191 1036 gene locus_tag LOCUS_06130 191 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3188 1038 gene locus_tag LOCUS_06140 3188 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3680 4834 gene locus_tag LOCUS_06150 3680 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5840 4860 gene locus_tag LOCUS_06160 5840 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6334 5894 gene locus_tag LOCUS_06170 6334 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 6497 9076 gene locus_tag LOCUS_06180 6497 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9172 10395 gene locus_tag LOCUS_06190 gene mexE 9172 10395 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_06190 10504 14007 gene locus_tag LOCUS_06200 gene mexF 10504 14007 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_06200 14094 17336 gene locus_tag LOCUS_06210 14094 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 17578 17958 gene locus_tag LOCUS_06220 17578 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 19118 18231 gene locus_tag LOCUS_06230 19118 18231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 19472 19266 gene locus_tag LOCUS_06240 19472 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 19792 21738 gene locus_tag LOCUS_06250 gene acs 19792 21738 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence0031 1221 133 gene locus_tag LOCUS_06260 1221 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4167 1570 gene locus_tag LOCUS_06270 4167 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4380 4793 gene locus_tag LOCUS_06280 4380 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4812 5774 gene locus_tag LOCUS_06290 4812 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5789 6745 gene locus_tag LOCUS_06300 5789 6745 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792065.1 protein_id gnl|my_center|LOCUS_06300 6781 7218 gene locus_tag LOCUS_06310 6781 7218 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325606.1 protein_id gnl|my_center|LOCUS_06310 7247 8455 gene locus_tag LOCUS_06320 7247 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8863 9093 gene locus_tag LOCUS_06330 8863 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9648 9980 gene locus_tag LOCUS_06340 9648 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9993 10586 gene locus_tag LOCUS_06350 9993 10586 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615894.1 protein_id gnl|my_center|LOCUS_06350 10613 10780 gene locus_tag LOCUS_06360 10613 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11696 10791 gene locus_tag LOCUS_06370 11696 10791 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187713770.1 protein_id gnl|my_center|LOCUS_06370 12299 11838 gene locus_tag LOCUS_06380 12299 11838 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_06380 12380 13252 gene locus_tag LOCUS_06390 12380 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_06390 15318 15667 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctggagggcatgccgattaccac 17966 15972 gene locus_tag LOCUS_06400 17966 15972 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_06400 18398 18207 gene locus_tag LOCUS_06410 18398 18207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 19195 18356 gene locus_tag LOCUS_06420 19195 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 19737 19192 gene locus_tag LOCUS_06430 19737 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 21035 19950 gene locus_tag LOCUS_06440 21035 19950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence0032 2026 536 gene locus_tag LOCUS_06450 2026 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117691.1 protein_id gnl|my_center|LOCUS_06450 4155 2227 gene locus_tag LOCUS_06460 4155 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 4513 5532 gene locus_tag LOCUS_06470 4513 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6011 7021 gene locus_tag LOCUS_06480 gene pseB 6011 7021 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_06480 7018 8169 gene locus_tag LOCUS_06490 gene pseC 7018 8169 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_06490 8557 8171 gene locus_tag LOCUS_06500 8557 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 8447 9169 gene locus_tag LOCUS_06510 8447 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 9166 9912 gene locus_tag LOCUS_06520 gene fabG 9166 9912 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_06520 9909 10649 gene locus_tag LOCUS_06530 9909 10649 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_06530 10639 12183 gene locus_tag LOCUS_06540 10639 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12215 13294 gene locus_tag LOCUS_06550 gene pseI 12215 13294 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_06550 14124 13399 gene locus_tag LOCUS_06560 14124 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 14157 14666 gene locus_tag LOCUS_06570 14157 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 16331 14889 gene locus_tag LOCUS_06580 16331 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17541 16396 gene locus_tag LOCUS_06590 gene wecB 17541 16396 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_06590 18933 17584 gene locus_tag LOCUS_06600 gene vpsB 18933 17584 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase VpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_06600 19379 20761 gene locus_tag LOCUS_06610 19379 20761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence0033 <1 1950 gene locus_tag LOCUS_06620 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121621.1:elongation factor Tu 2892 2080 gene locus_tag LOCUS_06630 gene cobB 2892 2080 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_06630 4159 2954 gene locus_tag LOCUS_06640 4159 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 5541 4468 gene locus_tag LOCUS_06650 5541 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5425 5850 gene locus_tag LOCUS_06660 5425 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6232 7734 gene locus_tag LOCUS_06670 6232 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_06670 7760 8815 gene locus_tag LOCUS_06680 7760 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 8812 10041 gene locus_tag LOCUS_06690 8812 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 11300 10026 gene locus_tag LOCUS_06700 11300 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 12337 11384 gene locus_tag LOCUS_06710 12337 11384 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_06710 12899 12372 gene locus_tag LOCUS_06720 12899 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 16029 12925 gene locus_tag LOCUS_06730 16029 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 17102 16254 gene locus_tag LOCUS_06740 17102 16254 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_06740 17517 18590 gene locus_tag LOCUS_06750 17517 18590 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_06750 19727 18627 gene locus_tag LOCUS_06760 19727 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 19937 20680 gene locus_tag LOCUS_06770 19937 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence0034 872 1942 gene locus_tag LOCUS_06780 872 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2258 3028 gene locus_tag LOCUS_06790 2258 3028 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_06790 3854 3045 gene locus_tag LOCUS_06800 3854 3045 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_06800 4689 3859 gene locus_tag LOCUS_06810 4689 3859 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_06810 6620 4917 gene locus_tag LOCUS_06820 6620 4917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_06820 7227 13994 gene locus_tag LOCUS_06830 7227 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 14107 15315 gene locus_tag LOCUS_06840 14107 15315 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_06840 15602 15393 gene locus_tag LOCUS_06850 15602 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 16050 15748 gene locus_tag LOCUS_06860 16050 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 16530 18113 gene locus_tag LOCUS_06870 16530 18113 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_06870 18193 18810 gene locus_tag LOCUS_06880 18193 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 18851 20122 gene locus_tag LOCUS_06890 18851 20122 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence0035 191 1708 gene locus_tag LOCUS_06900 191 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2034 2660 gene locus_tag LOCUS_06910 2034 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2804 3739 gene locus_tag LOCUS_06920 2804 3739 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420184.1 protein_id gnl|my_center|LOCUS_06920 3921 4673 gene locus_tag LOCUS_06930 gene lipB 3921 4673 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938205.1 protein_id gnl|my_center|LOCUS_06930 4648 5544 gene locus_tag LOCUS_06940 gene lipA 4648 5544 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 protein_id gnl|my_center|LOCUS_06940 5534 5761 gene locus_tag LOCUS_06950 5534 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5823 6758 gene locus_tag LOCUS_06960 5823 6758 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_06960 6787 7407 gene locus_tag LOCUS_06970 gene tmk 6787 7407 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666320.1 protein_id gnl|my_center|LOCUS_06970 7404 8438 gene locus_tag LOCUS_06980 gene holB 7404 8438 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_06980 9479 8481 gene locus_tag LOCUS_06990 9479 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9903 9553 gene locus_tag LOCUS_07000 9903 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10165 10944 gene locus_tag LOCUS_07010 10165 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 11178 11531 gene locus_tag LOCUS_07020 11178 11531 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_07020 12027 12560 gene locus_tag LOCUS_07030 gene rimI 12027 12560 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 protein_id gnl|my_center|LOCUS_07030 13484 12720 gene locus_tag LOCUS_07040 13484 12720 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_07040 13569 14078 gene locus_tag LOCUS_07050 13569 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 14075 14824 gene locus_tag LOCUS_07060 14075 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 15381 14815 gene locus_tag LOCUS_07070 15381 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 15899 15417 gene locus_tag LOCUS_07080 15899 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 16421 15996 gene locus_tag LOCUS_07090 16421 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 16754 16542 gene locus_tag LOCUS_07100 16754 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 17655 16873 gene locus_tag LOCUS_07110 17655 16873 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_07110 17759 18061 gene locus_tag LOCUS_07120 17759 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 18061 18495 gene locus_tag LOCUS_07130 18061 18495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 18580 19911 gene locus_tag LOCUS_07140 18580 19911 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence0036 370 2868 gene locus_tag LOCUS_07150 370 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 5438 3426 gene locus_tag LOCUS_07160 5438 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7646 5481 gene locus_tag LOCUS_07170 7646 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 8107 8907 gene locus_tag LOCUS_07180 8107 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07180 9150 10436 gene locus_tag LOCUS_07190 9150 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10436 11080 gene locus_tag LOCUS_07200 10436 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 11077 13218 gene locus_tag LOCUS_07210 11077 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13815 13321 gene locus_tag LOCUS_07220 13815 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14741 15325 gene locus_tag LOCUS_07230 14741 15325 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_07230 15410 17146 gene locus_tag LOCUS_07240 15410 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 17263 18171 gene locus_tag LOCUS_07250 17263 18171 CDS product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957922.1 protein_id gnl|my_center|LOCUS_07250 18390 19136 gene locus_tag LOCUS_07260 18390 19136 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence0037 1244 912 gene locus_tag LOCUS_07270 1244 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2189 1713 gene locus_tag LOCUS_07280 2189 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2425 2186 gene locus_tag LOCUS_07290 2425 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4220 3195 gene locus_tag LOCUS_07300 4220 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 5043 4444 gene locus_tag LOCUS_07310 5043 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7682 5055 gene locus_tag LOCUS_07320 gene clpB 7682 5055 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_07320 7959 8783 gene locus_tag LOCUS_07330 7959 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 9434 8694 gene locus_tag LOCUS_07340 9434 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_07340 9696 9436 gene locus_tag LOCUS_07350 9696 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 10731 9733 gene locus_tag LOCUS_07360 10731 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 11074 12264 gene locus_tag LOCUS_07370 11074 12264 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_07370 12537 12271 gene locus_tag LOCUS_07380 12537 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13948 12551 gene locus_tag LOCUS_07390 13948 12551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_07390 14122 14937 gene locus_tag LOCUS_07400 gene proC 14122 14937 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_07400 15091 16644 gene locus_tag LOCUS_07410 gene guaA 15091 16644 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_07410 16657 17067 gene locus_tag LOCUS_07420 16657 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 17070 17384 gene locus_tag LOCUS_07430 17070 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 17397 18233 gene locus_tag LOCUS_07440 gene dapF 17397 18233 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_07440 18283 18795 gene locus_tag LOCUS_07450 18283 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 18892 19578 gene locus_tag LOCUS_07460 18892 19578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence0038 199 543 gene locus_tag LOCUS_07470 199 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1561 443 gene locus_tag LOCUS_07480 1561 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1667 2623 gene locus_tag LOCUS_07490 1667 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7521 3169 gene locus_tag LOCUS_07500 7521 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8922 7591 gene locus_tag LOCUS_07510 8922 7591 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 protein_id gnl|my_center|LOCUS_07510 9658 9047 gene locus_tag LOCUS_07520 9658 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9976 10368 gene locus_tag LOCUS_07530 gene spo0F 9976 10368 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_07530 11076 17660 gene locus_tag LOCUS_07540 11076 17660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 18037 18855 gene locus_tag LOCUS_07550 18037 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07550 18828 19541 gene locus_tag LOCUS_07560 18828 19541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 19538 20140 gene locus_tag LOCUS_07570 19538 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence0039 2 1924 gene locus_tag LOCUS_07580 2 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2084 3226 gene locus_tag LOCUS_07590 2084 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3924 3571 gene locus_tag LOCUS_07600 3924 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4154 3921 gene locus_tag LOCUS_07610 4154 3921 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_07610 5596 4394 gene locus_tag LOCUS_07620 5596 4394 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615395.1 protein_id gnl|my_center|LOCUS_07620 5999 7000 gene locus_tag LOCUS_07630 gene fbp 5999 7000 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_07630 8097 7162 gene locus_tag LOCUS_07640 8097 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8427 8822 gene locus_tag LOCUS_07650 8427 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 8921 9616 gene locus_tag LOCUS_07660 8921 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9855 11483 gene locus_tag LOCUS_07670 9855 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 11600 13039 gene locus_tag LOCUS_07680 11600 13039 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_07680 14670 13114 gene locus_tag LOCUS_07690 14670 13114 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_07690 14702 14923 gene locus_tag LOCUS_07700 14702 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 15437 15042 gene locus_tag LOCUS_07710 15437 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 15646 15434 gene locus_tag LOCUS_07720 15646 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 16630 16064 gene locus_tag LOCUS_07730 16630 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 17860 16829 gene locus_tag LOCUS_07740 17860 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence0040 2228 2680 gene locus_tag LOCUS_07750 gene tnpA 2228 2680 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_07750 3119 2763 gene locus_tag LOCUS_07760 3119 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3216 4427 gene locus_tag LOCUS_07770 gene dgoD 3216 4427 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_07770 4930 5760 gene locus_tag LOCUS_07780 4930 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6234 9077 gene locus_tag LOCUS_07790 6234 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 9899 9072 gene locus_tag LOCUS_07800 9899 9072 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_07800 10615 9899 gene locus_tag LOCUS_07810 10615 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 11478 10765 gene locus_tag LOCUS_07820 11478 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 13364 11490 gene locus_tag LOCUS_07830 13364 11490 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_07830 14349 13465 gene locus_tag LOCUS_07840 14349 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_07840 16796 14643 gene locus_tag LOCUS_07850 16796 14643 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_07850 17909 17115 gene locus_tag LOCUS_07860 17909 17115 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_07860 18153 19094 gene locus_tag LOCUS_07870 18153 19094 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence0041 235 876 gene locus_tag LOCUS_07880 235 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 883 1548 gene locus_tag LOCUS_07890 883 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2223 2294 gene locus_tag LOCUS_t00060 2223 2294 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2430 3962 gene locus_tag LOCUS_07900 gene tig 2430 3962 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_07900 4201 4821 gene locus_tag LOCUS_07910 4201 4821 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_07910 4988 5602 gene locus_tag LOCUS_07920 gene clpP 4988 5602 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_07920 5599 6453 gene locus_tag LOCUS_07930 5599 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6867 6661 gene locus_tag LOCUS_07940 6867 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7148 7675 gene locus_tag LOCUS_07950 7148 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8974 7766 gene locus_tag LOCUS_07960 8974 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 9199 9480 gene locus_tag LOCUS_07970 9199 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 9485 9847 gene locus_tag LOCUS_07980 9485 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 9858 10139 gene locus_tag LOCUS_07990 9858 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 10144 11373 gene locus_tag LOCUS_08000 10144 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 13650 11446 gene locus_tag LOCUS_08010 13650 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 15614 13752 gene locus_tag LOCUS_08020 15614 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 16052 18616 gene locus_tag LOCUS_08030 16052 18616 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_08030 19100 18702 gene locus_tag LOCUS_08040 19100 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence0042 <1 560 gene locus_tag LOCUS_08050 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807705.1:FMN-binding negative transcriptional regulator 580 1014 gene locus_tag LOCUS_08060 580 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1132 2784 gene locus_tag LOCUS_08070 1132 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3231 2665 gene locus_tag LOCUS_08080 3231 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3526 3762 gene locus_tag LOCUS_08090 3526 3762 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_08090 4392 3847 gene locus_tag LOCUS_08100 4392 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5614 4733 gene locus_tag LOCUS_08110 5614 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7345 5915 gene locus_tag LOCUS_08120 7345 5915 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_08120 9083 7392 gene locus_tag LOCUS_08130 9083 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 9066 9515 gene locus_tag LOCUS_08140 9066 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 9544 12042 gene locus_tag LOCUS_08150 9544 12042 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_08150 12144 12371 gene locus_tag LOCUS_08160 12144 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 12328 12642 gene locus_tag LOCUS_08170 12328 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 12704 14179 gene locus_tag LOCUS_08180 12704 14179 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_08180 14547 15245 gene locus_tag LOCUS_08190 14547 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 15508 18018 gene locus_tag LOCUS_08200 15508 18018 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_08200 18110 18442 gene locus_tag LOCUS_08210 18110 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence0043 1654 227 gene locus_tag LOCUS_08220 1654 227 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_08220 3584 1737 gene locus_tag LOCUS_08230 gene asnB 3584 1737 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_08230 5156 3681 gene locus_tag LOCUS_08240 5156 3681 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085030.1 protein_id gnl|my_center|LOCUS_08240 6457 5189 gene locus_tag LOCUS_08250 6457 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7464 6454 gene locus_tag LOCUS_08260 7464 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 8367 7504 gene locus_tag LOCUS_08270 8367 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 9419 8349 gene locus_tag LOCUS_08280 9419 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 10707 9538 gene locus_tag LOCUS_08290 10707 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 11862 10711 gene locus_tag LOCUS_08300 11862 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 13082 11892 gene locus_tag LOCUS_08310 13082 11892 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 protein_id gnl|my_center|LOCUS_08310 14006 13098 gene locus_tag LOCUS_08320 14006 13098 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_08320 15136 14018 gene locus_tag LOCUS_08330 15136 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 16026 15346 gene locus_tag LOCUS_08340 16026 15346 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101302.1 protein_id gnl|my_center|LOCUS_08340 16909 16268 gene locus_tag LOCUS_08350 16909 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 <18996 17046 gene locus_tag LOCUS_08360 <18996 17046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037253001.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence0044 1341 187 gene locus_tag LOCUS_08370 1341 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2820 1396 gene locus_tag LOCUS_08380 gene pyk 2820 1396 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_08380 2959 7902 gene locus_tag LOCUS_08390 2959 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 7868 9799 gene locus_tag LOCUS_08400 7868 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15235 10238 gene locus_tag LOCUS_08410 15235 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 18451 16091 gene locus_tag LOCUS_08420 18451 16091 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256205.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence0045 125 1324 gene locus_tag LOCUS_08430 125 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1962 1378 gene locus_tag LOCUS_08440 1962 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2065 2919 gene locus_tag LOCUS_08450 2065 2919 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 protein_id gnl|my_center|LOCUS_08450 3052 3822 gene locus_tag LOCUS_08460 gene kdsB 3052 3822 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_08460 4131 5303 gene locus_tag LOCUS_08470 4131 5303 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_08470 5296 6153 gene locus_tag LOCUS_08480 5296 6153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812496.1 protein_id gnl|my_center|LOCUS_08480 6237 6725 gene locus_tag LOCUS_08490 6237 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 6746 8299 gene locus_tag LOCUS_08500 6746 8299 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_08500 8460 10007 gene locus_tag LOCUS_08510 8460 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 10261 10746 gene locus_tag LOCUS_08520 gene smpB 10261 10746 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_08520 10804 11814 gene locus_tag LOCUS_08530 10804 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 12420 12998 gene locus_tag LOCUS_08540 12420 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 13127 13480 gene locus_tag LOCUS_08550 13127 13480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 13516 13866 gene locus_tag LOCUS_08560 13516 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 15919 13904 gene locus_tag LOCUS_08570 15919 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 16317 16694 gene locus_tag LOCUS_08580 gene pcaC 16317 16694 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969834.1 protein_id gnl|my_center|LOCUS_08580 17873 16707 gene locus_tag LOCUS_08590 17873 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 18115 17945 gene locus_tag LOCUS_08600 18115 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence0046 834 184 gene locus_tag LOCUS_08610 834 184 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123567.1 protein_id gnl|my_center|LOCUS_08610 1944 964 gene locus_tag LOCUS_08620 1944 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3716 2259 gene locus_tag LOCUS_08630 3716 2259 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_08630 3883 7215 gene locus_tag LOCUS_08640 3883 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 8306 7311 gene locus_tag LOCUS_08650 8306 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 8580 11894 gene locus_tag LOCUS_08660 8580 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 12306 13436 gene locus_tag LOCUS_08670 12306 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922092.1 protein_id gnl|my_center|LOCUS_08670 13749 14717 gene locus_tag LOCUS_08680 gene arsM 13749 14717 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_08680 14805 15809 gene locus_tag LOCUS_08690 14805 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 18035 15975 gene locus_tag LOCUS_08700 18035 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence0047 948 565 gene locus_tag LOCUS_08710 948 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1528 1088 gene locus_tag LOCUS_08720 1528 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1791 2261 gene locus_tag LOCUS_08730 1791 2261 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199373.1 protein_id gnl|my_center|LOCUS_08730 3110 2295 gene locus_tag LOCUS_08740 3110 2295 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_08740 4463 3297 gene locus_tag LOCUS_08750 4463 3297 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_08750 5784 4504 gene locus_tag LOCUS_08760 5784 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6814 5993 gene locus_tag LOCUS_08770 6814 5993 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_08770 7440 6811 gene locus_tag LOCUS_08780 7440 6811 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_08780 7812 8873 gene locus_tag LOCUS_08790 7812 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 9414 9043 gene locus_tag LOCUS_08800 9414 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 9616 11715 gene locus_tag LOCUS_08810 gene ppk1 9616 11715 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_08810 11742 12530 gene locus_tag LOCUS_08820 11742 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 12571 18147 gene locus_tag LOCUS_08830 12571 18147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence0048 1686 595 gene locus_tag LOCUS_08840 1686 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4021 1700 gene locus_tag LOCUS_08850 4021 1700 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_08850 5398 4094 gene locus_tag LOCUS_08860 5398 4094 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_08860 6735 5449 gene locus_tag LOCUS_08870 6735 5449 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_08870 9407 6783 gene locus_tag LOCUS_08880 9407 6783 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922467.1 protein_id gnl|my_center|LOCUS_08880 9840 12362 gene locus_tag LOCUS_08890 9840 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 12389 13963 gene locus_tag LOCUS_08900 12389 13963 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_08900 13984 15438 gene locus_tag LOCUS_08910 13984 15438 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_08910 15684 16247 gene locus_tag LOCUS_08920 15684 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 16260 17297 gene locus_tag LOCUS_08930 16260 17297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence0049 825 58 gene locus_tag LOCUS_08940 825 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2203 959 gene locus_tag LOCUS_08950 2203 959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_08950 2493 3656 gene locus_tag LOCUS_08960 2493 3656 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_08960 3688 4650 gene locus_tag LOCUS_08970 3688 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 5462 4710 gene locus_tag LOCUS_08980 5462 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 7149 5644 gene locus_tag LOCUS_08990 7149 5644 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_08990 7409 8854 gene locus_tag LOCUS_09000 7409 8854 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943437.1 protein_id gnl|my_center|LOCUS_09000 9459 8956 gene locus_tag LOCUS_09010 gene coaD 9459 8956 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965045.1 protein_id gnl|my_center|LOCUS_09010 10010 9456 gene locus_tag LOCUS_09020 10010 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11556 10108 gene locus_tag LOCUS_09030 11556 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 12233 11553 gene locus_tag LOCUS_09040 12233 11553 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_09040 13055 12267 gene locus_tag LOCUS_09050 gene eutC 13055 12267 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462272.1 protein_id gnl|my_center|LOCUS_09050 14553 13087 gene locus_tag LOCUS_09060 14553 13087 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397083.1 protein_id gnl|my_center|LOCUS_09060 15971 14550 gene locus_tag LOCUS_09070 15971 14550 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_09070 16890 16147 gene locus_tag LOCUS_09080 16890 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 17547 17897 gene locus_tag LOCUS_09090 17547 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0050 121 1617 gene locus_tag LOCUS_09100 121 1617 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969004.1 protein_id gnl|my_center|LOCUS_09100 3290 1794 gene locus_tag LOCUS_09110 3290 1794 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_09110 3734 3393 gene locus_tag LOCUS_09120 3734 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4166 3810 gene locus_tag LOCUS_09130 4166 3810 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_09130 4368 4156 gene locus_tag LOCUS_09140 4368 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4624 4406 gene locus_tag LOCUS_09150 4624 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5984 4650 gene locus_tag LOCUS_09160 5984 4650 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_09160 8362 5981 gene locus_tag LOCUS_09170 8362 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 9280 8687 gene locus_tag LOCUS_09180 9280 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9534 10283 gene locus_tag LOCUS_09190 9534 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 11871 10498 gene locus_tag LOCUS_09200 11871 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 12748 12248 gene locus_tag LOCUS_09210 12748 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 13138 12770 gene locus_tag LOCUS_09220 13138 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13447 14211 gene locus_tag LOCUS_09230 13447 14211 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 protein_id gnl|my_center|LOCUS_09230 14217 14783 gene locus_tag LOCUS_09240 14217 14783 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_09240 15051 15605 gene locus_tag LOCUS_09250 15051 15605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 15662 15883 gene locus_tag LOCUS_09260 15662 15883 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_09260 15897 16643 gene locus_tag LOCUS_09270 15897 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 16883 16629 gene locus_tag LOCUS_09280 16883 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09280 17609 17013 gene locus_tag LOCUS_09290 17609 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09290 17730 17915 gene locus_tag LOCUS_09300 17730 17915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence0051 611 2311 gene locus_tag LOCUS_09310 611 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3166 2333 gene locus_tag LOCUS_09320 3166 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4250 3066 gene locus_tag LOCUS_09330 4250 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4767 5294 gene locus_tag LOCUS_09340 4767 5294 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_09340 5291 6772 gene locus_tag LOCUS_09350 5291 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6783 8894 gene locus_tag LOCUS_09360 6783 8894 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921596.1 protein_id gnl|my_center|LOCUS_09360 8922 10268 gene locus_tag LOCUS_09370 8922 10268 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 protein_id gnl|my_center|LOCUS_09370 10293 12071 gene locus_tag LOCUS_09380 10293 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 13721 12693 gene locus_tag LOCUS_09390 13721 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 14254 13829 gene locus_tag LOCUS_09400 14254 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 14253 14636 gene locus_tag LOCUS_09410 14253 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 14539 14766 gene locus_tag LOCUS_09420 14539 14766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 15531 14845 gene locus_tag LOCUS_09430 15531 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 15853 16062 gene locus_tag LOCUS_09440 15853 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 17578 16325 gene locus_tag LOCUS_09450 17578 16325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence0052 192 1460 gene locus_tag LOCUS_09460 192 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3500 1482 gene locus_tag LOCUS_09470 3500 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4158 3622 gene locus_tag LOCUS_09480 4158 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4148 4432 gene locus_tag LOCUS_09490 4148 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 5803 4454 gene locus_tag LOCUS_09500 5803 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 6943 5951 gene locus_tag LOCUS_09510 6943 5951 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_09510 7441 7058 gene locus_tag LOCUS_09520 7441 7058 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_09520 7772 7512 gene locus_tag LOCUS_09530 7772 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7729 8595 gene locus_tag LOCUS_09540 7729 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 9135 8623 gene locus_tag LOCUS_09550 9135 8623 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_09550 9295 10623 gene locus_tag LOCUS_09560 9295 10623 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_09560 10891 12156 gene locus_tag LOCUS_09570 10891 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12865 12233 gene locus_tag LOCUS_09580 12865 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 13067 13396 gene locus_tag LOCUS_09590 13067 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 14171 13512 gene locus_tag LOCUS_09600 14171 13512 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980063.1 protein_id gnl|my_center|LOCUS_09600 15123 14254 gene locus_tag LOCUS_09610 gene lpxI 15123 14254 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_09610 16174 15095 gene locus_tag LOCUS_09620 gene lpxD 16174 15095 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922341.1 protein_id gnl|my_center|LOCUS_09620 16761 16270 gene locus_tag LOCUS_09630 16761 16270 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615935.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence0053 1315 761 gene locus_tag LOCUS_09640 1315 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2950 1469 gene locus_tag LOCUS_09650 gene tssC 2950 1469 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343625.1 protein_id gnl|my_center|LOCUS_09650 3486 2950 gene locus_tag LOCUS_09660 gene tssB 3486 2950 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318241.1 protein_id gnl|my_center|LOCUS_09660 4686 3616 gene locus_tag LOCUS_09670 gene tssA 4686 3616 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_09670 5026 6402 gene locus_tag LOCUS_09680 5026 6402 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_09680 6531 6845 gene locus_tag LOCUS_09690 gene glnK 6531 6845 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367937.1 protein_id gnl|my_center|LOCUS_09690 7757 6855 gene locus_tag LOCUS_09700 7757 6855 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_09700 7853 8755 gene locus_tag LOCUS_09710 7853 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8761 9462 gene locus_tag LOCUS_09720 8761 9462 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_09720 9478 10578 gene locus_tag LOCUS_09730 9478 10578 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921817.1 protein_id gnl|my_center|LOCUS_09730 10829 11479 gene locus_tag LOCUS_09740 10829 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11466 12596 gene locus_tag LOCUS_09750 11466 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 12843 13568 gene locus_tag LOCUS_09760 12843 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 13565 16366 gene locus_tag LOCUS_09770 13565 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence0054 160 1191 gene locus_tag LOCUS_09780 160 1191 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_09780 2555 1329 gene locus_tag LOCUS_09790 2555 1329 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_09790 3200 2616 gene locus_tag LOCUS_09800 3200 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 4661 3237 gene locus_tag LOCUS_09810 4661 3237 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_09810 6487 4658 gene locus_tag LOCUS_09820 6487 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7900 6521 gene locus_tag LOCUS_09830 7900 6521 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_09830 9130 7952 gene locus_tag LOCUS_09840 9130 7952 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_09840 10181 9156 gene locus_tag LOCUS_09850 10181 9156 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529999.1 protein_id gnl|my_center|LOCUS_09850 11386 10166 gene locus_tag LOCUS_09860 11386 10166 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930876.1 protein_id gnl|my_center|LOCUS_09860 12954 11653 gene locus_tag LOCUS_09870 12954 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 13627 12989 gene locus_tag LOCUS_09880 13627 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 15942 13645 gene locus_tag LOCUS_09890 15942 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 16904 15984 gene locus_tag LOCUS_09900 gene xrt 16904 15984 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence0055 62 595 gene locus_tag LOCUS_09910 gene tssB 62 595 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973761.1 protein_id gnl|my_center|LOCUS_09910 595 2097 gene locus_tag LOCUS_09920 gene tssC 595 2097 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_09920 2385 3977 gene locus_tag LOCUS_09930 gene tssC 2385 3977 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521953.1 protein_id gnl|my_center|LOCUS_09930 4003 4806 gene locus_tag LOCUS_09940 4003 4806 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315897.1 protein_id gnl|my_center|LOCUS_09940 4927 5424 gene locus_tag LOCUS_09950 gene tssE 4927 5424 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315898.1 protein_id gnl|my_center|LOCUS_09950 5421 7262 gene locus_tag LOCUS_09960 gene tssF 5421 7262 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343627.1 protein_id gnl|my_center|LOCUS_09960 7226 8326 gene locus_tag LOCUS_09970 gene tssG 7226 8326 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_09970 8513 9130 gene locus_tag LOCUS_09980 8513 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 9376 9149 gene locus_tag LOCUS_09990 9376 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 9584 9973 gene locus_tag LOCUS_10000 9584 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 11376 10486 gene locus_tag LOCUS_10010 11376 10486 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_10010 12027 11437 gene locus_tag LOCUS_10020 12027 11437 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 protein_id gnl|my_center|LOCUS_10020 12517 14688 gene locus_tag LOCUS_10030 12517 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 14901 16691 gene locus_tag LOCUS_10040 14901 16691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence0056 2598 121 gene locus_tag LOCUS_10050 2598 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2892 3557 gene locus_tag LOCUS_10060 2892 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3564 4373 gene locus_tag LOCUS_10070 3564 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4664 6340 gene locus_tag LOCUS_10080 4664 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 6394 7704 gene locus_tag LOCUS_10090 6394 7704 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_10090 8104 8334 gene locus_tag LOCUS_10100 8104 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8431 8901 gene locus_tag LOCUS_10110 8431 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8914 10350 gene locus_tag LOCUS_10120 8914 10350 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_10120 10464 12935 gene locus_tag LOCUS_10130 10464 12935 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_10130 12932 13456 gene locus_tag LOCUS_10140 gene hoxE 12932 13456 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_10140 13434 15080 gene locus_tag LOCUS_10150 13434 15080 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_10150 15212 15928 gene locus_tag LOCUS_10160 gene hoxU 15212 15928 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_10160 15916 16458 gene locus_tag LOCUS_10170 15916 16458 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence0057 758 180 gene locus_tag LOCUS_10180 758 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1424 780 gene locus_tag LOCUS_10190 1424 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2785 1559 gene locus_tag LOCUS_10200 2785 1559 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892080.1 protein_id gnl|my_center|LOCUS_10200 4720 2870 gene locus_tag LOCUS_10210 gene pilB 4720 2870 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_10210 5887 4760 gene locus_tag LOCUS_10220 5887 4760 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944641.1 protein_id gnl|my_center|LOCUS_10220 7744 6176 gene locus_tag LOCUS_10230 7744 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9031 7955 gene locus_tag LOCUS_10240 9031 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10499 9066 gene locus_tag LOCUS_10250 10499 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10685 11890 gene locus_tag LOCUS_10260 10685 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 12781 12347 gene locus_tag LOCUS_10270 12781 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 13334 12846 gene locus_tag LOCUS_10280 13334 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 14509 13406 gene locus_tag LOCUS_10290 14509 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14910 14710 gene locus_tag LOCUS_10300 14910 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 16945 15371 gene locus_tag LOCUS_10310 16945 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence0058 709 1455 gene locus_tag LOCUS_10320 709 1455 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_10320 1789 2289 gene locus_tag LOCUS_10330 1789 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2286 2441 gene locus_tag LOCUS_10340 2286 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2646 3653 gene locus_tag LOCUS_10350 2646 3653 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057897.1 protein_id gnl|my_center|LOCUS_10350 3650 4426 gene locus_tag LOCUS_10360 3650 4426 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_10360 5612 4461 gene locus_tag LOCUS_10370 5612 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5854 6054 gene locus_tag LOCUS_10380 5854 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 7600 6038 gene locus_tag LOCUS_10390 gene cobA 7600 6038 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_10390 8087 8305 gene locus_tag LOCUS_10400 8087 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8345 8758 gene locus_tag LOCUS_10410 8345 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 9689 8772 gene locus_tag LOCUS_10420 9689 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9931 9626 gene locus_tag LOCUS_10430 9931 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 10030 10911 gene locus_tag LOCUS_10440 10030 10911 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946391.1 protein_id gnl|my_center|LOCUS_10440 11847 10933 gene locus_tag LOCUS_10450 11847 10933 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 protein_id gnl|my_center|LOCUS_10450 12586 11867 gene locus_tag LOCUS_10460 12586 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 13699 12680 gene locus_tag LOCUS_10470 13699 12680 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730921.1 protein_id gnl|my_center|LOCUS_10470 13851 14444 gene locus_tag LOCUS_10480 13851 14444 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_10480 15482 14574 gene locus_tag LOCUS_10490 15482 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 17150 15552 gene locus_tag LOCUS_10500 17150 15552 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence0059 1508 1732 gene locus_tag LOCUS_10510 1508 1732 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_10510 2598 1792 gene locus_tag LOCUS_10520 2598 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4409 2604 gene locus_tag LOCUS_10530 4409 2604 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083689.1 protein_id gnl|my_center|LOCUS_10530 7819 4406 gene locus_tag LOCUS_10540 gene drmA 7819 4406 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083688.1 protein_id gnl|my_center|LOCUS_10540 8334 7903 gene locus_tag LOCUS_10550 8334 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 8725 8336 gene locus_tag LOCUS_10560 8725 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 12755 8778 gene locus_tag LOCUS_10570 12755 8778 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083687.1 protein_id gnl|my_center|LOCUS_10570 15993 12760 gene locus_tag LOCUS_10580 gene drmD 15993 12760 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083686.1 protein_id gnl|my_center|LOCUS_10580 16856 16266 gene locus_tag LOCUS_10590 16856 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0060 <1 1048 gene locus_tag LOCUS_10600 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932353.1:molybdate ABC transporter substrate-binding protein 1092 1718 gene locus_tag LOCUS_10610 1092 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2217 1753 gene locus_tag LOCUS_10620 2217 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2348 3022 gene locus_tag LOCUS_10630 2348 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3434 3039 gene locus_tag LOCUS_10640 3434 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3662 4126 gene locus_tag LOCUS_10650 3662 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4756 4319 gene locus_tag LOCUS_10660 4756 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5182 4769 gene locus_tag LOCUS_10670 5182 4769 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269427.1 protein_id gnl|my_center|LOCUS_10670 5284 6006 gene locus_tag LOCUS_10680 5284 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 6135 6013 gene locus_tag LOCUS_10690 6135 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7789 6245 gene locus_tag LOCUS_10700 7789 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 9831 8353 gene locus_tag LOCUS_10710 9831 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10643 10005 gene locus_tag LOCUS_10720 10643 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11215 10718 gene locus_tag LOCUS_10730 gene sixA 11215 10718 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_10730 11578 13464 gene locus_tag LOCUS_10740 gene typA 11578 13464 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324768.1 protein_id gnl|my_center|LOCUS_10740 13765 14289 gene locus_tag LOCUS_10750 13765 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 14354 14917 gene locus_tag LOCUS_10760 14354 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15160 14936 gene locus_tag LOCUS_10770 15160 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 <16918 15181 gene locus_tag LOCUS_10780 <16918 15181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937748.1:adenine deaminase >Feature sequence0061 361 543 gene locus_tag LOCUS_10790 361 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 729 2633 gene locus_tag LOCUS_10800 729 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3155 2751 gene locus_tag LOCUS_10810 3155 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3549 4007 gene locus_tag LOCUS_10820 3549 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4365 6230 gene locus_tag LOCUS_10830 4365 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6227 6793 gene locus_tag LOCUS_10840 6227 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6821 9379 gene locus_tag LOCUS_10850 6821 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 10226 9399 gene locus_tag LOCUS_10860 10226 9399 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_10860 10542 11471 gene locus_tag LOCUS_10870 10542 11471 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_10870 12633 11434 gene locus_tag LOCUS_10880 12633 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 13559 12738 gene locus_tag LOCUS_10890 13559 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 14314 13556 gene locus_tag LOCUS_10900 14314 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 15958 14693 gene locus_tag LOCUS_10910 15958 14693 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921859.1 protein_id gnl|my_center|LOCUS_10910 16120 16701 gene locus_tag LOCUS_10920 16120 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0062 744 944 gene locus_tag LOCUS_10930 744 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1432 1169 gene locus_tag LOCUS_10940 1432 1169 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_10940 1714 1544 gene locus_tag LOCUS_10950 1714 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1988 1782 gene locus_tag LOCUS_10960 1988 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3221 2052 gene locus_tag LOCUS_10970 3221 2052 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_10970 4226 3363 gene locus_tag LOCUS_10980 4226 3363 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_10980 5412 4246 gene locus_tag LOCUS_10990 5412 4246 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_10990 6470 6276 gene locus_tag LOCUS_11000 6470 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6716 7021 gene locus_tag LOCUS_11010 6716 7021 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_11010 7062 8336 gene locus_tag LOCUS_11020 7062 8336 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957913.1 protein_id gnl|my_center|LOCUS_11020 8695 8294 gene locus_tag LOCUS_11030 8695 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 9093 8674 gene locus_tag LOCUS_11040 9093 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 10187 9123 gene locus_tag LOCUS_11050 10187 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 11286 10405 gene locus_tag LOCUS_11060 11286 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 11545 11919 gene locus_tag LOCUS_11070 11545 11919 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_11070 12489 12049 gene locus_tag LOCUS_11080 12489 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 14130 12838 gene locus_tag LOCUS_11090 14130 12838 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_11090 16631 14181 gene locus_tag LOCUS_11100 16631 14181 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146524746.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence0063 600 328 gene locus_tag LOCUS_11110 600 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 885 3689 gene locus_tag LOCUS_11120 885 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 6353 4401 gene locus_tag LOCUS_11130 gene cysN 6353 4401 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_11130 6725 6372 gene locus_tag LOCUS_11140 6725 6372 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_11140 7222 6737 gene locus_tag LOCUS_11150 7222 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8194 7277 gene locus_tag LOCUS_11160 gene cysD 8194 7277 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_11160 10622 8526 gene locus_tag LOCUS_11170 10622 8526 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_11170 10981 10763 gene locus_tag LOCUS_11180 10981 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 11370 10882 gene locus_tag LOCUS_11190 11370 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 <16788 11610 gene locus_tag LOCUS_11200 <16788 11610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein >Feature sequence0064 1551 322 gene locus_tag LOCUS_11210 1551 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1885 2712 gene locus_tag LOCUS_11220 1885 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3551 2829 gene locus_tag LOCUS_11230 gene queE 3551 2829 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_11230 3754 5826 gene locus_tag LOCUS_11240 3754 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5920 7614 gene locus_tag LOCUS_11250 5920 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7658 8605 gene locus_tag LOCUS_11260 7658 8605 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945844.1 protein_id gnl|my_center|LOCUS_11260 8803 9069 gene locus_tag LOCUS_11270 8803 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 9284 11605 gene locus_tag LOCUS_11280 9284 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 12587 13378 gene locus_tag LOCUS_11290 12587 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 13505 14179 gene locus_tag LOCUS_11300 13505 14179 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142137.1 protein_id gnl|my_center|LOCUS_11300 14444 15079 gene locus_tag LOCUS_11310 14444 15079 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_11310 15450 15085 gene locus_tag LOCUS_11320 15450 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 15777 16628 gene locus_tag LOCUS_11330 15777 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence0065 127 894 gene locus_tag LOCUS_11340 gene uppS 127 894 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_11340 975 1478 gene locus_tag LOCUS_11350 975 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1650 2510 gene locus_tag LOCUS_11360 1650 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2635 3597 gene locus_tag LOCUS_11370 2635 3597 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_11370 3705 5474 gene locus_tag LOCUS_11380 3705 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 5995 5783 gene locus_tag LOCUS_11390 5995 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 10601 6450 gene locus_tag LOCUS_11400 10601 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 13304 10773 gene locus_tag LOCUS_11410 13304 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 14355 13288 gene locus_tag LOCUS_11420 14355 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 14797 14441 gene locus_tag LOCUS_11430 14797 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 15827 14895 gene locus_tag LOCUS_11440 15827 14895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_11440 16032 16529 gene locus_tag LOCUS_11450 16032 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence0066 932 1288 gene locus_tag LOCUS_11460 932 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1285 1659 gene locus_tag LOCUS_11470 1285 1659 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_11470 1656 2246 gene locus_tag LOCUS_11480 1656 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2243 5926 gene locus_tag LOCUS_11490 2243 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6653 5928 gene locus_tag LOCUS_11500 6653 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7868 6663 gene locus_tag LOCUS_11510 7868 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 10053 8023 gene locus_tag LOCUS_11520 10053 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 10342 11301 gene locus_tag LOCUS_11530 10342 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 11326 11652 gene locus_tag LOCUS_11540 11326 11652 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_11540 11887 12645 gene locus_tag LOCUS_11550 11887 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 16030 12635 gene locus_tag LOCUS_11560 16030 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence0067 1882 980 gene locus_tag LOCUS_11570 1882 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3183 1900 gene locus_tag LOCUS_11580 3183 1900 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_11580 4588 3194 gene locus_tag LOCUS_11590 4588 3194 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_11590 7015 4607 gene locus_tag LOCUS_11600 7015 4607 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253280.1 protein_id gnl|my_center|LOCUS_11600 8956 7181 gene locus_tag LOCUS_11610 8956 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9522 8953 gene locus_tag LOCUS_11620 9522 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9795 11117 gene locus_tag LOCUS_11630 9795 11117 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_11630 11256 11507 gene locus_tag LOCUS_11640 11256 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 11626 14898 gene locus_tag LOCUS_11650 11626 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 14950 16113 gene locus_tag LOCUS_11660 14950 16113 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921849.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence0068 373 113 gene locus_tag LOCUS_11670 373 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 300 623 gene locus_tag LOCUS_11680 300 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 702 2039 gene locus_tag LOCUS_11690 702 2039 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_11690 2242 2430 gene locus_tag LOCUS_11700 2242 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2560 2910 gene locus_tag LOCUS_11710 2560 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3110 5206 gene locus_tag LOCUS_11720 3110 5206 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_11720 5383 7299 gene locus_tag LOCUS_11730 5383 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 7366 9618 gene locus_tag LOCUS_11740 7366 9618 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_11740 9985 9749 gene locus_tag LOCUS_11750 9985 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 10623 9982 gene locus_tag LOCUS_11760 10623 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 10646 11617 gene locus_tag LOCUS_11770 10646 11617 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_11770 11700 12617 gene locus_tag LOCUS_11780 11700 12617 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_11780 12713 13894 gene locus_tag LOCUS_11790 12713 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 13891 14595 gene locus_tag LOCUS_11800 13891 14595 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759985.1 protein_id gnl|my_center|LOCUS_11800 14966 14688 gene locus_tag LOCUS_11810 14966 14688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 14862 16439 gene locus_tag LOCUS_11820 14862 16439 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence0069 1146 271 gene locus_tag LOCUS_11830 1146 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3455 1143 gene locus_tag LOCUS_11840 3455 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3805 4353 gene locus_tag LOCUS_11850 3805 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615841.1 protein_id gnl|my_center|LOCUS_11850 4356 7139 gene locus_tag LOCUS_11860 4356 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 7159 7668 gene locus_tag LOCUS_11870 7159 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7678 7929 gene locus_tag LOCUS_11880 7678 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 8035 10626 gene locus_tag LOCUS_11890 8035 10626 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_11890 11466 10771 gene locus_tag LOCUS_11900 11466 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 11597 15427 gene locus_tag LOCUS_11910 11597 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 15615 16343 gene locus_tag LOCUS_11920 15615 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence0070 855 2078 gene locus_tag LOCUS_11930 855 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2157 2642 gene locus_tag LOCUS_11940 2157 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2991 4184 gene locus_tag LOCUS_11950 2991 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4658 4425 gene locus_tag LOCUS_11960 4658 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6690 5323 gene locus_tag LOCUS_11970 6690 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6923 6615 gene locus_tag LOCUS_11980 6923 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 7122 8264 gene locus_tag LOCUS_11990 7122 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9893 9072 gene locus_tag LOCUS_12000 9893 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10766 10134 gene locus_tag LOCUS_12010 10766 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11204 10983 gene locus_tag LOCUS_12020 11204 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 11734 12042 gene locus_tag LOCUS_12030 11734 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 13538 12597 gene locus_tag LOCUS_12040 13538 12597 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773261.1 protein_id gnl|my_center|LOCUS_12040 13836 14354 gene locus_tag LOCUS_12050 13836 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 14367 14594 gene locus_tag LOCUS_12060 14367 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 14601 14978 gene locus_tag LOCUS_12070 14601 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 15083 15289 gene locus_tag LOCUS_12080 15083 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 16063 15416 gene locus_tag LOCUS_12090 16063 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence0071 283 56 gene locus_tag LOCUS_12100 283 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 919 359 gene locus_tag LOCUS_12110 919 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 837 1061 gene locus_tag LOCUS_12120 837 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3062 1338 gene locus_tag LOCUS_12130 3062 1338 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_12130 3913 3311 gene locus_tag LOCUS_12140 3913 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4960 3932 gene locus_tag LOCUS_12150 4960 3932 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_12150 6265 5000 gene locus_tag LOCUS_12160 6265 5000 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_12160 7688 6405 gene locus_tag LOCUS_12170 gene fabF 7688 6405 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_12170 8245 7757 gene locus_tag LOCUS_12180 gene fabZ 8245 7757 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141864.1 protein_id gnl|my_center|LOCUS_12180 8762 8364 gene locus_tag LOCUS_12190 8762 8364 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_12190 9814 9050 gene locus_tag LOCUS_12200 gene fabG 9814 9050 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_12200 10298 9816 gene locus_tag LOCUS_12210 10298 9816 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 protein_id gnl|my_center|LOCUS_12210 11461 10730 gene locus_tag LOCUS_12220 11461 10730 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_12220 13836 11482 gene locus_tag LOCUS_12230 13836 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 14076 15263 gene locus_tag LOCUS_12240 14076 15263 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092856.1 protein_id gnl|my_center|LOCUS_12240 <16349 15352 gene locus_tag LOCUS_12250 <16349 15352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037401270.1:peptidase T >Feature sequence0072 3119 990 gene locus_tag LOCUS_12260 3119 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3292 3519 gene locus_tag LOCUS_12270 3292 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3736 3542 gene locus_tag LOCUS_12280 3736 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4510 3875 gene locus_tag LOCUS_12290 4510 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4723 4911 gene locus_tag LOCUS_12300 4723 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5679 4975 gene locus_tag LOCUS_12310 5679 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5894 6223 gene locus_tag LOCUS_12320 5894 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7604 6321 gene locus_tag LOCUS_12330 7604 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8883 7666 gene locus_tag LOCUS_12340 8883 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 9041 10393 gene locus_tag LOCUS_12350 9041 10393 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_12350 11027 10395 gene locus_tag LOCUS_12360 11027 10395 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_12360 11954 11088 gene locus_tag LOCUS_12370 11954 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 13353 12016 gene locus_tag LOCUS_12380 13353 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence0073 1086 217 gene locus_tag LOCUS_12390 1086 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1348 2796 gene locus_tag LOCUS_12400 1348 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3764 3042 gene locus_tag LOCUS_12410 3764 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5450 4047 gene locus_tag LOCUS_12420 5450 4047 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_12420 6467 7324 gene locus_tag LOCUS_12430 6467 7324 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_12430 7388 10885 gene locus_tag LOCUS_12440 7388 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 11776 11057 gene locus_tag LOCUS_12450 11776 11057 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_12450 12036 11773 gene locus_tag LOCUS_12460 12036 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_12460 12234 12674 gene locus_tag LOCUS_12470 gene dtd 12234 12674 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_12470 12743 14422 gene locus_tag LOCUS_12480 12743 14422 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_12480 14578 16206 gene locus_tag LOCUS_12490 14578 16206 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence0074 1946 843 gene locus_tag LOCUS_12500 1946 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2171 3670 gene locus_tag LOCUS_12510 gene glpK 2171 3670 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035612.1 protein_id gnl|my_center|LOCUS_12510 3819 4055 gene locus_tag LOCUS_12520 3819 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4052 4318 gene locus_tag LOCUS_12530 4052 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4320 5204 gene locus_tag LOCUS_12540 4320 5204 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_12540 5210 6163 gene locus_tag LOCUS_12550 5210 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6800 7237 gene locus_tag LOCUS_12560 6800 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8885 7362 gene locus_tag LOCUS_12570 gene malQ 8885 7362 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_12570 9238 10011 gene locus_tag LOCUS_12580 9238 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 10516 10136 gene locus_tag LOCUS_12590 10516 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11370 10855 gene locus_tag LOCUS_12600 11370 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 11803 12777 gene locus_tag LOCUS_12610 11803 12777 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_12610 12898 13173 gene locus_tag LOCUS_12620 12898 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 13136 13588 gene locus_tag LOCUS_12630 13136 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 13973 13593 gene locus_tag LOCUS_12640 13973 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 16035 14038 gene locus_tag LOCUS_12650 16035 14038 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence0075 1331 942 gene locus_tag LOCUS_12660 1331 942 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_12660 1525 1328 gene locus_tag LOCUS_12670 1525 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1769 1545 gene locus_tag LOCUS_12680 1769 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2426 1785 gene locus_tag LOCUS_12690 2426 1785 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_12690 2933 2439 gene locus_tag LOCUS_12700 gene ruvC 2933 2439 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_12700 4483 2984 gene locus_tag LOCUS_12710 gene cysS 4483 2984 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921769.1 protein_id gnl|my_center|LOCUS_12710 4963 4493 gene locus_tag LOCUS_12720 gene ispF 4963 4493 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_12720 6351 4999 gene locus_tag LOCUS_12730 gene dnaB 6351 4999 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_12730 6950 6438 gene locus_tag LOCUS_12740 gene rplI 6950 6438 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_12740 7548 7012 gene locus_tag LOCUS_12750 7548 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 8178 7726 gene locus_tag LOCUS_12760 8178 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 8791 8234 gene locus_tag LOCUS_12770 gene pth 8791 8234 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_12770 9538 8879 gene locus_tag LOCUS_12780 9538 8879 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_12780 9723 10592 gene locus_tag LOCUS_12790 9723 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 10620 11306 gene locus_tag LOCUS_12800 10620 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 15034 11336 gene locus_tag LOCUS_12810 15034 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 15511 15074 gene locus_tag LOCUS_12820 15511 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 16136 15666 gene locus_tag LOCUS_12830 16136 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence0076 742 44 gene locus_tag LOCUS_12840 742 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 937 1989 gene locus_tag LOCUS_12850 937 1989 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_12850 2801 2070 gene locus_tag LOCUS_12860 2801 2070 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672317.1 protein_id gnl|my_center|LOCUS_12860 3565 2831 gene locus_tag LOCUS_12870 3565 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3958 4569 gene locus_tag LOCUS_12880 3958 4569 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 protein_id gnl|my_center|LOCUS_12880 4566 5498 gene locus_tag LOCUS_12890 gene fhcD 4566 5498 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_12890 5602 5910 gene locus_tag LOCUS_12900 5602 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 5907 6287 gene locus_tag LOCUS_12910 5907 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6563 9742 gene locus_tag LOCUS_12920 6563 9742 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_12920 9991 10689 gene locus_tag LOCUS_12930 9991 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 10745 12760 gene locus_tag LOCUS_12940 10745 12760 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_12940 13566 12883 gene locus_tag LOCUS_12950 13566 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14300 13563 gene locus_tag LOCUS_12960 14300 13563 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_12960 15667 14384 gene locus_tag LOCUS_12970 15667 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence0077 613 260 gene locus_tag LOCUS_12980 613 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 947 591 gene locus_tag LOCUS_12990 947 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2521 1010 gene locus_tag LOCUS_13000 2521 1010 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_13000 2725 3939 gene locus_tag LOCUS_13010 2725 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4097 5158 gene locus_tag LOCUS_13020 4097 5158 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_13020 6224 5133 gene locus_tag LOCUS_13030 6224 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 6414 7214 gene locus_tag LOCUS_13040 gene trpC 6414 7214 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_13040 7410 8534 gene locus_tag LOCUS_13050 gene thiO 7410 8534 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103297.1 protein_id gnl|my_center|LOCUS_13050 8610 10415 gene locus_tag LOCUS_13060 8610 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 10491 12344 gene locus_tag LOCUS_13070 10491 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 12510 12749 gene locus_tag LOCUS_13080 12510 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 12939 13949 gene locus_tag LOCUS_13090 12939 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence0078 174 842 gene locus_tag LOCUS_13100 174 842 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889164.1 protein_id gnl|my_center|LOCUS_13100 2218 869 gene locus_tag LOCUS_13110 2218 869 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_13110 2887 2321 gene locus_tag LOCUS_13120 2887 2321 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_13120 3776 2928 gene locus_tag LOCUS_13130 3776 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4075 4782 gene locus_tag LOCUS_13140 4075 4782 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_13140 8708 4779 gene locus_tag LOCUS_13150 8708 4779 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119558.1 protein_id gnl|my_center|LOCUS_13150 8984 8760 gene locus_tag LOCUS_13160 8984 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 9511 8981 gene locus_tag LOCUS_13170 9511 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 9928 9656 gene locus_tag LOCUS_13180 9928 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11056 10649 gene locus_tag LOCUS_13190 11056 10649 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595914.1 protein_id gnl|my_center|LOCUS_13190 11721 11044 gene locus_tag LOCUS_13200 gene queC 11721 11044 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104586586.1 protein_id gnl|my_center|LOCUS_13200 11837 12715 gene locus_tag LOCUS_13210 gene murB 11837 12715 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_13210 13454 12852 gene locus_tag LOCUS_13220 13454 12852 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_13220 14733 13444 gene locus_tag LOCUS_13230 14733 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 15600 14752 gene locus_tag LOCUS_13240 15600 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0079 <1 2002 gene locus_tag LOCUS_13250 <1 2002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808145.1:polyamine aminopropyltransferase 2239 3330 gene locus_tag LOCUS_13260 2239 3330 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568351.1 protein_id gnl|my_center|LOCUS_13260 3337 3654 gene locus_tag LOCUS_13270 3337 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3665 3958 gene locus_tag LOCUS_13280 3665 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3976 5034 gene locus_tag LOCUS_13290 3976 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5091 5330 gene locus_tag LOCUS_13300 5091 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 5333 5734 gene locus_tag LOCUS_13310 5333 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5761 7014 gene locus_tag LOCUS_13320 gene pdhC 5761 7014 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_13320 7402 6965 gene locus_tag LOCUS_13330 7402 6965 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031578.1 protein_id gnl|my_center|LOCUS_13330 7876 7409 gene locus_tag LOCUS_13340 7876 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 9031 8066 gene locus_tag LOCUS_13350 9031 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 9112 11256 gene locus_tag LOCUS_13360 9112 11256 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_13360 11865 11527 gene locus_tag LOCUS_13370 11865 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 12567 12145 gene locus_tag LOCUS_13380 12567 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 14393 12990 gene locus_tag LOCUS_13390 gene dnaA 14393 12990 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_13390 15615 14671 gene locus_tag LOCUS_13400 15615 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence0080 1048 44 gene locus_tag LOCUS_13410 1048 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1139 1738 gene locus_tag LOCUS_13420 1139 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2694 1735 gene locus_tag LOCUS_13430 2694 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2886 5591 gene locus_tag LOCUS_13440 2886 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 5879 6577 gene locus_tag LOCUS_13450 5879 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6658 7557 gene locus_tag LOCUS_13460 6658 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 7593 8447 gene locus_tag LOCUS_13470 7593 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9309 8536 gene locus_tag LOCUS_13480 9309 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 10771 9422 gene locus_tag LOCUS_13490 10771 9422 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_13490 11611 11024 gene locus_tag LOCUS_13500 11611 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 12676 11723 gene locus_tag LOCUS_13510 12676 11723 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_13510 13724 12741 gene locus_tag LOCUS_13520 13724 12741 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324233.1 protein_id gnl|my_center|LOCUS_13520 15183 13807 gene locus_tag LOCUS_13530 15183 13807 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_13530 15551 15267 gene locus_tag LOCUS_13540 15551 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence0081 <1 7696 gene locus_tag LOCUS_13550 <1 7696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 7802 8353 gene locus_tag LOCUS_13560 7802 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 9668 8757 gene locus_tag LOCUS_13570 9668 8757 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_13570 10785 9790 gene locus_tag LOCUS_13580 10785 9790 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529026.1 protein_id gnl|my_center|LOCUS_13580 11382 11014 gene locus_tag LOCUS_13590 11382 11014 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948614.1 protein_id gnl|my_center|LOCUS_13590 13075 11510 gene locus_tag LOCUS_13600 13075 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 14353 13187 gene locus_tag LOCUS_13610 14353 13187 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085740.1 protein_id gnl|my_center|LOCUS_13610 14540 15388 gene locus_tag LOCUS_13620 14540 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence0082 1383 2963 gene locus_tag LOCUS_13630 1383 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3015 3419 gene locus_tag LOCUS_13640 3015 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 3421 3687 gene locus_tag LOCUS_13650 3421 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3739 4005 gene locus_tag LOCUS_13660 3739 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 4024 5226 gene locus_tag LOCUS_13670 4024 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 5610 5233 gene locus_tag LOCUS_13680 5610 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6095 5784 gene locus_tag LOCUS_13690 6095 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6077 6448 gene locus_tag LOCUS_13700 6077 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6426 6893 gene locus_tag LOCUS_13710 6426 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7298 6921 gene locus_tag LOCUS_13720 7298 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7945 7406 gene locus_tag LOCUS_13730 7945 7406 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_13730 8035 8382 gene locus_tag LOCUS_13740 8035 8382 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269102.1 protein_id gnl|my_center|LOCUS_13740 8648 8529 gene locus_tag LOCUS_13750 8648 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 9210 8758 gene locus_tag LOCUS_13760 9210 8758 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339262.1 protein_id gnl|my_center|LOCUS_13760 10937 9564 gene locus_tag LOCUS_13770 10937 9564 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_13770 12356 11028 gene locus_tag LOCUS_13780 12356 11028 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_13780 13880 12573 gene locus_tag LOCUS_13790 13880 12573 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_13790 15266 13947 gene locus_tag LOCUS_13800 15266 13947 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0083 949 302 gene locus_tag LOCUS_13810 949 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1271 960 gene locus_tag LOCUS_13820 1271 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2355 1456 gene locus_tag LOCUS_13830 2355 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3053 2367 gene locus_tag LOCUS_13840 3053 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058134.1 protein_id gnl|my_center|LOCUS_13840 3695 3198 gene locus_tag LOCUS_13850 3695 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4197 3841 gene locus_tag LOCUS_13860 4197 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5179 4400 gene locus_tag LOCUS_13870 5179 4400 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920766.1 protein_id gnl|my_center|LOCUS_13870 5696 5226 gene locus_tag LOCUS_13880 5696 5226 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058135.1 protein_id gnl|my_center|LOCUS_13880 6370 5693 gene locus_tag LOCUS_13890 6370 5693 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238149.1 protein_id gnl|my_center|LOCUS_13890 7259 6537 gene locus_tag LOCUS_13900 7259 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 8715 7249 gene locus_tag LOCUS_13910 8715 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 9301 10764 gene locus_tag LOCUS_13920 9301 10764 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 protein_id gnl|my_center|LOCUS_13920 12150 10837 gene locus_tag LOCUS_13930 12150 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 12937 12341 gene locus_tag LOCUS_13940 12937 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13593 12934 gene locus_tag LOCUS_13950 13593 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 15146 13590 gene locus_tag LOCUS_13960 15146 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence0084 1421 960 gene locus_tag LOCUS_13970 1421 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1855 1472 gene locus_tag LOCUS_13980 1855 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2095 1868 gene locus_tag LOCUS_13990 2095 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2437 2228 gene locus_tag LOCUS_14000 2437 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2708 2469 gene locus_tag LOCUS_14010 2708 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3258 2767 gene locus_tag LOCUS_14020 3258 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3578 3378 gene locus_tag LOCUS_14030 3578 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3973 3674 gene locus_tag LOCUS_14040 3973 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4217 3945 gene locus_tag LOCUS_14050 4217 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4844 4317 gene locus_tag LOCUS_14060 4844 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5132 5428 gene locus_tag LOCUS_14070 5132 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 5499 5717 gene locus_tag LOCUS_14080 5499 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 6231 6803 gene locus_tag LOCUS_14090 6231 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 7319 6825 gene locus_tag LOCUS_14100 7319 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 7818 8309 gene locus_tag LOCUS_14110 7818 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8890 8306 gene locus_tag LOCUS_14120 8890 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 9411 8998 gene locus_tag LOCUS_14130 9411 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 14540 9408 gene locus_tag LOCUS_14140 14540 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 14980 14639 gene locus_tag LOCUS_14150 14980 14639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence0085 632 147 gene locus_tag LOCUS_14160 632 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1037 789 gene locus_tag LOCUS_14170 1037 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1703 1287 gene locus_tag LOCUS_14180 1703 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2045 1845 gene locus_tag LOCUS_14190 2045 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3422 2238 gene locus_tag LOCUS_14200 gene moeB 3422 2238 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_14200 3944 4759 gene locus_tag LOCUS_14210 3944 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4760 5062 gene locus_tag LOCUS_14220 4760 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5133 5765 gene locus_tag LOCUS_14230 5133 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5998 6783 gene locus_tag LOCUS_14240 5998 6783 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_14240 7577 6864 gene locus_tag LOCUS_14250 7577 6864 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_14250 7844 7605 gene locus_tag LOCUS_14260 7844 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 8985 8047 gene locus_tag LOCUS_14270 8985 8047 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_14270 9827 9051 gene locus_tag LOCUS_14280 9827 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9970 10791 gene locus_tag LOCUS_14290 9970 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 11028 15059 gene locus_tag LOCUS_14300 11028 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0086 308 1477 gene locus_tag LOCUS_14310 gene truD 308 1477 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393246.1 protein_id gnl|my_center|LOCUS_14310 2589 1507 gene locus_tag LOCUS_14320 2589 1507 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870487.1 protein_id gnl|my_center|LOCUS_14320 2854 3360 gene locus_tag LOCUS_14330 2854 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 4894 3494 gene locus_tag LOCUS_14340 4894 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 5920 4946 gene locus_tag LOCUS_14350 gene hemH 5920 4946 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529728.1 protein_id gnl|my_center|LOCUS_14350 6302 5994 gene locus_tag LOCUS_14360 6302 5994 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_14360 8848 6470 gene locus_tag LOCUS_14370 8848 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 10171 8951 gene locus_tag LOCUS_14380 10171 8951 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143735.1 protein_id gnl|my_center|LOCUS_14380 10956 10204 gene locus_tag LOCUS_14390 10956 10204 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_14390 11390 12091 gene locus_tag LOCUS_14400 11390 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 12113 12706 gene locus_tag LOCUS_14410 12113 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 14760 13042 gene locus_tag LOCUS_14420 14760 13042 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence0087 2511 1141 gene locus_tag LOCUS_14430 2511 1141 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_14430 3900 2557 gene locus_tag LOCUS_14440 3900 2557 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_14440 4279 3989 gene locus_tag LOCUS_14450 4279 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6202 4385 gene locus_tag LOCUS_14460 6202 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6393 7088 gene locus_tag LOCUS_14470 6393 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 7602 7162 gene locus_tag LOCUS_14480 7602 7162 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 protein_id gnl|my_center|LOCUS_14480 8959 7715 gene locus_tag LOCUS_14490 8959 7715 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086613.1 protein_id gnl|my_center|LOCUS_14490 9171 10979 gene locus_tag LOCUS_14500 9171 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11158 10907 gene locus_tag LOCUS_14510 11158 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 11568 12626 gene locus_tag LOCUS_14520 11568 12626 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_14520 13116 12712 gene locus_tag LOCUS_14530 13116 12712 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327289.1 protein_id gnl|my_center|LOCUS_14530 13269 14264 gene locus_tag LOCUS_14540 13269 14264 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_14540 14976 14452 gene locus_tag LOCUS_14550 14976 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence0088 1709 66 gene locus_tag LOCUS_14560 1709 66 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020017.1 protein_id gnl|my_center|LOCUS_14560 1895 3127 gene locus_tag LOCUS_14570 1895 3127 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_14570 3377 6148 gene locus_tag LOCUS_14580 3377 6148 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942202.1 protein_id gnl|my_center|LOCUS_14580 7422 6421 gene locus_tag LOCUS_14590 gene hemB 7422 6421 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_14590 8301 7477 gene locus_tag LOCUS_14600 8301 7477 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_14600 9486 8305 gene locus_tag LOCUS_14610 9486 8305 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_14610 10133 9561 gene locus_tag LOCUS_14620 10133 9561 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_14620 12592 10286 gene locus_tag LOCUS_14630 12592 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13775 12582 gene locus_tag LOCUS_14640 13775 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 15044 14037 gene locus_tag LOCUS_14650 15044 14037 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122799.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence0089 488 198 gene locus_tag LOCUS_14660 488 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 369 1331 gene locus_tag LOCUS_14670 369 1331 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921954.1 protein_id gnl|my_center|LOCUS_14670 1348 1764 gene locus_tag LOCUS_14680 1348 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1868 2179 gene locus_tag LOCUS_14690 1868 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2303 3004 gene locus_tag LOCUS_14700 2303 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3018 3821 gene locus_tag LOCUS_14710 3018 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4711 3941 gene locus_tag LOCUS_14720 4711 3941 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_14720 5717 4881 gene locus_tag LOCUS_14730 5717 4881 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395936.1 protein_id gnl|my_center|LOCUS_14730 6959 5799 gene locus_tag LOCUS_14740 6959 5799 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_14740 7741 6956 gene locus_tag LOCUS_14750 7741 6956 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_14750 7964 8308 gene locus_tag LOCUS_14760 7964 8308 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879421.1 protein_id gnl|my_center|LOCUS_14760 8336 8482 gene locus_tag LOCUS_14770 8336 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8571 8837 gene locus_tag LOCUS_14780 8571 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8899 10236 gene locus_tag LOCUS_14790 8899 10236 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 transl_except (pos:9247..9249,aa:Sec) note codon on position 117 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14790 10404 11192 gene locus_tag LOCUS_14800 10404 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 11242 12876 gene locus_tag LOCUS_14810 11242 12876 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_14810 13012 13818 gene locus_tag LOCUS_14820 13012 13818 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870684.1 protein_id gnl|my_center|LOCUS_14820 14378 13902 gene locus_tag LOCUS_14830 14378 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 15028 14675 gene locus_tag LOCUS_14840 15028 14675 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390756.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence0090 824 6004 gene locus_tag LOCUS_14850 824 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 7568 5982 gene locus_tag LOCUS_14860 gene crtD 7568 5982 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_14860 7762 8169 gene locus_tag LOCUS_14870 7762 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 8266 9189 gene locus_tag LOCUS_14880 8266 9189 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_14880 9284 9808 gene locus_tag LOCUS_14890 gene tpx 9284 9808 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_14890 11249 9957 gene locus_tag LOCUS_14900 11249 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 11398 12996 gene locus_tag LOCUS_14910 11398 12996 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_14910 13032 13757 gene locus_tag LOCUS_14920 13032 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 13754 14272 gene locus_tag LOCUS_14930 13754 14272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0091 3733 1238 gene locus_tag LOCUS_14940 3733 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4445 3870 gene locus_tag LOCUS_14950 4445 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4499 5287 gene locus_tag LOCUS_14960 4499 5287 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899275.1 protein_id gnl|my_center|LOCUS_14960 5324 6358 gene locus_tag LOCUS_14970 5324 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6550 7560 gene locus_tag LOCUS_14980 6550 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 7681 8001 gene locus_tag LOCUS_14990 7681 8001 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_14990 8184 8546 gene locus_tag LOCUS_15000 8184 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 9088 8690 gene locus_tag LOCUS_15010 9088 8690 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_15010 9764 9093 gene locus_tag LOCUS_15020 9764 9093 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940072.1 protein_id gnl|my_center|LOCUS_15020 9863 10570 gene locus_tag LOCUS_15030 9863 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 10814 13198 gene locus_tag LOCUS_15040 10814 13198 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928491.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence0092 294 743 gene locus_tag LOCUS_15050 294 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1377 985 gene locus_tag LOCUS_15060 1377 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1703 2083 gene locus_tag LOCUS_15070 1703 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2534 3268 gene locus_tag LOCUS_15080 2534 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3795 5474 gene locus_tag LOCUS_15090 3795 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5973 7316 gene locus_tag LOCUS_15100 5973 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 7648 7436 gene locus_tag LOCUS_15110 7648 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7898 7692 gene locus_tag LOCUS_15120 7898 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 8293 7940 gene locus_tag LOCUS_15130 8293 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 8566 8333 gene locus_tag LOCUS_15140 8566 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9259 8633 gene locus_tag LOCUS_15150 9259 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 10232 9531 gene locus_tag LOCUS_15160 10232 9531 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_15160 13432 10229 gene locus_tag LOCUS_15170 13432 10229 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_15170 14644 13451 gene locus_tag LOCUS_15180 14644 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence0093 397 1257 gene locus_tag LOCUS_15190 397 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1303 1632 gene locus_tag LOCUS_15200 1303 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1840 2919 gene locus_tag LOCUS_15210 gene mnmA 1840 2919 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_15210 3845 2931 gene locus_tag LOCUS_15220 3845 2931 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_15220 6172 3869 gene locus_tag LOCUS_15230 6172 3869 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_15230 8578 6350 gene locus_tag LOCUS_15240 8578 6350 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122940.1 protein_id gnl|my_center|LOCUS_15240 9518 8622 gene locus_tag LOCUS_15250 9518 8622 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_15250 9979 9518 gene locus_tag LOCUS_15260 9979 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 10696 10088 gene locus_tag LOCUS_15270 10696 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 11887 10865 gene locus_tag LOCUS_15280 11887 10865 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_15280 11889 12188 gene locus_tag LOCUS_15290 11889 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 14608 12551 gene locus_tag LOCUS_15300 14608 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence0094 2826 652 gene locus_tag LOCUS_15310 2826 652 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_15310 3114 4031 gene locus_tag LOCUS_15320 3114 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4120 5049 gene locus_tag LOCUS_15330 4120 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5077 6042 gene locus_tag LOCUS_15340 5077 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6055 7053 gene locus_tag LOCUS_15350 6055 7053 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_15350 7046 8221 gene locus_tag LOCUS_15360 7046 8221 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_15360 8244 9260 gene locus_tag LOCUS_15370 8244 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 9268 10191 gene locus_tag LOCUS_15380 9268 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 10270 10611 gene locus_tag LOCUS_15390 10270 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 10601 12421 gene locus_tag LOCUS_15400 10601 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 13221 12481 gene locus_tag LOCUS_15410 13221 12481 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_15410 14423 13218 gene locus_tag LOCUS_15420 14423 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence0095 997 554 gene locus_tag LOCUS_15430 997 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1132 1317 gene locus_tag LOCUS_15440 gene csrA 1132 1317 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632782.1 protein_id gnl|my_center|LOCUS_15440 2040 2999 gene locus_tag LOCUS_15450 2040 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 7626 3067 gene locus_tag LOCUS_15460 7626 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 8309 10927 gene locus_tag LOCUS_15470 8309 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 14322 11053 gene locus_tag LOCUS_15480 14322 11053 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615526.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence0096 392 177 gene locus_tag LOCUS_15490 392 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 649 2031 gene locus_tag LOCUS_15500 649 2031 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_15500 2432 2136 gene locus_tag LOCUS_15510 2432 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2701 2429 gene locus_tag LOCUS_15520 2701 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3066 4331 gene locus_tag LOCUS_15530 gene thrC 3066 4331 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_15530 4382 4756 gene locus_tag LOCUS_15540 4382 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 4849 5121 gene locus_tag LOCUS_15550 4849 5121 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_15550 5259 5164 gene locus_tag LOCUS_t00070 5259 5164 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5579 6217 gene locus_tag LOCUS_15560 5579 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6247 7281 gene locus_tag LOCUS_15570 6247 7281 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_15570 7331 7555 gene locus_tag LOCUS_15580 7331 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 7583 7873 gene locus_tag LOCUS_15590 7583 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 7870 8127 gene locus_tag LOCUS_15600 7870 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8301 8621 gene locus_tag LOCUS_15610 8301 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 8618 8872 gene locus_tag LOCUS_15620 8618 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8909 10048 gene locus_tag LOCUS_15630 8909 10048 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_15630 10078 10389 gene locus_tag LOCUS_15640 10078 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 11196 10360 gene locus_tag LOCUS_15650 11196 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 12343 11219 gene locus_tag LOCUS_15660 gene queA 12343 11219 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_15660 12920 12354 gene locus_tag LOCUS_15670 12920 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 13455 13174 gene locus_tag LOCUS_15680 13455 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0097 2270 1353 gene locus_tag LOCUS_15690 2270 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2503 3582 gene locus_tag LOCUS_15700 gene gcvT 2503 3582 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393443.1 protein_id gnl|my_center|LOCUS_15700 3641 4027 gene locus_tag LOCUS_15710 gene gcvH 3641 4027 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_15710 4104 5450 gene locus_tag LOCUS_15720 gene gcvPA 4104 5450 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331407.1 protein_id gnl|my_center|LOCUS_15720 5470 5820 gene locus_tag LOCUS_15730 5470 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5853 7304 gene locus_tag LOCUS_15740 gene gcvPB 5853 7304 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 protein_id gnl|my_center|LOCUS_15740 7292 8029 gene locus_tag LOCUS_15750 7292 8029 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_15750 9722 8133 gene locus_tag LOCUS_15760 9722 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 10957 9755 gene locus_tag LOCUS_15770 10957 9755 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_15770 12608 11163 gene locus_tag LOCUS_15780 12608 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 14240 13035 gene locus_tag LOCUS_15790 14240 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0098 1910 1029 gene locus_tag LOCUS_15800 1910 1029 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_15800 3137 2154 gene locus_tag LOCUS_15810 gene hpnC 3137 2154 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_15810 3757 4164 gene locus_tag LOCUS_15820 3757 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4513 6375 gene locus_tag LOCUS_15830 4513 6375 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_15830 6598 9774 gene locus_tag LOCUS_15840 6598 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 10282 9833 gene locus_tag LOCUS_15850 10282 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 11341 10283 gene locus_tag LOCUS_15860 11341 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 14073 11380 gene locus_tag LOCUS_15870 14073 11380 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_15870 14519 14070 gene locus_tag LOCUS_15880 14519 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence0099 2165 45 gene locus_tag LOCUS_15890 2165 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2365 3237 gene locus_tag LOCUS_15900 2365 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3234 3500 gene locus_tag LOCUS_15910 3234 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4467 3460 gene locus_tag LOCUS_15920 4467 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 5267 4530 gene locus_tag LOCUS_15930 gene rph 5267 4530 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330546.1 protein_id gnl|my_center|LOCUS_15930 5921 5271 gene locus_tag LOCUS_15940 5921 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 6301 5936 gene locus_tag LOCUS_15950 6301 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 7305 6328 gene locus_tag LOCUS_15960 gene argF 7305 6328 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921923.1 protein_id gnl|my_center|LOCUS_15960 8607 7423 gene locus_tag LOCUS_15970 8607 7423 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546465.1 protein_id gnl|my_center|LOCUS_15970 9727 8852 gene locus_tag LOCUS_15980 gene argB 9727 8852 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_15980 9973 10836 gene locus_tag LOCUS_15990 9973 10836 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_15990 11036 12592 gene locus_tag LOCUS_16000 11036 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 13044 14360 gene locus_tag LOCUS_16010 13044 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence0100 <1 696 gene locus_tag LOCUS_16020 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941986.1:CusA/CzcA family heavy metal efflux RND transporter 744 1196 gene locus_tag LOCUS_16030 gene cadR 744 1196 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_16030 1740 2039 gene locus_tag LOCUS_16040 1740 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2244 2726 gene locus_tag LOCUS_16050 2244 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2972 3619 gene locus_tag LOCUS_16060 2972 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3750 3944 gene locus_tag LOCUS_16070 3750 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4192 3965 gene locus_tag LOCUS_16080 4192 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4347 5717 gene locus_tag LOCUS_16090 4347 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5963 6319 gene locus_tag LOCUS_16100 5963 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 6421 6978 gene locus_tag LOCUS_16110 6421 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 6975 7226 gene locus_tag LOCUS_16120 6975 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 7276 7497 gene locus_tag LOCUS_16130 7276 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7494 8567 gene locus_tag LOCUS_16140 7494 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 8527 9225 gene locus_tag LOCUS_16150 8527 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 9197 9898 gene locus_tag LOCUS_16160 9197 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 9983 10342 gene locus_tag LOCUS_16170 9983 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 10344 10565 gene locus_tag LOCUS_16180 10344 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 10565 10768 gene locus_tag LOCUS_16190 10565 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 10761 11072 gene locus_tag LOCUS_16200 10761 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 11069 12553 gene locus_tag LOCUS_16210 11069 12553 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_16210 12573 12935 gene locus_tag LOCUS_16220 12573 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 13031 14008 gene locus_tag LOCUS_16230 13031 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 13992 14246 gene locus_tag LOCUS_16240 13992 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence0101 2747 1449 gene locus_tag LOCUS_16250 2747 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5824 2819 gene locus_tag LOCUS_16260 5824 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6114 8057 gene locus_tag LOCUS_16270 6114 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 9160 8090 gene locus_tag LOCUS_16280 9160 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 10391 9594 gene locus_tag LOCUS_16290 10391 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 11842 10517 gene locus_tag LOCUS_16300 11842 10517 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_16300 12220 11897 gene locus_tag LOCUS_16310 12220 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 12426 13085 gene locus_tag LOCUS_16320 gene eda 12426 13085 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence0102 1338 40 gene locus_tag LOCUS_16330 gene hemA 1338 40 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334460.1 protein_id gnl|my_center|LOCUS_16330 2165 1335 gene locus_tag LOCUS_16340 2165 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2864 2226 gene locus_tag LOCUS_16350 2864 2226 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_16350 3974 2871 gene locus_tag LOCUS_16360 3974 2871 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434800.1 protein_id gnl|my_center|LOCUS_16360 4461 4063 gene locus_tag LOCUS_16370 4461 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5214 4492 gene locus_tag LOCUS_16380 5214 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6164 5220 gene locus_tag LOCUS_16390 6164 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 7286 6258 gene locus_tag LOCUS_16400 7286 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7554 10259 gene locus_tag LOCUS_16410 gene alaS 7554 10259 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_16410 11410 10418 gene locus_tag LOCUS_16420 11410 10418 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence0103 1552 344 gene locus_tag LOCUS_16430 1552 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2481 1549 gene locus_tag LOCUS_16440 2481 1549 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870376.1 protein_id gnl|my_center|LOCUS_16440 2693 5500 gene locus_tag LOCUS_16450 2693 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 6208 6711 gene locus_tag LOCUS_16460 6208 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 6951 7026 gene locus_tag LOCUS_t00080 6951 7026 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7144 8448 gene locus_tag LOCUS_16470 7144 8448 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922363.1 protein_id gnl|my_center|LOCUS_16470 8597 9370 gene locus_tag LOCUS_16480 8597 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 9472 9822 gene locus_tag LOCUS_16490 9472 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 9919 10167 gene locus_tag LOCUS_16500 9919 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 10232 12088 gene locus_tag LOCUS_16510 10232 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 12113 13912 gene locus_tag LOCUS_16520 12113 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence0104 791 213 gene locus_tag LOCUS_16530 791 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 854 1195 gene locus_tag LOCUS_16540 854 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1397 2737 gene locus_tag LOCUS_16550 1397 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2737 4092 gene locus_tag LOCUS_16560 2737 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4328 4798 gene locus_tag LOCUS_16570 4328 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 5939 6655 gene locus_tag LOCUS_16580 5939 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7485 8183 gene locus_tag LOCUS_16590 7485 8183 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_16590 8303 8683 gene locus_tag LOCUS_16600 8303 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 9083 9952 gene locus_tag LOCUS_16610 9083 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10062 11363 gene locus_tag LOCUS_16620 10062 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 11499 11942 gene locus_tag LOCUS_16630 11499 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 12108 12671 gene locus_tag LOCUS_16640 12108 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 12668 13657 gene locus_tag LOCUS_16650 12668 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 13660 13878 gene locus_tag LOCUS_16660 13660 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence0105 68 967 gene locus_tag LOCUS_16670 68 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1148 1858 gene locus_tag LOCUS_16680 1148 1858 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061309.1 protein_id gnl|my_center|LOCUS_16680 3009 2017 gene locus_tag LOCUS_16690 gene gmd 3009 2017 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_16690 3166 3651 gene locus_tag LOCUS_16700 3166 3651 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_16700 3863 4327 gene locus_tag LOCUS_16710 3863 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4936 4547 gene locus_tag LOCUS_16720 4936 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 4926 5138 gene locus_tag LOCUS_16730 4926 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5316 5798 gene locus_tag LOCUS_16740 5316 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 6374 5826 gene locus_tag LOCUS_16750 6374 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_16750 6451 6825 gene locus_tag LOCUS_16760 6451 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 10551 6883 gene locus_tag LOCUS_16770 10551 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 10564 10791 gene locus_tag LOCUS_16780 10564 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 10788 11417 gene locus_tag LOCUS_16790 10788 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 11608 13221 gene locus_tag LOCUS_16800 11608 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 13278 13841 gene locus_tag LOCUS_16810 13278 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence0106 216 1838 gene locus_tag LOCUS_16820 216 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1874 2704 gene locus_tag LOCUS_16830 1874 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2712 3545 gene locus_tag LOCUS_16840 2712 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3889 5313 gene locus_tag LOCUS_16850 3889 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5648 5340 gene locus_tag LOCUS_16860 5648 5340 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_16860 6259 5672 gene locus_tag LOCUS_16870 6259 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 6578 6273 gene locus_tag LOCUS_16880 6578 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6794 6615 gene locus_tag LOCUS_16890 6794 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7519 6836 gene locus_tag LOCUS_16900 7519 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 10355 7782 gene locus_tag LOCUS_16910 10355 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 12320 10677 gene locus_tag LOCUS_16920 12320 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 12744 13268 gene locus_tag LOCUS_16930 12744 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 <14323 13531 gene locus_tag LOCUS_16940 <14323 13531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004563822.1:ornithine cyclodeaminase family protein >Feature sequence0107 173 2290 gene locus_tag LOCUS_16950 173 2290 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_16950 2335 2619 gene locus_tag LOCUS_16960 2335 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2616 3038 gene locus_tag LOCUS_16970 2616 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3047 4426 gene locus_tag LOCUS_16980 3047 4426 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_16980 6611 4452 gene locus_tag LOCUS_16990 6611 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6917 7729 gene locus_tag LOCUS_17000 6917 7729 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060896.1 protein_id gnl|my_center|LOCUS_17000 7726 8493 gene locus_tag LOCUS_17010 7726 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 8672 10198 gene locus_tag LOCUS_17020 8672 10198 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 protein_id gnl|my_center|LOCUS_17020 10688 10272 gene locus_tag LOCUS_17030 10688 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 11445 10927 gene locus_tag LOCUS_17040 11445 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence0108 168 1199 gene locus_tag LOCUS_17050 168 1199 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_17050 1292 1510 gene locus_tag LOCUS_17060 1292 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1537 2820 gene locus_tag LOCUS_17070 1537 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3879 2824 gene locus_tag LOCUS_17080 gene ribD 3879 2824 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_17080 4997 4035 gene locus_tag LOCUS_17090 4997 4035 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_17090 5398 5087 gene locus_tag LOCUS_17100 5398 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6560 5496 gene locus_tag LOCUS_17110 6560 5496 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966354.1 protein_id gnl|my_center|LOCUS_17110 7279 6632 gene locus_tag LOCUS_17120 7279 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 8265 7276 gene locus_tag LOCUS_17130 8265 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 12020 8322 gene locus_tag LOCUS_17140 gene metH 12020 8322 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922281.1 protein_id gnl|my_center|LOCUS_17140 12417 12088 gene locus_tag LOCUS_17150 12417 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 12905 12567 gene locus_tag LOCUS_17160 12905 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 13171 14268 gene locus_tag LOCUS_17170 13171 14268 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence0109 <1 1649 gene locus_tag LOCUS_17180 <1 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein 2367 1672 gene locus_tag LOCUS_17190 2367 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3764 2463 gene locus_tag LOCUS_17200 3764 2463 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_17200 6670 3923 gene locus_tag LOCUS_17210 gene aceE 6670 3923 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_17210 8001 7015 gene locus_tag LOCUS_17220 8001 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 9607 8477 gene locus_tag LOCUS_17230 9607 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 10918 10043 gene locus_tag LOCUS_17240 10918 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 11103 11942 gene locus_tag LOCUS_17250 11103 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 12287 13774 gene locus_tag LOCUS_17260 gene gcvPA 12287 13774 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979226.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence0110 2407 3492 gene locus_tag LOCUS_17270 2407 3492 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_17270 3641 5332 gene locus_tag LOCUS_17280 gene araD 3641 5332 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039575.1 protein_id gnl|my_center|LOCUS_17280 5430 6293 gene locus_tag LOCUS_17290 5430 6293 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_17290 6350 6580 gene locus_tag LOCUS_17300 6350 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 6614 7225 gene locus_tag LOCUS_17310 6614 7225 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_17310 7245 8309 gene locus_tag LOCUS_17320 gene tsaD 7245 8309 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338414.1 protein_id gnl|my_center|LOCUS_17320 8431 10014 gene locus_tag LOCUS_17330 8431 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 10451 10017 gene locus_tag LOCUS_17340 10451 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 10822 10439 gene locus_tag LOCUS_17350 10822 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 10937 11371 gene locus_tag LOCUS_17360 10937 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 11410 12111 gene locus_tag LOCUS_17370 11410 12111 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_17370 12173 12751 gene locus_tag LOCUS_17380 12173 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 12943 13380 gene locus_tag LOCUS_17390 12943 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence0111 1631 1125 gene locus_tag LOCUS_17400 1631 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1865 2560 gene locus_tag LOCUS_17410 1865 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3349 2711 gene locus_tag LOCUS_17420 gene trmB 3349 2711 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_17420 3837 3346 gene locus_tag LOCUS_17430 3837 3346 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_17430 4111 5067 gene locus_tag LOCUS_17440 4111 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5069 5527 gene locus_tag LOCUS_17450 5069 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 6089 5520 gene locus_tag LOCUS_17460 6089 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6249 6851 gene locus_tag LOCUS_17470 6249 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 6949 7911 gene locus_tag LOCUS_17480 6949 7911 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_17480 9685 8069 gene locus_tag LOCUS_17490 gene serA 9685 8069 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_17490 9959 9708 gene locus_tag LOCUS_17500 9959 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 10330 9989 gene locus_tag LOCUS_17510 10330 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 11580 10429 gene locus_tag LOCUS_17520 11580 10429 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_17520 12968 11724 gene locus_tag LOCUS_17530 12968 11724 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_17530 13629 13701 gene locus_tag LOCUS_t00090 13629 13701 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0112 804 1391 gene locus_tag LOCUS_17540 804 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1576 3120 gene locus_tag LOCUS_17550 1576 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3943 3509 gene locus_tag LOCUS_17560 3943 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 11965 4661 gene locus_tag LOCUS_17570 11965 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence0113 1182 244 gene locus_tag LOCUS_17580 1182 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_17580 2980 1244 gene locus_tag LOCUS_17590 2980 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4033 3020 gene locus_tag LOCUS_17600 4033 3020 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_17600 6408 4228 gene locus_tag LOCUS_17610 6408 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6820 8274 gene locus_tag LOCUS_17620 6820 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 8378 9175 gene locus_tag LOCUS_17630 8378 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 9365 11779 gene locus_tag LOCUS_17640 9365 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 12192 12962 gene locus_tag LOCUS_17650 12192 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973780.1 protein_id gnl|my_center|LOCUS_17650 14072 13020 gene locus_tag LOCUS_17660 14072 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0114 3921 913 gene locus_tag LOCUS_17670 3921 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6426 4003 gene locus_tag LOCUS_17680 6426 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_17680 8757 6511 gene locus_tag LOCUS_17690 8757 6511 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921453.1 protein_id gnl|my_center|LOCUS_17690 9736 8846 gene locus_tag LOCUS_17700 9736 8846 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_17700 10806 9775 gene locus_tag LOCUS_17710 10806 9775 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_17710 11443 12438 gene locus_tag LOCUS_17720 11443 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 12673 13608 gene locus_tag LOCUS_17730 12673 13608 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_17730 13683 13958 gene locus_tag LOCUS_17740 13683 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence0115 850 518 gene locus_tag LOCUS_17750 gene nuoK 850 518 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_17750 1464 847 gene locus_tag LOCUS_17760 1464 847 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_17760 2770 1520 gene locus_tag LOCUS_17770 gene nuoH 2770 1520 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_17770 2912 3592 gene locus_tag LOCUS_17780 2912 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 4519 3782 gene locus_tag LOCUS_17790 4519 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 4868 5164 gene locus_tag LOCUS_17800 4868 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 5196 6095 gene locus_tag LOCUS_17810 gene ubiA 5196 6095 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_17810 6621 6193 gene locus_tag LOCUS_17820 6621 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 7226 6615 gene locus_tag LOCUS_17830 7226 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 7880 7488 gene locus_tag LOCUS_17840 7880 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 7979 7906 gene locus_tag LOCUS_t00100 7979 7906 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8543 7995 gene locus_tag LOCUS_17850 8543 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 9439 8561 gene locus_tag LOCUS_17860 9439 8561 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_17860 10009 11085 gene locus_tag LOCUS_17870 10009 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 11182 12912 gene locus_tag LOCUS_17880 gene polX 11182 12912 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_17880 12909 13109 gene locus_tag LOCUS_17890 12909 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 13087 13602 gene locus_tag LOCUS_17900 13087 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence0116 396 1670 gene locus_tag LOCUS_17910 396 1670 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 protein_id gnl|my_center|LOCUS_17910 1667 4636 gene locus_tag LOCUS_17920 1667 4636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880081.1 protein_id gnl|my_center|LOCUS_17920 5023 4658 gene locus_tag LOCUS_17930 5023 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5309 5037 gene locus_tag LOCUS_17940 5309 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5657 6973 gene locus_tag LOCUS_17950 5657 6973 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_17950 7102 7404 gene locus_tag LOCUS_17960 7102 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7623 8564 gene locus_tag LOCUS_17970 7623 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 8566 9708 gene locus_tag LOCUS_17980 8566 9708 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_17980 9746 10654 gene locus_tag LOCUS_17990 9746 10654 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_17990 10681 11991 gene locus_tag LOCUS_18000 10681 11991 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_18000 12046 13278 gene locus_tag LOCUS_18010 12046 13278 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence0117 1344 145 gene locus_tag LOCUS_18020 1344 145 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704202.1 protein_id gnl|my_center|LOCUS_18020 2987 1461 gene locus_tag LOCUS_18030 2987 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120360.1 protein_id gnl|my_center|LOCUS_18030 4662 3157 gene locus_tag LOCUS_18040 4662 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 5836 4757 gene locus_tag LOCUS_18050 5836 4757 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_18050 6028 6156 gene locus_tag LOCUS_18060 6028 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 9522 6499 gene locus_tag LOCUS_18070 9522 6499 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_18070 11036 9678 gene locus_tag LOCUS_18080 11036 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 11521 12444 gene locus_tag LOCUS_18090 11521 12444 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_18090 12621 13124 gene locus_tag LOCUS_18100 12621 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 13229 13663 gene locus_tag LOCUS_18110 13229 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence0118 23 937 gene locus_tag LOCUS_18120 23 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1025 1705 gene locus_tag LOCUS_18130 1025 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1912 2691 gene locus_tag LOCUS_18140 1912 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2898 5285 gene locus_tag LOCUS_18150 2898 5285 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_18150 5443 10125 gene locus_tag LOCUS_18160 5443 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence0119 570 1019 gene locus_tag LOCUS_18170 570 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1216 2376 gene locus_tag LOCUS_18180 gene grrM 1216 2376 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_18180 2445 3182 gene locus_tag LOCUS_18190 2445 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3760 3263 gene locus_tag LOCUS_18200 3760 3263 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_18200 3884 5320 gene locus_tag LOCUS_18210 gene cls 3884 5320 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629072.1 protein_id gnl|my_center|LOCUS_18210 5745 5485 gene locus_tag LOCUS_18220 5745 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6011 7210 gene locus_tag LOCUS_18230 6011 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7451 8251 gene locus_tag LOCUS_18240 7451 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 8380 9654 gene locus_tag LOCUS_18250 8380 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 9662 10735 gene locus_tag LOCUS_18260 9662 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 10850 12127 gene locus_tag LOCUS_18270 10850 12127 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence0120 186 1163 gene locus_tag LOCUS_18280 186 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1237 1425 gene locus_tag LOCUS_18290 1237 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2468 1545 gene locus_tag LOCUS_18300 2468 1545 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225382.1 protein_id gnl|my_center|LOCUS_18300 3683 2646 gene locus_tag LOCUS_18310 3683 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 4214 3849 gene locus_tag LOCUS_18320 4214 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 4501 6009 gene locus_tag LOCUS_18330 4501 6009 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_18330 5991 6458 gene locus_tag LOCUS_18340 5991 6458 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088276.1 protein_id gnl|my_center|LOCUS_18340 6692 8821 gene locus_tag LOCUS_18350 6692 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 9489 9097 gene locus_tag LOCUS_18360 9489 9097 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 protein_id gnl|my_center|LOCUS_18360 9697 10677 gene locus_tag LOCUS_18370 9697 10677 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122378.1 protein_id gnl|my_center|LOCUS_18370 10649 11416 gene locus_tag LOCUS_18380 10649 11416 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_18380 11618 12367 gene locus_tag LOCUS_18390 11618 12367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence0121 119 1447 gene locus_tag LOCUS_18400 119 1447 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_18400 1493 1834 gene locus_tag LOCUS_18410 1493 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1849 2226 gene locus_tag LOCUS_18420 1849 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2318 3964 gene locus_tag LOCUS_18430 2318 3964 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816830.1 protein_id gnl|my_center|LOCUS_18430 6948 4051 gene locus_tag LOCUS_18440 6948 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 7162 9300 gene locus_tag LOCUS_18450 7162 9300 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_18450 9695 11317 gene locus_tag LOCUS_18460 9695 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 11486 12754 gene locus_tag LOCUS_18470 11486 12754 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_18470 12797 13873 gene locus_tag LOCUS_18480 12797 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence0122 1533 685 gene locus_tag LOCUS_18490 1533 685 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_18490 2034 2282 gene locus_tag LOCUS_18500 2034 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2282 2632 gene locus_tag LOCUS_18510 2282 2632 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_18510 2679 3920 gene locus_tag LOCUS_18520 2679 3920 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_18520 4315 3950 gene locus_tag LOCUS_18530 4315 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 5007 8237 gene locus_tag LOCUS_18540 5007 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 8290 8586 gene locus_tag LOCUS_18550 8290 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 8675 8968 gene locus_tag LOCUS_18560 8675 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 8983 9363 gene locus_tag LOCUS_18570 8983 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 9406 10509 gene locus_tag LOCUS_18580 9406 10509 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_18580 10555 13302 gene locus_tag LOCUS_18590 10555 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 13265 13729 gene locus_tag LOCUS_18600 13265 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence0123 2506 161 gene locus_tag LOCUS_18610 2506 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4243 2540 gene locus_tag LOCUS_18620 4243 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4918 4553 gene locus_tag LOCUS_18630 4918 4553 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_18630 5642 4977 gene locus_tag LOCUS_18640 5642 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 7108 5666 gene locus_tag LOCUS_18650 7108 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7416 7201 gene locus_tag LOCUS_18660 7416 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 8831 7422 gene locus_tag LOCUS_18670 8831 7422 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_18670 9658 9002 gene locus_tag LOCUS_18680 9658 9002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_18680 10619 9963 gene locus_tag LOCUS_18690 10619 9963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_18690 <13717 10639 gene locus_tag LOCUS_18700 <13717 10639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113207.1:sensor histidine kinase >Feature sequence0124 1052 1903 gene locus_tag LOCUS_18710 1052 1903 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121199.1 protein_id gnl|my_center|LOCUS_18710 4036 1958 gene locus_tag LOCUS_18720 4036 1958 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_18720 4153 4419 gene locus_tag LOCUS_18730 4153 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4400 4762 gene locus_tag LOCUS_18740 4400 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 8426 4794 gene locus_tag LOCUS_18750 8426 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 9119 8493 gene locus_tag LOCUS_18760 9119 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 9227 10525 gene locus_tag LOCUS_18770 gene hemL 9227 10525 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_18770 11992 10739 gene locus_tag LOCUS_18780 11992 10739 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_18780 12346 13425 gene locus_tag LOCUS_18790 12346 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence0125 30 752 gene locus_tag LOCUS_18800 30 752 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827384.1 protein_id gnl|my_center|LOCUS_18800 1522 767 gene locus_tag LOCUS_18810 1522 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1636 2838 gene locus_tag LOCUS_18820 1636 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 3190 5058 gene locus_tag LOCUS_18830 3190 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5132 5485 gene locus_tag LOCUS_18840 5132 5485 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_18840 5889 7736 gene locus_tag LOCUS_18850 5889 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 8048 9910 gene locus_tag LOCUS_18860 8048 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 10026 10379 gene locus_tag LOCUS_18870 10026 10379 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_18870 12403 10475 gene locus_tag LOCUS_18880 gene dxs 12403 10475 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325559.1 protein_id gnl|my_center|LOCUS_18880 13476 12484 gene locus_tag LOCUS_18890 13476 12484 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence0126 3 1106 gene locus_tag LOCUS_18900 3 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1133 2086 gene locus_tag LOCUS_18910 1133 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2164 2637 gene locus_tag LOCUS_18920 2164 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2641 3729 gene locus_tag LOCUS_18930 2641 3729 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_18930 3948 4625 gene locus_tag LOCUS_18940 3948 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 4699 5394 gene locus_tag LOCUS_18950 4699 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5397 5831 gene locus_tag LOCUS_18960 5397 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 8283 6019 gene locus_tag LOCUS_18970 8283 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 8773 8297 gene locus_tag LOCUS_18980 8773 8297 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337487.1 protein_id gnl|my_center|LOCUS_18980 11568 8770 gene locus_tag LOCUS_18990 11568 8770 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_18990 12314 11550 gene locus_tag LOCUS_19000 12314 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0127 3135 709 gene locus_tag LOCUS_19010 3135 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4378 3221 gene locus_tag LOCUS_19020 4378 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5342 4371 gene locus_tag LOCUS_19030 5342 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5986 5381 gene locus_tag LOCUS_19040 5986 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 6799 6281 gene locus_tag LOCUS_19050 6799 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 11315 6873 gene locus_tag LOCUS_19060 11315 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 13414 11510 gene locus_tag LOCUS_19070 13414 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence0128 157 474 gene locus_tag LOCUS_19080 157 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1421 651 gene locus_tag LOCUS_19090 1421 651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405600.1 protein_id gnl|my_center|LOCUS_19090 2865 1510 gene locus_tag LOCUS_19100 2865 1510 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_19100 4561 3767 gene locus_tag LOCUS_19110 4561 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6852 4894 gene locus_tag LOCUS_19120 6852 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118733.1 protein_id gnl|my_center|LOCUS_19120 7481 7284 gene locus_tag LOCUS_19130 7481 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 7899 8432 gene locus_tag LOCUS_19140 7899 8432 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383325.1 protein_id gnl|my_center|LOCUS_19140 8493 9941 gene locus_tag LOCUS_19150 gene sufB 8493 9941 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_19150 10282 10983 gene locus_tag LOCUS_19160 10282 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 11022 11636 gene locus_tag LOCUS_19170 11022 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 11647 12402 gene locus_tag LOCUS_19180 gene sufC 11647 12402 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_19180 12415 12738 gene locus_tag LOCUS_19190 12415 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence0129 241 1407 gene locus_tag LOCUS_19200 241 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921862.1 protein_id gnl|my_center|LOCUS_19200 1449 1901 gene locus_tag LOCUS_19210 1449 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2889 1978 gene locus_tag LOCUS_19220 2889 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3655 2924 gene locus_tag LOCUS_19230 3655 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4516 3827 gene locus_tag LOCUS_19240 4516 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4863 4453 gene locus_tag LOCUS_19250 4863 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5351 5019 gene locus_tag LOCUS_19260 5351 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5595 5876 gene locus_tag LOCUS_19270 5595 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 6987 5836 gene locus_tag LOCUS_19280 6987 5836 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_19280 7178 7846 gene locus_tag LOCUS_19290 7178 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 9363 8053 gene locus_tag LOCUS_19300 9363 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 9623 9363 gene locus_tag LOCUS_19310 9623 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 9968 9645 gene locus_tag LOCUS_19320 9968 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 10117 10251 gene locus_tag LOCUS_19330 10117 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 11701 10370 gene locus_tag LOCUS_19340 11701 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 12274 12936 gene locus_tag LOCUS_19350 12274 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence0130 400 113 gene locus_tag LOCUS_19360 400 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1491 1165 gene locus_tag LOCUS_19370 1491 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1825 1661 gene locus_tag LOCUS_19380 1825 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2131 2328 gene locus_tag LOCUS_19390 2131 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2743 2384 gene locus_tag LOCUS_19400 2743 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3995 3450 gene locus_tag LOCUS_19410 3995 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 12386 4020 gene locus_tag LOCUS_19420 12386 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence0131 1915 848 gene locus_tag LOCUS_19430 1915 848 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967441.1 protein_id gnl|my_center|LOCUS_19430 3383 1941 gene locus_tag LOCUS_19440 3383 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_19440 4444 3503 gene locus_tag LOCUS_19450 4444 3503 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_19450 5505 4441 gene locus_tag LOCUS_19460 5505 4441 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_19460 5959 5522 gene locus_tag LOCUS_19470 5959 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 6200 7132 gene locus_tag LOCUS_19480 6200 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 8833 7190 gene locus_tag LOCUS_19490 8833 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 8744 8926 gene locus_tag LOCUS_19500 8744 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 9229 9594 gene locus_tag LOCUS_19510 9229 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 10542 9583 gene locus_tag LOCUS_19520 10542 9583 CDS product ISL3-like element IS1001 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927279.1 protein_id gnl|my_center|LOCUS_19520 10808 10539 gene locus_tag LOCUS_19530 10808 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 11124 11212 gene locus_tag LOCUS_t00110 11124 11212 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12629 11403 gene locus_tag LOCUS_19540 12629 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 12940 12641 gene locus_tag LOCUS_19550 12940 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence0132 3225 529 gene locus_tag LOCUS_19560 3225 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3748 5736 gene locus_tag LOCUS_19570 3748 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5838 6983 gene locus_tag LOCUS_19580 5838 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 7796 7146 gene locus_tag LOCUS_19590 7796 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 8225 7812 gene locus_tag LOCUS_19600 8225 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 8731 8303 gene locus_tag LOCUS_19610 8731 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 12506 8958 gene locus_tag LOCUS_19620 12506 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 13336 13001 gene locus_tag LOCUS_19630 13336 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence0133 664 2124 gene locus_tag LOCUS_19640 664 2124 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_19640 2269 3402 gene locus_tag LOCUS_19650 2269 3402 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_19650 3509 4093 gene locus_tag LOCUS_19660 3509 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392199.1 protein_id gnl|my_center|LOCUS_19660 4002 4238 gene locus_tag LOCUS_19670 4002 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4253 4576 gene locus_tag LOCUS_19680 4253 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4999 4598 gene locus_tag LOCUS_19690 4999 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 5319 4999 gene locus_tag LOCUS_19700 5319 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 5642 9169 gene locus_tag LOCUS_19710 5642 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9402 11012 gene locus_tag LOCUS_19720 gene nadB 9402 11012 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0134 1187 3274 gene locus_tag LOCUS_19730 1187 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3898 3365 gene locus_tag LOCUS_19740 3898 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4106 7417 gene locus_tag LOCUS_19750 4106 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 9082 7469 gene locus_tag LOCUS_19760 9082 7469 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_19760 10462 9272 gene locus_tag LOCUS_19770 10462 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 12742 10481 gene locus_tag LOCUS_19780 12742 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0135 1917 55 gene locus_tag LOCUS_19790 1917 55 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_19790 2853 2038 gene locus_tag LOCUS_19800 2853 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3126 4985 gene locus_tag LOCUS_19810 3126 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 6182 5106 gene locus_tag LOCUS_19820 6182 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 7774 6344 gene locus_tag LOCUS_19830 7774 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 8589 7792 gene locus_tag LOCUS_19840 8589 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 8723 10240 gene locus_tag LOCUS_19850 8723 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11377 10442 gene locus_tag LOCUS_19860 11377 10442 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_19860 11907 11377 gene locus_tag LOCUS_19870 11907 11377 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 protein_id gnl|my_center|LOCUS_19870 12182 12763 gene locus_tag LOCUS_19880 12182 12763 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence0136 135 1523 gene locus_tag LOCUS_19890 135 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2168 1944 gene locus_tag LOCUS_19900 2168 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2236 5766 gene locus_tag LOCUS_19910 2236 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6101 11209 gene locus_tag LOCUS_19920 6101 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 11307 12233 gene locus_tag LOCUS_19930 11307 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0137 217 1203 gene locus_tag LOCUS_19940 217 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1657 1448 gene locus_tag LOCUS_19950 1657 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2134 4851 gene locus_tag LOCUS_19960 2134 4851 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_19960 4916 6376 gene locus_tag LOCUS_19970 4916 6376 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_19970 6524 7411 gene locus_tag LOCUS_19980 6524 7411 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_19980 7408 9114 gene locus_tag LOCUS_19990 7408 9114 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_19990 9116 9574 gene locus_tag LOCUS_20000 9116 9574 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086249.1 protein_id gnl|my_center|LOCUS_20000 9615 11108 gene locus_tag LOCUS_20010 9615 11108 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_20010 11535 13166 gene locus_tag LOCUS_20020 11535 13166 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence0138 155 2407 gene locus_tag LOCUS_20030 155 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2414 4768 gene locus_tag LOCUS_20040 2414 4768 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 protein_id gnl|my_center|LOCUS_20040 4830 5417 gene locus_tag LOCUS_20050 4830 5417 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_20050 6125 5835 gene locus_tag LOCUS_20060 6125 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 6286 7020 gene locus_tag LOCUS_20070 6286 7020 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_20070 7284 8636 gene locus_tag LOCUS_20080 7284 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 8794 10416 gene locus_tag LOCUS_20090 8794 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 10767 11771 gene locus_tag LOCUS_20100 10767 11771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592685.1 protein_id gnl|my_center|LOCUS_20100 11821 12594 gene locus_tag LOCUS_20110 11821 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence0139 1943 1197 gene locus_tag LOCUS_20120 1943 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2711 1995 gene locus_tag LOCUS_20130 2711 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4187 2751 gene locus_tag LOCUS_20140 4187 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4792 4298 gene locus_tag LOCUS_20150 4792 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 7302 4831 gene locus_tag LOCUS_20160 7302 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 11267 7407 gene locus_tag LOCUS_20170 11267 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 13018 11618 gene locus_tag LOCUS_20180 13018 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence0140 <1 2302 gene locus_tag LOCUS_20190 <1 2302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982246.1:response regulator 2299 3234 gene locus_tag LOCUS_20200 2299 3234 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_20200 3231 5126 gene locus_tag LOCUS_20210 3231 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5334 6764 gene locus_tag LOCUS_20220 gene hisD 5334 6764 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_20220 6921 7964 gene locus_tag LOCUS_20230 gene hisC 6921 7964 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_20230 8061 8726 gene locus_tag LOCUS_20240 8061 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 8824 9351 gene locus_tag LOCUS_20250 8824 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 9354 9551 gene locus_tag LOCUS_20260 9354 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 9658 10248 gene locus_tag LOCUS_20270 gene hisB 9658 10248 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_20270 10623 10339 gene locus_tag LOCUS_20280 10623 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 10934 10620 gene locus_tag LOCUS_20290 10934 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11992 11003 gene locus_tag LOCUS_20300 11992 11003 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_20300 12570 11989 gene locus_tag LOCUS_20310 12570 11989 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_20310 <13191 12581 gene locus_tag LOCUS_20320 <13191 12581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393598.1:aminodeoxychorismate synthase component I >Feature sequence0141 182 1288 gene locus_tag LOCUS_20330 182 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1466 2344 gene locus_tag LOCUS_20340 1466 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4235 2403 gene locus_tag LOCUS_20350 4235 2403 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_20350 4614 4273 gene locus_tag LOCUS_20360 4614 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4819 4601 gene locus_tag LOCUS_20370 4819 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5177 4974 gene locus_tag LOCUS_20380 5177 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 6041 5190 gene locus_tag LOCUS_20390 6041 5190 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_20390 6194 6265 gene locus_tag LOCUS_t00120 6194 6265 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11073 6280 gene locus_tag LOCUS_20400 11073 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 11490 12572 gene locus_tag LOCUS_20410 11490 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 12713 13144 gene locus_tag LOCUS_20420 12713 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence0142 1323 364 gene locus_tag LOCUS_20430 1323 364 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_20430 1682 1353 gene locus_tag LOCUS_20440 1682 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2139 1942 gene locus_tag LOCUS_20450 2139 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2394 3911 gene locus_tag LOCUS_20460 2394 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3938 5386 gene locus_tag LOCUS_20470 3938 5386 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_20470 5589 6278 gene locus_tag LOCUS_20480 5589 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 7671 6514 gene locus_tag LOCUS_20490 gene fabD 7671 6514 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_20490 7862 11248 gene locus_tag LOCUS_20500 gene treS 7862 11248 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_20500 12004 11348 gene locus_tag LOCUS_20510 12004 11348 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037344.1 protein_id gnl|my_center|LOCUS_20510 13110 12037 gene locus_tag LOCUS_20520 13110 12037 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404993.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence0143 4502 3897 gene locus_tag LOCUS_20530 4502 3897 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_20530 7014 4621 gene locus_tag LOCUS_20540 gene uvrA 7014 4621 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090774.1 protein_id gnl|my_center|LOCUS_20540 7648 9921 gene locus_tag LOCUS_20550 7648 9921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921383.1 protein_id gnl|my_center|LOCUS_20550 9980 11356 gene locus_tag LOCUS_20560 9980 11356 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140024.1 protein_id gnl|my_center|LOCUS_20560 11356 13026 gene locus_tag LOCUS_20570 11356 13026 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667792.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence0144 484 2796 gene locus_tag LOCUS_20580 484 2796 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514631.1 protein_id gnl|my_center|LOCUS_20580 2880 4475 gene locus_tag LOCUS_20590 2880 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4472 5275 gene locus_tag LOCUS_20600 4472 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 5272 6402 gene locus_tag LOCUS_20610 5272 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_20610 6421 7044 gene locus_tag LOCUS_20620 6421 7044 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_20620 7053 7832 gene locus_tag LOCUS_20630 7053 7832 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_20630 7866 9314 gene locus_tag LOCUS_20640 7866 9314 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_20640 9407 10588 gene locus_tag LOCUS_20650 9407 10588 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_20650 11174 10593 gene locus_tag LOCUS_20660 11174 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 11472 11696 gene locus_tag LOCUS_20670 11472 11696 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_20670 11732 12151 gene locus_tag LOCUS_20680 11732 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 12268 12990 gene locus_tag LOCUS_20690 12268 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence0145 641 1117 gene locus_tag LOCUS_20700 641 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1208 1381 gene locus_tag LOCUS_20710 1208 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1520 5650 gene locus_tag LOCUS_20720 1520 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 6759 8333 gene locus_tag LOCUS_20730 6759 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 8359 9648 gene locus_tag LOCUS_20740 8359 9648 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_20740 9707 10978 gene locus_tag LOCUS_20750 9707 10978 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_20750 11005 11619 gene locus_tag LOCUS_20760 11005 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0146 506 1663 gene locus_tag LOCUS_20770 506 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1753 2043 gene locus_tag LOCUS_20780 1753 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2128 3123 gene locus_tag LOCUS_20790 2128 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 4521 3232 gene locus_tag LOCUS_20800 4521 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4768 4682 gene locus_tag LOCUS_t00130 4768 4682 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5193 4840 gene locus_tag LOCUS_20810 5193 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 6087 5197 gene locus_tag LOCUS_20820 6087 5197 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114074.1 protein_id gnl|my_center|LOCUS_20820 7043 6084 gene locus_tag LOCUS_20830 7043 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 8098 7136 gene locus_tag LOCUS_20840 8098 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 8301 8921 gene locus_tag LOCUS_20850 8301 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 10218 8983 gene locus_tag LOCUS_20860 10218 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 10285 10626 gene locus_tag LOCUS_20870 10285 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 11868 10753 gene locus_tag LOCUS_20880 11868 10753 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_20880 11940 12641 gene locus_tag LOCUS_20890 11940 12641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence0147 1743 73 gene locus_tag LOCUS_20900 1743 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3783 1996 gene locus_tag LOCUS_20910 gene recJ 3783 1996 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_20910 4313 4828 gene locus_tag LOCUS_20920 4313 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 5194 4994 gene locus_tag LOCUS_20930 5194 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 5100 6428 gene locus_tag LOCUS_20940 5100 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 6943 7503 gene locus_tag LOCUS_20950 6943 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 7922 7500 gene locus_tag LOCUS_20960 7922 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 8747 8076 gene locus_tag LOCUS_20970 8747 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 9661 8765 gene locus_tag LOCUS_20980 9661 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 10376 9669 gene locus_tag LOCUS_20990 10376 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 10637 10882 gene locus_tag LOCUS_21000 10637 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 10911 12728 gene locus_tag LOCUS_21010 10911 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence0148 <1 1718 gene locus_tag LOCUS_21020 <1 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141963.1:NB-ARC domain-containing protein 1808 3556 gene locus_tag LOCUS_21030 1808 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 3708 4010 gene locus_tag LOCUS_21040 3708 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4050 4763 gene locus_tag LOCUS_21050 4050 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4799 5599 gene locus_tag LOCUS_21060 4799 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 5922 9062 gene locus_tag LOCUS_21070 5922 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 9422 9991 gene locus_tag LOCUS_21080 9422 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 9994 10353 gene locus_tag LOCUS_21090 9994 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 11666 10422 gene locus_tag LOCUS_21100 11666 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 12595 12098 gene locus_tag LOCUS_21110 12595 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence0149 1451 165 gene locus_tag LOCUS_21120 1451 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1574 2833 gene locus_tag LOCUS_21130 1574 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3446 4012 gene locus_tag LOCUS_21140 3446 4012 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_21140 4527 5060 gene locus_tag LOCUS_21150 4527 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 5216 5632 gene locus_tag LOCUS_21160 5216 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 5787 6542 gene locus_tag LOCUS_21170 5787 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6693 7937 gene locus_tag LOCUS_21180 6693 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 9451 8099 gene locus_tag LOCUS_21190 9451 8099 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324232.1 protein_id gnl|my_center|LOCUS_21190 10837 9659 gene locus_tag LOCUS_21200 10837 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 11376 10882 gene locus_tag LOCUS_21210 11376 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 12323 11373 gene locus_tag LOCUS_21220 12323 11373 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence0150 994 272 gene locus_tag LOCUS_21230 994 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1518 1099 gene locus_tag LOCUS_21240 1518 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1807 3150 gene locus_tag LOCUS_21250 1807 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3417 5555 gene locus_tag LOCUS_21260 3417 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6037 8079 gene locus_tag LOCUS_21270 6037 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 8271 10463 gene locus_tag LOCUS_21280 8271 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 10426 11895 gene locus_tag LOCUS_21290 10426 11895 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence0151 1314 1766 gene locus_tag LOCUS_21300 1314 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4144 1922 gene locus_tag LOCUS_21310 4144 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4322 5218 gene locus_tag LOCUS_21320 4322 5218 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531728.1 protein_id gnl|my_center|LOCUS_21320 6748 5354 gene locus_tag LOCUS_21330 6748 5354 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_21330 6979 7722 gene locus_tag LOCUS_21340 6979 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 7844 9259 gene locus_tag LOCUS_21350 gene lpdA 7844 9259 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_21350 9487 10767 gene locus_tag LOCUS_21360 9487 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10770 11681 gene locus_tag LOCUS_21370 10770 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 11924 12712 gene locus_tag LOCUS_21380 11924 12712 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence0152 522 2108 gene locus_tag LOCUS_21390 522 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2129 2647 gene locus_tag LOCUS_21400 2129 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2718 4070 gene locus_tag LOCUS_21410 2718 4070 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_21410 4215 5096 gene locus_tag LOCUS_21420 4215 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 6074 5106 gene locus_tag LOCUS_21430 6074 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7552 6071 gene locus_tag LOCUS_21440 7552 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7609 9588 gene locus_tag LOCUS_21450 7609 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 11363 10269 gene locus_tag LOCUS_21460 11363 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 12667 11414 gene locus_tag LOCUS_21470 12667 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence0153 2952 499 gene locus_tag LOCUS_21480 2952 499 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_21480 3453 3659 gene locus_tag LOCUS_21490 3453 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3709 3894 gene locus_tag LOCUS_21500 3709 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 4323 6041 gene locus_tag LOCUS_21510 4323 6041 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_21510 7267 6122 gene locus_tag LOCUS_21520 7267 6122 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_21520 7616 8056 gene locus_tag LOCUS_21530 7616 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 9358 8270 gene locus_tag LOCUS_21540 9358 8270 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_21540 9678 11423 gene locus_tag LOCUS_21550 9678 11423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 11573 12061 gene locus_tag LOCUS_21560 gene purE 11573 12061 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_21560 <12708 12182 gene locus_tag LOCUS_21570 <12708 12182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920701.1:WD40 repeat domain-containing protein >Feature sequence0154 6920 5643 gene locus_tag LOCUS_21580 gene arsJ 6920 5643 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255925.1 protein_id gnl|my_center|LOCUS_21580 7985 6969 gene locus_tag LOCUS_21590 7985 6969 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_21590 8419 8036 gene locus_tag LOCUS_21600 8419 8036 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_21600 8922 8554 gene locus_tag LOCUS_21610 8922 8554 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 protein_id gnl|my_center|LOCUS_21610 10364 9240 gene locus_tag LOCUS_21620 gene rho 10364 9240 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_21620 11288 10485 gene locus_tag LOCUS_21630 gene thyX 11288 10485 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_21630 12453 11578 gene locus_tag LOCUS_21640 12453 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence0155 1841 177 gene locus_tag LOCUS_21650 1841 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3067 1979 gene locus_tag LOCUS_21660 3067 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4012 3107 gene locus_tag LOCUS_21670 gene rsmH 4012 3107 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888501.1 protein_id gnl|my_center|LOCUS_21670 4702 4268 gene locus_tag LOCUS_21680 gene mraZ 4702 4268 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_21680 5895 4885 gene locus_tag LOCUS_21690 5895 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 7014 6046 gene locus_tag LOCUS_21700 gene gluQRS 7014 6046 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922628.1 protein_id gnl|my_center|LOCUS_21700 7875 7018 gene locus_tag LOCUS_21710 7875 7018 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032814311.1 protein_id gnl|my_center|LOCUS_21710 8145 8792 gene locus_tag LOCUS_21720 8145 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 10292 8820 gene locus_tag LOCUS_21730 10292 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 10502 11764 gene locus_tag LOCUS_21740 10502 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 <12667 11776 gene locus_tag LOCUS_21750 <12667 11776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119323.1:outer membrane protein transport protein >Feature sequence0156 286 1284 gene locus_tag LOCUS_21760 286 1284 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_21760 2388 1459 gene locus_tag LOCUS_21770 gene lnrL 2388 1459 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_21770 2488 4011 gene locus_tag LOCUS_21780 2488 4011 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486574.1 protein_id gnl|my_center|LOCUS_21780 4101 7349 gene locus_tag LOCUS_21790 4101 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 8154 7426 gene locus_tag LOCUS_21800 8154 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 8706 8323 gene locus_tag LOCUS_21810 8706 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 9578 8862 gene locus_tag LOCUS_21820 9578 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 9964 9557 gene locus_tag LOCUS_21830 9964 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 10293 9967 gene locus_tag LOCUS_21840 10293 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 12243 10411 gene locus_tag LOCUS_21850 12243 10411 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106714628.1 protein_id gnl|my_center|LOCUS_21850 12630 12463 gene locus_tag LOCUS_21860 12630 12463 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856556.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence0157 1193 75 gene locus_tag LOCUS_21870 gene purM 1193 75 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_21870 4730 1338 gene locus_tag LOCUS_21880 4730 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 6322 4985 gene locus_tag LOCUS_21890 6322 4985 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_21890 7179 6352 gene locus_tag LOCUS_21900 7179 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 8309 7170 gene locus_tag LOCUS_21910 8309 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 11560 8420 gene locus_tag LOCUS_21920 11560 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 12415 11759 gene locus_tag LOCUS_21930 12415 11759 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225250.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0158 615 265 gene locus_tag LOCUS_21940 615 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1970 690 gene locus_tag LOCUS_21950 1970 690 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_21950 3346 2066 gene locus_tag LOCUS_21960 3346 2066 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_21960 3826 4230 gene locus_tag LOCUS_21970 3826 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 6084 4360 gene locus_tag LOCUS_21980 6084 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6703 6377 gene locus_tag LOCUS_21990 6703 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 7059 7346 gene locus_tag LOCUS_22000 7059 7346 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080382.1 protein_id gnl|my_center|LOCUS_22000 7400 7678 gene locus_tag LOCUS_22010 7400 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 8153 8602 gene locus_tag LOCUS_22020 8153 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 8677 9429 gene locus_tag LOCUS_22030 8677 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 9479 9769 gene locus_tag LOCUS_22040 9479 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 9827 10546 gene locus_tag LOCUS_22050 9827 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 10778 11182 gene locus_tag LOCUS_22060 10778 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 11187 11624 gene locus_tag LOCUS_22070 11187 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence0159 <1 1052 gene locus_tag LOCUS_22080 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122073.1:leucine--tRNA ligase 1077 1394 gene locus_tag LOCUS_22090 1077 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1673 2479 gene locus_tag LOCUS_22100 1673 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3282 2488 gene locus_tag LOCUS_22110 3282 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3983 3375 gene locus_tag LOCUS_22120 3983 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4805 4071 gene locus_tag LOCUS_22130 4805 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5635 4859 gene locus_tag LOCUS_22140 5635 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 6527 5742 gene locus_tag LOCUS_22150 6527 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 6965 9277 gene locus_tag LOCUS_22160 6965 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 9397 9912 gene locus_tag LOCUS_22170 9397 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 11181 9868 gene locus_tag LOCUS_22180 11181 9868 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_22180 12446 11178 gene locus_tag LOCUS_22190 gene kynU 12446 11178 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence0160 593 1507 gene locus_tag LOCUS_22200 593 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1542 3434 gene locus_tag LOCUS_22210 1542 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3437 4771 gene locus_tag LOCUS_22220 3437 4771 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_22220 4798 5994 gene locus_tag LOCUS_22230 4798 5994 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 protein_id gnl|my_center|LOCUS_22230 6009 7253 gene locus_tag LOCUS_22240 6009 7253 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827458.1 protein_id gnl|my_center|LOCUS_22240 10530 7465 gene locus_tag LOCUS_22250 10530 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 <12548 10597 gene locus_tag LOCUS_22260 <12548 10597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000454344.1:penicillin acylase family protein >Feature sequence0161 361 573 gene locus_tag LOCUS_22270 361 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 662 853 gene locus_tag LOCUS_22280 662 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 939 1124 gene locus_tag LOCUS_22290 939 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1541 3964 gene locus_tag LOCUS_22300 1541 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 4183 3980 gene locus_tag LOCUS_22310 4183 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4998 4213 gene locus_tag LOCUS_22320 4998 4213 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331492.1 protein_id gnl|my_center|LOCUS_22320 5408 4998 gene locus_tag LOCUS_22330 5408 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 6006 5383 gene locus_tag LOCUS_22340 6006 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 6176 6520 gene locus_tag LOCUS_22350 6176 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 6524 6919 gene locus_tag LOCUS_22360 6524 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 6922 8316 gene locus_tag LOCUS_22370 6922 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 8313 8660 gene locus_tag LOCUS_22380 8313 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 8826 9149 gene locus_tag LOCUS_22390 8826 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 9146 9529 gene locus_tag LOCUS_22400 9146 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 9533 10543 gene locus_tag LOCUS_22410 9533 10543 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533238.1 protein_id gnl|my_center|LOCUS_22410 10540 11187 gene locus_tag LOCUS_22420 10540 11187 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533239.1 protein_id gnl|my_center|LOCUS_22420 11202 11960 gene locus_tag LOCUS_22430 11202 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533240.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence0162 696 499 gene locus_tag LOCUS_22440 696 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1570 869 gene locus_tag LOCUS_22450 1570 869 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117923.1 protein_id gnl|my_center|LOCUS_22450 2755 1574 gene locus_tag LOCUS_22460 2755 1574 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117922.1 protein_id gnl|my_center|LOCUS_22460 3166 2780 gene locus_tag LOCUS_22470 3166 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5572 3524 gene locus_tag LOCUS_22480 5572 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 5949 5569 gene locus_tag LOCUS_22490 5949 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6133 5939 gene locus_tag LOCUS_22500 6133 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 6792 6211 gene locus_tag LOCUS_22510 6792 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 7258 6911 gene locus_tag LOCUS_22520 7258 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 8674 7409 gene locus_tag LOCUS_22530 8674 7409 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_22530 8865 8792 gene locus_tag LOCUS_t00140 8865 8792 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9118 9837 gene locus_tag LOCUS_22540 9118 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 10602 9871 gene locus_tag LOCUS_22550 10602 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 12419 10572 gene locus_tag LOCUS_22560 12419 10572 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence0163 874 449 gene locus_tag LOCUS_22570 874 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1697 1377 gene locus_tag LOCUS_22580 1697 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2537 1854 gene locus_tag LOCUS_22590 2537 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3372 2914 gene locus_tag LOCUS_22600 3372 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4825 3494 gene locus_tag LOCUS_22610 4825 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5252 6118 gene locus_tag LOCUS_22620 5252 6118 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_22620 6134 7606 gene locus_tag LOCUS_22630 6134 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 8113 7751 gene locus_tag LOCUS_22640 8113 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119559.1 protein_id gnl|my_center|LOCUS_22640 8228 9706 gene locus_tag LOCUS_22650 gene der 8228 9706 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_22650 9745 11124 gene locus_tag LOCUS_22660 gene argH 9745 11124 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_22660 11171 12454 gene locus_tag LOCUS_22670 gene lysA 11171 12454 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence0164 2069 1623 gene locus_tag LOCUS_22680 2069 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3324 2104 gene locus_tag LOCUS_22690 3324 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 3881 3324 gene locus_tag LOCUS_22700 3881 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5495 4134 gene locus_tag LOCUS_22710 5495 4134 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_22710 5928 8432 gene locus_tag LOCUS_22720 5928 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 9723 8443 gene locus_tag LOCUS_22730 9723 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 12373 9821 gene locus_tag LOCUS_22740 12373 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence0165 704 1588 gene locus_tag LOCUS_22750 704 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1704 2990 gene locus_tag LOCUS_22760 1704 2990 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_22760 3089 4045 gene locus_tag LOCUS_22770 3089 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 4104 4772 gene locus_tag LOCUS_22780 4104 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 4804 5088 gene locus_tag LOCUS_22790 4804 5088 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229269.1 protein_id gnl|my_center|LOCUS_22790 5085 5366 gene locus_tag LOCUS_22800 5085 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 5551 7287 gene locus_tag LOCUS_22810 5551 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 7902 7330 gene locus_tag LOCUS_22820 7902 7330 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_22820 8224 8814 gene locus_tag LOCUS_22830 8224 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 8866 9573 gene locus_tag LOCUS_22840 gene cmk 8866 9573 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122796.1 protein_id gnl|my_center|LOCUS_22840 9504 10166 gene locus_tag LOCUS_22850 9504 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 10672 10211 gene locus_tag LOCUS_22860 10672 10211 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_22860 11395 10781 gene locus_tag LOCUS_22870 11395 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 11777 11445 gene locus_tag LOCUS_22880 11777 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence0166 <1 776 gene locus_tag LOCUS_22890 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327079.1:ABC transporter permease 849 2906 gene locus_tag LOCUS_22900 849 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3054 3869 gene locus_tag LOCUS_22910 3054 3869 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_22910 4674 4207 gene locus_tag LOCUS_22920 gene ybaK 4674 4207 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098459.1 protein_id gnl|my_center|LOCUS_22920 4849 5082 gene locus_tag LOCUS_22930 4849 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 5095 5394 gene locus_tag LOCUS_22940 5095 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 5394 5579 gene locus_tag LOCUS_22950 5394 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 5769 6854 gene locus_tag LOCUS_22960 5769 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 7003 8400 gene locus_tag LOCUS_22970 7003 8400 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463823.1 protein_id gnl|my_center|LOCUS_22970 8681 8980 gene locus_tag LOCUS_22980 8681 8980 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_22980 9087 9425 gene locus_tag LOCUS_22990 9087 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 9454 9645 gene locus_tag LOCUS_23000 9454 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 9692 9967 gene locus_tag LOCUS_23010 9692 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 10880 10188 gene locus_tag LOCUS_23020 gene queC 10880 10188 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence0167 3311 1269 gene locus_tag LOCUS_23030 3311 1269 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_23030 3597 5594 gene locus_tag LOCUS_23040 3597 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5674 7047 gene locus_tag LOCUS_23050 5674 7047 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_23050 7161 8282 gene locus_tag LOCUS_23060 7161 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 8511 11459 gene locus_tag LOCUS_23070 8511 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 <12317 11624 gene locus_tag LOCUS_23080 <12317 11624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122691.1:5'/3'-nucleotidase SurE >Feature sequence0168 3904 2432 gene locus_tag LOCUS_23090 3904 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4596 4072 gene locus_tag LOCUS_23100 4596 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 5591 4779 gene locus_tag LOCUS_23110 5591 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 7350 5932 gene locus_tag LOCUS_23120 gene lpdA 7350 5932 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271667.1 protein_id gnl|my_center|LOCUS_23120 8669 7428 gene locus_tag LOCUS_23130 gene odhB 8669 7428 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970379.1 protein_id gnl|my_center|LOCUS_23130 11433 8659 gene locus_tag LOCUS_23140 11433 8659 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_23140 11629 12138 gene locus_tag LOCUS_23150 11629 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence0169 417 995 gene locus_tag LOCUS_23160 417 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 992 2824 gene locus_tag LOCUS_23170 992 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4002 3052 gene locus_tag LOCUS_23180 4002 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 4831 4022 gene locus_tag LOCUS_23190 4831 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 6186 4849 gene locus_tag LOCUS_23200 6186 4849 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_23200 8833 6188 gene locus_tag LOCUS_23210 8833 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 9351 8836 gene locus_tag LOCUS_23220 9351 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 11207 9486 gene locus_tag LOCUS_23230 11207 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 11755 11204 gene locus_tag LOCUS_23240 11755 11204 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence0170 263 1189 gene locus_tag LOCUS_23250 263 1189 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491187.1 protein_id gnl|my_center|LOCUS_23250 1341 3683 gene locus_tag LOCUS_23260 1341 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 4780 3752 gene locus_tag LOCUS_23270 4780 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4834 5067 gene locus_tag LOCUS_23280 4834 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 10307 5142 gene locus_tag LOCUS_23290 10307 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 11897 10719 gene locus_tag LOCUS_23300 11897 10719 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence0171 81 869 gene locus_tag LOCUS_23310 81 869 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_23310 1655 894 gene locus_tag LOCUS_23320 1655 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3403 1718 gene locus_tag LOCUS_23330 3403 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3942 4958 gene locus_tag LOCUS_23340 3942 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 5128 6249 gene locus_tag LOCUS_23350 5128 6249 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898432.1 protein_id gnl|my_center|LOCUS_23350 7768 6332 gene locus_tag LOCUS_23360 7768 6332 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_23360 8330 7848 gene locus_tag LOCUS_23370 8330 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 8827 8414 gene locus_tag LOCUS_23380 8827 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 11195 8955 gene locus_tag LOCUS_23390 11195 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 11453 11650 gene locus_tag LOCUS_23400 11453 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence0172 886 1461 gene locus_tag LOCUS_23410 886 1461 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_23410 1471 3849 gene locus_tag LOCUS_23420 1471 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 3880 4533 gene locus_tag LOCUS_23430 3880 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 4562 5695 gene locus_tag LOCUS_23440 4562 5695 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099305.1 protein_id gnl|my_center|LOCUS_23440 6454 5792 gene locus_tag LOCUS_23450 gene nthA 6454 5792 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_23450 7748 6663 gene locus_tag LOCUS_23460 7748 6663 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_23460 8218 7745 gene locus_tag LOCUS_23470 8218 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 9574 8363 gene locus_tag LOCUS_23480 9574 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 10978 9776 gene locus_tag LOCUS_23490 10978 9776 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129610996.1 protein_id gnl|my_center|LOCUS_23490 <12112 11061 gene locus_tag LOCUS_23500 <12112 11061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803965.1:C2 family cysteine protease >Feature sequence0173 1724 231 gene locus_tag LOCUS_23510 1724 231 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615854.1 protein_id gnl|my_center|LOCUS_23510 1872 2324 gene locus_tag LOCUS_23520 1872 2324 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_23520 5683 2483 gene locus_tag LOCUS_23530 5683 2483 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_23530 6201 5896 gene locus_tag LOCUS_23540 6201 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 6690 8165 gene locus_tag LOCUS_23550 6690 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 8211 9665 gene locus_tag LOCUS_23560 8211 9665 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 protein_id gnl|my_center|LOCUS_23560 10203 9673 gene locus_tag LOCUS_23570 10203 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 10887 10204 gene locus_tag LOCUS_23580 10887 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23580 <12046 11065 gene locus_tag LOCUS_23590 <12046 11065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118199.1:ABC transporter permease >Feature sequence0174 166 3609 gene locus_tag LOCUS_23600 166 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 6866 3732 gene locus_tag LOCUS_23610 6866 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 8417 7035 gene locus_tag LOCUS_23620 8417 7035 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_23620 9094 8630 gene locus_tag LOCUS_23630 9094 8630 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 protein_id gnl|my_center|LOCUS_23630 9352 10116 gene locus_tag LOCUS_23640 9352 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 10233 10436 gene locus_tag LOCUS_23650 10233 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 10433 11140 gene locus_tag LOCUS_23660 10433 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence0175 417 5777 gene locus_tag LOCUS_23670 417 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 6337 8322 gene locus_tag LOCUS_23680 6337 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 10460 8355 gene locus_tag LOCUS_23690 10460 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence0176 208 3417 gene locus_tag LOCUS_23700 208 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3467 4195 gene locus_tag LOCUS_23710 3467 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 4285 4878 gene locus_tag LOCUS_23720 4285 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4903 11250 gene locus_tag LOCUS_23730 4903 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence0177 413 21 gene locus_tag LOCUS_23740 413 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 729 1424 gene locus_tag LOCUS_23750 gene bshB1 729 1424 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_23750 1605 1841 gene locus_tag LOCUS_23760 1605 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2043 2945 gene locus_tag LOCUS_23770 gene xerC 2043 2945 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_23770 3067 4212 gene locus_tag LOCUS_23780 3067 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 4413 4688 gene locus_tag LOCUS_23790 4413 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 4745 5383 gene locus_tag LOCUS_23800 4745 5383 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_23800 6216 5500 gene locus_tag LOCUS_23810 6216 5500 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_23810 6820 6419 gene locus_tag LOCUS_23820 6820 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 6838 8799 gene locus_tag LOCUS_23830 gene yagF 6838 8799 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_23830 8946 9107 gene locus_tag LOCUS_23840 8946 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 9127 9381 gene locus_tag LOCUS_23850 9127 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9657 9418 gene locus_tag LOCUS_23860 9657 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 11387 9903 gene locus_tag LOCUS_23870 11387 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence0178 2090 2863 gene locus_tag LOCUS_23880 2090 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3414 2962 gene locus_tag LOCUS_23890 3414 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3598 3780 gene locus_tag LOCUS_23900 3598 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 5962 3983 gene locus_tag LOCUS_23910 5962 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 6177 6656 gene locus_tag LOCUS_23920 6177 6656 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_23920 6862 8385 gene locus_tag LOCUS_23930 6862 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 8538 10571 gene locus_tag LOCUS_23940 8538 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 10616 11833 gene locus_tag LOCUS_23950 10616 11833 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence0179 583 855 gene locus_tag LOCUS_23960 583 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 973 1497 gene locus_tag LOCUS_23970 973 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1552 1881 gene locus_tag LOCUS_23980 1552 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1853 2398 gene locus_tag LOCUS_23990 1853 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2874 3638 gene locus_tag LOCUS_24000 2874 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4076 4690 gene locus_tag LOCUS_24010 4076 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5462 7174 gene locus_tag LOCUS_24020 5462 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 7171 8022 gene locus_tag LOCUS_24030 7171 8022 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_24030 8632 9501 gene locus_tag LOCUS_24040 8632 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 9512 11431 gene locus_tag LOCUS_24050 9512 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence0180 1255 44 gene locus_tag LOCUS_24060 1255 44 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_24060 2500 2159 gene locus_tag LOCUS_24070 2500 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2682 3119 gene locus_tag LOCUS_24080 2682 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4354 3365 gene locus_tag LOCUS_24090 4354 3365 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_24090 6486 4540 gene locus_tag LOCUS_24100 6486 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 8708 6492 gene locus_tag LOCUS_24110 8708 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 10100 9108 gene locus_tag LOCUS_24120 10100 9108 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627574.1 protein_id gnl|my_center|LOCUS_24120 10545 10132 gene locus_tag LOCUS_24130 10545 10132 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_24130 10674 11753 gene locus_tag LOCUS_24140 10674 11753 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence0181 <1 3438 gene locus_tag LOCUS_24150 <1 3438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463281.1:WGR domain-containing protein 3566 4051 gene locus_tag LOCUS_24160 3566 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 4205 5353 gene locus_tag LOCUS_24170 4205 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 5813 5355 gene locus_tag LOCUS_24180 5813 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 6230 5817 gene locus_tag LOCUS_24190 6230 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 7127 6318 gene locus_tag LOCUS_24200 gene ricT 7127 6318 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 protein_id gnl|my_center|LOCUS_24200 7264 8130 gene locus_tag LOCUS_24210 7264 8130 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_24210 8448 8143 gene locus_tag LOCUS_24220 8448 8143 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_24220 8702 8445 gene locus_tag LOCUS_24230 8702 8445 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142529.1 protein_id gnl|my_center|LOCUS_24230 8855 9913 gene locus_tag LOCUS_24240 8855 9913 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_24240 11275 9929 gene locus_tag LOCUS_24250 11275 9929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_24250 11340 11771 gene locus_tag LOCUS_24260 11340 11771 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence0182 <1 2281 gene locus_tag LOCUS_24270 <1 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257330.1:G8 domain-containing protein 2354 2575 gene locus_tag LOCUS_24280 2354 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2839 4464 gene locus_tag LOCUS_24290 2839 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 5414 4770 gene locus_tag LOCUS_24300 5414 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 6620 5709 gene locus_tag LOCUS_24310 gene dapA 6620 5709 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_24310 7877 6699 gene locus_tag LOCUS_24320 gene dgoD 7877 6699 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_24320 8333 8097 gene locus_tag LOCUS_24330 8333 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 9005 9835 gene locus_tag LOCUS_24340 gene pstB 9005 9835 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_24340 9948 10487 gene locus_tag LOCUS_24350 9948 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24350 10631 11386 gene locus_tag LOCUS_24360 10631 11386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118951.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence0183 43 252 gene locus_tag LOCUS_24370 43 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 422 2851 gene locus_tag LOCUS_24380 422 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3883 2978 gene locus_tag LOCUS_24390 3883 2978 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_24390 5884 3953 gene locus_tag LOCUS_24400 gene speA 5884 3953 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_24400 6090 7295 gene locus_tag LOCUS_24410 6090 7295 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_24410 7744 7331 gene locus_tag LOCUS_24420 7744 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 7888 9822 gene locus_tag LOCUS_24430 7888 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 9942 11315 gene locus_tag LOCUS_24440 9942 11315 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence0184 1786 3471 gene locus_tag LOCUS_24450 1786 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 3950 4342 gene locus_tag LOCUS_24460 3950 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4342 4944 gene locus_tag LOCUS_24470 4342 4944 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_24470 7091 5136 gene locus_tag LOCUS_24480 gene zwf 7091 5136 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_24480 8470 7535 gene locus_tag LOCUS_24490 8470 7535 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886915.1 protein_id gnl|my_center|LOCUS_24490 8363 8575 gene locus_tag LOCUS_24500 8363 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 10577 8688 gene locus_tag LOCUS_24510 10577 8688 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921460.1 protein_id gnl|my_center|LOCUS_24510 11084 10599 gene locus_tag LOCUS_24520 11084 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 11462 11617 gene locus_tag LOCUS_24530 11462 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence0185 2 1822 gene locus_tag LOCUS_24540 2 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1853 2149 gene locus_tag LOCUS_24550 1853 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2165 2614 gene locus_tag LOCUS_24560 2165 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2711 4096 gene locus_tag LOCUS_24570 2711 4096 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_24570 4941 4192 gene locus_tag LOCUS_24580 4941 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5178 7316 gene locus_tag LOCUS_24590 5178 7316 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_24590 7692 8996 gene locus_tag LOCUS_24600 7692 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 11162 9129 gene locus_tag LOCUS_24610 11162 9129 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_24610 11416 11237 gene locus_tag LOCUS_24620 11416 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence0186 2070 1399 gene locus_tag LOCUS_24630 2070 1399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_24630 3575 2067 gene locus_tag LOCUS_24640 3575 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 5601 4147 gene locus_tag LOCUS_24650 gene cls 5601 4147 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629072.1 protein_id gnl|my_center|LOCUS_24650 6783 5896 gene locus_tag LOCUS_24660 6783 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_24660 7303 6803 gene locus_tag LOCUS_24670 7303 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_24670 7718 7467 gene locus_tag LOCUS_24680 7718 7467 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_24680 9168 7777 gene locus_tag LOCUS_24690 9168 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 11222 9165 gene locus_tag LOCUS_24700 11222 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence0187 607 104 gene locus_tag LOCUS_24710 607 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 853 644 gene locus_tag LOCUS_24720 853 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2413 1007 gene locus_tag LOCUS_24730 2413 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 3434 2394 gene locus_tag LOCUS_24740 3434 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4536 3628 gene locus_tag LOCUS_24750 4536 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5890 4580 gene locus_tag LOCUS_24760 5890 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24760 6615 6004 gene locus_tag LOCUS_24770 6615 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24770 6958 7227 gene locus_tag LOCUS_24780 6958 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 7759 7157 gene locus_tag LOCUS_24790 7759 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 7641 7850 gene locus_tag LOCUS_24800 7641 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 9063 8452 gene locus_tag LOCUS_24810 9063 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 9722 10018 gene locus_tag LOCUS_24820 9722 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 11159 10005 gene locus_tag LOCUS_24830 11159 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 11327 11166 gene locus_tag LOCUS_24840 11327 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0188 1211 2659 gene locus_tag LOCUS_24850 1211 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 3982 2663 gene locus_tag LOCUS_24860 gene mtaB 3982 2663 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_24860 5184 4090 gene locus_tag LOCUS_24870 5184 4090 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922457.1 protein_id gnl|my_center|LOCUS_24870 7451 5355 gene locus_tag LOCUS_24880 7451 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7644 8351 gene locus_tag LOCUS_24890 7644 8351 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_24890 9681 8713 gene locus_tag LOCUS_24900 9681 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence0189 2138 570 gene locus_tag LOCUS_24910 2138 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2369 3970 gene locus_tag LOCUS_24920 2369 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3994 5322 gene locus_tag LOCUS_24930 3994 5322 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_24930 5356 5685 gene locus_tag LOCUS_24940 5356 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5873 6067 gene locus_tag LOCUS_24950 5873 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 6454 6083 gene locus_tag LOCUS_24960 6454 6083 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143969.1 protein_id gnl|my_center|LOCUS_24960 6760 6524 gene locus_tag LOCUS_24970 6760 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 7026 7748 gene locus_tag LOCUS_24980 7026 7748 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230338.1 protein_id gnl|my_center|LOCUS_24980 7745 8947 gene locus_tag LOCUS_24990 7745 8947 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_24990 9067 9819 gene locus_tag LOCUS_25000 9067 9819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_25000 10071 11297 gene locus_tag LOCUS_25010 10071 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence0190 3074 51 gene locus_tag LOCUS_25020 3074 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 3378 3683 gene locus_tag LOCUS_25030 3378 3683 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_25030 4066 5049 gene locus_tag LOCUS_25040 4066 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 5337 6200 gene locus_tag LOCUS_25050 5337 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 6284 7006 gene locus_tag LOCUS_25060 6284 7006 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140107.1 protein_id gnl|my_center|LOCUS_25060 7841 7080 gene locus_tag LOCUS_25070 7841 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 7977 8252 gene locus_tag LOCUS_25080 7977 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 8249 8560 gene locus_tag LOCUS_25090 8249 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 9380 8565 gene locus_tag LOCUS_25100 9380 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 9496 10656 gene locus_tag LOCUS_25110 9496 10656 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350209.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence0191 10960 4538 gene locus_tag LOCUS_25120 10960 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence0192 136 1620 gene locus_tag LOCUS_25130 136 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1794 2612 gene locus_tag LOCUS_25140 1794 2612 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_25140 3742 2783 gene locus_tag LOCUS_25150 3742 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 4301 3915 gene locus_tag LOCUS_25160 4301 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 4539 4916 gene locus_tag LOCUS_25170 4539 4916 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_25170 4926 8144 gene locus_tag LOCUS_25180 4926 8144 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_25180 8210 9439 gene locus_tag LOCUS_25190 8210 9439 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_25190 9613 9786 gene locus_tag LOCUS_25200 9613 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 9831 11312 gene locus_tag LOCUS_25210 9831 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence0193 1864 728 gene locus_tag LOCUS_25220 1864 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2388 3476 gene locus_tag LOCUS_25230 2388 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119567.1 protein_id gnl|my_center|LOCUS_25230 4860 3499 gene locus_tag LOCUS_25240 4860 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 6844 4907 gene locus_tag LOCUS_25250 6844 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 7863 7156 gene locus_tag LOCUS_25260 7863 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 8641 7889 gene locus_tag LOCUS_25270 8641 7889 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532722.1 protein_id gnl|my_center|LOCUS_25270 9456 8677 gene locus_tag LOCUS_25280 9456 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 10819 9647 gene locus_tag LOCUS_25290 10819 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 11088 10801 gene locus_tag LOCUS_25300 11088 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 11401 11153 gene locus_tag LOCUS_25310 11401 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence0194 739 2340 gene locus_tag LOCUS_25320 739 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3822 2464 gene locus_tag LOCUS_25330 3822 2464 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_25330 4292 5002 gene locus_tag LOCUS_25340 4292 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 5214 6644 gene locus_tag LOCUS_25350 5214 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6795 7670 gene locus_tag LOCUS_25360 6795 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 9019 7748 gene locus_tag LOCUS_25370 gene larA 9019 7748 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_25370 9413 9084 gene locus_tag LOCUS_25380 9413 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 9809 9522 gene locus_tag LOCUS_25390 9809 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 11225 10281 gene locus_tag LOCUS_25400 11225 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence0195 463 1767 gene locus_tag LOCUS_25410 463 1767 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_25410 2183 1821 gene locus_tag LOCUS_25420 2183 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2431 2180 gene locus_tag LOCUS_25430 2431 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2997 2560 gene locus_tag LOCUS_25440 2997 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 3637 5412 gene locus_tag LOCUS_25450 3637 5412 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251940.1 protein_id gnl|my_center|LOCUS_25450 6023 5685 gene locus_tag LOCUS_25460 6023 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 9309 6178 gene locus_tag LOCUS_25470 9309 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 10194 9637 gene locus_tag LOCUS_25480 10194 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 10794 10444 gene locus_tag LOCUS_25490 10794 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 10992 10825 gene locus_tag LOCUS_25500 10992 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence0196 129 386 gene locus_tag LOCUS_25510 129 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 667 413 gene locus_tag LOCUS_25520 667 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1530 664 gene locus_tag LOCUS_25530 1530 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2302 1541 gene locus_tag LOCUS_25540 gene tpiA 2302 1541 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_25540 2407 2589 gene locus_tag LOCUS_25550 2407 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 4281 3037 gene locus_tag LOCUS_25560 4281 3037 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_25560 4356 4895 gene locus_tag LOCUS_25570 4356 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 5315 4950 gene locus_tag LOCUS_25580 5315 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 5717 5364 gene locus_tag LOCUS_25590 5717 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 5775 5924 gene locus_tag LOCUS_25600 5775 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 5997 6443 gene locus_tag LOCUS_25610 5997 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 6588 7526 gene locus_tag LOCUS_25620 6588 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 7964 9694 gene locus_tag LOCUS_25630 7964 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 9751 10506 gene locus_tag LOCUS_25640 9751 10506 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920670.1 protein_id gnl|my_center|LOCUS_25640 11234 10551 gene locus_tag LOCUS_25650 11234 10551 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266805.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence0197 62 955 gene locus_tag LOCUS_25660 gene ispE 62 955 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_25660 986 1573 gene locus_tag LOCUS_25670 986 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2598 1690 gene locus_tag LOCUS_25680 2598 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2880 3830 gene locus_tag LOCUS_25690 2880 3830 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_25690 4955 3912 gene locus_tag LOCUS_25700 4955 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 6767 5937 gene locus_tag LOCUS_25710 6767 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 7736 6801 gene locus_tag LOCUS_25720 7736 6801 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_25720 8442 10181 gene locus_tag LOCUS_25730 8442 10181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 protein_id gnl|my_center|LOCUS_25730 10620 10886 gene locus_tag LOCUS_25740 10620 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence0198 1681 488 gene locus_tag LOCUS_25750 1681 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2063 3322 gene locus_tag LOCUS_25760 2063 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3407 3742 gene locus_tag LOCUS_25770 3407 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3739 4101 gene locus_tag LOCUS_25780 3739 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 4115 4585 gene locus_tag LOCUS_25790 4115 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 4763 5707 gene locus_tag LOCUS_25800 4763 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 5828 7423 gene locus_tag LOCUS_25810 5828 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 7662 8132 gene locus_tag LOCUS_25820 7662 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 8139 9275 gene locus_tag LOCUS_25830 8139 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 9381 11213 gene locus_tag LOCUS_25840 9381 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence0199 262 477 gene locus_tag LOCUS_25850 262 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 1625 555 gene locus_tag LOCUS_25860 1625 555 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_25860 2252 1629 gene locus_tag LOCUS_25870 2252 1629 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_25870 2646 4349 gene locus_tag LOCUS_25880 2646 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 4863 7202 gene locus_tag LOCUS_25890 gene ptsP 4863 7202 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_25890 8537 7515 gene locus_tag LOCUS_25900 8537 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 9232 8669 gene locus_tag LOCUS_25910 9232 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 9558 9956 gene locus_tag LOCUS_25920 9558 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence0200 34 624 gene locus_tag LOCUS_25930 34 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 783 1487 gene locus_tag LOCUS_25940 783 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1547 1882 gene locus_tag LOCUS_25950 1547 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2128 3267 gene locus_tag LOCUS_25960 2128 3267 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_25960 3371 3718 gene locus_tag LOCUS_25970 3371 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3746 3982 gene locus_tag LOCUS_25980 3746 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4036 4563 gene locus_tag LOCUS_25990 4036 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 4556 4834 gene locus_tag LOCUS_26000 4556 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 7062 4849 gene locus_tag LOCUS_26010 7062 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 8280 7204 gene locus_tag LOCUS_26020 8280 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 8457 11009 gene locus_tag LOCUS_26030 8457 11009 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence0201 4192 386 gene locus_tag LOCUS_26040 4192 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 5525 4482 gene locus_tag LOCUS_26050 5525 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 8160 5539 gene locus_tag LOCUS_26060 8160 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 8394 9008 gene locus_tag LOCUS_26070 8394 9008 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_26070 9129 9731 gene locus_tag LOCUS_26080 9129 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 9768 10019 gene locus_tag LOCUS_26090 9768 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 10198 10554 gene locus_tag LOCUS_26100 10198 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence0202 1540 2220 gene locus_tag LOCUS_26110 1540 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3610 2336 gene locus_tag LOCUS_26120 3610 2336 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_26120 4015 6264 gene locus_tag LOCUS_26130 4015 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 6391 7842 gene locus_tag LOCUS_26140 6391 7842 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_26140 8132 7914 gene locus_tag LOCUS_26150 8132 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 8016 8609 gene locus_tag LOCUS_26160 8016 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 8664 11186 gene locus_tag LOCUS_26170 8664 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence0203 1241 2749 gene locus_tag LOCUS_26180 1241 2749 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897727.1 protein_id gnl|my_center|LOCUS_26180 2855 3619 gene locus_tag LOCUS_26190 2855 3619 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_26190 3637 4476 gene locus_tag LOCUS_26200 3637 4476 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_26200 4659 5789 gene locus_tag LOCUS_26210 4659 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 6025 7407 gene locus_tag LOCUS_26220 6025 7407 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_26220 7476 7754 gene locus_tag LOCUS_26230 7476 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 7775 9706 gene locus_tag LOCUS_26240 7775 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 9739 9960 gene locus_tag LOCUS_26250 9739 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 10072 11115 gene locus_tag LOCUS_26260 10072 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence0204 2669 108 gene locus_tag LOCUS_26270 2669 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 4474 2945 gene locus_tag LOCUS_26280 4474 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 7463 4578 gene locus_tag LOCUS_26290 7463 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 8829 7579 gene locus_tag LOCUS_26300 8829 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 9624 11102 gene locus_tag LOCUS_26310 9624 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence0205 <1 2072 gene locus_tag LOCUS_26320 <1 2072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615693.1:DUF1549 and DUF1553 domain-containing protein 2127 3482 gene locus_tag LOCUS_26330 2127 3482 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_26330 3522 6224 gene locus_tag LOCUS_26340 3522 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 7643 6654 gene locus_tag LOCUS_26350 7643 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 7786 7968 gene locus_tag LOCUS_26360 7786 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 8240 7920 gene locus_tag LOCUS_26370 8240 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 9442 8513 gene locus_tag LOCUS_26380 9442 8513 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_26380 9801 9598 gene locus_tag LOCUS_26390 9801 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 10866 9814 gene locus_tag LOCUS_26400 10866 9814 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence0206 953 195 gene locus_tag LOCUS_26410 953 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1280 2863 gene locus_tag LOCUS_26420 1280 2863 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_26420 2880 3554 gene locus_tag LOCUS_26430 2880 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 4518 3601 gene locus_tag LOCUS_26440 4518 3601 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_26440 5539 4610 gene locus_tag LOCUS_26450 5539 4610 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_26450 6760 5858 gene locus_tag LOCUS_26460 6760 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 9052 6860 gene locus_tag LOCUS_26470 9052 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 10882 9242 gene locus_tag LOCUS_26480 10882 9242 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence0207 <1 2515 gene locus_tag LOCUS_26490 <1 2515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257050.1:malto-oligosyltrehalose synthase 3236 2691 gene locus_tag LOCUS_26500 3236 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975008.1 protein_id gnl|my_center|LOCUS_26500 3439 3579 gene locus_tag LOCUS_26510 3439 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3622 4161 gene locus_tag LOCUS_26520 3622 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26520 7583 4242 gene locus_tag LOCUS_26530 gene mexF 7583 4242 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_26530 11086 7676 gene locus_tag LOCUS_26540 11086 7676 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence0208 112 348 gene locus_tag LOCUS_26550 112 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 595 389 gene locus_tag LOCUS_26560 595 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 890 633 gene locus_tag LOCUS_26570 890 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1125 1487 gene locus_tag LOCUS_26580 1125 1487 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_26580 1806 2450 gene locus_tag LOCUS_26590 1806 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2637 2942 gene locus_tag LOCUS_26600 2637 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2968 3249 gene locus_tag LOCUS_26610 2968 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3259 3768 gene locus_tag LOCUS_26620 3259 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3942 4340 gene locus_tag LOCUS_26630 3942 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4376 4693 gene locus_tag LOCUS_26640 4376 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 4690 4869 gene locus_tag LOCUS_26650 4690 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 4866 5093 gene locus_tag LOCUS_26660 4866 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 5090 5536 gene locus_tag LOCUS_26670 5090 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 5800 6627 gene locus_tag LOCUS_26680 gene kdsA 5800 6627 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_26680 6779 6609 gene locus_tag LOCUS_26690 6779 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 6818 8749 gene locus_tag LOCUS_26700 6818 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 8749 9789 gene locus_tag LOCUS_26710 8749 9789 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122268.1 protein_id gnl|my_center|LOCUS_26710 10011 9820 gene locus_tag LOCUS_26720 10011 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 10501 11064 gene locus_tag LOCUS_26730 10501 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence0209 3450 925 gene locus_tag LOCUS_26740 3450 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3673 5601 gene locus_tag LOCUS_26750 gene ftsH 3673 5601 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120515.1 protein_id gnl|my_center|LOCUS_26750 4378 4473 gene locus_tag LOCUS_t00150 4378 4473 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5656 6492 gene locus_tag LOCUS_26760 5656 6492 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_26760 6629 6853 gene locus_tag LOCUS_26770 6629 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 6850 7275 gene locus_tag LOCUS_26780 6850 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8243 7344 gene locus_tag LOCUS_26790 8243 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 9699 8560 gene locus_tag LOCUS_26800 9699 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 10648 9629 gene locus_tag LOCUS_26810 10648 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence0210 <1 1521 gene locus_tag LOCUS_26820 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616108.1:c-type cytochrome 1635 2897 gene locus_tag LOCUS_26830 1635 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3952 3185 gene locus_tag LOCUS_26840 3952 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 5738 4233 gene locus_tag LOCUS_26850 5738 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 6940 5837 gene locus_tag LOCUS_26860 6940 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 7271 8191 gene locus_tag LOCUS_26870 7271 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 8824 8486 gene locus_tag LOCUS_26880 8824 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 9431 10657 gene locus_tag LOCUS_26890 9431 10657 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398426.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence0211 <1 2793 gene locus_tag LOCUS_26900 <1 2793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000370122.1:Tex family protein 2943 3476 gene locus_tag LOCUS_26910 2943 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 6144 3550 gene locus_tag LOCUS_26920 6144 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 9642 6166 gene locus_tag LOCUS_26930 9642 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 10548 9688 gene locus_tag LOCUS_26940 10548 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 11059 10727 gene locus_tag LOCUS_26950 11059 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence0212 713 306 gene locus_tag LOCUS_26960 713 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1044 688 gene locus_tag LOCUS_26970 1044 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2452 1184 gene locus_tag LOCUS_26980 2452 1184 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921947.1 protein_id gnl|my_center|LOCUS_26980 7297 2549 gene locus_tag LOCUS_26990 7297 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 7735 8280 gene locus_tag LOCUS_27000 7735 8280 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 protein_id gnl|my_center|LOCUS_27000 9383 8301 gene locus_tag LOCUS_27010 9383 8301 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_27010 10344 9511 gene locus_tag LOCUS_27020 10344 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 10555 10935 gene locus_tag LOCUS_27030 10555 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence0213 <1 950 gene locus_tag LOCUS_27040 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615587.1:SulP family inorganic anion transporter 1217 2833 gene locus_tag LOCUS_27050 1217 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3628 2960 gene locus_tag LOCUS_27060 3628 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 5456 3966 gene locus_tag LOCUS_27070 5456 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 6719 5952 gene locus_tag LOCUS_27080 6719 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 8645 6981 gene locus_tag LOCUS_27090 gene ggt 8645 6981 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_27090 9621 8746 gene locus_tag LOCUS_27100 gene metF 9621 8746 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_27100 9766 10845 gene locus_tag LOCUS_27110 9766 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence0214 110 2650 gene locus_tag LOCUS_27120 110 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2647 3084 gene locus_tag LOCUS_27130 2647 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3203 3529 gene locus_tag LOCUS_27140 3203 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3536 4798 gene locus_tag LOCUS_27150 3536 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 4938 4855 gene locus_tag LOCUS_t00160 4938 4855 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5135 6640 gene locus_tag LOCUS_27160 5135 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 7041 6802 gene locus_tag LOCUS_27170 7041 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 6986 9055 gene locus_tag LOCUS_27180 6986 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 9167 10843 gene locus_tag LOCUS_27190 9167 10843 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967597.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence0215 712 1161 gene locus_tag LOCUS_27200 712 1161 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_27200 1291 2472 gene locus_tag LOCUS_27210 1291 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2475 3731 gene locus_tag LOCUS_27220 2475 3731 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120898.1 protein_id gnl|my_center|LOCUS_27220 4935 3847 gene locus_tag LOCUS_27230 4935 3847 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_27230 5411 4983 gene locus_tag LOCUS_27240 gene nikR 5411 4983 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_27240 6200 5463 gene locus_tag LOCUS_27250 6200 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 7755 6307 gene locus_tag LOCUS_27260 7755 6307 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_27260 7936 10002 gene locus_tag LOCUS_27270 7936 10002 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_27270 10345 10010 gene locus_tag LOCUS_27280 10345 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 10406 10747 gene locus_tag LOCUS_27290 10406 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence0216 1228 35 gene locus_tag LOCUS_27300 gene larC 1228 35 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_27300 3465 1240 gene locus_tag LOCUS_27310 3465 1240 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120924.1 protein_id gnl|my_center|LOCUS_27310 4502 3606 gene locus_tag LOCUS_27320 4502 3606 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921310.1 protein_id gnl|my_center|LOCUS_27320 5729 4656 gene locus_tag LOCUS_27330 5729 4656 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_27330 6371 5865 gene locus_tag LOCUS_27340 6371 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 7057 6512 gene locus_tag LOCUS_27350 7057 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 7650 7102 gene locus_tag LOCUS_27360 7650 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 8260 7721 gene locus_tag LOCUS_27370 8260 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 8422 9141 gene locus_tag LOCUS_27380 8422 9141 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120970.1 protein_id gnl|my_center|LOCUS_27380 10384 9311 gene locus_tag LOCUS_27390 10384 9311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_27390 <10936 10381 gene locus_tag LOCUS_27400 <10936 10381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582519.1:ABC transporter ATP-binding protein >Feature sequence0217 <1 1718 gene locus_tag LOCUS_27410 <1 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789619.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1789 2196 gene locus_tag LOCUS_27420 1789 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2227 2532 gene locus_tag LOCUS_27430 2227 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2542 2988 gene locus_tag LOCUS_27440 2542 2988 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142568.1 protein_id gnl|my_center|LOCUS_27440 3032 4687 gene locus_tag LOCUS_27450 3032 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 4702 5058 gene locus_tag LOCUS_27460 4702 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 5320 5724 gene locus_tag LOCUS_27470 5320 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 9301 6014 gene locus_tag LOCUS_27480 9301 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 <10914 9656 gene locus_tag LOCUS_27490 <10914 9656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942599.1:phenylacetate--CoA ligase family protein >Feature sequence0218 3038 3610 gene locus_tag LOCUS_27500 3038 3610 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_27500 3607 5040 gene locus_tag LOCUS_27510 3607 5040 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122362.1 protein_id gnl|my_center|LOCUS_27510 6607 5177 gene locus_tag LOCUS_27520 6607 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 7285 7671 gene locus_tag LOCUS_27530 7285 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 8567 7560 gene locus_tag LOCUS_27540 8567 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 8726 9697 gene locus_tag LOCUS_27550 8726 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence0219 2130 835 gene locus_tag LOCUS_27560 2130 835 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_27560 3265 2258 gene locus_tag LOCUS_27570 3265 2258 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444469.1 protein_id gnl|my_center|LOCUS_27570 5095 3491 gene locus_tag LOCUS_27580 5095 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 5315 6817 gene locus_tag LOCUS_27590 5315 6817 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921497.1 protein_id gnl|my_center|LOCUS_27590 8197 6842 gene locus_tag LOCUS_27600 8197 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence0220 168 836 gene locus_tag LOCUS_27610 168 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1053 1790 gene locus_tag LOCUS_27620 1053 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1950 2372 gene locus_tag LOCUS_27630 1950 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2518 3006 gene locus_tag LOCUS_27640 2518 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3024 3581 gene locus_tag LOCUS_27650 3024 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3696 4823 gene locus_tag LOCUS_27660 3696 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 4952 5401 gene locus_tag LOCUS_27670 4952 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 5663 6238 gene locus_tag LOCUS_27680 5663 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 6219 6407 gene locus_tag LOCUS_27690 6219 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 6657 8303 gene locus_tag LOCUS_27700 6657 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 8476 9057 gene locus_tag LOCUS_27710 8476 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 9815 9186 gene locus_tag LOCUS_27720 9815 9186 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_27720 9986 10708 gene locus_tag LOCUS_27730 9986 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence0221 528 148 gene locus_tag LOCUS_27740 528 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1598 573 gene locus_tag LOCUS_27750 1598 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1840 1595 gene locus_tag LOCUS_27760 1840 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2808 2074 gene locus_tag LOCUS_27770 2808 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3246 5849 gene locus_tag LOCUS_27780 3246 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 6076 6405 gene locus_tag LOCUS_27790 6076 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 6761 8140 gene locus_tag LOCUS_27800 6761 8140 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_27800 8415 8296 gene locus_tag LOCUS_27810 8415 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8627 9019 gene locus_tag LOCUS_27820 8627 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0222 1227 118 gene locus_tag LOCUS_27830 1227 118 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_27830 2185 1310 gene locus_tag LOCUS_27840 2185 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2387 5407 gene locus_tag LOCUS_27850 2387 5407 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142749.1 protein_id gnl|my_center|LOCUS_27850 5527 6459 gene locus_tag LOCUS_27860 5527 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 6647 8422 gene locus_tag LOCUS_27870 6647 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_27870 9088 8435 gene locus_tag LOCUS_27880 9088 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 10693 9101 gene locus_tag LOCUS_27890 10693 9101 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence0223 316 1776 gene locus_tag LOCUS_27900 gene gnd 316 1776 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_27900 2944 5136 gene locus_tag LOCUS_27910 2944 5136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_27910 5224 5997 gene locus_tag LOCUS_27920 5224 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 6999 6058 gene locus_tag LOCUS_27930 6999 6058 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_27930 8807 7701 gene locus_tag LOCUS_27940 8807 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 9309 10316 gene locus_tag LOCUS_27950 9309 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 10771 10466 gene locus_tag LOCUS_27960 10771 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0224 72 344 gene locus_tag LOCUS_27970 72 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 518 445 gene locus_tag LOCUS_t00170 518 445 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 938 747 gene locus_tag LOCUS_27980 938 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1307 990 gene locus_tag LOCUS_27990 1307 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1652 1323 gene locus_tag LOCUS_28000 1652 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3493 2048 gene locus_tag LOCUS_28010 3493 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 4875 3490 gene locus_tag LOCUS_28020 4875 3490 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_28020 5928 5056 gene locus_tag LOCUS_28030 5928 5056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921488.1 protein_id gnl|my_center|LOCUS_28030 7933 6047 gene locus_tag LOCUS_28040 7933 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 8685 7963 gene locus_tag LOCUS_28050 8685 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 9581 8700 gene locus_tag LOCUS_28060 9581 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 10668 9568 gene locus_tag LOCUS_28070 10668 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0225 728 186 gene locus_tag LOCUS_28080 728 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2090 765 gene locus_tag LOCUS_28090 gene hisS 2090 765 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_28090 3480 2200 gene locus_tag LOCUS_28100 3480 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3595 4107 gene locus_tag LOCUS_28110 3595 4107 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327748.1 protein_id gnl|my_center|LOCUS_28110 6929 4227 gene locus_tag LOCUS_28120 6929 4227 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_28120 7003 7761 gene locus_tag LOCUS_28130 7003 7761 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122697.1 protein_id gnl|my_center|LOCUS_28130 7836 8855 gene locus_tag LOCUS_28140 7836 8855 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_28140 8901 9803 gene locus_tag LOCUS_28150 8901 9803 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence0226 172 2232 gene locus_tag LOCUS_28160 172 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2238 3686 gene locus_tag LOCUS_28170 2238 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 7128 3811 gene locus_tag LOCUS_28180 7128 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 7231 7794 gene locus_tag LOCUS_28190 7231 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 7856 10717 gene locus_tag LOCUS_28200 7856 10717 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922826.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence0227 35 514 gene locus_tag LOCUS_28210 35 514 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_28210 697 3090 gene locus_tag LOCUS_28220 697 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3387 3091 gene locus_tag LOCUS_28230 3387 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3325 5217 gene locus_tag LOCUS_28240 3325 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 5274 6560 gene locus_tag LOCUS_28250 5274 6560 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_28250 7121 7666 gene locus_tag LOCUS_28260 7121 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 7821 8807 gene locus_tag LOCUS_28270 7821 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 9141 8755 gene locus_tag LOCUS_28280 9141 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence0228 315 599 gene locus_tag LOCUS_28290 315 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 599 1819 gene locus_tag LOCUS_28300 599 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2565 1837 gene locus_tag LOCUS_28310 2565 1837 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_28310 3988 2885 gene locus_tag LOCUS_28320 3988 2885 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384657.1 protein_id gnl|my_center|LOCUS_28320 7268 4011 gene locus_tag LOCUS_28330 7268 4011 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_28330 8314 7370 gene locus_tag LOCUS_28340 8314 7370 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_28340 8258 8485 gene locus_tag LOCUS_28350 8258 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 8592 9782 gene locus_tag LOCUS_28360 8592 9782 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_28360 10609 9842 gene locus_tag LOCUS_28370 10609 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence0229 1364 27 gene locus_tag LOCUS_28380 1364 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1475 3673 gene locus_tag LOCUS_28390 1475 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3703 4452 gene locus_tag LOCUS_28400 3703 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 4466 4882 gene locus_tag LOCUS_28410 4466 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065260.1 protein_id gnl|my_center|LOCUS_28410 5776 4898 gene locus_tag LOCUS_28420 5776 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 6245 5769 gene locus_tag LOCUS_28430 6245 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 7255 6242 gene locus_tag LOCUS_28440 7255 6242 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_28440 7817 7575 gene locus_tag LOCUS_28450 7817 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 8364 9494 gene locus_tag LOCUS_28460 8364 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 9635 10081 gene locus_tag LOCUS_28470 9635 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 10452 9970 gene locus_tag LOCUS_28480 10452 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence0230 1376 30 gene locus_tag LOCUS_28490 1376 30 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_28490 1410 1589 gene locus_tag LOCUS_28500 1410 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1835 8773 gene locus_tag LOCUS_28510 1835 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 9847 8792 gene locus_tag LOCUS_28520 9847 8792 CDS product BBP7 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921355.1 protein_id gnl|my_center|LOCUS_28520 <10674 10134 gene locus_tag LOCUS_28530 <10674 10134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729358.1:threonine/serine exporter family protein >Feature sequence0231 1638 679 gene locus_tag LOCUS_28540 1638 679 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_28540 2132 1785 gene locus_tag LOCUS_28550 2132 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3745 2297 gene locus_tag LOCUS_28560 3745 2297 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_28560 4712 3945 gene locus_tag LOCUS_28570 4712 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 5155 5817 gene locus_tag LOCUS_28580 5155 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 5827 6738 gene locus_tag LOCUS_28590 5827 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 6776 7441 gene locus_tag LOCUS_28600 6776 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 7876 7481 gene locus_tag LOCUS_28610 7876 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 8121 7873 gene locus_tag LOCUS_28620 8121 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 8348 8142 gene locus_tag LOCUS_28630 8348 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 10332 8626 gene locus_tag LOCUS_28640 10332 8626 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence0232 5 3172 gene locus_tag LOCUS_28650 5 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 6791 3252 gene locus_tag LOCUS_28660 6791 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 6873 8558 gene locus_tag LOCUS_28670 6873 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 9335 8613 gene locus_tag LOCUS_28680 9335 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 9536 10153 gene locus_tag LOCUS_28690 9536 10153 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence0233 513 1703 gene locus_tag LOCUS_28700 513 1703 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_28700 1749 2108 gene locus_tag LOCUS_28710 1749 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2169 2459 gene locus_tag LOCUS_28720 2169 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2986 2438 gene locus_tag LOCUS_28730 2986 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3403 2993 gene locus_tag LOCUS_28740 3403 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 5318 4059 gene locus_tag LOCUS_28750 5318 4059 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_28750 10006 5405 gene locus_tag LOCUS_28760 10006 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 10309 10166 gene locus_tag LOCUS_28770 10309 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence0234 1492 692 gene locus_tag LOCUS_28780 1492 692 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531349.1 protein_id gnl|my_center|LOCUS_28780 1668 2855 gene locus_tag LOCUS_28790 gene sucC 1668 2855 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 protein_id gnl|my_center|LOCUS_28790 2892 3467 gene locus_tag LOCUS_28800 2892 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3962 4837 gene locus_tag LOCUS_28810 gene sucD 3962 4837 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_28810 6003 4906 gene locus_tag LOCUS_28820 6003 4906 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 protein_id gnl|my_center|LOCUS_28820 6809 6000 gene locus_tag LOCUS_28830 6809 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 7879 6947 gene locus_tag LOCUS_28840 gene ispH 7879 6947 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_28840 8336 8007 gene locus_tag LOCUS_28850 8336 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 8891 10153 gene locus_tag LOCUS_28860 8891 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence0235 4073 489 gene locus_tag LOCUS_28870 4073 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3997 4272 gene locus_tag LOCUS_28880 3997 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 4502 5896 gene locus_tag LOCUS_28890 4502 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 6011 7825 gene locus_tag LOCUS_28900 6011 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 8053 9969 gene locus_tag LOCUS_28910 8053 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 10471 10097 gene locus_tag LOCUS_28920 10471 10097 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence0236 815 45 gene locus_tag LOCUS_28930 815 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 904 1512 gene locus_tag LOCUS_28940 904 1512 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_28940 2391 1546 gene locus_tag LOCUS_28950 2391 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2657 3358 gene locus_tag LOCUS_28960 2657 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 3373 5541 gene locus_tag LOCUS_28970 3373 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 6744 5617 gene locus_tag LOCUS_28980 6744 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 7079 7732 gene locus_tag LOCUS_28990 7079 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 7969 7793 gene locus_tag LOCUS_29000 7969 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 10006 8006 gene locus_tag LOCUS_29010 10006 8006 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence0237 249 887 gene locus_tag LOCUS_29020 249 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 931 1320 gene locus_tag LOCUS_29030 931 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1390 2265 gene locus_tag LOCUS_29040 gene atpG 1390 2265 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_29040 2272 3045 gene locus_tag LOCUS_29050 2272 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3197 3763 gene locus_tag LOCUS_29060 3197 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 3805 5265 gene locus_tag LOCUS_29070 gene atpD 3805 5265 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_29070 5269 5664 gene locus_tag LOCUS_29080 5269 5664 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 protein_id gnl|my_center|LOCUS_29080 5738 6139 gene locus_tag LOCUS_29090 5738 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 6161 6592 gene locus_tag LOCUS_29100 6161 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 9583 6899 gene locus_tag LOCUS_29110 9583 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 9660 9845 gene locus_tag LOCUS_29120 9660 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 9855 10061 gene locus_tag LOCUS_29130 9855 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 10258 10461 gene locus_tag LOCUS_29140 10258 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence0238 1701 4073 gene locus_tag LOCUS_29150 gene priA 1701 4073 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_29150 4186 4920 gene locus_tag LOCUS_29160 4186 4920 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_29160 5037 5108 gene locus_tag LOCUS_t00180 5037 5108 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6533 5043 gene locus_tag LOCUS_29170 6533 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 6971 6579 gene locus_tag LOCUS_29180 6971 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 8724 6979 gene locus_tag LOCUS_29190 8724 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 9350 8721 gene locus_tag LOCUS_29200 9350 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 9638 9414 gene locus_tag LOCUS_29210 9638 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 9817 9638 gene locus_tag LOCUS_29220 9817 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence0239 1161 187 gene locus_tag LOCUS_29230 1161 187 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_29230 1367 3055 gene locus_tag LOCUS_29240 1367 3055 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_29240 3132 3665 gene locus_tag LOCUS_29250 3132 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_29250 4167 3814 gene locus_tag LOCUS_29260 4167 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 5378 4188 gene locus_tag LOCUS_29270 5378 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 6432 5413 gene locus_tag LOCUS_29280 6432 5413 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_29280 6505 7578 gene locus_tag LOCUS_29290 6505 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 7654 8979 gene locus_tag LOCUS_29300 7654 8979 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_29300 9198 10226 gene locus_tag LOCUS_29310 9198 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence0240 786 1004 gene locus_tag LOCUS_29320 786 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1203 3131 gene locus_tag LOCUS_29330 1203 3131 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921710.1 protein_id gnl|my_center|LOCUS_29330 3610 5151 gene locus_tag LOCUS_29340 3610 5151 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_29340 5168 5518 gene locus_tag LOCUS_29350 5168 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 9029 5610 gene locus_tag LOCUS_29360 gene mexF 9029 5610 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_29360 10351 9080 gene locus_tag LOCUS_29370 10351 9080 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096739.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence0241 52 753 gene locus_tag LOCUS_29380 52 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 1094 2794 gene locus_tag LOCUS_29390 1094 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3872 2826 gene locus_tag LOCUS_29400 3872 2826 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_29400 5582 3927 gene locus_tag LOCUS_29410 5582 3927 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_29410 5694 6245 gene locus_tag LOCUS_29420 5694 6245 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_29420 6242 7657 gene locus_tag LOCUS_29430 6242 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 7644 10232 gene locus_tag LOCUS_29440 7644 10232 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0242 495 1886 gene locus_tag LOCUS_29450 gene asnS 495 1886 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337912.1 protein_id gnl|my_center|LOCUS_29450 2014 3036 gene locus_tag LOCUS_29460 gene rtcA 2014 3036 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602549.1 protein_id gnl|my_center|LOCUS_29460 4301 3156 gene locus_tag LOCUS_29470 4301 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 4487 6397 gene locus_tag LOCUS_29480 4487 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 6838 7827 gene locus_tag LOCUS_29490 6838 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29490 7984 9351 gene locus_tag LOCUS_29500 7984 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29500 9640 9568 gene locus_tag LOCUS_t00190 9640 9568 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9733 9661 gene locus_tag LOCUS_t00200 9733 9661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9884 9810 gene locus_tag LOCUS_t00210 9884 9810 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9961 9891 gene locus_tag LOCUS_t00220 9961 9891 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10047 9975 gene locus_tag LOCUS_t00230 10047 9975 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10148 10065 gene locus_tag LOCUS_t00240 10148 10065 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10296 10224 gene locus_tag LOCUS_t00250 10296 10224 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10387 10302 gene locus_tag LOCUS_t00260 10387 10302 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10467 10396 gene locus_tag LOCUS_t00270 10467 10396 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0243 1489 71 gene locus_tag LOCUS_29510 1489 71 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_29510 4728 1486 gene locus_tag LOCUS_29520 4728 1486 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_29520 4885 5877 gene locus_tag LOCUS_29530 4885 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 6043 6369 gene locus_tag LOCUS_29540 6043 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 7901 6609 gene locus_tag LOCUS_29550 7901 6609 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_29550 8307 7912 gene locus_tag LOCUS_29560 8307 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 9266 8424 gene locus_tag LOCUS_29570 9266 8424 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932424.1 protein_id gnl|my_center|LOCUS_29570 <10512 9460 gene locus_tag LOCUS_29580 <10512 9460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958006.1:class II fumarate hydratase >Feature sequence0244 116 2734 gene locus_tag LOCUS_29590 116 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 2713 5235 gene locus_tag LOCUS_29600 2713 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 5237 6067 gene locus_tag LOCUS_29610 5237 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 6742 7020 gene locus_tag LOCUS_29620 6742 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 7139 8014 gene locus_tag LOCUS_29630 7139 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 8161 9621 gene locus_tag LOCUS_29640 8161 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 9827 10396 gene locus_tag LOCUS_29650 9827 10396 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence0245 338 2530 gene locus_tag LOCUS_29660 338 2530 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119585.1 protein_id gnl|my_center|LOCUS_29660 2637 4001 gene locus_tag LOCUS_29670 2637 4001 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_29670 4494 5444 gene locus_tag LOCUS_29680 4494 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 6123 5998 gene locus_tag LOCUS_29690 6123 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 6747 6151 gene locus_tag LOCUS_29700 6747 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 8114 7068 gene locus_tag LOCUS_29710 8114 7068 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613930.1 protein_id gnl|my_center|LOCUS_29710 9077 8142 gene locus_tag LOCUS_29720 9077 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 9673 10368 gene locus_tag LOCUS_29730 9673 10368 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence0246 201 626 gene locus_tag LOCUS_29740 201 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 699 784 gene locus_tag LOCUS_t00280 699 784 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 910 2247 gene locus_tag LOCUS_29750 910 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 2636 2322 gene locus_tag LOCUS_29760 2636 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 2916 2689 gene locus_tag LOCUS_29770 2916 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3458 2922 gene locus_tag LOCUS_29780 3458 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 4303 3458 gene locus_tag LOCUS_29790 4303 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 4479 4300 gene locus_tag LOCUS_29800 4479 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4727 4425 gene locus_tag LOCUS_29810 4727 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 5646 4705 gene locus_tag LOCUS_29820 5646 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 5854 5615 gene locus_tag LOCUS_29830 5854 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 6062 5835 gene locus_tag LOCUS_29840 6062 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 7546 6059 gene locus_tag LOCUS_29850 7546 6059 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_29850 7827 7543 gene locus_tag LOCUS_29860 7827 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 8012 7824 gene locus_tag LOCUS_29870 8012 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 8494 8012 gene locus_tag LOCUS_29880 8494 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 8978 8568 gene locus_tag LOCUS_29890 8978 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 9242 8982 gene locus_tag LOCUS_29900 9242 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 9938 9303 gene locus_tag LOCUS_29910 9938 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence0247 2095 875 gene locus_tag LOCUS_29920 2095 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4776 2095 gene locus_tag LOCUS_29930 4776 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 5607 4957 gene locus_tag LOCUS_29940 5607 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 7765 5882 gene locus_tag LOCUS_29950 7765 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 8221 9561 gene locus_tag LOCUS_29960 8221 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 10386 10162 gene locus_tag LOCUS_29970 10386 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence0248 168 926 gene locus_tag LOCUS_29980 168 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1172 2275 gene locus_tag LOCUS_29990 gene aroC 1172 2275 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_29990 2411 4711 gene locus_tag LOCUS_30000 2411 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 4966 6216 gene locus_tag LOCUS_30010 4966 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 6439 6224 gene locus_tag LOCUS_30020 6439 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 6875 6507 gene locus_tag LOCUS_30030 6875 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 7130 8578 gene locus_tag LOCUS_30040 7130 8578 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_30040 8677 9822 gene locus_tag LOCUS_30050 8677 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 9928 10278 gene locus_tag LOCUS_30060 9928 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence0249 677 991 gene locus_tag LOCUS_30070 677 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1475 1098 gene locus_tag LOCUS_30080 1475 1098 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_30080 2789 1491 gene locus_tag LOCUS_30090 2789 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 4226 3084 gene locus_tag LOCUS_30100 4226 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 4614 4333 gene locus_tag LOCUS_30110 4614 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 6419 4914 gene locus_tag LOCUS_30120 6419 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 6637 6864 gene locus_tag LOCUS_30130 6637 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 6861 8876 gene locus_tag LOCUS_30140 6861 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 8981 9184 gene locus_tag LOCUS_30150 8981 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 9259 9735 gene locus_tag LOCUS_30160 9259 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0250 181 2994 gene locus_tag LOCUS_30170 181 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3131 4039 gene locus_tag LOCUS_30180 3131 4039 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_30180 4050 6770 gene locus_tag LOCUS_30190 4050 6770 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_30190 6780 7037 gene locus_tag LOCUS_30200 6780 7037 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_30200 7021 8127 gene locus_tag LOCUS_30210 gene hypD 7021 8127 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_30210 8124 9164 gene locus_tag LOCUS_30220 gene hypE 8124 9164 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_30220 9591 9112 gene locus_tag LOCUS_30230 9591 9112 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_30230 <10325 9588 gene locus_tag LOCUS_30240 <10325 9588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257074.1:Ni/Fe hydrogenase subunit alpha >Feature sequence0251 351 719 gene locus_tag LOCUS_30250 351 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1226 1020 gene locus_tag LOCUS_30260 1226 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1225 2379 gene locus_tag LOCUS_30270 1225 2379 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_30270 2510 3076 gene locus_tag LOCUS_30280 2510 3076 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_30280 4015 3077 gene locus_tag LOCUS_30290 4015 3077 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_30290 4914 4012 gene locus_tag LOCUS_30300 4914 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 5173 6870 gene locus_tag LOCUS_30310 5173 6870 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_30310 6959 8173 gene locus_tag LOCUS_30320 6959 8173 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_30320 8339 8773 gene locus_tag LOCUS_30330 gene gspG 8339 8773 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533582.1 protein_id gnl|my_center|LOCUS_30330 8884 9453 gene locus_tag LOCUS_30340 8884 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 9450 10184 gene locus_tag LOCUS_30350 9450 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence0252 946 464 gene locus_tag LOCUS_30360 946 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 2907 943 gene locus_tag LOCUS_30370 2907 943 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_30370 3251 2976 gene locus_tag LOCUS_30380 3251 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3687 3289 gene locus_tag LOCUS_30390 3687 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 4319 3870 gene locus_tag LOCUS_30400 4319 3870 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_30400 5015 5764 gene locus_tag LOCUS_30410 5015 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 5761 6861 gene locus_tag LOCUS_30420 5761 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 6858 8027 gene locus_tag LOCUS_30430 6858 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 8637 8191 gene locus_tag LOCUS_30440 8637 8191 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_30440 8779 8940 gene locus_tag LOCUS_30450 8779 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 8937 9374 gene locus_tag LOCUS_30460 8937 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence0253 1268 3814 gene locus_tag LOCUS_30470 1268 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 3818 4108 gene locus_tag LOCUS_30480 3818 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4095 5033 gene locus_tag LOCUS_30490 4095 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 5030 6490 gene locus_tag LOCUS_30500 5030 6490 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_30500 6539 6778 gene locus_tag LOCUS_30510 6539 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 6833 7612 gene locus_tag LOCUS_30520 6833 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 7746 8468 gene locus_tag LOCUS_30530 7746 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 8795 9805 gene locus_tag LOCUS_30540 8795 9805 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence0254 2257 254 gene locus_tag LOCUS_30550 2257 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3173 2367 gene locus_tag LOCUS_30560 3173 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 4294 3200 gene locus_tag LOCUS_30570 gene aroB 4294 3200 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846185.1 protein_id gnl|my_center|LOCUS_30570 4442 5974 gene locus_tag LOCUS_30580 gene aroE 4442 5974 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_30580 5971 6501 gene locus_tag LOCUS_30590 5971 6501 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119378.1 protein_id gnl|my_center|LOCUS_30590 8001 6514 gene locus_tag LOCUS_30600 8001 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 8552 7998 gene locus_tag LOCUS_30610 8552 7998 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039400.1 protein_id gnl|my_center|LOCUS_30610 8816 9268 gene locus_tag LOCUS_30620 8816 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence0255 567 1847 gene locus_tag LOCUS_30630 567 1847 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_30630 2129 4348 gene locus_tag LOCUS_30640 2129 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 4795 4433 gene locus_tag LOCUS_30650 4795 4433 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_30650 4886 5848 gene locus_tag LOCUS_30660 4886 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 6065 7309 gene locus_tag LOCUS_30670 6065 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 7410 8564 gene locus_tag LOCUS_30680 7410 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 9238 8687 gene locus_tag LOCUS_30690 9238 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 >Feature sequence0256 1703 399 gene locus_tag LOCUS_30700 1703 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333115.1 protein_id gnl|my_center|LOCUS_30700 5236 1793 gene locus_tag LOCUS_30710 5236 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 7029 5671 gene locus_tag LOCUS_30720 gene glmM 7029 5671 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_30720 7332 7931 gene locus_tag LOCUS_30730 7332 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 8180 9265 gene locus_tag LOCUS_30740 8180 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence0257 1280 762 gene locus_tag LOCUS_30750 1280 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1466 1708 gene locus_tag LOCUS_30760 1466 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2002 2382 gene locus_tag LOCUS_30770 2002 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2575 2384 gene locus_tag LOCUS_30780 2575 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2602 3891 gene locus_tag LOCUS_30790 2602 3891 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_30790 4410 4802 gene locus_tag LOCUS_30800 4410 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 5325 5765 gene locus_tag LOCUS_30810 5325 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 5916 6809 gene locus_tag LOCUS_30820 5916 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 6920 7420 gene locus_tag LOCUS_30830 6920 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 7467 8468 gene locus_tag LOCUS_30840 gene gctA 7467 8468 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_30840 8527 9123 gene locus_tag LOCUS_30850 8527 9123 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921805.1 protein_id gnl|my_center|LOCUS_30850 9173 9403 gene locus_tag LOCUS_30860 9173 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 9414 9713 gene locus_tag LOCUS_30870 9414 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0258 4010 90 gene locus_tag LOCUS_30880 4010 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334944.1 protein_id gnl|my_center|LOCUS_30880 6164 4629 gene locus_tag LOCUS_30890 6164 4629 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_30890 7690 6392 gene locus_tag LOCUS_30900 7690 6392 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 protein_id gnl|my_center|LOCUS_30900 7994 9532 gene locus_tag LOCUS_30910 7994 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332518.1 protein_id gnl|my_center|LOCUS_30910 9631 9924 gene locus_tag LOCUS_30920 9631 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence0259 621 1730 gene locus_tag LOCUS_30930 621 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1786 1980 gene locus_tag LOCUS_30940 1786 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2084 2902 gene locus_tag LOCUS_30950 2084 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 4194 2923 gene locus_tag LOCUS_30960 4194 2923 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_30960 6771 4252 gene locus_tag LOCUS_30970 6771 4252 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_30970 7828 7238 gene locus_tag LOCUS_30980 7828 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 8762 7866 gene locus_tag LOCUS_30990 8762 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 9790 8861 gene locus_tag LOCUS_31000 9790 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence0260 1009 2397 gene locus_tag LOCUS_31010 1009 2397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207163.1 protein_id gnl|my_center|LOCUS_31010 2574 2646 gene locus_tag LOCUS_t00290 2574 2646 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2753 2837 gene locus_tag LOCUS_t00300 2753 2837 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2929 3002 gene locus_tag LOCUS_t00310 2929 3002 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3205 3417 gene locus_tag LOCUS_31020 3205 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3408 3480 gene locus_tag LOCUS_t00320 3408 3480 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3568 4797 gene locus_tag LOCUS_31030 gene tuf 3568 4797 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_31030 4856 5008 gene locus_tag LOCUS_31040 gene rpmG 4856 5008 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265616.1 protein_id gnl|my_center|LOCUS_31040 5135 5209 gene locus_tag LOCUS_t00330 5135 5209 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5307 6329 gene locus_tag LOCUS_31050 5307 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 6382 7233 gene locus_tag LOCUS_31060 6382 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 7286 7750 gene locus_tag LOCUS_31070 gene rplK 7286 7750 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_31070 7970 8914 gene locus_tag LOCUS_31080 7970 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 8992 9528 gene locus_tag LOCUS_31090 8992 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 9612 10016 gene locus_tag LOCUS_31100 gene rplL 9612 10016 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence0261 420 1514 gene locus_tag LOCUS_31110 420 1514 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_31110 1690 3171 gene locus_tag LOCUS_31120 1690 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3176 3814 gene locus_tag LOCUS_31130 3176 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3807 6545 gene locus_tag LOCUS_31140 3807 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence0262 643 2139 gene locus_tag LOCUS_31150 643 2139 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_31150 2173 3384 gene locus_tag LOCUS_31160 2173 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 3576 4001 gene locus_tag LOCUS_31170 3576 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 4316 5482 gene locus_tag LOCUS_31180 4316 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 5672 6184 gene locus_tag LOCUS_31190 5672 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 6268 6555 gene locus_tag LOCUS_31200 gene groES 6268 6555 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_31200 6906 7967 gene locus_tag LOCUS_31210 6906 7967 CDS product transaldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119230.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence0263 194 1207 gene locus_tag LOCUS_31220 gene argC 194 1207 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_31220 1567 1857 gene locus_tag LOCUS_31230 1567 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 2064 3587 gene locus_tag LOCUS_31240 2064 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4054 4620 gene locus_tag LOCUS_31250 4054 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 4799 6712 gene locus_tag LOCUS_31260 gene selB 4799 6712 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_31260 6815 7399 gene locus_tag LOCUS_31270 6815 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 7442 8092 gene locus_tag LOCUS_31280 7442 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 8097 9368 gene locus_tag LOCUS_31290 8097 9368 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence0264 961 26 gene locus_tag LOCUS_31300 961 26 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_31300 3430 1001 gene locus_tag LOCUS_31310 3430 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3920 3615 gene locus_tag LOCUS_31320 3920 3615 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_31320 6653 3999 gene locus_tag LOCUS_31330 6653 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 7429 6758 gene locus_tag LOCUS_31340 7429 6758 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140605.1 protein_id gnl|my_center|LOCUS_31340 7714 7475 gene locus_tag LOCUS_31350 7714 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 7598 8548 gene locus_tag LOCUS_31360 7598 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 8676 8948 gene locus_tag LOCUS_31370 8676 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 9217 9963 gene locus_tag LOCUS_31380 9217 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence0265 1088 105 gene locus_tag LOCUS_31390 1088 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2437 1121 gene locus_tag LOCUS_31400 2437 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3165 2491 gene locus_tag LOCUS_31410 3165 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 3652 3218 gene locus_tag LOCUS_31420 3652 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3834 4388 gene locus_tag LOCUS_31430 gene rpoE 3834 4388 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_31430 4385 5692 gene locus_tag LOCUS_31440 4385 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 9580 6188 gene locus_tag LOCUS_31450 9580 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence0266 4873 1064 gene locus_tag LOCUS_31460 4873 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 7091 5343 gene locus_tag LOCUS_31470 7091 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 6973 7338 gene locus_tag LOCUS_31480 6973 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 7591 9972 gene locus_tag LOCUS_31490 7591 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence0267 360 91 gene locus_tag LOCUS_31500 360 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 359 1993 gene locus_tag LOCUS_31510 359 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3852 2188 gene locus_tag LOCUS_31520 3852 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 4586 3999 gene locus_tag LOCUS_31530 4586 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31530 5046 4777 gene locus_tag LOCUS_31540 5046 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 5665 5039 gene locus_tag LOCUS_31550 5665 5039 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_31550 6767 5778 gene locus_tag LOCUS_31560 6767 5778 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_31560 7775 6771 gene locus_tag LOCUS_31570 7775 6771 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_31570 8714 7929 gene locus_tag LOCUS_31580 8714 7929 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_31580 9409 8747 gene locus_tag LOCUS_31590 9409 8747 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence0268 3103 2525 gene locus_tag LOCUS_31600 3103 2525 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_31600 3392 3940 gene locus_tag LOCUS_31610 3392 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 4956 3982 gene locus_tag LOCUS_31620 4956 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 6038 4971 gene locus_tag LOCUS_31630 6038 4971 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198645.1 protein_id gnl|my_center|LOCUS_31630 9062 6066 gene locus_tag LOCUS_31640 9062 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 9953 9096 gene locus_tag LOCUS_31650 gene pilK 9953 9096 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_31650 >Feature sequence0269 203 24 gene locus_tag LOCUS_31660 203 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 1786 218 gene locus_tag LOCUS_31670 gene dnaK 1786 218 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_31670 2675 1974 gene locus_tag LOCUS_31680 2675 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 5287 2798 gene locus_tag LOCUS_31690 5287 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 5244 5792 gene locus_tag LOCUS_31700 5244 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 7534 5954 gene locus_tag LOCUS_31710 7534 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 8535 7825 gene locus_tag LOCUS_31720 gene rplC 8535 7825 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence0270 383 1654 gene locus_tag LOCUS_31730 383 1654 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_31730 3894 1873 gene locus_tag LOCUS_31740 3894 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4925 4008 gene locus_tag LOCUS_31750 gene truB 4925 4008 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_31750 5248 6000 gene locus_tag LOCUS_31760 5248 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 6492 8861 gene locus_tag LOCUS_31770 6492 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31770 9765 8899 gene locus_tag LOCUS_31780 9765 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence0271 1454 114 gene locus_tag LOCUS_31790 1454 114 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_31790 2463 1753 gene locus_tag LOCUS_31800 2463 1753 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_31800 2629 3375 gene locus_tag LOCUS_31810 2629 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3492 4859 gene locus_tag LOCUS_31820 gene nhaA 3492 4859 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_31820 6206 4926 gene locus_tag LOCUS_31830 6206 4926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_31830 6966 6313 gene locus_tag LOCUS_31840 6966 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 8431 7070 gene locus_tag LOCUS_31850 8431 7070 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_31850 9685 8438 gene locus_tag LOCUS_31860 9685 8438 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence0272 2916 1051 gene locus_tag LOCUS_31870 gene ctaD 2916 1051 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_31870 3963 3016 gene locus_tag LOCUS_31880 3963 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5337 4066 gene locus_tag LOCUS_31890 5337 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 5720 5887 gene locus_tag LOCUS_31900 5720 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 6622 6032 gene locus_tag LOCUS_31910 6622 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 6880 6626 gene locus_tag LOCUS_31920 6880 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 <9781 7063 gene locus_tag LOCUS_31930 <9781 7063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084126.1:tetratricopeptide repeat protein >Feature sequence0273 997 83 gene locus_tag LOCUS_31940 997 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 2438 1134 gene locus_tag LOCUS_31950 2438 1134 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031025.1 protein_id gnl|my_center|LOCUS_31950 2857 2435 gene locus_tag LOCUS_31960 2857 2435 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087586.1 protein_id gnl|my_center|LOCUS_31960 3687 2878 gene locus_tag LOCUS_31970 gene ppk2 3687 2878 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086264.1 protein_id gnl|my_center|LOCUS_31970 4445 3720 gene locus_tag LOCUS_31980 4445 3720 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932146.1 protein_id gnl|my_center|LOCUS_31980 6927 4492 gene locus_tag LOCUS_31990 6927 4492 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209289.1 protein_id gnl|my_center|LOCUS_31990 7742 7092 gene locus_tag LOCUS_32000 7742 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 8049 7792 gene locus_tag LOCUS_32010 8049 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 8537 9727 gene locus_tag LOCUS_32020 8537 9727 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence0274 2489 1038 gene locus_tag LOCUS_32030 2489 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 2746 2673 gene locus_tag LOCUS_t00340 2746 2673 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3591 2827 gene locus_tag LOCUS_32040 3591 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 6900 4027 gene locus_tag LOCUS_32050 6900 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 9530 7065 gene locus_tag LOCUS_32060 9530 7065 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121337.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence0275 846 22 gene locus_tag LOCUS_32070 846 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1547 1080 gene locus_tag LOCUS_32080 1547 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 1697 2692 gene locus_tag LOCUS_32090 1697 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2976 3611 gene locus_tag LOCUS_32100 2976 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 5837 3771 gene locus_tag LOCUS_32110 5837 3771 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_32110 7895 6024 gene locus_tag LOCUS_32120 gene treZ 7895 6024 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389950.1 protein_id gnl|my_center|LOCUS_32120 8189 8461 gene locus_tag LOCUS_32130 8189 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 <9575 8513 gene locus_tag LOCUS_32140 <9575 8513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480024.1:membrane dipeptidase >Feature sequence0276 1350 2855 gene locus_tag LOCUS_32150 1350 2855 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_32150 3196 3717 gene locus_tag LOCUS_32160 3196 3717 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_32160 3714 5351 gene locus_tag LOCUS_32170 3714 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 5470 7974 gene locus_tag LOCUS_32180 5470 7974 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_32180 8119 9492 gene locus_tag LOCUS_32190 8119 9492 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence0277 2266 188 gene locus_tag LOCUS_32200 2266 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 2747 2397 gene locus_tag LOCUS_32210 2747 2397 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_32210 3028 2750 gene locus_tag LOCUS_32220 3028 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 4367 3243 gene locus_tag LOCUS_32230 4367 3243 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 protein_id gnl|my_center|LOCUS_32230 5605 4454 gene locus_tag LOCUS_32240 5605 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 6295 7638 gene locus_tag LOCUS_32250 6295 7638 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_32250 7694 7978 gene locus_tag LOCUS_32260 7694 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 7978 8370 gene locus_tag LOCUS_32270 7978 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 8422 9270 gene locus_tag LOCUS_32280 8422 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence0278 401 676 gene locus_tag LOCUS_32290 401 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1242 751 gene locus_tag LOCUS_32300 1242 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 1538 1311 gene locus_tag LOCUS_32310 1538 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 2258 1548 gene locus_tag LOCUS_32320 2258 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2899 2183 gene locus_tag LOCUS_32330 2899 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 4154 2904 gene locus_tag LOCUS_32340 4154 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 5475 4285 gene locus_tag LOCUS_32350 5475 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 6223 5480 gene locus_tag LOCUS_32360 6223 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 9189 6418 gene locus_tag LOCUS_32370 gene acnA 9189 6418 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_32370 9503 9312 gene locus_tag LOCUS_32380 9503 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence0279 1540 173 gene locus_tag LOCUS_32390 1540 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 2132 1614 gene locus_tag LOCUS_32400 2132 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2615 2214 gene locus_tag LOCUS_32410 2615 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 2875 3711 gene locus_tag LOCUS_32420 2875 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3997 4497 gene locus_tag LOCUS_32430 3997 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 5615 4587 gene locus_tag LOCUS_32440 5615 4587 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921881.1 protein_id gnl|my_center|LOCUS_32440 5836 7659 gene locus_tag LOCUS_32450 5836 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 8229 9395 gene locus_tag LOCUS_32460 8229 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence0280 200 1753 gene locus_tag LOCUS_32470 200 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3026 2028 gene locus_tag LOCUS_32480 3026 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32480 3577 2924 gene locus_tag LOCUS_32490 3577 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3921 4871 gene locus_tag LOCUS_32500 gene gyaR 3921 4871 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_32500 5211 7736 gene locus_tag LOCUS_32510 5211 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 7739 9142 gene locus_tag LOCUS_32520 7739 9142 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921597.1 protein_id gnl|my_center|LOCUS_32520 >Feature sequence0281 1745 618 gene locus_tag LOCUS_32530 gene pheA 1745 618 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_32530 3694 2150 gene locus_tag LOCUS_32540 3694 2150 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530657.1 protein_id gnl|my_center|LOCUS_32540 4929 3958 gene locus_tag LOCUS_32550 4929 3958 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_32550 5725 5099 gene locus_tag LOCUS_32560 5725 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_32560 6144 7673 gene locus_tag LOCUS_32570 6144 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence0282 479 1696 gene locus_tag LOCUS_32580 gene fabF 479 1696 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125918.1 protein_id gnl|my_center|LOCUS_32580 3954 1762 gene locus_tag LOCUS_32590 3954 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 8222 4239 gene locus_tag LOCUS_32600 8222 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 >Feature sequence0283 4192 797 gene locus_tag LOCUS_32610 4192 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 6104 4215 gene locus_tag LOCUS_32620 6104 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 8517 6361 gene locus_tag LOCUS_32630 8517 6361 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_32630 <9406 8706 gene locus_tag LOCUS_32640 <9406 8706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334964.1:OB-fold nucleic acid binding domain-containing protein >Feature sequence0284 185 505 gene locus_tag LOCUS_32650 gene sugE 185 505 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_32650 581 1153 gene locus_tag LOCUS_32660 581 1153 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_32660 1638 1150 gene locus_tag LOCUS_32670 1638 1150 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_32670 2158 1673 gene locus_tag LOCUS_32680 2158 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 2249 3952 gene locus_tag LOCUS_32690 2249 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 4652 4047 gene locus_tag LOCUS_32700 4652 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 5999 4731 gene locus_tag LOCUS_32710 5999 4731 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_32710 6546 6052 gene locus_tag LOCUS_32720 6546 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 9344 6759 gene locus_tag LOCUS_32730 9344 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence0285 <1 8684 gene locus_tag LOCUS_32740 <1 8684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein 8674 9264 gene locus_tag LOCUS_32750 8674 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence0286 1339 92 gene locus_tag LOCUS_32760 gene glgC 1339 92 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_32760 2433 1366 gene locus_tag LOCUS_32770 2433 1366 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_32770 2963 2430 gene locus_tag LOCUS_32780 gene hpt 2963 2430 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_32780 3455 3018 gene locus_tag LOCUS_32790 3455 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3820 3452 gene locus_tag LOCUS_32800 3820 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 5685 3817 gene locus_tag LOCUS_32810 gene ftsH 5685 3817 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325413.1 protein_id gnl|my_center|LOCUS_32810 6013 6231 gene locus_tag LOCUS_32820 6013 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 6680 8269 gene locus_tag LOCUS_32830 6680 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 8412 8936 gene locus_tag LOCUS_32840 8412 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 9387 9151 gene locus_tag LOCUS_32850 9387 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence0287 3474 2737 gene locus_tag LOCUS_32860 3474 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3732 4898 gene locus_tag LOCUS_32870 3732 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 5041 5418 gene locus_tag LOCUS_32880 5041 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 5492 5854 gene locus_tag LOCUS_32890 5492 5854 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106458570.1 protein_id gnl|my_center|LOCUS_32890 5975 6277 gene locus_tag LOCUS_32900 5975 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 6274 6507 gene locus_tag LOCUS_32910 6274 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 8036 6681 gene locus_tag LOCUS_32920 8036 6681 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615503.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence0288 <1 571 gene locus_tag LOCUS_32930 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000970490.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 834 932 gene locus_tag LOCUS_t00350 834 932 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 999 1445 gene locus_tag LOCUS_32940 999 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 1668 2930 gene locus_tag LOCUS_32950 1668 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 4058 3084 gene locus_tag LOCUS_32960 4058 3084 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_32960 4907 4107 gene locus_tag LOCUS_32970 4907 4107 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114948346.1 protein_id gnl|my_center|LOCUS_32970 6097 4913 gene locus_tag LOCUS_32980 gene rffA 6097 4913 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_32980 6769 6107 gene locus_tag LOCUS_32990 6769 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 7833 6901 gene locus_tag LOCUS_33000 7833 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 8777 7842 gene locus_tag LOCUS_33010 gene arnC 8777 7842 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112880.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence0289 2337 799 gene locus_tag LOCUS_33020 gene zwf 2337 799 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_33020 3416 2433 gene locus_tag LOCUS_33030 gene gnd 3416 2433 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_33030 4237 3575 gene locus_tag LOCUS_33040 gene rpiA 4237 3575 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_33040 4391 5473 gene locus_tag LOCUS_33050 4391 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 6537 5602 gene locus_tag LOCUS_33060 gene cysB 6537 5602 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072595.1 protein_id gnl|my_center|LOCUS_33060 6808 9324 gene locus_tag LOCUS_33070 6808 9324 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615693.1 protein_id gnl|my_center|LOCUS_33070 >Feature sequence0290 8216 8455 gene locus_tag LOCUS_33080 8216 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence0291 1514 369 gene locus_tag LOCUS_33090 1514 369 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_33090 2535 1528 gene locus_tag LOCUS_33100 2535 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 2956 2591 gene locus_tag LOCUS_33110 2956 2591 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_33110 4071 3133 gene locus_tag LOCUS_33120 4071 3133 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_33120 8513 4284 gene locus_tag LOCUS_33130 8513 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence0292 1263 439 gene locus_tag LOCUS_33140 1263 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 1904 1314 gene locus_tag LOCUS_33150 1904 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 4176 1879 gene locus_tag LOCUS_33160 4176 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 6344 4485 gene locus_tag LOCUS_33170 6344 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 7244 6438 gene locus_tag LOCUS_33180 7244 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 7705 7283 gene locus_tag LOCUS_33190 7705 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 8849 7839 gene locus_tag LOCUS_33200 8849 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 >Feature sequence0293 645 169 gene locus_tag LOCUS_33210 645 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 751 927 gene locus_tag LOCUS_33220 751 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3011 1047 gene locus_tag LOCUS_33230 gene dnaK 3011 1047 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326035.1 protein_id gnl|my_center|LOCUS_33230 4007 3321 gene locus_tag LOCUS_33240 4007 3321 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_33240 4161 4607 gene locus_tag LOCUS_33250 4161 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 4693 5859 gene locus_tag LOCUS_33260 4693 5859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 protein_id gnl|my_center|LOCUS_33260 5948 6508 gene locus_tag LOCUS_33270 5948 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 6505 8031 gene locus_tag LOCUS_33280 6505 8031 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_33280 8179 8886 gene locus_tag LOCUS_33290 8179 8886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119837.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence0294 1665 2813 gene locus_tag LOCUS_33300 1665 2813 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_33300 2863 3354 gene locus_tag LOCUS_33310 2863 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3424 3765 gene locus_tag LOCUS_33320 3424 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3799 5220 gene locus_tag LOCUS_33330 3799 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 5821 5390 gene locus_tag LOCUS_33340 5821 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 5918 6535 gene locus_tag LOCUS_33350 5918 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 6961 6578 gene locus_tag LOCUS_33360 6961 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 8734 7094 gene locus_tag LOCUS_33370 8734 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 9228 8764 gene locus_tag LOCUS_33380 9228 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence0295 695 12 gene locus_tag LOCUS_33390 695 12 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_33390 1250 852 gene locus_tag LOCUS_33400 1250 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 1608 1159 gene locus_tag LOCUS_33410 1608 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 2148 2588 gene locus_tag LOCUS_33420 2148 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 3434 2631 gene locus_tag LOCUS_33430 3434 2631 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969397.1 protein_id gnl|my_center|LOCUS_33430 4773 3652 gene locus_tag LOCUS_33440 4773 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 5894 4821 gene locus_tag LOCUS_33450 5894 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 6486 8603 gene locus_tag LOCUS_33460 6486 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 8828 8998 gene locus_tag LOCUS_33470 8828 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence0296 <1 558 gene locus_tag LOCUS_33480 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein 815 1675 gene locus_tag LOCUS_33490 815 1675 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_33490 3210 1849 gene locus_tag LOCUS_33500 3210 1849 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_33500 3330 4070 gene locus_tag LOCUS_33510 3330 4070 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_33510 6510 4180 gene locus_tag LOCUS_33520 6510 4180 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078404016.1 protein_id gnl|my_center|LOCUS_33520 6733 7371 gene locus_tag LOCUS_33530 6733 7371 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_33530 7612 8250 gene locus_tag LOCUS_33540 7612 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 8398 9081 gene locus_tag LOCUS_33550 8398 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533245.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence0297 798 67 gene locus_tag LOCUS_33560 798 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1284 844 gene locus_tag LOCUS_33570 1284 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 2225 1620 gene locus_tag LOCUS_33580 2225 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 2453 4201 gene locus_tag LOCUS_33590 2453 4201 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_33590 4481 5152 gene locus_tag LOCUS_33600 4481 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 5415 7811 gene locus_tag LOCUS_33610 5415 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 9037 8042 gene locus_tag LOCUS_33620 9037 8042 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921965.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence0298 <1 635 gene locus_tag LOCUS_33630 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081403079.1:formylglycine-generating enzyme family protein 2047 851 gene locus_tag LOCUS_33640 2047 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 5602 2585 gene locus_tag LOCUS_33650 5602 2585 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_33650 7148 5649 gene locus_tag LOCUS_33660 7148 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 8317 8586 gene locus_tag LOCUS_33670 8317 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence0299 1647 1189 gene locus_tag LOCUS_33680 1647 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 1835 1647 gene locus_tag LOCUS_33690 1835 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 2467 1874 gene locus_tag LOCUS_33700 2467 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3074 2508 gene locus_tag LOCUS_33710 3074 2508 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_33710 3314 3117 gene locus_tag LOCUS_33720 3314 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3852 3640 gene locus_tag LOCUS_33730 3852 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4253 3849 gene locus_tag LOCUS_33740 4253 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 5722 4274 gene locus_tag LOCUS_33750 5722 4274 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257998.1 protein_id gnl|my_center|LOCUS_33750 6188 5679 gene locus_tag LOCUS_33760 6188 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 6935 8839 gene locus_tag LOCUS_33770 6935 8839 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_33770 8889 9077 gene locus_tag LOCUS_33780 8889 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence0300 3067 3984 gene locus_tag LOCUS_33790 3067 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4448 4981 gene locus_tag LOCUS_33800 4448 4981 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120138.1 protein_id gnl|my_center|LOCUS_33800 4981 6756 gene locus_tag LOCUS_33810 4981 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 6967 8997 gene locus_tag LOCUS_33820 6967 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence0301 1287 478 gene locus_tag LOCUS_33830 1287 478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122369.1 protein_id gnl|my_center|LOCUS_33830 3143 1575 gene locus_tag LOCUS_33840 3143 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 5161 3134 gene locus_tag LOCUS_33850 5161 3134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122606.1 protein_id gnl|my_center|LOCUS_33850 5845 6066 gene locus_tag LOCUS_33860 5845 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 6258 6512 gene locus_tag LOCUS_33870 gene rpmE 6258 6512 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_33870 6886 7977 gene locus_tag LOCUS_33880 gene prfA 6886 7977 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_33880 8037 8900 gene locus_tag LOCUS_33890 gene prmC 8037 8900 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence0302 91 1491 gene locus_tag LOCUS_33900 91 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 1635 2837 gene locus_tag LOCUS_33910 1635 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 2923 4749 gene locus_tag LOCUS_33920 2923 4749 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_33920 4987 6078 gene locus_tag LOCUS_33930 4987 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 6240 8306 gene locus_tag LOCUS_33940 6240 8306 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260110.1 protein_id gnl|my_center|LOCUS_33940 8598 8942 gene locus_tag LOCUS_33950 8598 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence0303 4168 92 gene locus_tag LOCUS_33960 4168 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 5085 4342 gene locus_tag LOCUS_33970 5085 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 5674 5072 gene locus_tag LOCUS_33980 5674 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 6884 5658 gene locus_tag LOCUS_33990 6884 5658 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_33990 7382 7062 gene locus_tag LOCUS_34000 7382 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 7623 7853 gene locus_tag LOCUS_34010 7623 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence0304 2510 270 gene locus_tag LOCUS_34020 2510 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3794 2556 gene locus_tag LOCUS_34030 3794 2556 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921329.1 protein_id gnl|my_center|LOCUS_34030 4982 3978 gene locus_tag LOCUS_34040 4982 3978 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_34040 5556 5092 gene locus_tag LOCUS_34050 5556 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 5920 5588 gene locus_tag LOCUS_34060 5920 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 6384 5908 gene locus_tag LOCUS_34070 6384 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 <9030 6381 gene locus_tag LOCUS_34080 <9030 6381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922518.1:VWA domain-containing protein >Feature sequence0305 2650 515 gene locus_tag LOCUS_34090 gene recG 2650 515 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_34090 4415 2625 gene locus_tag LOCUS_34100 4415 2625 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922444.1 protein_id gnl|my_center|LOCUS_34100 5278 4439 gene locus_tag LOCUS_34110 gene mutM 5278 4439 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_34110 5424 6635 gene locus_tag LOCUS_34120 gene trpB 5424 6635 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_34120 6668 7258 gene locus_tag LOCUS_34130 6668 7258 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_34130 7255 7467 gene locus_tag LOCUS_34140 7255 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 7507 7944 gene locus_tag LOCUS_34150 7507 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 7998 8999 gene locus_tag LOCUS_34160 gene trpA 7998 8999 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence0306 2712 1327 gene locus_tag LOCUS_34170 2712 1327 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122712.1 protein_id gnl|my_center|LOCUS_34170 6003 2866 gene locus_tag LOCUS_34180 6003 2866 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122713.1 protein_id gnl|my_center|LOCUS_34180 6556 6230 gene locus_tag LOCUS_34190 6556 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 6822 7085 gene locus_tag LOCUS_34200 6822 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 7334 8893 gene locus_tag LOCUS_34210 7334 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 >Feature sequence0307 178 1566 gene locus_tag LOCUS_34220 178 1566 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_34220 1684 2757 gene locus_tag LOCUS_34230 gene dcyD 1684 2757 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096021.1 protein_id gnl|my_center|LOCUS_34230 2991 6113 gene locus_tag LOCUS_34240 2991 6113 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020247.1 protein_id gnl|my_center|LOCUS_34240 6200 7066 gene locus_tag LOCUS_34250 6200 7066 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_34250 8448 7114 gene locus_tag LOCUS_34260 8448 7114 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence0308 602 967 gene locus_tag LOCUS_34270 602 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 2874 1024 gene locus_tag LOCUS_34280 2874 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 3042 4433 gene locus_tag LOCUS_34290 3042 4433 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_34290 4573 5646 gene locus_tag LOCUS_34300 4573 5646 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984026.1 protein_id gnl|my_center|LOCUS_34300 8072 5655 gene locus_tag LOCUS_34310 8072 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence0309 <1 850 gene locus_tag LOCUS_34320 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259389.1:lactate racemase domain-containing protein 1681 923 gene locus_tag LOCUS_34330 gene ispD 1681 923 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_34330 2174 1836 gene locus_tag LOCUS_34340 2174 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 2626 3390 gene locus_tag LOCUS_34350 2626 3390 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_34350 3524 4330 gene locus_tag LOCUS_34360 3524 4330 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_34360 5837 4284 gene locus_tag LOCUS_34370 5837 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 6057 5848 gene locus_tag LOCUS_34380 6057 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 7678 6188 gene locus_tag LOCUS_34390 7678 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 8206 7694 gene locus_tag LOCUS_34400 8206 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 8612 8289 gene locus_tag LOCUS_34410 8612 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence0310 587 102 gene locus_tag LOCUS_34420 587 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 1096 2364 gene locus_tag LOCUS_34430 1096 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 2531 5056 gene locus_tag LOCUS_34440 2531 5056 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_34440 5221 6774 gene locus_tag LOCUS_34450 5221 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 7585 6860 gene locus_tag LOCUS_34460 7585 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 8405 7620 gene locus_tag LOCUS_34470 8405 7620 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence0311 117 491 gene locus_tag LOCUS_34480 117 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 766 1563 gene locus_tag LOCUS_34490 766 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 3039 1714 gene locus_tag LOCUS_34500 3039 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 4229 3180 gene locus_tag LOCUS_34510 4229 3180 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_34510 4486 5904 gene locus_tag LOCUS_34520 4486 5904 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_34520 6200 7576 gene locus_tag LOCUS_34530 6200 7576 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence0312 624 1331 gene locus_tag LOCUS_34540 624 1331 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_34540 1484 2524 gene locus_tag LOCUS_34550 1484 2524 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122163.1 protein_id gnl|my_center|LOCUS_34550 2873 4576 gene locus_tag LOCUS_34560 2873 4576 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_34560 5030 6178 gene locus_tag LOCUS_34570 5030 6178 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_34570 7021 8889 gene locus_tag LOCUS_34580 7021 8889 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence0313 1898 1023 gene locus_tag LOCUS_34590 1898 1023 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338658.1 protein_id gnl|my_center|LOCUS_34590 2954 2019 gene locus_tag LOCUS_34600 2954 2019 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_34600 3692 3093 gene locus_tag LOCUS_34610 3692 3093 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926060.1 protein_id gnl|my_center|LOCUS_34610 8089 3743 gene locus_tag LOCUS_34620 8089 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 <8916 8273 gene locus_tag LOCUS_34630 <8916 8273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922102.1:sigma-70 family RNA polymerase sigma factor >Feature sequence0314 <1 4637 gene locus_tag LOCUS_34640 <1 4637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein 4656 5129 gene locus_tag LOCUS_34650 4656 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 5917 7995 gene locus_tag LOCUS_34660 5917 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence0315 1061 183 gene locus_tag LOCUS_34670 1061 183 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921623.1 protein_id gnl|my_center|LOCUS_34670 1295 2473 gene locus_tag LOCUS_34680 1295 2473 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_34680 2684 2493 gene locus_tag LOCUS_34690 2684 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3033 3542 gene locus_tag LOCUS_34700 3033 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3539 4087 gene locus_tag LOCUS_34710 3539 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 4222 5403 gene locus_tag LOCUS_34720 4222 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 5556 7208 gene locus_tag LOCUS_34730 5556 7208 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_34730 7250 7483 gene locus_tag LOCUS_34740 7250 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 7508 7930 gene locus_tag LOCUS_34750 7508 7930 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_34750 7923 8837 gene locus_tag LOCUS_34760 gene meaB 7923 8837 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 protein_id gnl|my_center|LOCUS_34760 >Feature sequence0316 1925 351 gene locus_tag LOCUS_34770 1925 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118733.1 protein_id gnl|my_center|LOCUS_34770 2254 4941 gene locus_tag LOCUS_34780 2254 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 4960 5781 gene locus_tag LOCUS_34790 4960 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 6086 6634 gene locus_tag LOCUS_34800 6086 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 <8894 6830 gene locus_tag LOCUS_34810 <8894 6830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942181.1:exodeoxyribonuclease V subunit beta >Feature sequence0317 1096 86 gene locus_tag LOCUS_34820 1096 86 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_34820 1016 1396 gene locus_tag LOCUS_34830 1016 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 1947 1399 gene locus_tag LOCUS_34840 1947 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 2075 2815 gene locus_tag LOCUS_34850 2075 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 4239 2836 gene locus_tag LOCUS_34860 gene pfp 4239 2836 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_34860 4628 5134 gene locus_tag LOCUS_34870 4628 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 5427 6119 gene locus_tag LOCUS_34880 5427 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 6712 6167 gene locus_tag LOCUS_34890 6712 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 7030 8088 gene locus_tag LOCUS_34900 7030 8088 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331256.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence0318 1014 3305 gene locus_tag LOCUS_34910 1014 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 4362 3310 gene locus_tag LOCUS_34920 gene mtnA 4362 3310 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_34920 5161 4388 gene locus_tag LOCUS_34930 5161 4388 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_34930 6545 5253 gene locus_tag LOCUS_34940 6545 5253 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_34940 7405 6659 gene locus_tag LOCUS_34950 7405 6659 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_34950 7536 7916 gene locus_tag LOCUS_34960 7536 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 8012 8728 gene locus_tag LOCUS_34970 8012 8728 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence0319 1924 53 gene locus_tag LOCUS_34980 1924 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 2882 1929 gene locus_tag LOCUS_34990 2882 1929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_34990 3206 4963 gene locus_tag LOCUS_35000 3206 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122727.1 protein_id gnl|my_center|LOCUS_35000 5529 5053 gene locus_tag LOCUS_35010 5529 5053 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_35010 8047 5564 gene locus_tag LOCUS_35020 gene mutS 8047 5564 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_35020 8579 8124 gene locus_tag LOCUS_35030 8579 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence0320 152 1471 gene locus_tag LOCUS_35040 152 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2139 1474 gene locus_tag LOCUS_35050 2139 1474 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_35050 3566 2226 gene locus_tag LOCUS_35060 3566 2226 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_35060 6198 3805 gene locus_tag LOCUS_35070 6198 3805 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_35070 7278 6760 gene locus_tag LOCUS_35080 7278 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 >Feature sequence0321 2617 2348 gene locus_tag LOCUS_35090 gene rpsO 2617 2348 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_35090 4238 2808 gene locus_tag LOCUS_35100 4238 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 5295 4357 gene locus_tag LOCUS_35110 5295 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 6068 5406 gene locus_tag LOCUS_35120 6068 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 8033 6111 gene locus_tag LOCUS_35130 8033 6111 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_35130 8617 8060 gene locus_tag LOCUS_35140 8617 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence0322 1153 38 gene locus_tag LOCUS_35150 1153 38 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_35150 1427 1167 gene locus_tag LOCUS_35160 1427 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 1703 3844 gene locus_tag LOCUS_35170 1703 3844 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_35170 3982 4329 gene locus_tag LOCUS_35180 3982 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4566 6821 gene locus_tag LOCUS_35190 4566 6821 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_35190 6925 8250 gene locus_tag LOCUS_35200 6925 8250 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence0323 1895 9 gene locus_tag LOCUS_35210 1895 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 4017 2029 gene locus_tag LOCUS_35220 4017 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 4242 5306 gene locus_tag LOCUS_35230 4242 5306 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119542.1 protein_id gnl|my_center|LOCUS_35230 5330 6292 gene locus_tag LOCUS_35240 5330 6292 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_35240 6371 6739 gene locus_tag LOCUS_35250 6371 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 7646 6870 gene locus_tag LOCUS_35260 7646 6870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_35260 <8770 7730 gene locus_tag LOCUS_35270 <8770 7730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868896.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence0324 3006 274 gene locus_tag LOCUS_35280 3006 274 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393289.1 protein_id gnl|my_center|LOCUS_35280 4196 3003 gene locus_tag LOCUS_35290 4196 3003 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870412.1 protein_id gnl|my_center|LOCUS_35290 4470 7736 gene locus_tag LOCUS_35300 4470 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence0325 <1 3914 gene locus_tag LOCUS_35310 <1 3914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921931.1:chromosome segregation protein SMC 5686 4022 gene locus_tag LOCUS_35320 5686 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 6462 5737 gene locus_tag LOCUS_35330 6462 5737 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888515.1 protein_id gnl|my_center|LOCUS_35330 7597 6587 gene locus_tag LOCUS_35340 7597 6587 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_35340 7823 8662 gene locus_tag LOCUS_35350 7823 8662 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838432.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence0326 276 977 gene locus_tag LOCUS_35360 276 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 1059 1418 gene locus_tag LOCUS_35370 1059 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 1644 1829 gene locus_tag LOCUS_35380 1644 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 1877 3361 gene locus_tag LOCUS_35390 1877 3361 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_35390 3385 3744 gene locus_tag LOCUS_35400 3385 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 3861 4814 gene locus_tag LOCUS_35410 3861 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 4798 5046 gene locus_tag LOCUS_35420 4798 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 5362 6786 gene locus_tag LOCUS_35430 5362 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 6885 7097 gene locus_tag LOCUS_35440 6885 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 7169 7360 gene locus_tag LOCUS_35450 7169 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 7456 7644 gene locus_tag LOCUS_35460 7456 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 7873 8556 gene locus_tag LOCUS_35470 7873 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 >Feature sequence0327 <1 767 gene locus_tag LOCUS_35480 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030640.1:glycogen debranching protein GlgX 2453 1065 gene locus_tag LOCUS_35490 2453 1065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967746.1 protein_id gnl|my_center|LOCUS_35490 3518 2559 gene locus_tag LOCUS_35500 3518 2559 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417760.1 protein_id gnl|my_center|LOCUS_35500 3737 4573 gene locus_tag LOCUS_35510 3737 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 5153 4653 gene locus_tag LOCUS_35520 5153 4653 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_35520 5772 5344 gene locus_tag LOCUS_35530 5772 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 6177 6602 gene locus_tag LOCUS_35540 6177 6602 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243551.1 protein_id gnl|my_center|LOCUS_35540 6891 6571 gene locus_tag LOCUS_35550 6891 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 8312 6930 gene locus_tag LOCUS_35560 8312 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence0328 1281 37 gene locus_tag LOCUS_35570 1281 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 2155 1391 gene locus_tag LOCUS_35580 2155 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3005 2502 gene locus_tag LOCUS_35590 3005 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 4009 3002 gene locus_tag LOCUS_35600 4009 3002 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_35600 3972 4238 gene locus_tag LOCUS_35610 3972 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 5218 4193 gene locus_tag LOCUS_35620 5218 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 6377 5259 gene locus_tag LOCUS_35630 6377 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 7501 6506 gene locus_tag LOCUS_35640 7501 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 <8740 8142 gene locus_tag LOCUS_35650 <8740 8142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793004.1:MFS transporter >Feature sequence0329 1 2157 gene locus_tag LOCUS_35660 1 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2190 2837 gene locus_tag LOCUS_35670 2190 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3006 4223 gene locus_tag LOCUS_35680 3006 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4220 8428 gene locus_tag LOCUS_35690 4220 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence0330 3276 4949 gene locus_tag LOCUS_35700 3276 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 5013 5678 gene locus_tag LOCUS_35710 5013 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 5938 7020 gene locus_tag LOCUS_35720 5938 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 7406 8485 gene locus_tag LOCUS_35730 gene recA 7406 8485 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence0331 3034 1274 gene locus_tag LOCUS_35740 3034 1274 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813188.1 protein_id gnl|my_center|LOCUS_35740 3194 4357 gene locus_tag LOCUS_35750 3194 4357 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_35750 5245 4472 gene locus_tag LOCUS_35760 5245 4472 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_35760 6882 5380 gene locus_tag LOCUS_35770 6882 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence0332 3509 4120 gene locus_tag LOCUS_35780 3509 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4208 4864 gene locus_tag LOCUS_35790 4208 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 5782 4877 gene locus_tag LOCUS_35800 5782 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 6722 5877 gene locus_tag LOCUS_35810 6722 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 7589 6759 gene locus_tag LOCUS_35820 7589 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 8337 7579 gene locus_tag LOCUS_35830 8337 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence0333 120 2876 gene locus_tag LOCUS_35840 120 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3153 4304 gene locus_tag LOCUS_35850 3153 4304 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_35850 5177 4377 gene locus_tag LOCUS_35860 5177 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 6081 5314 gene locus_tag LOCUS_35870 6081 5314 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_35870 6424 7425 gene locus_tag LOCUS_35880 6424 7425 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_35880 7472 8545 gene locus_tag LOCUS_35890 gene queG 7472 8545 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence0334 939 787 gene locus_tag LOCUS_35900 939 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 1561 1043 gene locus_tag LOCUS_35910 1561 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2515 1640 gene locus_tag LOCUS_35920 2515 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3576 3944 gene locus_tag LOCUS_35930 3576 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4120 4311 gene locus_tag LOCUS_35940 4120 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 5568 4528 gene locus_tag LOCUS_35950 5568 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 8414 5970 gene locus_tag LOCUS_35960 8414 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence0335 8509 176 gene locus_tag LOCUS_35970 8509 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence0336 746 1747 gene locus_tag LOCUS_35980 746 1747 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_35980 1917 2354 gene locus_tag LOCUS_35990 1917 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2448 2855 gene locus_tag LOCUS_36000 2448 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 2931 3533 gene locus_tag LOCUS_36010 2931 3533 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889480.1 protein_id gnl|my_center|LOCUS_36010 3610 4239 gene locus_tag LOCUS_36020 3610 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296439.1 protein_id gnl|my_center|LOCUS_36020 4379 5557 gene locus_tag LOCUS_36030 4379 5557 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120019338.1 protein_id gnl|my_center|LOCUS_36030 6086 6472 gene locus_tag LOCUS_36040 6086 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 6561 7163 gene locus_tag LOCUS_36050 6561 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 8256 8564 gene locus_tag LOCUS_36060 8256 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence0337 16 423 gene locus_tag LOCUS_36070 16 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 470 2110 gene locus_tag LOCUS_36080 470 2110 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970122.1 protein_id gnl|my_center|LOCUS_36080 2185 3261 gene locus_tag LOCUS_36090 2185 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_36090 3374 4579 gene locus_tag LOCUS_36100 3374 4579 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970121.1 protein_id gnl|my_center|LOCUS_36100 4661 5086 gene locus_tag LOCUS_36110 gene aroH 4661 5086 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_36110 6433 5222 gene locus_tag LOCUS_36120 gene tyrS 6433 5222 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_36120 7041 6448 gene locus_tag LOCUS_36130 7041 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 7497 7081 gene locus_tag LOCUS_36140 7497 7081 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_36140 8020 7592 gene locus_tag LOCUS_36150 gene rplS 8020 7592 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_36150 <8608 8017 gene locus_tag LOCUS_36160 <8608 8017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123923.1:tRNA (guanosine(37)-N1)-methyltransferase TrmD >Feature sequence0338 1520 105 gene locus_tag LOCUS_36170 1520 105 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460058.1 protein_id gnl|my_center|LOCUS_36170 3028 1670 gene locus_tag LOCUS_36180 3028 1670 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529380.1 protein_id gnl|my_center|LOCUS_36180 4442 3261 gene locus_tag LOCUS_36190 4442 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 5059 4526 gene locus_tag LOCUS_36200 5059 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 5651 5169 gene locus_tag LOCUS_36210 gene greA 5651 5169 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_36210 6670 5951 gene locus_tag LOCUS_36220 6670 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 7192 8292 gene locus_tag LOCUS_36230 7192 8292 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090184.1 protein_id gnl|my_center|LOCUS_36230 >Feature sequence0339 219 1652 gene locus_tag LOCUS_36240 219 1652 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_36240 2450 1737 gene locus_tag LOCUS_36250 2450 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 2782 3312 gene locus_tag LOCUS_36260 2782 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 4085 3534 gene locus_tag LOCUS_36270 4085 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 5905 4436 gene locus_tag LOCUS_36280 gene purB 5905 4436 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_36280 6156 6464 gene locus_tag LOCUS_36290 6156 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 <8556 7156 gene locus_tag LOCUS_36300 <8556 7156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203365.1:VWA domain-containing protein >Feature sequence0340 236 3670 gene locus_tag LOCUS_36310 236 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3677 7045 gene locus_tag LOCUS_36320 3677 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence0341 641 1885 gene locus_tag LOCUS_36330 641 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 3433 2081 gene locus_tag LOCUS_36340 3433 2081 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_36340 4520 3615 gene locus_tag LOCUS_36350 gene fabD 4520 3615 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_36350 5627 4614 gene locus_tag LOCUS_36360 gene plsX 5627 4614 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_36360 5819 5631 gene locus_tag LOCUS_36370 gene rpmF 5819 5631 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290970.1 protein_id gnl|my_center|LOCUS_36370 5998 6498 gene locus_tag LOCUS_36380 5998 6498 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_36380 6593 7693 gene locus_tag LOCUS_36390 6593 7693 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_36390 7733 8527 gene locus_tag LOCUS_36400 7733 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence0342 585 124 gene locus_tag LOCUS_36410 585 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 896 2509 gene locus_tag LOCUS_36420 896 2509 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615418.1 protein_id gnl|my_center|LOCUS_36420 2558 4075 gene locus_tag LOCUS_36430 2558 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 4172 5269 gene locus_tag LOCUS_36440 gene dusB 4172 5269 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_36440 5857 5285 gene locus_tag LOCUS_36450 5857 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 8105 5952 gene locus_tag LOCUS_36460 gene fadB 8105 5952 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815377.1 protein_id gnl|my_center|LOCUS_36460 >Feature sequence0343 758 405 gene locus_tag LOCUS_36470 758 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 1148 843 gene locus_tag LOCUS_36480 1148 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 1496 1164 gene locus_tag LOCUS_36490 1496 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 1825 1523 gene locus_tag LOCUS_36500 1825 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 2231 1965 gene locus_tag LOCUS_36510 2231 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 2517 2293 gene locus_tag LOCUS_36520 2517 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 2792 2544 gene locus_tag LOCUS_36530 2792 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 3370 2858 gene locus_tag LOCUS_36540 3370 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3706 3984 gene locus_tag LOCUS_36550 3706 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 4015 4368 gene locus_tag LOCUS_36560 4015 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 4467 4649 gene locus_tag LOCUS_36570 4467 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 4808 5317 gene locus_tag LOCUS_36580 4808 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 5338 6195 gene locus_tag LOCUS_36590 5338 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 6875 6282 gene locus_tag LOCUS_36600 6875 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 7448 6924 gene locus_tag LOCUS_36610 7448 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 7839 7630 gene locus_tag LOCUS_36620 7839 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence0344 199 1539 gene locus_tag LOCUS_36630 199 1539 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_36630 1692 2222 gene locus_tag LOCUS_36640 1692 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2267 3631 gene locus_tag LOCUS_36650 2267 3631 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_36650 3745 5601 gene locus_tag LOCUS_36660 3745 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 5652 6554 gene locus_tag LOCUS_36670 5652 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 7237 6557 gene locus_tag LOCUS_36680 7237 6557 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_36680 7409 8449 gene locus_tag LOCUS_36690 7409 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 >Feature sequence0345 1581 1135 gene locus_tag LOCUS_36700 1581 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 2103 2738 gene locus_tag LOCUS_36710 2103 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 2895 8339 gene locus_tag LOCUS_36720 2895 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence0346 1875 190 gene locus_tag LOCUS_36730 1875 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 3337 1865 gene locus_tag LOCUS_36740 gene guaB 3337 1865 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_36740 4091 3684 gene locus_tag LOCUS_36750 4091 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 4208 5800 gene locus_tag LOCUS_36760 gene glpD 4208 5800 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_36760 6035 6658 gene locus_tag LOCUS_36770 6035 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 6830 6743 gene locus_tag LOCUS_t00360 6830 6743 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6991 7374 gene locus_tag LOCUS_36780 6991 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 >Feature sequence0347 1703 2431 gene locus_tag LOCUS_36790 1703 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3020 2661 gene locus_tag LOCUS_36800 3020 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325780.1 protein_id gnl|my_center|LOCUS_36800 3649 3017 gene locus_tag LOCUS_36810 3649 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 7424 3837 gene locus_tag LOCUS_36820 7424 3837 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_36820 8102 7431 gene locus_tag LOCUS_36830 8102 7431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_36830 8446 8111 gene locus_tag LOCUS_36840 8446 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence0348 362 1846 gene locus_tag LOCUS_36850 362 1846 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_36850 2010 2408 gene locus_tag LOCUS_36860 2010 2408 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_36860 2703 6902 gene locus_tag LOCUS_36870 2703 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 6899 7945 gene locus_tag LOCUS_36880 6899 7945 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_36880 8053 8388 gene locus_tag LOCUS_36890 8053 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence0349 <1 1177 gene locus_tag LOCUS_36900 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259747.1:type I DNA topoisomerase 2140 1232 gene locus_tag LOCUS_36910 2140 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 3507 2251 gene locus_tag LOCUS_36920 3507 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 3596 4546 gene locus_tag LOCUS_36930 3596 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 7005 4621 gene locus_tag LOCUS_36940 7005 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 <8440 7230 gene locus_tag LOCUS_36950 <8440 7230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118448.1:isochorismatase family protein >Feature sequence0350 1484 51 gene locus_tag LOCUS_36960 1484 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2823 1714 gene locus_tag LOCUS_36970 2823 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 3491 5872 gene locus_tag LOCUS_36980 3491 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 7412 5952 gene locus_tag LOCUS_36990 7412 5952 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_36990 7776 7396 gene locus_tag LOCUS_37000 7776 7396 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052031444.1 protein_id gnl|my_center|LOCUS_37000 >Feature sequence0351 1077 397 gene locus_tag LOCUS_37010 1077 397 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_37010 1504 1157 gene locus_tag LOCUS_37020 gene ndoA 1504 1157 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_37020 1740 1504 gene locus_tag LOCUS_37030 1740 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4278 1741 gene locus_tag LOCUS_37040 4278 1741 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_37040 5764 4571 gene locus_tag LOCUS_37050 5764 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 6591 7097 gene locus_tag LOCUS_37060 6591 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 >Feature sequence0352 355 4956 gene locus_tag LOCUS_37070 gene gltB 355 4956 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_37070 5002 5772 gene locus_tag LOCUS_37080 5002 5772 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_37080 5814 7301 gene locus_tag LOCUS_37090 5814 7301 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence0353 1696 1085 gene locus_tag LOCUS_37100 1696 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 1780 1995 gene locus_tag LOCUS_37110 1780 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 3422 1884 gene locus_tag LOCUS_37120 3422 1884 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_37120 4591 6549 gene locus_tag LOCUS_37130 4591 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence0354 1054 203 gene locus_tag LOCUS_37140 1054 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 1164 3689 gene locus_tag LOCUS_37150 1164 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3958 5484 gene locus_tag LOCUS_37160 3958 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 5930 5511 gene locus_tag LOCUS_37170 gene arfB 5930 5511 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_37170 6225 5998 gene locus_tag LOCUS_37180 6225 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 6116 7744 gene locus_tag LOCUS_37190 6116 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 7812 8174 gene locus_tag LOCUS_37200 7812 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence0355 128 1459 gene locus_tag LOCUS_37210 128 1459 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332063.1 protein_id gnl|my_center|LOCUS_37210 1473 3161 gene locus_tag LOCUS_37220 1473 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 3526 4704 gene locus_tag LOCUS_37230 3526 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 4825 5610 gene locus_tag LOCUS_37240 4825 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 5888 6808 gene locus_tag LOCUS_37250 5888 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 7235 8278 gene locus_tag LOCUS_37260 7235 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 >Feature sequence0356 784 533 gene locus_tag LOCUS_37270 784 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 1694 792 gene locus_tag LOCUS_37280 1694 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3681 1711 gene locus_tag LOCUS_37290 3681 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 4583 3852 gene locus_tag LOCUS_37300 4583 3852 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392253.1 protein_id gnl|my_center|LOCUS_37300 4674 5183 gene locus_tag LOCUS_37310 4674 5183 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141970.1 protein_id gnl|my_center|LOCUS_37310 5274 5699 gene locus_tag LOCUS_37320 5274 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 5729 6487 gene locus_tag LOCUS_37330 5729 6487 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_37330 6517 6939 gene locus_tag LOCUS_37340 6517 6939 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327433.1 protein_id gnl|my_center|LOCUS_37340 6956 7444 gene locus_tag LOCUS_37350 6956 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 >Feature sequence0357 685 972 gene locus_tag LOCUS_37360 685 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 1496 2428 gene locus_tag LOCUS_37370 1496 2428 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_37370 2741 3109 gene locus_tag LOCUS_37380 gene rnpA 2741 3109 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458485.1 protein_id gnl|my_center|LOCUS_37380 3106 3348 gene locus_tag LOCUS_37390 3106 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 3345 3761 gene locus_tag LOCUS_37400 3345 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 3811 4533 gene locus_tag LOCUS_37410 3811 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4619 4936 gene locus_tag LOCUS_37420 4619 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 5095 5850 gene locus_tag LOCUS_37430 5095 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 5866 6618 gene locus_tag LOCUS_37440 5866 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 6615 7502 gene locus_tag LOCUS_37450 6615 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 7850 7587 gene locus_tag LOCUS_37460 7850 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 8074 7865 gene locus_tag LOCUS_37470 8074 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence0358 15 2426 gene locus_tag LOCUS_37480 15 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2529 3140 gene locus_tag LOCUS_37490 2529 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 5063 3348 gene locus_tag LOCUS_37500 5063 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 5259 6455 gene locus_tag LOCUS_37510 5259 6455 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669535.1 protein_id gnl|my_center|LOCUS_37510 6470 6970 gene locus_tag LOCUS_37520 6470 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 7074 7652 gene locus_tag LOCUS_37530 7074 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence0359 <1 1704 gene locus_tag LOCUS_37540 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942708.1:glycogen/starch/alpha-glucan phosphorylase 3062 1713 gene locus_tag LOCUS_37550 3062 1713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_37550 4583 3732 gene locus_tag LOCUS_37560 4583 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 6167 4635 gene locus_tag LOCUS_37570 6167 4635 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_37570 >Feature sequence0360 1935 448 gene locus_tag LOCUS_37580 1935 448 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_37580 2324 4105 gene locus_tag LOCUS_37590 gene treZ 2324 4105 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_37590 4356 5384 gene locus_tag LOCUS_37600 4356 5384 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_37600 5594 6652 gene locus_tag LOCUS_37610 5594 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 6972 7056 gene locus_tag LOCUS_t00370 6972 7056 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0361 353 949 gene locus_tag LOCUS_37620 353 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 2023 1115 gene locus_tag LOCUS_37630 2023 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 2127 2561 gene locus_tag LOCUS_37640 2127 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 2589 3368 gene locus_tag LOCUS_37650 2589 3368 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_37650 3398 4162 gene locus_tag LOCUS_37660 3398 4162 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921554.1 protein_id gnl|my_center|LOCUS_37660 4920 4297 gene locus_tag LOCUS_37670 4920 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 6355 4946 gene locus_tag LOCUS_37680 6355 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence0362 129 632 gene locus_tag LOCUS_37690 129 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 637 828 gene locus_tag LOCUS_37700 637 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 844 1629 gene locus_tag LOCUS_37710 844 1629 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235568.1 protein_id gnl|my_center|LOCUS_37710 1708 5460 gene locus_tag LOCUS_37720 1708 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 5491 8247 gene locus_tag LOCUS_37730 5491 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence0363 <1 928 gene locus_tag LOCUS_37740 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922522.1:sulfatase-like hydrolase/transferase 979 1260 gene locus_tag LOCUS_37750 979 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 1503 1303 gene locus_tag LOCUS_37760 1503 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 1397 1792 gene locus_tag LOCUS_37770 1397 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 1789 3333 gene locus_tag LOCUS_37780 1789 3333 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_37780 3330 3863 gene locus_tag LOCUS_37790 3330 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3876 5345 gene locus_tag LOCUS_37800 3876 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 5342 7420 gene locus_tag LOCUS_37810 5342 7420 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_37810 >Feature sequence0364 193 1545 gene locus_tag LOCUS_37820 193 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 1655 2476 gene locus_tag LOCUS_37830 1655 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 2623 3918 gene locus_tag LOCUS_37840 2623 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4018 4461 gene locus_tag LOCUS_37850 4018 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4748 5596 gene locus_tag LOCUS_37860 4748 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 5814 6572 gene locus_tag LOCUS_37870 5814 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 7082 7486 gene locus_tag LOCUS_37880 7082 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 7571 7792 gene locus_tag LOCUS_37890 7571 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 7793 8197 gene locus_tag LOCUS_37900 7793 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 >Feature sequence0365 1671 94 gene locus_tag LOCUS_37910 1671 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3196 1796 gene locus_tag LOCUS_37920 3196 1796 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_37920 3307 4845 gene locus_tag LOCUS_37930 3307 4845 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_37930 8098 4883 gene locus_tag LOCUS_37940 8098 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence0366 1452 946 gene locus_tag LOCUS_37950 1452 946 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_37950 2316 1615 gene locus_tag LOCUS_37960 2316 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 2621 3598 gene locus_tag LOCUS_37970 2621 3598 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_37970 4195 3635 gene locus_tag LOCUS_37980 4195 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 5467 4481 gene locus_tag LOCUS_37990 5467 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 6298 5486 gene locus_tag LOCUS_38000 gene otsB 6298 5486 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392881.1 protein_id gnl|my_center|LOCUS_38000 7830 6295 gene locus_tag LOCUS_38010 7830 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 >Feature sequence0367 <1 1518 gene locus_tag LOCUS_38020 <1 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120407.1:recombinase family protein 1532 2101 gene locus_tag LOCUS_38030 1532 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 2133 2351 gene locus_tag LOCUS_38040 2133 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 2839 2465 gene locus_tag LOCUS_38050 2839 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 3311 4981 gene locus_tag LOCUS_38060 3311 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 5824 5192 gene locus_tag LOCUS_38070 5824 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 6774 6079 gene locus_tag LOCUS_38080 gene nfi 6774 6079 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_38080 7430 7176 gene locus_tag LOCUS_38090 7430 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence0368 1171 1380 gene locus_tag LOCUS_38100 1171 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 1514 2044 gene locus_tag LOCUS_38110 1514 2044 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_38110 2051 2965 gene locus_tag LOCUS_38120 2051 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 3014 3382 gene locus_tag LOCUS_38130 3014 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 3448 3633 gene locus_tag LOCUS_38140 3448 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 3724 4677 gene locus_tag LOCUS_38150 3724 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38150 5048 5509 gene locus_tag LOCUS_38160 5048 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 5607 6251 gene locus_tag LOCUS_38170 5607 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 7897 6608 gene locus_tag LOCUS_38180 7897 6608 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence0369 2993 741 gene locus_tag LOCUS_38190 2993 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 4950 3280 gene locus_tag LOCUS_38200 4950 3280 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_38200 5381 6208 gene locus_tag LOCUS_38210 5381 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 6382 8007 gene locus_tag LOCUS_38220 6382 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence0370 663 79 gene locus_tag LOCUS_38230 663 79 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 protein_id gnl|my_center|LOCUS_38230 801 2585 gene locus_tag LOCUS_38240 801 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 2633 2923 gene locus_tag LOCUS_38250 2633 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 2939 3694 gene locus_tag LOCUS_38260 2939 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 4191 3811 gene locus_tag LOCUS_38270 4191 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 5252 4362 gene locus_tag LOCUS_38280 5252 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 5923 5504 gene locus_tag LOCUS_38290 5923 5504 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_38290 7900 5933 gene locus_tag LOCUS_38300 7900 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence0371 <1 983 gene locus_tag LOCUS_38310 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391957.1:sugar kinase 1316 1861 gene locus_tag LOCUS_38320 1316 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 3488 1935 gene locus_tag LOCUS_38330 3488 1935 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 protein_id gnl|my_center|LOCUS_38330 3793 5223 gene locus_tag LOCUS_38340 gene ablA 3793 5223 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902142.1 protein_id gnl|my_center|LOCUS_38340 5220 6275 gene locus_tag LOCUS_38350 5220 6275 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_38350 6299 7405 gene locus_tag LOCUS_38360 6299 7405 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174672.1 protein_id gnl|my_center|LOCUS_38360 7488 8141 gene locus_tag LOCUS_38370 7488 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence0372 186 1265 gene locus_tag LOCUS_38380 gene bfmBAA 186 1265 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 protein_id gnl|my_center|LOCUS_38380 1470 1706 gene locus_tag LOCUS_38390 1470 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 1703 1999 gene locus_tag LOCUS_38400 1703 1999 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_38400 3438 2068 gene locus_tag LOCUS_38410 3438 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 4355 3435 gene locus_tag LOCUS_38420 4355 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 4582 7797 gene locus_tag LOCUS_38430 4582 7797 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence0373 951 238 gene locus_tag LOCUS_38440 951 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 1098 2015 gene locus_tag LOCUS_38450 1098 2015 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_38450 2424 2732 gene locus_tag LOCUS_38460 2424 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 2989 3531 gene locus_tag LOCUS_38470 2989 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 4827 4060 gene locus_tag LOCUS_38480 4827 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 5118 7940 gene locus_tag LOCUS_38490 5118 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 >Feature sequence0374 <1 1879 gene locus_tag LOCUS_38500 <1 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427762.1:valine--tRNA ligase 1882 2283 gene locus_tag LOCUS_38510 1882 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 2276 2710 gene locus_tag LOCUS_38520 2276 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 2937 3638 gene locus_tag LOCUS_38530 2937 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 3719 4453 gene locus_tag LOCUS_38540 3719 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 4878 4564 gene locus_tag LOCUS_38550 4878 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 >Feature sequence0375 1035 739 gene locus_tag LOCUS_38560 1035 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 1094 2026 gene locus_tag LOCUS_38570 1094 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 2059 3594 gene locus_tag LOCUS_38580 2059 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3648 4403 gene locus_tag LOCUS_38590 3648 4403 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129999477.1 protein_id gnl|my_center|LOCUS_38590 4681 5229 gene locus_tag LOCUS_38600 4681 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 5759 5538 gene locus_tag LOCUS_38610 5759 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 6017 5808 gene locus_tag LOCUS_38620 6017 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 6410 6063 gene locus_tag LOCUS_38630 6410 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 7872 6466 gene locus_tag LOCUS_38640 7872 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence0376 101 775 gene locus_tag LOCUS_38650 101 775 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035300.1 protein_id gnl|my_center|LOCUS_38650 924 2096 gene locus_tag LOCUS_38660 924 2096 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942021.1 protein_id gnl|my_center|LOCUS_38660 2152 2523 gene locus_tag LOCUS_38670 2152 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 2583 3119 gene locus_tag LOCUS_38680 2583 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 3175 3582 gene locus_tag LOCUS_38690 3175 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 3647 4081 gene locus_tag LOCUS_38700 3647 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 4451 5095 gene locus_tag LOCUS_38710 4451 5095 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119806.1 protein_id gnl|my_center|LOCUS_38710 5128 5934 gene locus_tag LOCUS_38720 5128 5934 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_38720 5976 6716 gene locus_tag LOCUS_38730 5976 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 7083 6736 gene locus_tag LOCUS_38740 7083 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 >Feature sequence0377 153 578 gene locus_tag LOCUS_38750 153 578 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_38750 668 1198 gene locus_tag LOCUS_38760 668 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 1251 4871 gene locus_tag LOCUS_38770 1251 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 5177 6517 gene locus_tag LOCUS_38780 5177 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 6652 7929 gene locus_tag LOCUS_38790 6652 7929 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_38790 >Feature sequence0378 1886 1041 gene locus_tag LOCUS_38800 1886 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 2854 1913 gene locus_tag LOCUS_38810 2854 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 4350 2995 gene locus_tag LOCUS_38820 4350 2995 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763236.1 protein_id gnl|my_center|LOCUS_38820 6066 4381 gene locus_tag LOCUS_38830 6066 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 7156 6107 gene locus_tag LOCUS_38840 7156 6107 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_38840 >Feature sequence0379 1554 658 gene locus_tag LOCUS_38850 1554 658 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229054.1 protein_id gnl|my_center|LOCUS_38850 2261 1608 gene locus_tag LOCUS_38860 2261 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2875 2318 gene locus_tag LOCUS_38870 2875 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4725 2872 gene locus_tag LOCUS_38880 4725 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 5528 4737 gene locus_tag LOCUS_38890 5528 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 6223 5540 gene locus_tag LOCUS_38900 6223 5540 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920766.1 protein_id gnl|my_center|LOCUS_38900 6769 6257 gene locus_tag LOCUS_38910 6769 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 7397 6897 gene locus_tag LOCUS_38920 7397 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 7850 7413 gene locus_tag LOCUS_38930 7850 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence0380 433 1326 gene locus_tag LOCUS_38940 433 1326 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898971.1 protein_id gnl|my_center|LOCUS_38940 1363 2616 gene locus_tag LOCUS_38950 1363 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 2632 3186 gene locus_tag LOCUS_38960 2632 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4337 3279 gene locus_tag LOCUS_38970 4337 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 4414 6225 gene locus_tag LOCUS_38980 4414 6225 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_38980 6769 6230 gene locus_tag LOCUS_38990 gene msrA 6769 6230 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_38990 7942 7001 gene locus_tag LOCUS_39000 7942 7001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence0381 530 1621 gene locus_tag LOCUS_39010 530 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 2034 3365 gene locus_tag LOCUS_39020 2034 3365 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_39020 3921 3436 gene locus_tag LOCUS_39030 3921 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 4415 4876 gene locus_tag LOCUS_39040 4415 4876 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_39040 4873 5247 gene locus_tag LOCUS_39050 4873 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 5492 6397 gene locus_tag LOCUS_39060 5492 6397 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_39060 6681 7706 gene locus_tag LOCUS_39070 6681 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 >Feature sequence0382 <1 2132 gene locus_tag LOCUS_39080 <1 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L 2441 4291 gene locus_tag LOCUS_39090 2441 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 4398 6188 gene locus_tag LOCUS_39100 4398 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 6185 6637 gene locus_tag LOCUS_39110 6185 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 6618 7427 gene locus_tag LOCUS_39120 6618 7427 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118949.1 protein_id gnl|my_center|LOCUS_39120 >Feature sequence0383 116 1576 gene locus_tag LOCUS_39130 116 1576 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_39130 1961 1605 gene locus_tag LOCUS_39140 1961 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 2749 1985 gene locus_tag LOCUS_39150 2749 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 4756 2759 gene locus_tag LOCUS_39160 4756 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 5255 4791 gene locus_tag LOCUS_39170 5255 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 6367 5381 gene locus_tag LOCUS_39180 6367 5381 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_39180 7876 6494 gene locus_tag LOCUS_39190 7876 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 >Feature sequence0384 395 132 gene locus_tag LOCUS_39200 395 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 2221 314 gene locus_tag LOCUS_39210 2221 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 2820 2218 gene locus_tag LOCUS_39220 2820 2218 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616165.1 protein_id gnl|my_center|LOCUS_39220 3221 7927 gene locus_tag LOCUS_39230 3221 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence0385 3050 1410 gene locus_tag LOCUS_39240 3050 1410 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_39240 3195 3659 gene locus_tag LOCUS_39250 3195 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 5157 3589 gene locus_tag LOCUS_39260 5157 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 5484 7958 gene locus_tag LOCUS_39270 5484 7958 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_39270 >Feature sequence0386 <1 1205 gene locus_tag LOCUS_39280 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921302.1:DUF1501 domain-containing protein 1403 1951 gene locus_tag LOCUS_39290 1403 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 2300 2527 gene locus_tag LOCUS_39300 2300 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 3280 2564 gene locus_tag LOCUS_39310 3280 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 3482 4369 gene locus_tag LOCUS_39320 3482 4369 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_39320 4445 5347 gene locus_tag LOCUS_39330 4445 5347 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_39330 6498 5530 gene locus_tag LOCUS_39340 6498 5530 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921653.1 protein_id gnl|my_center|LOCUS_39340 7233 6589 gene locus_tag LOCUS_39350 7233 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 7924 7244 gene locus_tag LOCUS_39360 7924 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence0387 2227 1010 gene locus_tag LOCUS_39370 2227 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 2665 2243 gene locus_tag LOCUS_39380 2665 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 2952 3617 gene locus_tag LOCUS_39390 2952 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 3622 4059 gene locus_tag LOCUS_39400 3622 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 4424 4047 gene locus_tag LOCUS_39410 4424 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 4893 4435 gene locus_tag LOCUS_39420 4893 4435 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_39420 5594 4875 gene locus_tag LOCUS_39430 5594 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39430 7806 5668 gene locus_tag LOCUS_39440 7806 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence0388 844 1416 gene locus_tag LOCUS_39450 844 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615849.1 protein_id gnl|my_center|LOCUS_39450 2276 1530 gene locus_tag LOCUS_39460 2276 1530 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336481.1 protein_id gnl|my_center|LOCUS_39460 4075 2774 gene locus_tag LOCUS_39470 4075 2774 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_39470 4767 4099 gene locus_tag LOCUS_39480 4767 4099 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_39480 7131 4795 gene locus_tag LOCUS_39490 7131 4795 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_39490 7832 7497 gene locus_tag LOCUS_39500 7832 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence0389 2 1105 gene locus_tag LOCUS_39510 2 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 1537 1136 gene locus_tag LOCUS_39520 1537 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 2244 1534 gene locus_tag LOCUS_39530 2244 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 2377 3240 gene locus_tag LOCUS_39540 2377 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 3562 4665 gene locus_tag LOCUS_39550 3562 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4719 5942 gene locus_tag LOCUS_39560 gene clsB 4719 5942 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035545.1 protein_id gnl|my_center|LOCUS_39560 6028 7740 gene locus_tag LOCUS_39570 gene ggt 6028 7740 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_39570 >Feature sequence0390 284 901 gene locus_tag LOCUS_39580 284 901 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 protein_id gnl|my_center|LOCUS_39580 1114 1449 gene locus_tag LOCUS_39590 1114 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 2320 1481 gene locus_tag LOCUS_39600 2320 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 2529 3236 gene locus_tag LOCUS_39610 2529 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 3691 3347 gene locus_tag LOCUS_39620 3691 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 4126 3863 gene locus_tag LOCUS_39630 4126 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 5319 4225 gene locus_tag LOCUS_39640 gene dprA 5319 4225 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_39640 5603 6652 gene locus_tag LOCUS_39650 5603 6652 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674778.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence0391 3850 1262 gene locus_tag LOCUS_39660 3850 1262 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_39660 5255 3966 gene locus_tag LOCUS_39670 5255 3966 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_39670 5474 6067 gene locus_tag LOCUS_39680 5474 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 >Feature sequence0392 596 2560 gene locus_tag LOCUS_39690 596 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 2588 3538 gene locus_tag LOCUS_39700 2588 3538 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615550.1 protein_id gnl|my_center|LOCUS_39700 3559 5076 gene locus_tag LOCUS_39710 3559 5076 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111272.1 protein_id gnl|my_center|LOCUS_39710 5073 6020 gene locus_tag LOCUS_39720 5073 6020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521614.1 protein_id gnl|my_center|LOCUS_39720 6017 6958 gene locus_tag LOCUS_39730 gene rbsK 6017 6958 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267464.1 protein_id gnl|my_center|LOCUS_39730 7015 7536 gene locus_tag LOCUS_39740 7015 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence0393 1155 2792 gene locus_tag LOCUS_39750 1155 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 4482 3073 gene locus_tag LOCUS_39760 4482 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 4633 5226 gene locus_tag LOCUS_39770 4633 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 5919 5326 gene locus_tag LOCUS_39780 5919 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 >Feature sequence0394 2402 60 gene locus_tag LOCUS_39790 2402 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 3087 2521 gene locus_tag LOCUS_39800 3087 2521 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812894.1 protein_id gnl|my_center|LOCUS_39800 4569 3253 gene locus_tag LOCUS_39810 4569 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_39810 5953 5117 gene locus_tag LOCUS_39820 5953 5117 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_39820 6311 7801 gene locus_tag LOCUS_39830 6311 7801 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_39830 >Feature sequence0395 <1 1075 gene locus_tag LOCUS_39840 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966435.1:fused MFS/spermidine synthase 1734 1222 gene locus_tag LOCUS_39850 1734 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 3987 2023 gene locus_tag LOCUS_39860 3987 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 4192 4776 gene locus_tag LOCUS_39870 4192 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 4912 6867 gene locus_tag LOCUS_39880 4912 6867 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_39880 6937 7104 gene locus_tag LOCUS_39890 6937 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 >Feature sequence0396 >Feature sequence0397 123 1013 gene locus_tag LOCUS_39900 123 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 1212 1802 gene locus_tag LOCUS_39910 gene def 1212 1802 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_39910 1851 2837 gene locus_tag LOCUS_39920 gene fmt 1851 2837 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_39920 2834 4237 gene locus_tag LOCUS_39930 gene rsmB 2834 4237 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_39930 4273 5745 gene locus_tag LOCUS_39940 gene miaB 4273 5745 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_39940 5851 6666 gene locus_tag LOCUS_39950 5851 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 7510 6677 gene locus_tag LOCUS_39960 gene ada 7510 6677 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_39960 >Feature sequence0398 777 175 gene locus_tag LOCUS_39970 777 175 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921444.1 protein_id gnl|my_center|LOCUS_39970 1826 750 gene locus_tag LOCUS_39980 gene waaC 1826 750 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_39980 3168 1852 gene locus_tag LOCUS_39990 3168 1852 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_39990 3251 4051 gene locus_tag LOCUS_40000 3251 4051 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_40000 5215 4184 gene locus_tag LOCUS_40010 5215 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 5874 5146 gene locus_tag LOCUS_40020 5874 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 6354 5884 gene locus_tag LOCUS_40030 6354 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 6611 7303 gene locus_tag LOCUS_40040 6611 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence0399 2049 985 gene locus_tag LOCUS_40050 2049 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 3239 2091 gene locus_tag LOCUS_40060 3239 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 4713 3289 gene locus_tag LOCUS_40070 4713 3289 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146066.1 protein_id gnl|my_center|LOCUS_40070 5600 4806 gene locus_tag LOCUS_40080 5600 4806 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_40080 6411 5947 gene locus_tag LOCUS_40090 6411 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 6958 7722 gene locus_tag LOCUS_40100 6958 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 >Feature sequence0400 389 2452 gene locus_tag LOCUS_40110 389 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 2727 3476 gene locus_tag LOCUS_40120 2727 3476 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085024.1 protein_id gnl|my_center|LOCUS_40120 3817 5061 gene locus_tag LOCUS_40130 3817 5061 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_40130 6328 5495 gene locus_tag LOCUS_40140 6328 5495 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328901.1 protein_id gnl|my_center|LOCUS_40140 7517 6510 gene locus_tag LOCUS_40150 7517 6510 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_40150 >Feature sequence0401 333 1907 gene locus_tag LOCUS_40160 333 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 2271 3635 gene locus_tag LOCUS_40170 2271 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 3653 4483 gene locus_tag LOCUS_40180 3653 4483 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_40180 7537 4712 gene locus_tag LOCUS_40190 7537 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence0402 586 347 gene locus_tag LOCUS_40200 586 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 954 592 gene locus_tag LOCUS_40210 954 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 2088 970 gene locus_tag LOCUS_40220 2088 970 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_40220 3118 2228 gene locus_tag LOCUS_40230 3118 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 7080 3115 gene locus_tag LOCUS_40240 7080 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 7543 7181 gene locus_tag LOCUS_40250 7543 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence0403 1896 2513 gene locus_tag LOCUS_40260 gene purN 1896 2513 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_40260 2545 2820 gene locus_tag LOCUS_40270 2545 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 2820 3239 gene locus_tag LOCUS_40280 2820 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 3300 3572 gene locus_tag LOCUS_40290 3300 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 5087 3681 gene locus_tag LOCUS_40300 gene purD 5087 3681 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_40300 5524 5171 gene locus_tag LOCUS_40310 5524 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 7115 5625 gene locus_tag LOCUS_40320 7115 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 >Feature sequence0404 1261 134 gene locus_tag LOCUS_40330 1261 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 3385 1403 gene locus_tag LOCUS_40340 3385 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 3620 5320 gene locus_tag LOCUS_40350 3620 5320 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_40350 6585 5584 gene locus_tag LOCUS_40360 6585 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 <7742 6635 gene locus_tag LOCUS_40370 <7742 6635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181406033.1:ATP-dependent protease ATPase subunit HslU >Feature sequence0405 105 1346 gene locus_tag LOCUS_40380 105 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence0406 2993 2427 gene locus_tag LOCUS_40390 2993 2427 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258285.1 protein_id gnl|my_center|LOCUS_40390 3555 3121 gene locus_tag LOCUS_40400 3555 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 4910 3681 gene locus_tag LOCUS_40410 4910 3681 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256631.1 protein_id gnl|my_center|LOCUS_40410 6250 5018 gene locus_tag LOCUS_40420 6250 5018 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122283.1 protein_id gnl|my_center|LOCUS_40420 7532 6297 gene locus_tag LOCUS_40430 7532 6297 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_40430 >Feature sequence0407 1248 520 gene locus_tag LOCUS_40440 1248 520 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268232.1 protein_id gnl|my_center|LOCUS_40440 1473 3104 gene locus_tag LOCUS_40450 1473 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 6502 3317 gene locus_tag LOCUS_40460 6502 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 6797 7534 gene locus_tag LOCUS_40470 6797 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence0408 1934 150 gene locus_tag LOCUS_40480 1934 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 2404 2165 gene locus_tag LOCUS_40490 2404 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 3317 2736 gene locus_tag LOCUS_40500 3317 2736 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_40500 3397 4197 gene locus_tag LOCUS_40510 3397 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 4414 4758 gene locus_tag LOCUS_40520 4414 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 4819 5058 gene locus_tag LOCUS_40530 4819 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 5177 5905 gene locus_tag LOCUS_40540 5177 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 5927 6382 gene locus_tag LOCUS_40550 5927 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 6775 6389 gene locus_tag LOCUS_40560 6775 6389 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_40560 7570 6836 gene locus_tag LOCUS_40570 gene pepE 7570 6836 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027213.1 protein_id gnl|my_center|LOCUS_40570 >Feature sequence0409 1364 738 gene locus_tag LOCUS_40580 1364 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 1525 2283 gene locus_tag LOCUS_40590 1525 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 2280 2909 gene locus_tag LOCUS_40600 2280 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 4391 2940 gene locus_tag LOCUS_40610 4391 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 4712 6031 gene locus_tag LOCUS_40620 4712 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 6300 6659 gene locus_tag LOCUS_40630 6300 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence0410 58 1059 gene locus_tag LOCUS_40640 gene galE 58 1059 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_40640 1052 2068 gene locus_tag LOCUS_40650 1052 2068 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_40650 2065 3354 gene locus_tag LOCUS_40660 gene eno 2065 3354 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_40660 4434 3583 gene locus_tag LOCUS_40670 gene panB 4434 3583 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_40670 4556 5164 gene locus_tag LOCUS_40680 4556 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 6665 5190 gene locus_tag LOCUS_40690 gene rhaB 6665 5190 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_40690 6863 7252 gene locus_tag LOCUS_40700 6863 7252 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228929.1 protein_id gnl|my_center|LOCUS_40700 >Feature sequence0411 2113 827 gene locus_tag LOCUS_40710 gene fabF 2113 827 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_40710 3025 3753 gene locus_tag LOCUS_40720 3025 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 3987 4892 gene locus_tag LOCUS_40730 3987 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 5124 5405 gene locus_tag LOCUS_40740 5124 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 5689 6048 gene locus_tag LOCUS_40750 5689 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 6282 6749 gene locus_tag LOCUS_40760 6282 6749 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246482.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence0412 238 960 gene locus_tag LOCUS_40770 238 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 1126 3636 gene locus_tag LOCUS_40780 1126 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 4059 3784 gene locus_tag LOCUS_40790 4059 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 4532 4083 gene locus_tag LOCUS_40800 4532 4083 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_40800 5119 4532 gene locus_tag LOCUS_40810 5119 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 5570 5193 gene locus_tag LOCUS_40820 5570 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 6482 5622 gene locus_tag LOCUS_40830 6482 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 7567 6635 gene locus_tag LOCUS_40840 gene cyoE 7567 6635 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_40840 >Feature sequence0413 3156 115 gene locus_tag LOCUS_40850 3156 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 3527 3276 gene locus_tag LOCUS_40860 3527 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 3872 3627 gene locus_tag LOCUS_40870 3872 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 3756 6530 gene locus_tag LOCUS_40880 3756 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 6595 7272 gene locus_tag LOCUS_40890 6595 7272 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_40890 >Feature sequence0414 282 1010 gene locus_tag LOCUS_40900 282 1010 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563385.1 protein_id gnl|my_center|LOCUS_40900 1274 2161 gene locus_tag LOCUS_40910 1274 2161 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_40910 2552 2896 gene locus_tag LOCUS_40920 2552 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 5016 3424 gene locus_tag LOCUS_40930 5016 3424 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070558.1 protein_id gnl|my_center|LOCUS_40930 6423 5170 gene locus_tag LOCUS_40940 6423 5170 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_40940 7005 6571 gene locus_tag LOCUS_40950 gene ruvX 7005 6571 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_40950 <7650 7002 gene locus_tag LOCUS_40960 <7650 7002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120825.1:mannose-1-phosphate guanylyltransferase >Feature sequence0415 1032 247 gene locus_tag LOCUS_40970 1032 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 3564 1096 gene locus_tag LOCUS_40980 3564 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 5433 3664 gene locus_tag LOCUS_40990 5433 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 5993 5433 gene locus_tag LOCUS_41000 5993 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 6242 7600 gene locus_tag LOCUS_41010 6242 7600 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112315.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence0416 <1 1688 gene locus_tag LOCUS_41020 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258550.1:isoleucine--tRNA ligase 2007 1693 gene locus_tag LOCUS_41030 2007 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 2287 1913 gene locus_tag LOCUS_41040 2287 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 3599 2400 gene locus_tag LOCUS_41050 3599 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 3664 4806 gene locus_tag LOCUS_41060 gene mqnE 3664 4806 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_41060 4899 5891 gene locus_tag LOCUS_41070 4899 5891 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 protein_id gnl|my_center|LOCUS_41070 6437 5922 gene locus_tag LOCUS_41080 6437 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 6706 6572 gene locus_tag LOCUS_41090 6706 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 >Feature sequence0417 951 763 gene locus_tag LOCUS_41100 951 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 1169 987 gene locus_tag LOCUS_41110 1169 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129052038.1 protein_id gnl|my_center|LOCUS_41110 1424 1209 gene locus_tag LOCUS_41120 1424 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 1793 1428 gene locus_tag LOCUS_41130 1793 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 2523 1894 gene locus_tag LOCUS_41140 2523 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 2882 3673 gene locus_tag LOCUS_41150 2882 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_41150 3660 4220 gene locus_tag LOCUS_41160 3660 4220 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_41160 >Feature sequence0418 1404 31 gene locus_tag LOCUS_41170 gene rimO 1404 31 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_41170 1592 2095 gene locus_tag LOCUS_41180 1592 2095 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 protein_id gnl|my_center|LOCUS_41180 2301 2741 gene locus_tag LOCUS_41190 2301 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_41190 3410 3895 gene locus_tag LOCUS_41200 3410 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 4773 4168 gene locus_tag LOCUS_41210 4773 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 6436 5096 gene locus_tag LOCUS_41220 6436 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 6823 6452 gene locus_tag LOCUS_41230 6823 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence0419 2341 2087 gene locus_tag LOCUS_41240 2341 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 2916 2344 gene locus_tag LOCUS_41250 2916 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 3896 3156 gene locus_tag LOCUS_41260 3896 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 4158 5819 gene locus_tag LOCUS_41270 4158 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 >Feature sequence0420 <1 2062 gene locus_tag LOCUS_41280 <1 2062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120353.1:DEAD/DEAH box helicase 4423 2174 gene locus_tag LOCUS_41290 4423 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 4627 5442 gene locus_tag LOCUS_41300 4627 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397681.1 protein_id gnl|my_center|LOCUS_41300 5475 6521 gene locus_tag LOCUS_41310 5475 6521 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_41310 >Feature sequence0421 106 738 gene locus_tag LOCUS_41320 106 738 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_41320 735 4124 gene locus_tag LOCUS_41330 735 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4316 5671 gene locus_tag LOCUS_41340 4316 5671 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_41340 5714 6496 gene locus_tag LOCUS_41350 gene pcaD 5714 6496 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976279.1 protein_id gnl|my_center|LOCUS_41350 >Feature sequence0422 121 1254 gene locus_tag LOCUS_41360 gene solA 121 1254 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_41360 1345 2379 gene locus_tag LOCUS_41370 1345 2379 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_41370 2931 3170 gene locus_tag LOCUS_41380 2931 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 3216 4409 gene locus_tag LOCUS_41390 3216 4409 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_41390 4419 6635 gene locus_tag LOCUS_41400 4419 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 6753 7361 gene locus_tag LOCUS_41410 6753 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 >Feature sequence0423 160 2043 gene locus_tag LOCUS_41420 160 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 2414 2040 gene locus_tag LOCUS_41430 2414 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 2581 2904 gene locus_tag LOCUS_41440 2581 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 3297 3025 gene locus_tag LOCUS_41450 3297 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 3653 3297 gene locus_tag LOCUS_41460 3653 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 4186 3650 gene locus_tag LOCUS_41470 4186 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 4480 4289 gene locus_tag LOCUS_41480 4480 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 4825 4583 gene locus_tag LOCUS_41490 4825 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 5410 4907 gene locus_tag LOCUS_41500 5410 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 5557 5871 gene locus_tag LOCUS_41510 5557 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 5887 7269 gene locus_tag LOCUS_41520 5887 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence0424 487 699 gene locus_tag LOCUS_41530 487 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 817 1197 gene locus_tag LOCUS_41540 817 1197 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330324.1 protein_id gnl|my_center|LOCUS_41540 2968 1214 gene locus_tag LOCUS_41550 2968 1214 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325003.1 protein_id gnl|my_center|LOCUS_41550 3293 4459 gene locus_tag LOCUS_41560 3293 4459 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_41560 4456 7509 gene locus_tag LOCUS_41570 4456 7509 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_41570 >Feature sequence0425 137 262 gene locus_tag LOCUS_41580 137 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 284 1462 gene locus_tag LOCUS_41590 284 1462 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_41590 1444 1815 gene locus_tag LOCUS_41600 1444 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 1877 2182 gene locus_tag LOCUS_41610 1877 2182 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729333.1 protein_id gnl|my_center|LOCUS_41610 2313 3461 gene locus_tag LOCUS_41620 2313 3461 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_41620 4990 3722 gene locus_tag LOCUS_41630 4990 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 6175 5174 gene locus_tag LOCUS_41640 6175 5174 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227924.1 protein_id gnl|my_center|LOCUS_41640 >Feature sequence0426 47 991 gene locus_tag LOCUS_41650 47 991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41650 1970 1017 gene locus_tag LOCUS_41660 1970 1017 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_41660 2181 4646 gene locus_tag LOCUS_41670 2181 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 4843 6000 gene locus_tag LOCUS_41680 4843 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 >Feature sequence0427 <1 728 gene locus_tag LOCUS_41690 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922629.1:serine/threonine protein kinase 1122 1283 gene locus_tag LOCUS_41700 1122 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 1385 1561 gene locus_tag LOCUS_41710 1385 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 1714 1929 gene locus_tag LOCUS_41720 1714 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 2026 2154 gene locus_tag LOCUS_41730 2026 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 3619 2162 gene locus_tag LOCUS_41740 3619 2162 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_41740 3892 3677 gene locus_tag LOCUS_41750 3892 3677 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_41750 4071 3889 gene locus_tag LOCUS_41760 4071 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 5355 4132 gene locus_tag LOCUS_41770 5355 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 5962 6846 gene locus_tag LOCUS_41780 5962 6846 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_41780 >Feature sequence0428 5113 95 gene locus_tag LOCUS_41790 5113 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 5683 5156 gene locus_tag LOCUS_41800 5683 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 6702 5800 gene locus_tag LOCUS_41810 6702 5800 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_41810 <7495 6813 gene locus_tag LOCUS_41820 <7495 6813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928692.1:Uma2 family endonuclease >Feature sequence0429 298 897 gene locus_tag LOCUS_41830 298 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 1065 1871 gene locus_tag LOCUS_41840 1065 1871 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_41840 1862 1792 gene locus_tag LOCUS_t00380 1862 1792 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1903 2859 gene locus_tag LOCUS_41850 1903 2859 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_41850 2881 3888 gene locus_tag LOCUS_41860 2881 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 3934 5880 gene locus_tag LOCUS_41870 3934 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 6334 7365 gene locus_tag LOCUS_41880 6334 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 >Feature sequence0430 483 866 gene locus_tag LOCUS_41890 483 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41890 2110 1142 gene locus_tag LOCUS_41900 2110 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 3693 4349 gene locus_tag LOCUS_41910 3693 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 4407 4949 gene locus_tag LOCUS_41920 4407 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 5095 5745 gene locus_tag LOCUS_41930 5095 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 5907 6269 gene locus_tag LOCUS_41940 5907 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 6266 6487 gene locus_tag LOCUS_41950 6266 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 6490 6768 gene locus_tag LOCUS_41960 6490 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 6769 6957 gene locus_tag LOCUS_41970 6769 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 >Feature sequence0431 342 710 gene locus_tag LOCUS_41980 342 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 2135 789 gene locus_tag LOCUS_41990 2135 789 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_41990 2363 2884 gene locus_tag LOCUS_42000 2363 2884 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335808.1 protein_id gnl|my_center|LOCUS_42000 3022 3807 gene locus_tag LOCUS_42010 3022 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 6330 3925 gene locus_tag LOCUS_42020 6330 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 6436 6921 gene locus_tag LOCUS_42030 6436 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence0432 65 3112 gene locus_tag LOCUS_42040 65 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 3371 3120 gene locus_tag LOCUS_42050 3371 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 4832 3462 gene locus_tag LOCUS_42060 4832 3462 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_42060 4951 5709 gene locus_tag LOCUS_42070 4951 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 5742 6254 gene locus_tag LOCUS_42080 5742 6254 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027542149.1 protein_id gnl|my_center|LOCUS_42080 <7450 6336 gene locus_tag LOCUS_42090 <7450 6336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942109.1:aspartate--tRNA ligase >Feature sequence0433 1346 159 gene locus_tag LOCUS_42100 1346 159 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922165.1 protein_id gnl|my_center|LOCUS_42100 3222 1504 gene locus_tag LOCUS_42110 3222 1504 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_42110 3743 3489 gene locus_tag LOCUS_42120 3743 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 5187 3955 gene locus_tag LOCUS_42130 5187 3955 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_42130 5588 5247 gene locus_tag LOCUS_42140 5588 5247 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071008.1 protein_id gnl|my_center|LOCUS_42140 7243 6143 gene locus_tag LOCUS_42150 7243 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 >Feature sequence0434 <1 650 gene locus_tag LOCUS_42160 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530054.1:class I SAM-dependent methyltransferase 767 2929 gene locus_tag LOCUS_42170 767 2929 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020515.1 protein_id gnl|my_center|LOCUS_42170 2935 3687 gene locus_tag LOCUS_42180 2935 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 3891 4250 gene locus_tag LOCUS_42190 3891 4250 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966633.1 protein_id gnl|my_center|LOCUS_42190 4795 6039 gene locus_tag LOCUS_42200 4795 6039 CDS product IS701-like element ISBj6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038951335.1 protein_id gnl|my_center|LOCUS_42200 7302 6373 gene locus_tag LOCUS_42210 7302 6373 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_42210 >Feature sequence0435 301 1080 gene locus_tag LOCUS_42220 gene fabG 301 1080 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_42220 1123 2997 gene locus_tag LOCUS_42230 1123 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 3044 4204 gene locus_tag LOCUS_42240 3044 4204 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640274.1 protein_id gnl|my_center|LOCUS_42240 4902 4687 gene locus_tag LOCUS_42250 4902 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 4787 5818 gene locus_tag LOCUS_42260 4787 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 6000 7367 gene locus_tag LOCUS_42270 6000 7367 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_42270 >Feature sequence0436 1805 669 gene locus_tag LOCUS_42280 1805 669 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_42280 2974 1856 gene locus_tag LOCUS_42290 gene menC 2974 1856 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_42290 3055 3801 gene locus_tag LOCUS_42300 3055 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 3889 4512 gene locus_tag LOCUS_42310 3889 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 4807 4523 gene locus_tag LOCUS_42320 4807 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 5396 4848 gene locus_tag LOCUS_42330 5396 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 6180 5389 gene locus_tag LOCUS_42340 6180 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 7114 6323 gene locus_tag LOCUS_42350 7114 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 >Feature sequence0437 1420 278 gene locus_tag LOCUS_42360 1420 278 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704459.1 protein_id gnl|my_center|LOCUS_42360 2410 1427 gene locus_tag LOCUS_42370 2410 1427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_42370 3399 2407 gene locus_tag LOCUS_42380 3399 2407 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_42380 4074 3568 gene locus_tag LOCUS_42390 4074 3568 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_42390 4849 4265 gene locus_tag LOCUS_42400 4849 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 6588 5026 gene locus_tag LOCUS_42410 6588 5026 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_42410 <7420 6799 gene locus_tag LOCUS_42420 <7420 6799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107164.1:NAD(+) synthase >Feature sequence0438 5291 216 gene locus_tag LOCUS_42430 5291 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 6047 5427 gene locus_tag LOCUS_42440 6047 5427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654974.1 protein_id gnl|my_center|LOCUS_42440 <7400 6160 gene locus_tag LOCUS_42450 <7400 6160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584016.1:serpin family protein >Feature sequence0439 2446 3450 gene locus_tag LOCUS_42460 2446 3450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_42460 3559 5136 gene locus_tag LOCUS_42470 3559 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 5282 7351 gene locus_tag LOCUS_42480 5282 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 >Feature sequence0440 2227 47 gene locus_tag LOCUS_42490 2227 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 4195 2312 gene locus_tag LOCUS_42500 4195 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 7249 5177 gene locus_tag LOCUS_42510 7249 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence0441 4989 7367 gene locus_tag LOCUS_42520 4989 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence0442 929 267 gene locus_tag LOCUS_42530 929 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615698.1 protein_id gnl|my_center|LOCUS_42530 1320 2537 gene locus_tag LOCUS_42540 1320 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 2927 4054 gene locus_tag LOCUS_42550 2927 4054 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_42550 4168 4605 gene locus_tag LOCUS_42560 4168 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 5019 4711 gene locus_tag LOCUS_42570 5019 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 5522 5019 gene locus_tag LOCUS_42580 gene ilvN 5522 5019 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_42580 6409 5834 gene locus_tag LOCUS_42590 6409 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 7386 6574 gene locus_tag LOCUS_42600 7386 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 >Feature sequence0443 1057 1485 gene locus_tag LOCUS_42610 1057 1485 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233882.1 protein_id gnl|my_center|LOCUS_42610 1656 2900 gene locus_tag LOCUS_42620 1656 2900 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922057.1 protein_id gnl|my_center|LOCUS_42620 3211 5439 gene locus_tag LOCUS_42630 3211 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 5659 6891 gene locus_tag LOCUS_42640 5659 6891 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_42640 >Feature sequence0444 2004 6452 gene locus_tag LOCUS_42650 2004 6452 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_42650 6556 7095 gene locus_tag LOCUS_42660 6556 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 >Feature sequence0445 3889 2552 gene locus_tag LOCUS_42670 3889 2552 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_42670 4044 5894 gene locus_tag LOCUS_42680 4044 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 6303 5962 gene locus_tag LOCUS_42690 6303 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 >Feature sequence0446 1191 148 gene locus_tag LOCUS_42700 1191 148 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615376.1 protein_id gnl|my_center|LOCUS_42700 4490 1191 gene locus_tag LOCUS_42710 4490 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 4732 7242 gene locus_tag LOCUS_42720 4732 7242 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_42720 >Feature sequence0447 77 862 gene locus_tag LOCUS_42730 77 862 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_42730 1082 1324 gene locus_tag LOCUS_42740 1082 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 1543 3903 gene locus_tag LOCUS_42750 gene thrS 1543 3903 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_42750 4180 5376 gene locus_tag LOCUS_42760 4180 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 5521 6030 gene locus_tag LOCUS_42770 5521 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 5990 6307 gene locus_tag LOCUS_42780 5990 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 6343 7185 gene locus_tag LOCUS_42790 6343 7185 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_42790 >Feature sequence0448 443 835 gene locus_tag LOCUS_42800 443 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 966 2780 gene locus_tag LOCUS_42810 gene argS 966 2780 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025297.1 protein_id gnl|my_center|LOCUS_42810 3037 2885 gene locus_tag LOCUS_42820 3037 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 3232 3053 gene locus_tag LOCUS_42830 3232 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 3434 3276 gene locus_tag LOCUS_42840 3434 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 4771 3476 gene locus_tag LOCUS_42850 gene serS 4771 3476 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_42850 5455 4787 gene locus_tag LOCUS_42860 5455 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 5754 5452 gene locus_tag LOCUS_42870 5754 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 6211 5807 gene locus_tag LOCUS_42880 6211 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 <7328 6249 gene locus_tag LOCUS_42890 <7328 6249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058225.1:citrate synthase >Feature sequence0449 290 6439 gene locus_tag LOCUS_42900 290 6439 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_42900 >Feature sequence0450 757 455 gene locus_tag LOCUS_42910 757 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 2019 1021 gene locus_tag LOCUS_42920 2019 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 2440 4008 gene locus_tag LOCUS_42930 2440 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 4554 4042 gene locus_tag LOCUS_42940 4554 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 5459 4896 gene locus_tag LOCUS_42950 5459 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 5870 5493 gene locus_tag LOCUS_42960 5870 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence0451 2404 20 gene locus_tag LOCUS_42970 gene lon 2404 20 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_42970 4195 3464 gene locus_tag LOCUS_42980 4195 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 5240 4230 gene locus_tag LOCUS_42990 5240 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 6338 5280 gene locus_tag LOCUS_43000 6338 5280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_43000 7222 6287 gene locus_tag LOCUS_43010 7222 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 >Feature sequence0452 1783 653 gene locus_tag LOCUS_43020 1783 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 1892 2635 gene locus_tag LOCUS_43030 1892 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 2628 3215 gene locus_tag LOCUS_43040 gene coaC 2628 3215 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284128.1 protein_id gnl|my_center|LOCUS_43040 4917 3292 gene locus_tag LOCUS_43050 4917 3292 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_43050 5799 5032 gene locus_tag LOCUS_43060 5799 5032 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_43060 6163 7128 gene locus_tag LOCUS_43070 6163 7128 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_43070 >Feature sequence0453 1308 139 gene locus_tag LOCUS_43080 1308 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 1700 2152 gene locus_tag LOCUS_43090 gene ndk 1700 2152 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_43090 3146 2235 gene locus_tag LOCUS_43100 3146 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 4200 3310 gene locus_tag LOCUS_43110 4200 3310 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_43110 >Feature sequence0454 2321 1953 gene locus_tag LOCUS_43120 2321 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 2711 3760 gene locus_tag LOCUS_43130 2711 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 3998 3792 gene locus_tag LOCUS_43140 3998 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 4070 4396 gene locus_tag LOCUS_43150 4070 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 4558 4878 gene locus_tag LOCUS_43160 4558 4878 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_43160 5060 6868 gene locus_tag LOCUS_43170 5060 6868 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_43170 >Feature sequence0455 40 789 gene locus_tag LOCUS_43180 40 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 1207 884 gene locus_tag LOCUS_43190 1207 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 1693 1316 gene locus_tag LOCUS_43200 1693 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 1883 1810 gene locus_tag LOCUS_t00390 1883 1810 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2034 3059 gene locus_tag LOCUS_43210 gene asd 2034 3059 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_43210 3143 3904 gene locus_tag LOCUS_43220 gene truA 3143 3904 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_43220 3920 5215 gene locus_tag LOCUS_43230 gene aroA 3920 5215 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_43230 5369 7234 gene locus_tag LOCUS_43240 5369 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 >Feature sequence0456 <1 771 gene locus_tag LOCUS_43250 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000364870.1:HlyD family secretion protein 969 1226 gene locus_tag LOCUS_43260 969 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 3301 1325 gene locus_tag LOCUS_43270 3301 1325 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922110.1 protein_id gnl|my_center|LOCUS_43270 4065 3298 gene locus_tag LOCUS_43280 4065 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 4225 4929 gene locus_tag LOCUS_43290 4225 4929 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_43290 >Feature sequence0457 368 138 gene locus_tag LOCUS_43300 368 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 2128 803 gene locus_tag LOCUS_43310 gene hflX 2128 803 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_43310 2774 4309 gene locus_tag LOCUS_43320 2774 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 4610 5158 gene locus_tag LOCUS_43330 4610 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 5155 5976 gene locus_tag LOCUS_43340 5155 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43340 6048 7055 gene locus_tag LOCUS_43350 6048 7055 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257988.1 protein_id gnl|my_center|LOCUS_43350 >Feature sequence0458 2160 142 gene locus_tag LOCUS_43360 2160 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 3439 2411 gene locus_tag LOCUS_43370 3439 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 4789 3515 gene locus_tag LOCUS_43380 4789 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 6287 5058 gene locus_tag LOCUS_43390 6287 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 6680 7021 gene locus_tag LOCUS_43400 6680 7021 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_43400 >Feature sequence0459 1968 40 gene locus_tag LOCUS_43410 1968 40 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_43410 2268 2912 gene locus_tag LOCUS_43420 2268 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 4961 2922 gene locus_tag LOCUS_43430 gene katG 4961 2922 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_43430 5141 4971 gene locus_tag LOCUS_43440 5141 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43440 5389 5784 gene locus_tag LOCUS_43450 5389 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 5933 6496 gene locus_tag LOCUS_43460 5933 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 7224 6712 gene locus_tag LOCUS_43470 7224 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 >Feature sequence0460 879 379 gene locus_tag LOCUS_43480 879 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 1085 876 gene locus_tag LOCUS_43490 1085 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 1264 5913 gene locus_tag LOCUS_43500 1264 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 6189 7163 gene locus_tag LOCUS_43510 6189 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 >Feature sequence0461 1790 54 gene locus_tag LOCUS_43520 gene dnaK 1790 54 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_43520 2313 3971 gene locus_tag LOCUS_43530 2313 3971 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921786.1 protein_id gnl|my_center|LOCUS_43530 4017 5306 gene locus_tag LOCUS_43540 4017 5306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_43540 5442 7193 gene locus_tag LOCUS_43550 5442 7193 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_43550 >Feature sequence0462 1553 120 gene locus_tag LOCUS_43560 1553 120 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038700.1 protein_id gnl|my_center|LOCUS_43560 2142 1735 gene locus_tag LOCUS_43570 2142 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615996.1 protein_id gnl|my_center|LOCUS_43570 2847 2188 gene locus_tag LOCUS_43580 2847 2188 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921755.1 protein_id gnl|my_center|LOCUS_43580 4039 2969 gene locus_tag LOCUS_43590 4039 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 5617 4070 gene locus_tag LOCUS_43600 5617 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 7130 5766 gene locus_tag LOCUS_43610 7130 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 >Feature sequence0463 494 913 gene locus_tag LOCUS_43620 494 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 951 1352 gene locus_tag LOCUS_43630 951 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 3951 1501 gene locus_tag LOCUS_43640 3951 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 4070 5407 gene locus_tag LOCUS_43650 4070 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 6338 5619 gene locus_tag LOCUS_43660 6338 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 6726 6352 gene locus_tag LOCUS_43670 6726 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 >Feature sequence0464 1600 68 gene locus_tag LOCUS_43680 1600 68 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_43680 1772 2446 gene locus_tag LOCUS_43690 1772 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2821 2426 gene locus_tag LOCUS_43700 2821 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 3720 2965 gene locus_tag LOCUS_43710 3720 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 5525 3903 gene locus_tag LOCUS_43720 5525 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 <7180 5555 gene locus_tag LOCUS_43730 <7180 5555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886407.1:putative hydro-lyase >Feature sequence0465 112 567 gene locus_tag LOCUS_43740 112 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 806 564 gene locus_tag LOCUS_43750 806 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 1708 869 gene locus_tag LOCUS_43760 1708 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 2726 1869 gene locus_tag LOCUS_43770 2726 1869 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_43770 4635 2719 gene locus_tag LOCUS_43780 4635 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 5942 4722 gene locus_tag LOCUS_43790 5942 4722 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_43790 6028 6699 gene locus_tag LOCUS_43800 6028 6699 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_43800 7104 7175 gene locus_tag LOCUS_t00400 7104 7175 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0466 240 659 gene locus_tag LOCUS_43810 240 659 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_43810 801 1016 gene locus_tag LOCUS_43820 801 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 1243 908 gene locus_tag LOCUS_43830 1243 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 3156 1312 gene locus_tag LOCUS_43840 3156 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 3395 3877 gene locus_tag LOCUS_43850 3395 3877 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_43850 4037 4522 gene locus_tag LOCUS_43860 4037 4522 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_43860 4519 5580 gene locus_tag LOCUS_43870 4519 5580 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_43870 6597 5617 gene locus_tag LOCUS_43880 6597 5617 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918455.1 protein_id gnl|my_center|LOCUS_43880 >Feature sequence0467 246 2357 gene locus_tag LOCUS_43890 246 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 2755 2423 gene locus_tag LOCUS_43900 gene trxA 2755 2423 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460330.1 protein_id gnl|my_center|LOCUS_43900 4476 2935 gene locus_tag LOCUS_43910 4476 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 4791 5927 gene locus_tag LOCUS_43920 4791 5927 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812857.1 protein_id gnl|my_center|LOCUS_43920 5964 6332 gene locus_tag LOCUS_43930 5964 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 >Feature sequence0468 583 1269 gene locus_tag LOCUS_43940 583 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 2021 1374 gene locus_tag LOCUS_43950 2021 1374 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_43950 2168 2968 gene locus_tag LOCUS_43960 2168 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 4111 3014 gene locus_tag LOCUS_43970 4111 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 >Feature sequence0469 2875 842 gene locus_tag LOCUS_43980 2875 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 4371 3073 gene locus_tag LOCUS_43990 4371 3073 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_43990 6370 4424 gene locus_tag LOCUS_44000 6370 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 >Feature sequence0470 106 885 gene locus_tag LOCUS_44010 106 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 994 2439 gene locus_tag LOCUS_44020 994 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 2674 3813 gene locus_tag LOCUS_44030 2674 3813 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337844.1 protein_id gnl|my_center|LOCUS_44030 4160 4672 gene locus_tag LOCUS_44040 4160 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 5394 4762 gene locus_tag LOCUS_44050 5394 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 5531 6685 gene locus_tag LOCUS_44060 gene ispG 5531 6685 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546314.1 protein_id gnl|my_center|LOCUS_44060 >Feature sequence0471 <1 4241 gene locus_tag LOCUS_44070 <1 4241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein 4256 4873 gene locus_tag LOCUS_44080 4256 4873 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 protein_id gnl|my_center|LOCUS_44080 4948 6993 gene locus_tag LOCUS_44090 4948 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 >Feature sequence0472 1243 164 gene locus_tag LOCUS_44100 1243 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 1567 2940 gene locus_tag LOCUS_44110 1567 2940 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_44110 2994 3596 gene locus_tag LOCUS_44120 2994 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 3635 6112 gene locus_tag LOCUS_44130 3635 6112 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_44130 6127 6603 gene locus_tag LOCUS_44140 6127 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 6686 7027 gene locus_tag LOCUS_44150 6686 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 >Feature sequence0473 108 2918 gene locus_tag LOCUS_44160 gene ppc 108 2918 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_44160 5192 2982 gene locus_tag LOCUS_44170 gene recQ 5192 2982 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_44170 5334 5969 gene locus_tag LOCUS_44180 5334 5969 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_44180 >Feature sequence0474 85 315 gene locus_tag LOCUS_44190 85 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 2956 584 gene locus_tag LOCUS_44200 2956 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 3770 2979 gene locus_tag LOCUS_44210 3770 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 5974 4208 gene locus_tag LOCUS_44220 gene ptsP 5974 4208 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_44220 6341 6033 gene locus_tag LOCUS_44230 6341 6033 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_44230 6982 6515 gene locus_tag LOCUS_44240 6982 6515 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_44240 >Feature sequence0475 1522 116 gene locus_tag LOCUS_44250 1522 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 3510 1954 gene locus_tag LOCUS_44260 gene gatB 3510 1954 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122965.1 protein_id gnl|my_center|LOCUS_44260 4183 3524 gene locus_tag LOCUS_44270 4183 3524 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_44270 5715 4261 gene locus_tag LOCUS_44280 gene gatA 5715 4261 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 protein_id gnl|my_center|LOCUS_44280 6124 5837 gene locus_tag LOCUS_44290 gene gatC 6124 5837 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_44290 6434 6174 gene locus_tag LOCUS_44300 gene rpmB 6434 6174 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051452.1 protein_id gnl|my_center|LOCUS_44300 >Feature sequence0476 1091 15 gene locus_tag LOCUS_44310 1091 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 1686 2450 gene locus_tag LOCUS_44320 1686 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 2468 3142 gene locus_tag LOCUS_44330 2468 3142 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123040.1 protein_id gnl|my_center|LOCUS_44330 3195 4379 gene locus_tag LOCUS_44340 3195 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 4537 5850 gene locus_tag LOCUS_44350 4537 5850 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_44350 6033 6905 gene locus_tag LOCUS_44360 6033 6905 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_44360 >Feature sequence0477 1090 1524 gene locus_tag LOCUS_44370 1090 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 1530 2660 gene locus_tag LOCUS_44380 1530 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 3562 2669 gene locus_tag LOCUS_44390 3562 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 3966 3559 gene locus_tag LOCUS_44400 3966 3559 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_44400 4198 4479 gene locus_tag LOCUS_44410 4198 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 4490 4828 gene locus_tag LOCUS_44420 4490 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 4825 5337 gene locus_tag LOCUS_44430 4825 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 5334 6143 gene locus_tag LOCUS_44440 5334 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 >Feature sequence0478 >Feature sequence0479 352 768 gene locus_tag LOCUS_44450 352 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 765 1157 gene locus_tag LOCUS_44460 765 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 1351 1797 gene locus_tag LOCUS_44470 1351 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 1855 2568 gene locus_tag LOCUS_44480 1855 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 2628 3080 gene locus_tag LOCUS_44490 2628 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 3077 3682 gene locus_tag LOCUS_44500 3077 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 5086 3818 gene locus_tag LOCUS_44510 5086 3818 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_44510 6644 5004 gene locus_tag LOCUS_44520 6644 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 >Feature sequence0480 3534 3007 gene locus_tag LOCUS_44530 3534 3007 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122486.1 protein_id gnl|my_center|LOCUS_44530 4781 3708 gene locus_tag LOCUS_44540 4781 3708 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_44540 >Feature sequence0481 1322 1486 gene locus_tag LOCUS_44550 1322 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 1984 1526 gene locus_tag LOCUS_44560 1984 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 2217 1981 gene locus_tag LOCUS_44570 2217 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 3066 2257 gene locus_tag LOCUS_44580 3066 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 3258 4175 gene locus_tag LOCUS_44590 3258 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 4676 6586 gene locus_tag LOCUS_44600 4676 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 6589 6933 gene locus_tag LOCUS_44610 6589 6933 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_44610 >Feature sequence0482 1832 51 gene locus_tag LOCUS_44620 1832 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 4665 1777 gene locus_tag LOCUS_44630 4665 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 5833 4787 gene locus_tag LOCUS_44640 5833 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 <6995 5840 gene locus_tag LOCUS_44650 <6995 5840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922199.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0483 1983 622 gene locus_tag LOCUS_44660 1983 622 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_44660 3638 2310 gene locus_tag LOCUS_44670 3638 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 4350 3826 gene locus_tag LOCUS_44680 gene rplQ 4350 3826 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633358.1 protein_id gnl|my_center|LOCUS_44680 5403 4378 gene locus_tag LOCUS_44690 5403 4378 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_44690 6116 5481 gene locus_tag LOCUS_44700 gene rpsD 6116 5481 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_44700 6540 6160 gene locus_tag LOCUS_44710 gene rpsK 6540 6160 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_44710 >Feature sequence0484 <1 934 gene locus_tag LOCUS_44720 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458696.1:acetyl-CoA C-acyltransferase FadA 1038 2543 gene locus_tag LOCUS_44730 gene trpE 1038 2543 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_44730 2587 2871 gene locus_tag LOCUS_44740 2587 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2868 3095 gene locus_tag LOCUS_44750 2868 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 3102 3320 gene locus_tag LOCUS_44760 3102 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 3597 3403 gene locus_tag LOCUS_44770 3597 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 3499 4563 gene locus_tag LOCUS_44780 3499 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 4649 5122 gene locus_tag LOCUS_44790 4649 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 5608 5333 gene locus_tag LOCUS_44800 5608 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 6041 5649 gene locus_tag LOCUS_44810 6041 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 6731 6045 gene locus_tag LOCUS_44820 6731 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence0485 <1 977 gene locus_tag LOCUS_44830 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487479.1:amidohydrolase family protein 1136 1684 gene locus_tag LOCUS_44840 1136 1684 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095369.1 protein_id gnl|my_center|LOCUS_44840 1814 2119 gene locus_tag LOCUS_44850 1814 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 2521 5310 gene locus_tag LOCUS_44860 2521 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 >Feature sequence0486 980 3976 gene locus_tag LOCUS_44870 980 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 4038 5834 gene locus_tag LOCUS_44880 4038 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 5942 6880 gene locus_tag LOCUS_44890 5942 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 >Feature sequence0487 556 29 gene locus_tag LOCUS_44900 556 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 2773 596 gene locus_tag LOCUS_44910 2773 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 3185 2931 gene locus_tag LOCUS_44920 3185 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 3067 4029 gene locus_tag LOCUS_44930 3067 4029 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666219.1 protein_id gnl|my_center|LOCUS_44930 4435 4067 gene locus_tag LOCUS_44940 4435 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 5097 5024 gene locus_tag LOCUS_t00410 5097 5024 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5332 6435 gene locus_tag LOCUS_44950 5332 6435 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_44950 >Feature sequence0488 6881 3855 gene locus_tag LOCUS_44960 6881 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 >Feature sequence0489 293 469 gene locus_tag LOCUS_44970 293 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 810 2450 gene locus_tag LOCUS_44980 gene purH 810 2450 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_44980 2560 2820 gene locus_tag LOCUS_44990 2560 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 4396 3506 gene locus_tag LOCUS_45000 4396 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 5332 4703 gene locus_tag LOCUS_45010 5332 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_45010 5468 6250 gene locus_tag LOCUS_45020 5468 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 6272 6838 gene locus_tag LOCUS_45030 6272 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 >Feature sequence0490 1106 918 gene locus_tag LOCUS_45040 1106 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 1830 1225 gene locus_tag LOCUS_45050 1830 1225 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770497.1 protein_id gnl|my_center|LOCUS_45050 1981 1908 gene locus_tag LOCUS_t00420 1981 1908 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2450 2076 gene locus_tag LOCUS_45060 2450 2076 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_45060 3742 2549 gene locus_tag LOCUS_45070 3742 2549 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_45070 4312 3854 gene locus_tag LOCUS_45080 4312 3854 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958178.1 protein_id gnl|my_center|LOCUS_45080 5428 4394 gene locus_tag LOCUS_45090 5428 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 6876 5536 gene locus_tag LOCUS_45100 6876 5536 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_45100 >Feature sequence0491 <1 1034 gene locus_tag LOCUS_45110 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121153.1:DUF1552 domain-containing protein 1132 2694 gene locus_tag LOCUS_45120 1132 2694 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_45120 4255 2723 gene locus_tag LOCUS_45130 4255 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 4805 5332 gene locus_tag LOCUS_45140 4805 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 5404 6105 gene locus_tag LOCUS_45150 gene pxpA 5404 6105 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_45150 >Feature sequence0492 <1 944 gene locus_tag LOCUS_45160 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002371207.1:formate dehydrogenase subunit alpha 1053 2201 gene locus_tag LOCUS_45170 gene nuoH 1053 2201 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_45170 2264 2815 gene locus_tag LOCUS_45180 2264 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 2939 3979 gene locus_tag LOCUS_45190 2939 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 4025 4441 gene locus_tag LOCUS_45200 4025 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 4434 6437 gene locus_tag LOCUS_45210 gene nuoL 4434 6437 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_45210 >Feature sequence0493 403 1236 gene locus_tag LOCUS_45220 403 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 1340 1753 gene locus_tag LOCUS_45230 1340 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 3952 1844 gene locus_tag LOCUS_45240 3952 1844 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_45240 6687 4081 gene locus_tag LOCUS_45250 6687 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 >Feature sequence0494 1585 125 gene locus_tag LOCUS_45260 1585 125 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921298.1 protein_id gnl|my_center|LOCUS_45260 1834 3039 gene locus_tag LOCUS_45270 1834 3039 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_45270 3124 4002 gene locus_tag LOCUS_45280 3124 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 6061 4316 gene locus_tag LOCUS_45290 6061 4316 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_45290 >Feature sequence0495 155 1261 gene locus_tag LOCUS_45300 155 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 1535 3259 gene locus_tag LOCUS_45310 1535 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 3579 6104 gene locus_tag LOCUS_45320 3579 6104 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_45320 6138 6692 gene locus_tag LOCUS_45330 6138 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 >Feature sequence0496 176 1291 gene locus_tag LOCUS_45340 176 1291 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_45340 1320 1847 gene locus_tag LOCUS_45350 1320 1847 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_45350 1977 2198 gene locus_tag LOCUS_45360 1977 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 2195 2491 gene locus_tag LOCUS_45370 2195 2491 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_45370 2570 3256 gene locus_tag LOCUS_45380 2570 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 5799 3340 gene locus_tag LOCUS_45390 5799 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 <6875 5816 gene locus_tag LOCUS_45400 <6875 5816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141207.1:tetratricopeptide repeat protein >Feature sequence0497 1967 816 gene locus_tag LOCUS_45410 1967 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 2501 2313 gene locus_tag LOCUS_45420 2501 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 2539 2925 gene locus_tag LOCUS_45430 2539 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 2986 4131 gene locus_tag LOCUS_45440 2986 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 5033 4137 gene locus_tag LOCUS_45450 5033 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 6014 5055 gene locus_tag LOCUS_45460 6014 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 6770 6054 gene locus_tag LOCUS_45470 6770 6054 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767289.1 protein_id gnl|my_center|LOCUS_45470 >Feature sequence0498 446 2926 gene locus_tag LOCUS_45480 446 2926 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_45480 3023 3313 gene locus_tag LOCUS_45490 3023 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 3360 4739 gene locus_tag LOCUS_45500 3360 4739 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_45500 4837 5703 gene locus_tag LOCUS_45510 4837 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 5767 6006 gene locus_tag LOCUS_45520 5767 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 >Feature sequence0499 776 3151 gene locus_tag LOCUS_45530 776 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 3358 4209 gene locus_tag LOCUS_45540 3358 4209 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_45540 4940 4200 gene locus_tag LOCUS_45550 4940 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 5111 6805 gene locus_tag LOCUS_45560 5111 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 >Feature sequence0500 66 767 gene locus_tag LOCUS_45570 66 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 848 1207 gene locus_tag LOCUS_45580 848 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 1209 1433 gene locus_tag LOCUS_45590 1209 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 1433 1636 gene locus_tag LOCUS_45600 1433 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 1694 3178 gene locus_tag LOCUS_45610 1694 3178 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_45610 3202 3564 gene locus_tag LOCUS_45620 3202 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 3660 4634 gene locus_tag LOCUS_45630 3660 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 4618 4884 gene locus_tag LOCUS_45640 4618 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 4877 5293 gene locus_tag LOCUS_45650 4877 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 5361 5540 gene locus_tag LOCUS_45660 5361 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 >Feature sequence0501 399 1289 gene locus_tag LOCUS_45670 399 1289 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_45670 1344 1721 gene locus_tag LOCUS_45680 1344 1721 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_45680 1718 2965 gene locus_tag LOCUS_45690 1718 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 2972 3727 gene locus_tag LOCUS_45700 2972 3727 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_45700 3807 5693 gene locus_tag LOCUS_45710 3807 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 6303 5824 gene locus_tag LOCUS_45720 6303 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 >Feature sequence0502 2808 2029 gene locus_tag LOCUS_45730 2808 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 4496 3183 gene locus_tag LOCUS_45740 4496 3183 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_45740 6738 4606 gene locus_tag LOCUS_45750 6738 4606 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_45750 >Feature sequence0503 1377 52 gene locus_tag LOCUS_45760 1377 52 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_45760 3184 1565 gene locus_tag LOCUS_45770 3184 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5004 3475 gene locus_tag LOCUS_45780 5004 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 5839 5012 gene locus_tag LOCUS_45790 5839 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946778.1 protein_id gnl|my_center|LOCUS_45790 <6829 5870 gene locus_tag LOCUS_45800 <6829 5870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083225.1:FAD-dependent oxidoreductase >Feature sequence0504 1197 1394 gene locus_tag LOCUS_45810 1197 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 4612 1508 gene locus_tag LOCUS_45820 4612 1508 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_45820 5065 4697 gene locus_tag LOCUS_45830 5065 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 5195 5764 gene locus_tag LOCUS_45840 5195 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 6002 6754 gene locus_tag LOCUS_45850 6002 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 >Feature sequence0505 995 18 gene locus_tag LOCUS_45860 995 18 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_45860 2763 1390 gene locus_tag LOCUS_45870 2763 1390 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_45870 3841 2903 gene locus_tag LOCUS_45880 3841 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 4453 3893 gene locus_tag LOCUS_45890 4453 3893 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_45890 6035 4641 gene locus_tag LOCUS_45900 6035 4641 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_45900 <6811 6078 gene locus_tag LOCUS_45910 <6811 6078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922542.1:DUF1553 domain-containing protein >Feature sequence0506 3054 1036 gene locus_tag LOCUS_45920 3054 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 3586 2987 gene locus_tag LOCUS_45930 3586 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 5215 4082 gene locus_tag LOCUS_45940 5215 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 <6809 5218 gene locus_tag LOCUS_45950 <6809 5218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114120.1:KinB sensor domain-containing domain >Feature sequence0507 2984 2316 gene locus_tag LOCUS_45960 2984 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 5012 3144 gene locus_tag LOCUS_45970 5012 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 5241 5050 gene locus_tag LOCUS_45980 5241 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 6073 5408 gene locus_tag LOCUS_45990 6073 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 6721 6083 gene locus_tag LOCUS_46000 6721 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence0508 1300 989 gene locus_tag LOCUS_46010 1300 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 1866 3719 gene locus_tag LOCUS_46020 1866 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_46020 3982 4962 gene locus_tag LOCUS_46030 3982 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 5098 6195 gene locus_tag LOCUS_46040 5098 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 >Feature sequence0509 795 106 gene locus_tag LOCUS_46050 795 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 2222 873 gene locus_tag LOCUS_46060 2222 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 3121 2417 gene locus_tag LOCUS_46070 gene bioD 3121 2417 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_46070 4500 3118 gene locus_tag LOCUS_46080 gene bioA 4500 3118 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_46080 5291 4506 gene locus_tag LOCUS_46090 5291 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 5652 5461 gene locus_tag LOCUS_46100 5652 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 5597 6028 gene locus_tag LOCUS_46110 5597 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 6632 6063 gene locus_tag LOCUS_46120 gene efp 6632 6063 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082309.1 protein_id gnl|my_center|LOCUS_46120 >Feature sequence0510 2389 1892 gene locus_tag LOCUS_46130 2389 1892 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_46130 3468 2608 gene locus_tag LOCUS_46140 3468 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 3643 5985 gene locus_tag LOCUS_46150 3643 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 >Feature sequence0511 271 942 gene locus_tag LOCUS_46160 271 942 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_46160 2366 1071 gene locus_tag LOCUS_46170 gene proP 2366 1071 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198608.1 protein_id gnl|my_center|LOCUS_46170 2816 2463 gene locus_tag LOCUS_46180 2816 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 3067 3687 gene locus_tag LOCUS_46190 3067 3687 CDS product DUF4337 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083279.1 protein_id gnl|my_center|LOCUS_46190 4603 3791 gene locus_tag LOCUS_46200 4603 3791 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_46200 4961 4692 gene locus_tag LOCUS_46210 4961 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 5119 6717 gene locus_tag LOCUS_46220 5119 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence0512 1207 914 gene locus_tag LOCUS_46230 1207 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 4469 1515 gene locus_tag LOCUS_46240 gene purL 4469 1515 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_46240 5322 4453 gene locus_tag LOCUS_46250 5322 4453 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_46250 5974 5372 gene locus_tag LOCUS_46260 5974 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 6718 5993 gene locus_tag LOCUS_46270 6718 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 >Feature sequence0513 1213 458 gene locus_tag LOCUS_46280 1213 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 2505 1210 gene locus_tag LOCUS_46290 2505 1210 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_46290 2876 2511 gene locus_tag LOCUS_46300 2876 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 3199 2969 gene locus_tag LOCUS_46310 3199 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 4923 3277 gene locus_tag LOCUS_46320 4923 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 5381 5157 gene locus_tag LOCUS_46330 5381 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 5690 5454 gene locus_tag LOCUS_46340 5690 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 5962 5687 gene locus_tag LOCUS_46350 5962 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 6488 6102 gene locus_tag LOCUS_46360 6488 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 >Feature sequence0514 1881 454 gene locus_tag LOCUS_46370 1881 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 3069 1972 gene locus_tag LOCUS_46380 3069 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 3455 3114 gene locus_tag LOCUS_46390 3455 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 3675 3460 gene locus_tag LOCUS_46400 3675 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 5482 3722 gene locus_tag LOCUS_46410 5482 3722 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336666.1 protein_id gnl|my_center|LOCUS_46410 >Feature sequence0515 >Feature sequence0516 2163 2257 gene locus_tag LOCUS_t00430 2163 2257 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3701 2388 gene locus_tag LOCUS_46420 3701 2388 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_46420 5627 4119 gene locus_tag LOCUS_46430 5627 4119 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 protein_id gnl|my_center|LOCUS_46430 <6753 5757 gene locus_tag LOCUS_46440 <6753 5757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence0517 1095 34 gene locus_tag LOCUS_46450 gene modC 1095 34 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836198.1 protein_id gnl|my_center|LOCUS_46450 1796 1104 gene locus_tag LOCUS_46460 gene modB 1796 1104 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097514.1 protein_id gnl|my_center|LOCUS_46460 2637 1828 gene locus_tag LOCUS_46470 gene modA 2637 1828 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951413.1 protein_id gnl|my_center|LOCUS_46470 3614 2643 gene locus_tag LOCUS_46480 3614 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 3833 3633 gene locus_tag LOCUS_46490 3833 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 4756 3965 gene locus_tag LOCUS_46500 4756 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 6557 5160 gene locus_tag LOCUS_46510 6557 5160 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_46510 >Feature sequence0518 344 4297 gene locus_tag LOCUS_46520 344 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 4384 5763 gene locus_tag LOCUS_46530 4384 5763 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946005.1 protein_id gnl|my_center|LOCUS_46530 <6731 5850 gene locus_tag LOCUS_46540 <6731 5850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326414.1:S1 RNA-binding domain-containing protein >Feature sequence0519 1482 4 gene locus_tag LOCUS_46550 gene rfaE1 1482 4 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_46550 1958 1644 gene locus_tag LOCUS_46560 1958 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 3020 1992 gene locus_tag LOCUS_46570 3020 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_46570 4147 3062 gene locus_tag LOCUS_46580 gene lpxK 4147 3062 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_46580 6219 4573 gene locus_tag LOCUS_46590 6219 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085894.1 protein_id gnl|my_center|LOCUS_46590 >Feature sequence0520 385 263 gene locus_tag LOCUS_46600 385 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 564 1934 gene locus_tag LOCUS_46610 gene icd 564 1934 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_46610 2247 2017 gene locus_tag LOCUS_46620 2247 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 3383 2379 gene locus_tag LOCUS_46630 3383 2379 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_46630 4053 3445 gene locus_tag LOCUS_46640 4053 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 4282 5697 gene locus_tag LOCUS_46650 4282 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 5931 6293 gene locus_tag LOCUS_46660 5931 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence0521 117 707 gene locus_tag LOCUS_46670 117 707 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615894.1 protein_id gnl|my_center|LOCUS_46670 720 1250 gene locus_tag LOCUS_46680 720 1250 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957571.1 protein_id gnl|my_center|LOCUS_46680 1468 2241 gene locus_tag LOCUS_46690 1468 2241 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_46690 2263 4011 gene locus_tag LOCUS_46700 2263 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145058669.1 protein_id gnl|my_center|LOCUS_46700 4011 4859 gene locus_tag LOCUS_46710 4011 4859 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_46710 5172 5741 gene locus_tag LOCUS_46720 5172 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 >Feature sequence0522 1 330 gene locus_tag LOCUS_46730 1 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 579 980 gene locus_tag LOCUS_46740 579 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 996 1187 gene locus_tag LOCUS_46750 996 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 1227 1700 gene locus_tag LOCUS_46760 1227 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 1798 2982 gene locus_tag LOCUS_46770 1798 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 2979 3707 gene locus_tag LOCUS_46780 2979 3707 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120080.1 protein_id gnl|my_center|LOCUS_46780 4755 3757 gene locus_tag LOCUS_46790 4755 3757 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485753.1 protein_id gnl|my_center|LOCUS_46790 5467 4835 gene locus_tag LOCUS_46800 5467 4835 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257866.1 protein_id gnl|my_center|LOCUS_46800 5801 5433 gene locus_tag LOCUS_46810 5801 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 >Feature sequence0523 1292 444 gene locus_tag LOCUS_46820 1292 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 1431 2099 gene locus_tag LOCUS_46830 1431 2099 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615797.1 protein_id gnl|my_center|LOCUS_46830 2134 2595 gene locus_tag LOCUS_46840 gene phnB 2134 2595 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_46840 3678 2638 gene locus_tag LOCUS_46850 3678 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 4670 3747 gene locus_tag LOCUS_46860 4670 3747 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_46860 6459 4804 gene locus_tag LOCUS_46870 6459 4804 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_46870 >Feature sequence0524 482 2035 gene locus_tag LOCUS_46880 gene glgA 482 2035 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_46880 2260 4560 gene locus_tag LOCUS_46890 2260 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 4611 5729 gene locus_tag LOCUS_46900 gene galT 4611 5729 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_46900 5992 6624 gene locus_tag LOCUS_46910 gene nadD 5992 6624 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_46910 >Feature sequence0525 4405 2831 gene locus_tag LOCUS_46920 4405 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 6516 4546 gene locus_tag LOCUS_46930 6516 4546 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_46930 >Feature sequence0526 72 494 gene locus_tag LOCUS_46940 72 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 660 1391 gene locus_tag LOCUS_46950 660 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 1427 4036 gene locus_tag LOCUS_46960 1427 4036 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_46960 4142 5311 gene locus_tag LOCUS_46970 4142 5311 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_46970 5497 5757 gene locus_tag LOCUS_46980 5497 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 6336 5785 gene locus_tag LOCUS_46990 6336 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 >Feature sequence0527 1364 90 gene locus_tag LOCUS_47000 1364 90 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_47000 5720 1560 gene locus_tag LOCUS_47010 5720 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 6093 6272 gene locus_tag LOCUS_47020 6093 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 >Feature sequence0528 5192 69 gene locus_tag LOCUS_47030 5192 69 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146390841.1 protein_id gnl|my_center|LOCUS_47030 5427 6599 gene locus_tag LOCUS_47040 5427 6599 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence0529 521 1624 gene locus_tag LOCUS_47050 521 1624 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921527.1 protein_id gnl|my_center|LOCUS_47050 1830 1654 gene locus_tag LOCUS_47060 1830 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 2803 1850 gene locus_tag LOCUS_47070 2803 1850 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_47070 2999 4300 gene locus_tag LOCUS_47080 2999 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 5020 5796 gene locus_tag LOCUS_47090 5020 5796 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_47090 5995 5786 gene locus_tag LOCUS_47100 5995 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 6039 6512 gene locus_tag LOCUS_47110 6039 6512 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_47110 >Feature sequence0530 1271 180 gene locus_tag LOCUS_47120 1271 180 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223424.1 protein_id gnl|my_center|LOCUS_47120 1328 1549 gene locus_tag LOCUS_47130 1328 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 1888 1463 gene locus_tag LOCUS_47140 1888 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 2080 3906 gene locus_tag LOCUS_47150 gene glmS 2080 3906 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_47150 4037 5638 gene locus_tag LOCUS_47160 4037 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 5651 6577 gene locus_tag LOCUS_47170 5651 6577 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813621.1 protein_id gnl|my_center|LOCUS_47170 >Feature sequence0531 1619 27 gene locus_tag LOCUS_47180 1619 27 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_47180 1837 3075 gene locus_tag LOCUS_47190 1837 3075 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_47190 4187 3171 gene locus_tag LOCUS_47200 4187 3171 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_47200 4422 5321 gene locus_tag LOCUS_47210 4422 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 5374 6492 gene locus_tag LOCUS_47220 5374 6492 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_47220 >Feature sequence0532 914 2251 gene locus_tag LOCUS_47230 914 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 2383 3921 gene locus_tag LOCUS_47240 2383 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 6367 3959 gene locus_tag LOCUS_47250 6367 3959 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_47250 >Feature sequence0533 177 899 gene locus_tag LOCUS_47260 177 899 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064694.1 protein_id gnl|my_center|LOCUS_47260 943 2160 gene locus_tag LOCUS_47270 943 2160 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_47270 2825 2268 gene locus_tag LOCUS_47280 2825 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 3548 4882 gene locus_tag LOCUS_47290 3548 4882 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_47290 6107 5004 gene locus_tag LOCUS_47300 6107 5004 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_47300 6523 6104 gene locus_tag LOCUS_47310 6523 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 >Feature sequence0534 <1 4565 gene locus_tag LOCUS_47320 <1 4565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922115.1:PQQ-binding-like beta-propeller repeat protein 4654 5748 gene locus_tag LOCUS_47330 4654 5748 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_47330 6519 5821 gene locus_tag LOCUS_47340 6519 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 >Feature sequence0535 1456 302 gene locus_tag LOCUS_47350 1456 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 2275 1556 gene locus_tag LOCUS_47360 2275 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 5479 2585 gene locus_tag LOCUS_47370 5479 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 >Feature sequence0536 3384 85 gene locus_tag LOCUS_47380 3384 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 3628 3981 gene locus_tag LOCUS_47390 3628 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 4161 4589 gene locus_tag LOCUS_47400 4161 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 5786 4632 gene locus_tag LOCUS_47410 5786 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 6362 5808 gene locus_tag LOCUS_47420 6362 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 >Feature sequence0537 229 1485 gene locus_tag LOCUS_47430 229 1485 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_47430 2873 1521 gene locus_tag LOCUS_47440 2873 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616020.1 protein_id gnl|my_center|LOCUS_47440 3134 4486 gene locus_tag LOCUS_47450 3134 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 4606 5547 gene locus_tag LOCUS_47460 4606 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 >Feature sequence0538 118 1281 gene locus_tag LOCUS_47470 118 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 1349 5782 gene locus_tag LOCUS_47480 1349 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 5808 6494 gene locus_tag LOCUS_47490 5808 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 >Feature sequence0539 991 1911 gene locus_tag LOCUS_47500 991 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 3594 2101 gene locus_tag LOCUS_47510 3594 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 3733 3975 gene locus_tag LOCUS_47520 3733 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 3960 4304 gene locus_tag LOCUS_47530 3960 4304 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_47530 5153 4500 gene locus_tag LOCUS_47540 5153 4500 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_47540 >Feature sequence0540 345 2234 gene locus_tag LOCUS_47550 345 2234 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_47550 2553 2260 gene locus_tag LOCUS_47560 2553 2260 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_47560 2888 4363 gene locus_tag LOCUS_47570 2888 4363 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 protein_id gnl|my_center|LOCUS_47570 6189 4378 gene locus_tag LOCUS_47580 6189 4378 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_47580 >Feature sequence0541 2719 3003 gene locus_tag LOCUS_47590 2719 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 3146 3583 gene locus_tag LOCUS_47600 3146 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 3620 5104 gene locus_tag LOCUS_47610 3620 5104 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_47610 5110 5586 gene locus_tag LOCUS_47620 5110 5586 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_47620 5827 6051 gene locus_tag LOCUS_47630 5827 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 >Feature sequence0542 94 1134 gene locus_tag LOCUS_47640 94 1134 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_47640 1302 2966 gene locus_tag LOCUS_47650 1302 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 3024 3956 gene locus_tag LOCUS_47660 3024 3956 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_47660 4000 4527 gene locus_tag LOCUS_47670 4000 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 4517 4765 gene locus_tag LOCUS_47680 4517 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 >Feature sequence0543 4175 2841 gene locus_tag LOCUS_47690 4175 2841 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_47690 4474 5241 gene locus_tag LOCUS_47700 4474 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence0544 365 718 gene locus_tag LOCUS_47710 365 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 742 1041 gene locus_tag LOCUS_47720 742 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 2637 1048 gene locus_tag LOCUS_47730 2637 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 2867 2658 gene locus_tag LOCUS_47740 2867 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 3293 2880 gene locus_tag LOCUS_47750 3293 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 5207 3351 gene locus_tag LOCUS_47760 5207 3351 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_47760 5435 6439 gene locus_tag LOCUS_47770 5435 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_47770 >Feature sequence0545 395 1303 gene locus_tag LOCUS_47780 395 1303 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_47780 1331 2599 gene locus_tag LOCUS_47790 1331 2599 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_47790 3048 5138 gene locus_tag LOCUS_47800 3048 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 5645 5265 gene locus_tag LOCUS_47810 5645 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 5745 6326 gene locus_tag LOCUS_47820 5745 6326 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928883.1 protein_id gnl|my_center|LOCUS_47820 >Feature sequence0546 321 34 gene locus_tag LOCUS_47830 321 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 1445 444 gene locus_tag LOCUS_47840 1445 444 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_47840 3464 1554 gene locus_tag LOCUS_47850 3464 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 4466 3672 gene locus_tag LOCUS_47860 4466 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 5828 4536 gene locus_tag LOCUS_47870 5828 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 6280 5825 gene locus_tag LOCUS_47880 6280 5825 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_47880 >Feature sequence0547 3389 36 gene locus_tag LOCUS_47890 gene mfd 3389 36 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_47890 3924 3529 gene locus_tag LOCUS_47900 3924 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 5047 3959 gene locus_tag LOCUS_47910 5047 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 >Feature sequence0548 616 2121 gene locus_tag LOCUS_47920 616 2121 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035575.1 protein_id gnl|my_center|LOCUS_47920 3496 2240 gene locus_tag LOCUS_47930 3496 2240 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729293.1 protein_id gnl|my_center|LOCUS_47930 3956 4735 gene locus_tag LOCUS_47940 3956 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 6219 4930 gene locus_tag LOCUS_47950 6219 4930 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_47950 >Feature sequence0549 856 3918 gene locus_tag LOCUS_47960 856 3918 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_47960 4192 4857 gene locus_tag LOCUS_47970 4192 4857 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_47970 >Feature sequence0550 1042 65 gene locus_tag LOCUS_47980 1042 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 1662 1048 gene locus_tag LOCUS_47990 1662 1048 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_47990 2284 1859 gene locus_tag LOCUS_48000 2284 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 <6428 2430 gene locus_tag LOCUS_48010 <6428 2430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143069.1:cobaltochelatase subunit CobN >Feature sequence0551 1058 105 gene locus_tag LOCUS_48020 1058 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 1447 1262 gene locus_tag LOCUS_48030 1447 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 1842 1483 gene locus_tag LOCUS_48040 1842 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 2585 1839 gene locus_tag LOCUS_48050 2585 1839 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_48050 3413 2604 gene locus_tag LOCUS_48060 3413 2604 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816911.1 protein_id gnl|my_center|LOCUS_48060 4190 3435 gene locus_tag LOCUS_48070 4190 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 5720 4305 gene locus_tag LOCUS_48080 5720 4305 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112138.1 protein_id gnl|my_center|LOCUS_48080 >Feature sequence0552 1417 383 gene locus_tag LOCUS_48090 1417 383 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921527.1 protein_id gnl|my_center|LOCUS_48090 3141 1813 gene locus_tag LOCUS_48100 3141 1813 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_48100 5789 3189 gene locus_tag LOCUS_48110 5789 3189 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146524746.1 protein_id gnl|my_center|LOCUS_48110 >Feature sequence0553 1979 321 gene locus_tag LOCUS_48120 1979 321 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_48120 2987 2088 gene locus_tag LOCUS_48130 gene rsmA 2987 2088 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_48130 3585 2992 gene locus_tag LOCUS_48140 3585 2992 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_48140 6104 3726 gene locus_tag LOCUS_48150 6104 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence0554 2611 5 gene locus_tag LOCUS_48160 2611 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 3289 2864 gene locus_tag LOCUS_48170 3289 2864 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140723.1 protein_id gnl|my_center|LOCUS_48170 3498 3286 gene locus_tag LOCUS_48180 3498 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 4718 3570 gene locus_tag LOCUS_48190 4718 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 5664 4783 gene locus_tag LOCUS_48200 5664 4783 CDS product enoyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871451.1 protein_id gnl|my_center|LOCUS_48200 5946 6335 gene locus_tag LOCUS_48210 5946 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 >Feature sequence0555 151 969 gene locus_tag LOCUS_48220 gene cdaA 151 969 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_48220 1079 2098 gene locus_tag LOCUS_48230 1079 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 2095 3396 gene locus_tag LOCUS_48240 2095 3396 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_48240 3444 5024 gene locus_tag LOCUS_48250 3444 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 6229 5129 gene locus_tag LOCUS_48260 6229 5129 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_48260 >Feature sequence0556 1190 75 gene locus_tag LOCUS_48270 1190 75 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_48270 2371 1376 gene locus_tag LOCUS_48280 2371 1376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_48280 3541 2405 gene locus_tag LOCUS_48290 3541 2405 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393402.1 protein_id gnl|my_center|LOCUS_48290 3880 4488 gene locus_tag LOCUS_48300 3880 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 4603 6234 gene locus_tag LOCUS_48310 4603 6234 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_48310 >Feature sequence0557 2776 2153 gene locus_tag LOCUS_48320 2776 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 3001 3411 gene locus_tag LOCUS_48330 3001 3411 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082826795.1 protein_id gnl|my_center|LOCUS_48330 >Feature sequence0558 2114 783 gene locus_tag LOCUS_48340 gene nuoF 2114 783 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_48340 2538 2137 gene locus_tag LOCUS_48350 2538 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 2898 2545 gene locus_tag LOCUS_48360 2898 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 3425 2946 gene locus_tag LOCUS_48370 gene nuoE 3425 2946 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_48370 4683 3463 gene locus_tag LOCUS_48380 gene nuoD 4683 3463 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969257.1 protein_id gnl|my_center|LOCUS_48380 5244 4741 gene locus_tag LOCUS_48390 5244 4741 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_48390 5876 5289 gene locus_tag LOCUS_48400 5876 5289 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174271.1 protein_id gnl|my_center|LOCUS_48400 6265 5867 gene locus_tag LOCUS_48410 6265 5867 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_48410 >Feature sequence0559 1335 85 gene locus_tag LOCUS_48420 1335 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 2917 1448 gene locus_tag LOCUS_48430 2917 1448 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799194.1 protein_id gnl|my_center|LOCUS_48430 3007 3477 gene locus_tag LOCUS_48440 3007 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 5100 3664 gene locus_tag LOCUS_48450 5100 3664 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_48450 <6337 5156 gene locus_tag LOCUS_48460 <6337 5156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616161.1:HAMP domain-containing sensor histidine kinase >Feature sequence0560 397 2391 gene locus_tag LOCUS_48470 397 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 2448 3473 gene locus_tag LOCUS_48480 2448 3473 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_48480 3488 4297 gene locus_tag LOCUS_48490 3488 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 4341 4637 gene locus_tag LOCUS_48500 4341 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 4634 4927 gene locus_tag LOCUS_48510 4634 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 5972 4965 gene locus_tag LOCUS_48520 5972 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 6328 6056 gene locus_tag LOCUS_48530 6328 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 >Feature sequence0561 935 87 gene locus_tag LOCUS_48540 935 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 1764 925 gene locus_tag LOCUS_48550 1764 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 2023 3006 gene locus_tag LOCUS_48560 2023 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 4389 3034 gene locus_tag LOCUS_48570 4389 3034 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_48570 5312 4521 gene locus_tag LOCUS_48580 5312 4521 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_48580 5522 5980 gene locus_tag LOCUS_48590 5522 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 >Feature sequence0562 399 1355 gene locus_tag LOCUS_48600 399 1355 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_48600 1482 3038 gene locus_tag LOCUS_48610 gene gltX 1482 3038 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_48610 3184 3936 gene locus_tag LOCUS_48620 3184 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 3969 5654 gene locus_tag LOCUS_48630 3969 5654 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_48630 5668 6228 gene locus_tag LOCUS_48640 5668 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 >Feature sequence0563 <1 1234 gene locus_tag LOCUS_48650 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257660.1:tetratricopeptide repeat protein 1939 1436 gene locus_tag LOCUS_48660 1939 1436 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_48660 2270 2959 gene locus_tag LOCUS_48670 2270 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 2980 3516 gene locus_tag LOCUS_48680 2980 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 5354 3651 gene locus_tag LOCUS_48690 5354 3651 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_48690 5917 5351 gene locus_tag LOCUS_48700 5917 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 6284 5982 gene locus_tag LOCUS_48710 6284 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 protein_id gnl|my_center|LOCUS_48710 >Feature sequence0564 2460 46 gene locus_tag LOCUS_48720 2460 46 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_48720 2824 2609 gene locus_tag LOCUS_48730 2824 2609 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_48730 5740 2987 gene locus_tag LOCUS_48740 5740 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence0565 3748 98 gene locus_tag LOCUS_48750 3748 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 4146 3811 gene locus_tag LOCUS_48760 4146 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 4627 4208 gene locus_tag LOCUS_48770 4627 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 5943 4627 gene locus_tag LOCUS_48780 5943 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 >Feature sequence0566 137 1171 gene locus_tag LOCUS_48790 137 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 1711 1244 gene locus_tag LOCUS_48800 1711 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 1758 3899 gene locus_tag LOCUS_48810 1758 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 4134 4829 gene locus_tag LOCUS_48820 4134 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 >Feature sequence0567 220 1617 gene locus_tag LOCUS_48830 220 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 2482 1727 gene locus_tag LOCUS_48840 2482 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 4441 2570 gene locus_tag LOCUS_48850 4441 2570 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_48850 >Feature sequence0568 174 1103 gene locus_tag LOCUS_48860 174 1103 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_48860 1165 1247 gene locus_tag LOCUS_t00440 1165 1247 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1272 1664 gene locus_tag LOCUS_48870 1272 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 2221 5454 gene locus_tag LOCUS_48880 2221 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 >Feature sequence0569 6208 5600 gene locus_tag LOCUS_48890 6208 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 >Feature sequence0570 1073 33 gene locus_tag LOCUS_48900 1073 33 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_48900 1191 2498 gene locus_tag LOCUS_48910 1191 2498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731096.1 protein_id gnl|my_center|LOCUS_48910 2800 6267 gene locus_tag LOCUS_48920 2800 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 >Feature sequence0571 47 949 gene locus_tag LOCUS_48930 47 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 1050 1181 gene locus_tag LOCUS_48940 1050 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 1555 4056 gene locus_tag LOCUS_48950 1555 4056 CDS product SHD1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117996.1 protein_id gnl|my_center|LOCUS_48950 4287 6116 gene locus_tag LOCUS_48960 4287 6116 CDS product mucoidy inhibitor MuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_48960 >Feature sequence0572 1709 9 gene locus_tag LOCUS_48970 1709 9 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_48970 2264 3151 gene locus_tag LOCUS_48980 2264 3151 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922494.1 protein_id gnl|my_center|LOCUS_48980 3186 4016 gene locus_tag LOCUS_48990 3186 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 4517 4089 gene locus_tag LOCUS_49000 4517 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 6165 4891 gene locus_tag LOCUS_49010 6165 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 >Feature sequence0573 1428 61 gene locus_tag LOCUS_49020 1428 61 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_49020 2374 1634 gene locus_tag LOCUS_49030 2374 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 2906 2364 gene locus_tag LOCUS_49040 2906 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 3088 3423 gene locus_tag LOCUS_49050 3088 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 3720 4244 gene locus_tag LOCUS_49060 3720 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 4313 4507 gene locus_tag LOCUS_49070 4313 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096763.1 protein_id gnl|my_center|LOCUS_49070 4579 5313 gene locus_tag LOCUS_49080 4579 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 5317 6183 gene locus_tag LOCUS_49090 5317 6183 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_49090 >Feature sequence0574 335 1192 gene locus_tag LOCUS_49100 gene rfbD 335 1192 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_49100 1227 1802 gene locus_tag LOCUS_49110 1227 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 2133 2396 gene locus_tag LOCUS_49120 2133 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 2393 2623 gene locus_tag LOCUS_49130 2393 2623 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_49130 2664 5009 gene locus_tag LOCUS_49140 2664 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 5061 5279 gene locus_tag LOCUS_49150 5061 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 >Feature sequence0575 2511 1363 gene locus_tag LOCUS_49160 2511 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 3696 2557 gene locus_tag LOCUS_49170 3696 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 4837 3719 gene locus_tag LOCUS_49180 4837 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 6107 5136 gene locus_tag LOCUS_49190 6107 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 >Feature sequence0576 562 1251 gene locus_tag LOCUS_49200 562 1251 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_49200 1515 2204 gene locus_tag LOCUS_49210 1515 2204 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_49210 2343 3260 gene locus_tag LOCUS_49220 2343 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 3272 4258 gene locus_tag LOCUS_49230 3272 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 4368 4850 gene locus_tag LOCUS_49240 4368 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 4847 6136 gene locus_tag LOCUS_49250 4847 6136 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_49250 >Feature sequence0577 2422 1196 gene locus_tag LOCUS_49260 2422 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 >Feature sequence0578 <1 969 gene locus_tag LOCUS_49270 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257005.1:GDP-mannose 4,6-dehydratase 972 1913 gene locus_tag LOCUS_49280 972 1913 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_49280 2155 4938 gene locus_tag LOCUS_49290 2155 4938 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870567.1 protein_id gnl|my_center|LOCUS_49290 5951 5001 gene locus_tag LOCUS_49300 5951 5001 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_49300 >Feature sequence0579 <1 1603 gene locus_tag LOCUS_49310 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487114.1:nitrate reductase subunit alpha 1634 2686 gene locus_tag LOCUS_49320 1634 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 2799 3530 gene locus_tag LOCUS_49330 2799 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 3527 4174 gene locus_tag LOCUS_49340 3527 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 4171 4425 gene locus_tag LOCUS_49350 4171 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 5097 4471 gene locus_tag LOCUS_49360 5097 4471 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838972.1 protein_id gnl|my_center|LOCUS_49360 5621 5178 gene locus_tag LOCUS_49370 5621 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 6155 5670 gene locus_tag LOCUS_49380 6155 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 >Feature sequence0580 942 169 gene locus_tag LOCUS_49390 942 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 1661 1050 gene locus_tag LOCUS_49400 gene hisH 1661 1050 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_49400 2779 1664 gene locus_tag LOCUS_49410 2779 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 3393 2995 gene locus_tag LOCUS_49420 3393 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 5108 3525 gene locus_tag LOCUS_49430 5108 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 <6152 5343 gene locus_tag LOCUS_49440 <6152 5343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005460310.1:ATP-dependent chaperone ClpB >Feature sequence0581 1531 104 gene locus_tag LOCUS_49450 1531 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 2152 2064 gene locus_tag LOCUS_t00450 2152 2064 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2682 2981 gene locus_tag LOCUS_49460 2682 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 3009 3830 gene locus_tag LOCUS_49470 3009 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 >Feature sequence0582 337 1338 gene locus_tag LOCUS_49480 337 1338 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_49480 1706 1401 gene locus_tag LOCUS_49490 1706 1401 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143803.1 protein_id gnl|my_center|LOCUS_49490 2426 1866 gene locus_tag LOCUS_49500 gene frr 2426 1866 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_49500 3196 2462 gene locus_tag LOCUS_49510 gene pyrH 3196 2462 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_49510 3563 6091 gene locus_tag LOCUS_49520 3563 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 >Feature sequence0583 125 1144 gene locus_tag LOCUS_49530 125 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 2004 1477 gene locus_tag LOCUS_49540 2004 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 2781 2260 gene locus_tag LOCUS_49550 2781 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 4193 2931 gene locus_tag LOCUS_49560 4193 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 5003 4581 gene locus_tag LOCUS_49570 5003 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 5222 6085 gene locus_tag LOCUS_49580 5222 6085 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315826.1 protein_id gnl|my_center|LOCUS_49580 >Feature sequence0584 1300 23 gene locus_tag LOCUS_49590 1300 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 1524 2660 gene locus_tag LOCUS_49600 gene proB 1524 2660 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_49600 2892 4010 gene locus_tag LOCUS_49610 2892 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 4151 5134 gene locus_tag LOCUS_49620 4151 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 >Feature sequence0585 97 2493 gene locus_tag LOCUS_49630 97 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 2506 3114 gene locus_tag LOCUS_49640 2506 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 3815 3342 gene locus_tag LOCUS_49650 3815 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 4023 4763 gene locus_tag LOCUS_49660 gene recO 4023 4763 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119985.1 protein_id gnl|my_center|LOCUS_49660 >Feature sequence0586 1086 79 gene locus_tag LOCUS_49670 1086 79 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_49670 1199 1414 gene locus_tag LOCUS_49680 1199 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 1555 3282 gene locus_tag LOCUS_49690 gene ilvB 1555 3282 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_49690 3547 3371 gene locus_tag LOCUS_49700 3547 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 4464 3697 gene locus_tag LOCUS_49710 gene surE 4464 3697 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_49710 4622 5719 gene locus_tag LOCUS_49720 4622 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 5782 5857 gene locus_tag LOCUS_t00460 5782 5857 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0587 49 6000 gene locus_tag LOCUS_49730 49 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 >Feature sequence0588 4172 1704 gene locus_tag LOCUS_49740 4172 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 <6084 4636 gene locus_tag LOCUS_49750 <6084 4636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886371.1:lysine methyltransferase >Feature sequence0589 376 1245 gene locus_tag LOCUS_49760 376 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 1503 3911 gene locus_tag LOCUS_49770 1503 3911 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_49770 3908 4849 gene locus_tag LOCUS_49780 3908 4849 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206386.1 protein_id gnl|my_center|LOCUS_49780 >Feature sequence0590 1897 59 gene locus_tag LOCUS_49790 1897 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 3215 2316 gene locus_tag LOCUS_49800 3215 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 3354 3731 gene locus_tag LOCUS_49810 3354 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 4152 4388 gene locus_tag LOCUS_49820 4152 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 4385 4837 gene locus_tag LOCUS_49830 4385 4837 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_49830 4968 5834 gene locus_tag LOCUS_49840 4968 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 >Feature sequence0591 1118 507 gene locus_tag LOCUS_49850 1118 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 1819 1118 gene locus_tag LOCUS_49860 1819 1118 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_49860 2106 1816 gene locus_tag LOCUS_49870 gene sdpR 2106 1816 CDS product sporulation delaying system autorepressor SdpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243541.1 protein_id gnl|my_center|LOCUS_49870 2297 2707 gene locus_tag LOCUS_49880 2297 2707 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_49880 2868 4331 gene locus_tag LOCUS_49890 2868 4331 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 protein_id gnl|my_center|LOCUS_49890 4376 4957 gene locus_tag LOCUS_49900 4376 4957 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_49900 5077 5922 gene locus_tag LOCUS_49910 5077 5922 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967715.1 protein_id gnl|my_center|LOCUS_49910 >Feature sequence0592 1371 85 gene locus_tag LOCUS_49920 1371 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 1861 1481 gene locus_tag LOCUS_49930 gene rplU 1861 1481 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_49930 2447 1962 gene locus_tag LOCUS_49940 2447 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 3305 2460 gene locus_tag LOCUS_49950 3305 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 4427 3312 gene locus_tag LOCUS_49960 4427 3312 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_49960 4947 4561 gene locus_tag LOCUS_49970 4947 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 6055 5102 gene locus_tag LOCUS_49980 gene carA 6055 5102 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_49980 >Feature sequence0593 218 1231 gene locus_tag LOCUS_49990 gene aroF 218 1231 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_49990 1369 3633 gene locus_tag LOCUS_50000 1369 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 3844 4965 gene locus_tag LOCUS_50010 3844 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 4962 5318 gene locus_tag LOCUS_50020 4962 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 5349 6005 gene locus_tag LOCUS_50030 5349 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 >Feature sequence0594 28 1047 gene locus_tag LOCUS_50040 gene hpnH 28 1047 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_50040 2442 1138 gene locus_tag LOCUS_50050 2442 1138 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_50050 2719 3513 gene locus_tag LOCUS_50060 2719 3513 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_50060 4633 3560 gene locus_tag LOCUS_50070 4633 3560 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085499.1 protein_id gnl|my_center|LOCUS_50070 5003 5344 gene locus_tag LOCUS_50080 5003 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 >Feature sequence0595 1080 151 gene locus_tag LOCUS_50090 1080 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 3920 1299 gene locus_tag LOCUS_50100 3920 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 4536 4123 gene locus_tag LOCUS_50110 4536 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 5115 4576 gene locus_tag LOCUS_50120 5115 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 >Feature sequence0596 995 615 gene locus_tag LOCUS_50130 995 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 1972 1127 gene locus_tag LOCUS_50140 1972 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 2863 2018 gene locus_tag LOCUS_50150 2863 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 3779 2901 gene locus_tag LOCUS_50160 3779 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 3972 5069 gene locus_tag LOCUS_50170 3972 5069 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_50170 5620 5339 gene locus_tag LOCUS_50180 5620 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 >Feature sequence0597 <1 516 gene locus_tag LOCUS_50190 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007336701.1:GTP cyclohydrolase I FolE 527 1396 gene locus_tag LOCUS_50200 527 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 1393 1845 gene locus_tag LOCUS_50210 1393 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 1978 4974 gene locus_tag LOCUS_50220 1978 4974 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_50220 4971 5210 gene locus_tag LOCUS_50230 4971 5210 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120576.1 protein_id gnl|my_center|LOCUS_50230 5294 5554 gene locus_tag LOCUS_50240 5294 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_50240 5657 5986 gene locus_tag LOCUS_50250 5657 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 >Feature sequence0598 1974 1453 gene locus_tag LOCUS_50260 1974 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 2337 2888 gene locus_tag LOCUS_50270 2337 2888 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168108876.1 protein_id gnl|my_center|LOCUS_50270 2901 3431 gene locus_tag LOCUS_50280 2901 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 3475 4140 gene locus_tag LOCUS_50290 3475 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 4157 4462 gene locus_tag LOCUS_50300 4157 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 4459 5016 gene locus_tag LOCUS_50310 4459 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 5426 5109 gene locus_tag LOCUS_50320 5426 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 >Feature sequence0599 1384 779 gene locus_tag LOCUS_50330 1384 779 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_50330 3956 1425 gene locus_tag LOCUS_50340 3956 1425 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922467.1 protein_id gnl|my_center|LOCUS_50340 >Feature sequence0600 <1 1018 gene locus_tag LOCUS_50350 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175611800.1:diguanylate cyclase 1105 1743 gene locus_tag LOCUS_50360 1105 1743 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_50360 3624 1759 gene locus_tag LOCUS_50370 3624 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 5135 3951 gene locus_tag LOCUS_50380 5135 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 >Feature sequence0601 297 2093 gene locus_tag LOCUS_50390 297 2093 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_50390 2090 2638 gene locus_tag LOCUS_50400 2090 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921915.1 protein_id gnl|my_center|LOCUS_50400 2690 3319 gene locus_tag LOCUS_50410 2690 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 3475 5100 gene locus_tag LOCUS_50420 3475 5100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_50420 5717 5346 gene locus_tag LOCUS_50430 5717 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 >Feature sequence0602 2033 3439 gene locus_tag LOCUS_50440 2033 3439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_50440 4180 3458 gene locus_tag LOCUS_50450 4180 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 5001 4177 gene locus_tag LOCUS_50460 5001 4177 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_50460 >Feature sequence0603 425 1360 gene locus_tag LOCUS_50470 gene thiL 425 1360 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_50470 2763 1432 gene locus_tag LOCUS_50480 2763 1432 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_50480 3483 2779 gene locus_tag LOCUS_50490 3483 2779 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_50490 5871 3523 gene locus_tag LOCUS_50500 5871 3523 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_50500 >Feature sequence0604 161 2173 gene locus_tag LOCUS_50510 gene uvrB 161 2173 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_50510 2218 3429 gene locus_tag LOCUS_50520 2218 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 3476 3859 gene locus_tag LOCUS_50530 3476 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 4082 3852 gene locus_tag LOCUS_50540 4082 3852 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051141364.1 protein_id gnl|my_center|LOCUS_50540 4527 4156 gene locus_tag LOCUS_50550 4527 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 4752 5909 gene locus_tag LOCUS_50560 4752 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 >Feature sequence0605 134 2464 gene locus_tag LOCUS_50570 134 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 2679 3620 gene locus_tag LOCUS_50580 2679 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 3831 4709 gene locus_tag LOCUS_50590 3831 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 4706 5917 gene locus_tag LOCUS_50600 4706 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 >Feature sequence0606 1901 609 gene locus_tag LOCUS_50610 1901 609 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022506.1 protein_id gnl|my_center|LOCUS_50610 2046 3743 gene locus_tag LOCUS_50620 gene recN 2046 3743 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_50620 4363 4130 gene locus_tag LOCUS_50630 4363 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 >Feature sequence0607 199 684 gene locus_tag LOCUS_50640 199 684 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_50640 1094 3133 gene locus_tag LOCUS_50650 1094 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 3449 5776 gene locus_tag LOCUS_50660 3449 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 >Feature sequence0608 <1 1102 gene locus_tag LOCUS_50670 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120349.1:DUF1553 domain-containing protein 1156 2511 gene locus_tag LOCUS_50680 1156 2511 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_50680 2726 4423 gene locus_tag LOCUS_50690 2726 4423 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_50690 4435 5451 gene locus_tag LOCUS_50700 4435 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 >Feature sequence0609 5276 4458 gene locus_tag LOCUS_50710 5276 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 5774 5433 gene locus_tag LOCUS_50720 5774 5433 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_50720 >Feature sequence0610 993 265 gene locus_tag LOCUS_50730 993 265 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 protein_id gnl|my_center|LOCUS_50730 2217 1075 gene locus_tag LOCUS_50740 2217 1075 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963878.1 protein_id gnl|my_center|LOCUS_50740 2462 2881 gene locus_tag LOCUS_50750 2462 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 5013 3022 gene locus_tag LOCUS_50760 5013 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 5793 5053 gene locus_tag LOCUS_50770 5793 5053 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 protein_id gnl|my_center|LOCUS_50770 >Feature sequence0611 156 467 gene locus_tag LOCUS_50780 156 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 478 2283 gene locus_tag LOCUS_50790 478 2283 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812952.1 protein_id gnl|my_center|LOCUS_50790 4047 2452 gene locus_tag LOCUS_50800 4047 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 5384 4044 gene locus_tag LOCUS_50810 5384 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 >Feature sequence0612 2353 1184 gene locus_tag LOCUS_50820 2353 1184 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061661.1 protein_id gnl|my_center|LOCUS_50820 2766 2386 gene locus_tag LOCUS_50830 2766 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 3298 4515 gene locus_tag LOCUS_50840 3298 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 4899 5690 gene locus_tag LOCUS_50850 4899 5690 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_50850 >Feature sequence0613 <1 2261 gene locus_tag LOCUS_50860 <1 2261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403883.1:amidohydrolase family protein 2502 3161 gene locus_tag LOCUS_50870 2502 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 3744 3391 gene locus_tag LOCUS_50880 3744 3391 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532029.1 protein_id gnl|my_center|LOCUS_50880 3940 5595 gene locus_tag LOCUS_50890 3940 5595 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_50890 >Feature sequence0614 219 656 gene locus_tag LOCUS_50900 gene rplM 219 656 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_50900 714 1202 gene locus_tag LOCUS_50910 gene rpsI 714 1202 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_50910 1375 4473 gene locus_tag LOCUS_50920 1375 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 <5818 4494 gene locus_tag LOCUS_50930 <5818 4494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583129.1:MATE family efflux transporter >Feature sequence0615 194 1477 gene locus_tag LOCUS_50940 194 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 1474 2514 gene locus_tag LOCUS_50950 1474 2514 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_50950 2566 2865 gene locus_tag LOCUS_50960 2566 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 3075 3263 gene locus_tag LOCUS_50970 3075 3263 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_50970 3275 3490 gene locus_tag LOCUS_50980 3275 3490 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_50980 3604 4110 gene locus_tag LOCUS_50990 3604 4110 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_50990 5258 4221 gene locus_tag LOCUS_51000 5258 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 >Feature sequence0616 63 1019 gene locus_tag LOCUS_51010 gene mch 63 1019 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145084390.1 protein_id gnl|my_center|LOCUS_51010 1080 1637 gene locus_tag LOCUS_51020 1080 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 1726 3351 gene locus_tag LOCUS_51030 1726 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 3450 4652 gene locus_tag LOCUS_51040 3450 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 >Feature sequence0617 1 441 gene locus_tag LOCUS_51050 1 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 451 4356 gene locus_tag LOCUS_51060 451 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 >Feature sequence0618 71 1204 gene locus_tag LOCUS_51070 71 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 1301 2074 gene locus_tag LOCUS_51080 gene larB 1301 2074 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_51080 2229 2684 gene locus_tag LOCUS_51090 gene tnpA 2229 2684 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_51090 2860 3843 gene locus_tag LOCUS_51100 2860 3843 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808077.1 protein_id gnl|my_center|LOCUS_51100 4373 3984 gene locus_tag LOCUS_51110 4373 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 4255 4671 gene locus_tag LOCUS_51120 4255 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 >Feature sequence0619 297 1595 gene locus_tag LOCUS_51130 297 1595 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_51130 3761 1599 gene locus_tag LOCUS_51140 3761 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 <5787 3799 gene locus_tag LOCUS_51150 <5787 3799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047813379.1:HEAT repeat domain-containing protein >Feature sequence0620 396 1694 gene locus_tag LOCUS_51160 396 1694 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_51160 1716 2549 gene locus_tag LOCUS_51170 1716 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 2662 4368 gene locus_tag LOCUS_51180 2662 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 4853 5341 gene locus_tag LOCUS_51190 4853 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 >Feature sequence0621 223 768 gene locus_tag LOCUS_51200 223 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 765 1403 gene locus_tag LOCUS_51210 765 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 1564 5631 gene locus_tag LOCUS_51220 1564 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 >Feature sequence0622 77 493 gene locus_tag LOCUS_51230 77 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 546 701 gene locus_tag LOCUS_51240 546 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 832 3639 gene locus_tag LOCUS_51250 832 3639 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_51250 3689 3973 gene locus_tag LOCUS_51260 3689 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 3913 4239 gene locus_tag LOCUS_51270 3913 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 4236 5672 gene locus_tag LOCUS_51280 4236 5672 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_51280 >Feature sequence0623 5094 2857 gene locus_tag LOCUS_51290 5094 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 5703 5113 gene locus_tag LOCUS_51300 5703 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 >Feature sequence0624 531 1553 gene locus_tag LOCUS_51310 531 1553 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_51310 1664 2179 gene locus_tag LOCUS_51320 1664 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 3143 2346 gene locus_tag LOCUS_51330 3143 2346 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_51330 3357 3172 gene locus_tag LOCUS_51340 3357 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 4320 3580 gene locus_tag LOCUS_51350 4320 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 4341 4628 gene locus_tag LOCUS_51360 4341 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 4958 4659 gene locus_tag LOCUS_51370 4958 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 5675 4998 gene locus_tag LOCUS_51380 5675 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 >Feature sequence0625 1 273 gene locus_tag LOCUS_51390 1 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 270 1850 gene locus_tag LOCUS_51400 gene hutH 270 1850 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_51400 1985 2440 gene locus_tag LOCUS_51410 1985 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 2559 3266 gene locus_tag LOCUS_51420 2559 3266 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444161.1 protein_id gnl|my_center|LOCUS_51420 3464 3270 gene locus_tag LOCUS_51430 3464 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 4381 3551 gene locus_tag LOCUS_51440 4381 3551 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880637.1 protein_id gnl|my_center|LOCUS_51440 <5710 4487 gene locus_tag LOCUS_51450 <5710 4487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463797.1:type VI secretion system baseplate subunit TssK >Feature sequence0626 1936 584 gene locus_tag LOCUS_51460 1936 584 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_51460 2995 2144 gene locus_tag LOCUS_51470 2995 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 3102 3917 gene locus_tag LOCUS_51480 3102 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 3959 4285 gene locus_tag LOCUS_51490 3959 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 4412 4876 gene locus_tag LOCUS_51500 4412 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 <5693 4939 gene locus_tag LOCUS_51510 <5693 4939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403756.1:class I SAM-dependent methyltransferase >Feature sequence0627 1657 584 gene locus_tag LOCUS_51520 1657 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 2007 1642 gene locus_tag LOCUS_51530 2007 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 3144 2308 gene locus_tag LOCUS_51540 gene map 3144 2308 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_51540 3921 3256 gene locus_tag LOCUS_51550 3921 3256 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_51550 5535 4156 gene locus_tag LOCUS_51560 gene secY 5535 4156 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_51560 >Feature sequence0628 <1 825 gene locus_tag LOCUS_51570 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922304.1:fumarylacetoacetate hydrolase family protein 849 1529 gene locus_tag LOCUS_51580 849 1529 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_51580 1596 2921 gene locus_tag LOCUS_51590 1596 2921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088779.1 protein_id gnl|my_center|LOCUS_51590 2924 4171 gene locus_tag LOCUS_51600 2924 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_51600 5551 4322 gene locus_tag LOCUS_51610 5551 4322 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_51610 >Feature sequence0629 1824 334 gene locus_tag LOCUS_51620 1824 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 2786 1830 gene locus_tag LOCUS_51630 2786 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 3644 2805 gene locus_tag LOCUS_51640 3644 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 4579 3692 gene locus_tag LOCUS_51650 4579 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51650 4801 4583 gene locus_tag LOCUS_51660 4801 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 5497 4829 gene locus_tag LOCUS_51670 5497 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 >Feature sequence0630 1071 184 gene locus_tag LOCUS_51680 1071 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 2514 1237 gene locus_tag LOCUS_51690 2514 1237 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_51690 2785 3936 gene locus_tag LOCUS_51700 2785 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 5171 3921 gene locus_tag LOCUS_51710 5171 3921 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143936.1 protein_id gnl|my_center|LOCUS_51710 5250 5606 gene locus_tag LOCUS_51720 5250 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 >Feature sequence0631 431 742 gene locus_tag LOCUS_51730 431 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 739 1518 gene locus_tag LOCUS_51740 739 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946778.1 protein_id gnl|my_center|LOCUS_51740 1532 2572 gene locus_tag LOCUS_51750 1532 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 2728 3183 gene locus_tag LOCUS_51760 2728 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 3226 4308 gene locus_tag LOCUS_51770 3226 4308 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_51770 <5659 4601 gene locus_tag LOCUS_51780 <5659 4601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123802.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0632 705 1217 gene locus_tag LOCUS_51790 705 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 2224 1352 gene locus_tag LOCUS_51800 2224 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 2865 2377 gene locus_tag LOCUS_51810 2865 2377 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_51810 2856 3149 gene locus_tag LOCUS_51820 2856 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 4256 3201 gene locus_tag LOCUS_51830 gene hemE 4256 3201 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404447.1 protein_id gnl|my_center|LOCUS_51830 5125 4388 gene locus_tag LOCUS_51840 gene ubiE 5125 4388 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_51840 >Feature sequence0633 253 3942 gene locus_tag LOCUS_51850 253 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 >Feature sequence0634 859 425 gene locus_tag LOCUS_51860 859 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 845 1174 gene locus_tag LOCUS_51870 845 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 1220 2704 gene locus_tag LOCUS_51880 1220 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 >Feature sequence0635 <1 2140 gene locus_tag LOCUS_51890 <1 2140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119187.1:DNA polymerase III subunit alpha 2299 3048 gene locus_tag LOCUS_51900 2299 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 3113 4294 gene locus_tag LOCUS_51910 3113 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 4452 5561 gene locus_tag LOCUS_51920 4452 5561 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211853.1 protein_id gnl|my_center|LOCUS_51920 >Feature sequence0636 2264 1050 gene locus_tag LOCUS_51930 2264 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 3176 2457 gene locus_tag LOCUS_51940 3176 2457 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_51940 3930 3199 gene locus_tag LOCUS_51950 3930 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 4498 3935 gene locus_tag LOCUS_51960 4498 3935 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_51960 >Feature sequence0637 646 1815 gene locus_tag LOCUS_51970 646 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 4130 1818 gene locus_tag LOCUS_51980 4130 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 4310 4585 gene locus_tag LOCUS_51990 4310 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 >Feature sequence0638 922 683 gene locus_tag LOCUS_52000 922 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 1174 956 gene locus_tag LOCUS_52010 1174 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 1785 1333 gene locus_tag LOCUS_52020 1785 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 2014 2217 gene locus_tag LOCUS_52030 2014 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 2487 3050 gene locus_tag LOCUS_52040 2487 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 3586 3137 gene locus_tag LOCUS_52050 3586 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 4276 3842 gene locus_tag LOCUS_52060 4276 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 5298 4360 gene locus_tag LOCUS_52070 5298 4360 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_52070 >Feature sequence0639 769 74 gene locus_tag LOCUS_52080 769 74 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_52080 1009 4641 gene locus_tag LOCUS_52090 1009 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 5454 4873 gene locus_tag LOCUS_52100 5454 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 >Feature sequence0640 2489 744 gene locus_tag LOCUS_52110 2489 744 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_52110 2688 4313 gene locus_tag LOCUS_52120 2688 4313 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 protein_id gnl|my_center|LOCUS_52120 4919 4398 gene locus_tag LOCUS_52130 4919 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 >Feature sequence0641 5266 98 gene locus_tag LOCUS_52140 5266 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 >Feature sequence0642 159 746 gene locus_tag LOCUS_52150 159 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 1024 1992 gene locus_tag LOCUS_52160 1024 1992 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_52160 3032 2103 gene locus_tag LOCUS_52170 3032 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 5375 3201 gene locus_tag LOCUS_52180 gene kdpB 5375 3201 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883953.1 protein_id gnl|my_center|LOCUS_52180 >Feature sequence0643 3223 2153 gene locus_tag LOCUS_52190 3223 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 4350 3397 gene locus_tag LOCUS_52200 4350 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 4688 5470 gene locus_tag LOCUS_52210 4688 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 >Feature sequence0644 3244 3453 gene locus_tag LOCUS_52220 3244 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 3450 4160 gene locus_tag LOCUS_52230 3450 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 4164 4880 gene locus_tag LOCUS_52240 4164 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 5252 4917 gene locus_tag LOCUS_52250 5252 4917 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118825886.1 protein_id gnl|my_center|LOCUS_52250 >Feature sequence0645 974 1705 gene locus_tag LOCUS_52260 974 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 2174 1722 gene locus_tag LOCUS_52270 2174 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 2416 3000 gene locus_tag LOCUS_52280 gene rpoE 2416 3000 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_52280 2997 4382 gene locus_tag LOCUS_52290 2997 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 5343 4528 gene locus_tag LOCUS_52300 5343 4528 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869145.1 protein_id gnl|my_center|LOCUS_52300 >Feature sequence0646 1131 76 gene locus_tag LOCUS_52310 1131 76 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_52310 2075 1230 gene locus_tag LOCUS_52320 2075 1230 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086979.1 protein_id gnl|my_center|LOCUS_52320 3674 2088 gene locus_tag LOCUS_52330 3674 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 4525 3863 gene locus_tag LOCUS_52340 4525 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_52340 >Feature sequence0647 1209 811 gene locus_tag LOCUS_52350 1209 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 1762 1668 gene locus_tag LOCUS_t00470 1762 1668 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1863 3059 gene locus_tag LOCUS_52360 1863 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 3430 3056 gene locus_tag LOCUS_52370 3430 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52370 5426 4026 gene locus_tag LOCUS_52380 5426 4026 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_52380 >Feature sequence0648 <1 958 gene locus_tag LOCUS_52390 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545143.1:DegQ family serine endoprotease 1583 3790 gene locus_tag LOCUS_52400 1583 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 4361 3882 gene locus_tag LOCUS_52410 4361 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 4599 4811 gene locus_tag LOCUS_52420 4599 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52420 >Feature sequence0649 <1 2931 gene locus_tag LOCUS_52430 <1 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 5058 3079 gene locus_tag LOCUS_52440 5058 3079 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_52440 >Feature sequence0650 47 370 gene locus_tag LOCUS_52450 47 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 478 1227 gene locus_tag LOCUS_52460 478 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 1239 3695 gene locus_tag LOCUS_52470 1239 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 3725 4207 gene locus_tag LOCUS_52480 3725 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 4092 4418 gene locus_tag LOCUS_52490 4092 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 4433 4603 gene locus_tag LOCUS_52500 4433 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 4743 5396 gene locus_tag LOCUS_52510 4743 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 >Feature sequence0651 771 283 gene locus_tag LOCUS_52520 771 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 1364 1011 gene locus_tag LOCUS_52530 1364 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 4672 2171 gene locus_tag LOCUS_52540 4672 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 >Feature sequence0652 2069 15 gene locus_tag LOCUS_52550 2069 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 4109 2235 gene locus_tag LOCUS_52560 4109 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 >Feature sequence0653 1899 5426 gene locus_tag LOCUS_52570 1899 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 >Feature sequence0654 <1 1257 gene locus_tag LOCUS_52580 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123879.1:DUF1549 domain-containing protein 1473 1739 gene locus_tag LOCUS_52590 1473 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 1775 2752 gene locus_tag LOCUS_52600 1775 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 3238 2882 gene locus_tag LOCUS_52610 3238 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 5283 3691 gene locus_tag LOCUS_52620 5283 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 >Feature sequence0655 <1 1201 gene locus_tag LOCUS_52630 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941985.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0656 52 1065 gene locus_tag LOCUS_52640 gene yhaM 52 1065 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_52640 2249 1062 gene locus_tag LOCUS_52650 gene cax 2249 1062 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_52650 3093 2425 gene locus_tag LOCUS_52660 3093 2425 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923472.1 protein_id gnl|my_center|LOCUS_52660 3630 4406 gene locus_tag LOCUS_52670 3630 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 5073 4501 gene locus_tag LOCUS_52680 5073 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 >Feature sequence0657 1843 56 gene locus_tag LOCUS_52690 1843 56 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_52690 2907 1840 gene locus_tag LOCUS_52700 2907 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 >Feature sequence0658 1772 2227 gene locus_tag LOCUS_52710 1772 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52710 2234 3004 gene locus_tag LOCUS_52720 2234 3004 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_52720 >Feature sequence0659 473 1723 gene locus_tag LOCUS_52730 473 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 <5358 1876 gene locus_tag LOCUS_52740 <5358 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969687.1:calcium-binding protein 5059 5148 gene locus_tag LOCUS_t00480 5059 5148 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0660 762 49 gene locus_tag LOCUS_52750 762 49 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226620.1 protein_id gnl|my_center|LOCUS_52750 938 1552 gene locus_tag LOCUS_52760 gene rdgB 938 1552 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_52760 4374 1648 gene locus_tag LOCUS_52770 4374 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 4972 4394 gene locus_tag LOCUS_52780 4972 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 >Feature sequence0661 1976 1545 gene locus_tag LOCUS_52790 1976 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 2259 2038 gene locus_tag LOCUS_52800 2259 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 2150 3601 gene locus_tag LOCUS_52810 2150 3601 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_52810 3667 4692 gene locus_tag LOCUS_52820 3667 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 4694 5296 gene locus_tag LOCUS_52830 4694 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 >Feature sequence0662 369 2060 gene locus_tag LOCUS_52840 369 2060 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_52840 2232 2624 gene locus_tag LOCUS_52850 2232 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 2879 3559 gene locus_tag LOCUS_52860 2879 3559 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115027.1 protein_id gnl|my_center|LOCUS_52860 >Feature sequence0663 667 86 gene locus_tag LOCUS_52870 667 86 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946157.1 protein_id gnl|my_center|LOCUS_52870 833 678 gene locus_tag LOCUS_52880 833 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 2395 878 gene locus_tag LOCUS_52890 2395 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 3130 2603 gene locus_tag LOCUS_52900 3130 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 3511 4869 gene locus_tag LOCUS_52910 3511 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52910 4866 5207 gene locus_tag LOCUS_52920 4866 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52920 >Feature sequence0664 1748 861 gene locus_tag LOCUS_52930 1748 861 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_52930 1919 2668 gene locus_tag LOCUS_52940 1919 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 2977 3336 gene locus_tag LOCUS_52950 2977 3336 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338472.1 protein_id gnl|my_center|LOCUS_52950 3437 5143 gene locus_tag LOCUS_52960 3437 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 >Feature sequence0665 1040 270 gene locus_tag LOCUS_52970 1040 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 2677 1100 gene locus_tag LOCUS_52980 2677 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 <5313 2707 gene locus_tag LOCUS_52990 <5313 2707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272458.1:calcium-transporting P-type ATPase, PMR1-type >Feature sequence0666 469 47 gene locus_tag LOCUS_53000 469 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 637 1347 gene locus_tag LOCUS_53010 637 1347 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_53010 3237 1474 gene locus_tag LOCUS_53020 3237 1474 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_53020 <5307 3381 gene locus_tag LOCUS_53030 <5307 3381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025862443.1:fused MFS/spermidine synthase >Feature sequence0667 109 1749 gene locus_tag LOCUS_53040 109 1749 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_53040 1814 3022 gene locus_tag LOCUS_53050 1814 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 4774 3140 gene locus_tag LOCUS_53060 4774 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 5250 4882 gene locus_tag LOCUS_53070 5250 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 >Feature sequence0668 345 106 gene locus_tag LOCUS_53080 345 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 1197 472 gene locus_tag LOCUS_53090 1197 472 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_53090 1403 3322 gene locus_tag LOCUS_53100 1403 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 3589 5043 gene locus_tag LOCUS_53110 gene gabD 3589 5043 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_53110 >Feature sequence0669 69 1067 gene locus_tag LOCUS_53120 69 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 1118 2500 gene locus_tag LOCUS_53130 1118 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 2885 3484 gene locus_tag LOCUS_53140 2885 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 3956 4747 gene locus_tag LOCUS_53150 3956 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 >Feature sequence0670 80 2416 gene locus_tag LOCUS_53160 80 2416 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815631.1 protein_id gnl|my_center|LOCUS_53160 2443 3033 gene locus_tag LOCUS_53170 2443 3033 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_53170 3076 4251 gene locus_tag LOCUS_53180 gene argJ 3076 4251 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119260.1 protein_id gnl|my_center|LOCUS_53180 4331 5254 gene locus_tag LOCUS_53190 4331 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 >Feature sequence0671 118 1137 gene locus_tag LOCUS_53200 118 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 2423 1125 gene locus_tag LOCUS_53210 2423 1125 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_53210 2486 2713 gene locus_tag LOCUS_53220 2486 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 2730 2969 gene locus_tag LOCUS_53230 2730 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 3592 2972 gene locus_tag LOCUS_53240 3592 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 4664 3702 gene locus_tag LOCUS_53250 4664 3702 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_53250 >Feature sequence0672 172 1320 gene locus_tag LOCUS_53260 172 1320 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_53260 1834 1418 gene locus_tag LOCUS_53270 1834 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 2279 1899 gene locus_tag LOCUS_53280 2279 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 2543 2283 gene locus_tag LOCUS_53290 2543 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 3089 2757 gene locus_tag LOCUS_53300 3089 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 3414 4769 gene locus_tag LOCUS_53310 3414 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 5003 5239 gene locus_tag LOCUS_53320 5003 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 >Feature sequence0673 2318 48 gene locus_tag LOCUS_53330 2318 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 3723 2611 gene locus_tag LOCUS_53340 3723 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 >Feature sequence0674 612 55 gene locus_tag LOCUS_53350 612 55 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_53350 2369 759 gene locus_tag LOCUS_53360 2369 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 2588 2974 gene locus_tag LOCUS_53370 2588 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 >Feature sequence0675 443 1762 gene locus_tag LOCUS_53380 443 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 1801 3138 gene locus_tag LOCUS_53390 1801 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 3256 3699 gene locus_tag LOCUS_53400 3256 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 3920 5143 gene locus_tag LOCUS_53410 3920 5143 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_53410 >Feature sequence0676 2367 691 gene locus_tag LOCUS_53420 2367 691 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728834.1 protein_id gnl|my_center|LOCUS_53420 3503 2475 gene locus_tag LOCUS_53430 3503 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 5047 3704 gene locus_tag LOCUS_53440 5047 3704 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_53440 >Feature sequence0677 <1 715 gene locus_tag LOCUS_53450 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929529.1:TerC family protein 1437 2147 gene locus_tag LOCUS_53460 1437 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 2637 3200 gene locus_tag LOCUS_53470 2637 3200 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_53470 3187 3669 gene locus_tag LOCUS_53480 3187 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 3666 4058 gene locus_tag LOCUS_53490 3666 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 4202 5035 gene locus_tag LOCUS_53500 4202 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 >Feature sequence0678 2770 272 gene locus_tag LOCUS_53510 2770 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 2965 3156 gene locus_tag LOCUS_53520 2965 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 3751 3125 gene locus_tag LOCUS_53530 3751 3125 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922102.1 protein_id gnl|my_center|LOCUS_53530 >Feature sequence0679 112 1548 gene locus_tag LOCUS_53540 gene gabT 112 1548 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013682.1 protein_id gnl|my_center|LOCUS_53540 1778 2902 gene locus_tag LOCUS_53550 1778 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 2919 3887 gene locus_tag LOCUS_53560 2919 3887 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_53560 >Feature sequence0680 5030 171 gene locus_tag LOCUS_53570 5030 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 >Feature sequence0681 1054 32 gene locus_tag LOCUS_53580 1054 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 2064 1201 gene locus_tag LOCUS_53590 2064 1201 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_53590 2800 2207 gene locus_tag LOCUS_53600 2800 2207 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_53600 3216 4955 gene locus_tag LOCUS_53610 3216 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 >Feature sequence0682 <1 802 gene locus_tag LOCUS_53620 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118727.1:DUF1501 domain-containing protein 929 1375 gene locus_tag LOCUS_53630 929 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 1380 3899 gene locus_tag LOCUS_53640 gene hrpB 1380 3899 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921689.1 protein_id gnl|my_center|LOCUS_53640 <5219 4066 gene locus_tag LOCUS_53650 <5219 4066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921690.1:acetylxylan esterase >Feature sequence0683 960 199 gene locus_tag LOCUS_53660 960 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 1205 2314 gene locus_tag LOCUS_53670 1205 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 2504 3064 gene locus_tag LOCUS_53680 gene cobU 2504 3064 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552342.1 protein_id gnl|my_center|LOCUS_53680 3068 4462 gene locus_tag LOCUS_53690 3068 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 >Feature sequence0684 473 1666 gene locus_tag LOCUS_53700 473 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 1980 1705 gene locus_tag LOCUS_53710 1980 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 5044 2066 gene locus_tag LOCUS_53720 5044 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 >Feature sequence0685 <1 735 gene locus_tag LOCUS_53730 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein 983 1408 gene locus_tag LOCUS_53740 983 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 1526 1858 gene locus_tag LOCUS_53750 1526 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 2053 2526 gene locus_tag LOCUS_53760 2053 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 2544 3998 gene locus_tag LOCUS_53770 2544 3998 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_53770 >Feature sequence0686 276 1268 gene locus_tag LOCUS_53780 276 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 1461 2615 gene locus_tag LOCUS_53790 1461 2615 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_53790 2689 2934 gene locus_tag LOCUS_53800 2689 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 3022 3489 gene locus_tag LOCUS_53810 3022 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 >Feature sequence0687 <1 3071 gene locus_tag LOCUS_53820 <1 3071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921767.1:protein translocase subunit SecD 4679 3141 gene locus_tag LOCUS_53830 4679 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 >Feature sequence0688 2947 4035 gene locus_tag LOCUS_53840 2947 4035 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_53840 4084 4899 gene locus_tag LOCUS_53850 4084 4899 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_53850 >Feature sequence0689 1 375 gene locus_tag LOCUS_53860 1 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 1006 527 gene locus_tag LOCUS_53870 1006 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 1684 1130 gene locus_tag LOCUS_53880 1684 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 2332 1742 gene locus_tag LOCUS_53890 2332 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 3697 2597 gene locus_tag LOCUS_53900 3697 2597 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_53900 >Feature sequence0690 145 2049 gene locus_tag LOCUS_53910 145 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 2301 3149 gene locus_tag LOCUS_53920 2301 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 3307 5055 gene locus_tag LOCUS_53930 3307 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 >Feature sequence0691 92 277 gene locus_tag LOCUS_53940 92 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 548 1180 gene locus_tag LOCUS_53950 548 1180 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326626.1 protein_id gnl|my_center|LOCUS_53950 1788 2954 gene locus_tag LOCUS_53960 1788 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 3131 4852 gene locus_tag LOCUS_53970 3131 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 >Feature sequence0692 2605 494 gene locus_tag LOCUS_53980 2605 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 4125 2812 gene locus_tag LOCUS_53990 4125 2812 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123471.1 protein_id gnl|my_center|LOCUS_53990 >Feature sequence0693 1362 4097 gene locus_tag LOCUS_54000 1362 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 >Feature sequence0694 785 1963 gene locus_tag LOCUS_54010 785 1963 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_54010 2125 2580 gene locus_tag LOCUS_54020 2125 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 3043 3417 gene locus_tag LOCUS_54030 3043 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 4468 3632 gene locus_tag LOCUS_54040 4468 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 4425 4820 gene locus_tag LOCUS_54050 4425 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 >Feature sequence0695 555 4289 gene locus_tag LOCUS_54060 gene rpoB 555 4289 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_54060 4313 4720 gene locus_tag LOCUS_54070 4313 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 >Feature sequence0696 237 4 gene locus_tag LOCUS_54080 237 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 383 967 gene locus_tag LOCUS_54090 gene pyrE 383 967 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_54090 933 1268 gene locus_tag LOCUS_54100 933 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 1578 2864 gene locus_tag LOCUS_54110 1578 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 2861 5086 gene locus_tag LOCUS_54120 2861 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 >Feature sequence0697 1007 309 gene locus_tag LOCUS_54130 1007 309 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_54130 3178 1208 gene locus_tag LOCUS_54140 3178 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 4521 3229 gene locus_tag LOCUS_54150 4521 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 >Feature sequence0698 229 573 gene locus_tag LOCUS_54160 229 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 774 1106 gene locus_tag LOCUS_54170 774 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 1103 1483 gene locus_tag LOCUS_54180 1103 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 2660 1503 gene locus_tag LOCUS_54190 2660 1503 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_54190 4124 2742 gene locus_tag LOCUS_54200 4124 2742 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_54200 4976 4572 gene locus_tag LOCUS_54210 4976 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54210 >Feature sequence0699 1025 1492 gene locus_tag LOCUS_54220 1025 1492 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014359.1 protein_id gnl|my_center|LOCUS_54220 1754 2866 gene locus_tag LOCUS_54230 1754 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 4847 3033 gene locus_tag LOCUS_54240 4847 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 >Feature sequence0700 404 168 gene locus_tag LOCUS_54250 404 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 709 401 gene locus_tag LOCUS_54260 709 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 3483 1162 gene locus_tag LOCUS_54270 3483 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 3654 4346 gene locus_tag LOCUS_54280 3654 4346 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_54280 >Feature sequence0701 1878 1003 gene locus_tag LOCUS_54290 1878 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 2640 1888 gene locus_tag LOCUS_54300 2640 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 3522 2677 gene locus_tag LOCUS_54310 3522 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 4976 3729 gene locus_tag LOCUS_54320 4976 3729 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329380.1 protein_id gnl|my_center|LOCUS_54320 >Feature sequence0702 286 2229 gene locus_tag LOCUS_54330 286 2229 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_54330 3582 2605 gene locus_tag LOCUS_54340 3582 2605 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234111.1 protein_id gnl|my_center|LOCUS_54340 4925 3732 gene locus_tag LOCUS_54350 4925 3732 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_54350 >Feature sequence0703 <1 3905 gene locus_tag LOCUS_54360 <1 3905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922226.1:SdrD B-like domain-containing protein >Feature sequence0704 69 2408 gene locus_tag LOCUS_54370 69 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 2650 3429 gene locus_tag LOCUS_54380 2650 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 3829 3581 gene locus_tag LOCUS_54390 3829 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 4351 3848 gene locus_tag LOCUS_54400 4351 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 4962 4387 gene locus_tag LOCUS_54410 4962 4387 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142306.1 protein_id gnl|my_center|LOCUS_54410 >Feature sequence0705 1653 241 gene locus_tag LOCUS_54420 gene glnA 1653 241 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_54420 1925 3826 gene locus_tag LOCUS_54430 1925 3826 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_54430 4832 3903 gene locus_tag LOCUS_54440 4832 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 >Feature sequence0706 1126 65 gene locus_tag LOCUS_54450 1126 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 3477 1468 gene locus_tag LOCUS_54460 3477 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 3675 4070 gene locus_tag LOCUS_54470 3675 4070 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_54470 4295 5002 gene locus_tag LOCUS_54480 4295 5002 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582743.1 protein_id gnl|my_center|LOCUS_54480 >Feature sequence0707 82 426 gene locus_tag LOCUS_54490 82 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 487 559 gene locus_tag LOCUS_t00490 487 559 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 755 1831 gene locus_tag LOCUS_54500 755 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 3016 1904 gene locus_tag LOCUS_54510 3016 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 3811 3128 gene locus_tag LOCUS_54520 3811 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 4390 3905 gene locus_tag LOCUS_54530 4390 3905 CDS product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_54530 4959 4456 gene locus_tag LOCUS_54540 4959 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 >Feature sequence0708 2536 71 gene locus_tag LOCUS_54550 2536 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 3564 3115 gene locus_tag LOCUS_54560 3564 3115 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_54560 3879 3565 gene locus_tag LOCUS_54570 3879 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 4305 4604 gene locus_tag LOCUS_54580 4305 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 5012 4632 gene locus_tag LOCUS_54590 5012 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 >Feature sequence0709 1954 113 gene locus_tag LOCUS_54600 1954 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 4796 2130 gene locus_tag LOCUS_54610 4796 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 >Feature sequence0710 1139 453 gene locus_tag LOCUS_54620 1139 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54620 3265 1136 gene locus_tag LOCUS_54630 3265 1136 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_54630 >Feature sequence0711 3013 4713 gene locus_tag LOCUS_54640 gene groL 3013 4713 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_54640 >Feature sequence0712 1079 1690 gene locus_tag LOCUS_54650 1079 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 1739 2362 gene locus_tag LOCUS_54660 1739 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 2371 2883 gene locus_tag LOCUS_54670 2371 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 3199 4758 gene locus_tag LOCUS_54680 3199 4758 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967728.1 protein_id gnl|my_center|LOCUS_54680 >Feature sequence0713 3540 25 gene locus_tag LOCUS_54690 3540 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 3779 4936 gene locus_tag LOCUS_54700 gene rlmN 3779 4936 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_54700 >Feature sequence0714 210 1175 gene locus_tag LOCUS_54710 gene msrP 210 1175 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_54710 3469 1667 gene locus_tag LOCUS_54720 3469 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 >Feature sequence0715 3750 1348 gene locus_tag LOCUS_54730 3750 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 4492 3776 gene locus_tag LOCUS_54740 4492 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 >Feature sequence0716 25 1785 gene locus_tag LOCUS_54750 25 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 3457 1811 gene locus_tag LOCUS_54760 3457 1811 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921438.1 protein_id gnl|my_center|LOCUS_54760 <5005 3500 gene locus_tag LOCUS_54770 <5005 3500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118670.1:polyamine aminopropyltransferase >Feature sequence0717 1535 9 gene locus_tag LOCUS_54780 1535 9 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_54780 1765 3129 gene locus_tag LOCUS_54790 1765 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 4919 3195 gene locus_tag LOCUS_54800 4919 3195 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928668.1 protein_id gnl|my_center|LOCUS_54800 >Feature sequence0718 985 374 gene locus_tag LOCUS_54810 985 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 2944 1124 gene locus_tag LOCUS_54820 2944 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 <4983 2947 gene locus_tag LOCUS_54830 <4983 2947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200284324.1:NACHT domain-containing protein >Feature sequence0719 326 51 gene locus_tag LOCUS_54840 326 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 742 1131 gene locus_tag LOCUS_54850 742 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 1228 4833 gene locus_tag LOCUS_54860 1228 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 >Feature sequence0720 1072 1818 gene locus_tag LOCUS_54870 1072 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 1957 2709 gene locus_tag LOCUS_54880 gene hisA 1957 2709 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_54880 2755 4902 gene locus_tag LOCUS_54890 gene fusA 2755 4902 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258549.1 protein_id gnl|my_center|LOCUS_54890 >Feature sequence0721 1276 347 gene locus_tag LOCUS_54900 1276 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 2927 1560 gene locus_tag LOCUS_54910 2927 1560 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_54910 4852 2924 gene locus_tag LOCUS_54920 4852 2924 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_54920 >Feature sequence0722 221 589 gene locus_tag LOCUS_54930 221 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 657 1190 gene locus_tag LOCUS_54940 657 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 1774 1238 gene locus_tag LOCUS_54950 1774 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 2163 1978 gene locus_tag LOCUS_54960 2163 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 >Feature sequence0723 66 767 gene locus_tag LOCUS_54970 66 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 853 1212 gene locus_tag LOCUS_54980 853 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 1435 1638 gene locus_tag LOCUS_54990 1435 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 1684 2370 gene locus_tag LOCUS_55000 1684 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 2367 2819 gene locus_tag LOCUS_55010 2367 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 2964 4448 gene locus_tag LOCUS_55020 2964 4448 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_55020 4472 4834 gene locus_tag LOCUS_55030 4472 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 >Feature sequence0724 214 894 gene locus_tag LOCUS_55040 214 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 925 1569 gene locus_tag LOCUS_55050 925 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 1582 1854 gene locus_tag LOCUS_55060 1582 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 3019 2054 gene locus_tag LOCUS_55070 gene cysK 3019 2054 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_55070 3504 4895 gene locus_tag LOCUS_55080 3504 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 >Feature sequence0725 656 117 gene locus_tag LOCUS_55090 656 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 1539 955 gene locus_tag LOCUS_55100 1539 955 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_55100 2953 1892 gene locus_tag LOCUS_55110 2953 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 3216 4868 gene locus_tag LOCUS_55120 3216 4868 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615418.1 protein_id gnl|my_center|LOCUS_55120 >Feature sequence0726 <1 812 gene locus_tag LOCUS_55130 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122281.1:MMPL family transporter 1185 817 gene locus_tag LOCUS_55140 1185 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 1480 1187 gene locus_tag LOCUS_55150 1480 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 1993 4164 gene locus_tag LOCUS_55160 1993 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 >Feature sequence0727 106 1200 gene locus_tag LOCUS_55170 106 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 2769 1237 gene locus_tag LOCUS_55180 2769 1237 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_55180 3328 2831 gene locus_tag LOCUS_55190 3328 2831 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_55190 4167 3379 gene locus_tag LOCUS_55200 4167 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 4439 4218 gene locus_tag LOCUS_55210 4439 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 >Feature sequence0728 2070 3881 gene locus_tag LOCUS_55220 2070 3881 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_55220 >Feature sequence0729 658 155 gene locus_tag LOCUS_55230 658 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 1730 786 gene locus_tag LOCUS_55240 1730 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 2167 1889 gene locus_tag LOCUS_55250 2167 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 2378 3367 gene locus_tag LOCUS_55260 2378 3367 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_55260 3484 4806 gene locus_tag LOCUS_55270 3484 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 >Feature sequence0730 2540 138 gene locus_tag LOCUS_55280 2540 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 4293 2785 gene locus_tag LOCUS_55290 4293 2785 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_55290 >Feature sequence0731 66 1982 gene locus_tag LOCUS_55300 66 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 1975 2439 gene locus_tag LOCUS_55310 1975 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 2809 2961 gene locus_tag LOCUS_55320 2809 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 2948 3586 gene locus_tag LOCUS_55330 gene coaE 2948 3586 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816768.1 protein_id gnl|my_center|LOCUS_55330 >Feature sequence0732 1033 68 gene locus_tag LOCUS_55340 1033 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 1917 1165 gene locus_tag LOCUS_55350 1917 1165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_55350 2573 1914 gene locus_tag LOCUS_55360 2573 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 3501 2584 gene locus_tag LOCUS_55370 3501 2584 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_55370 4717 3587 gene locus_tag LOCUS_55380 4717 3587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_55380 >Feature sequence0733 <1 1435 gene locus_tag LOCUS_55390 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943026.1:molecular chaperone HtpG 1599 2378 gene locus_tag LOCUS_55400 1599 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 >Feature sequence0734 <1 1194 gene locus_tag LOCUS_55410 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein 2341 1220 gene locus_tag LOCUS_55420 2341 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 3029 2583 gene locus_tag LOCUS_55430 3029 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 <4869 3687 gene locus_tag LOCUS_55440 <4869 3687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000682856.1:signal peptide peptidase SppA >Feature sequence0735 242 4588 gene locus_tag LOCUS_55450 gene rpoC 242 4588 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_55450 >Feature sequence0736 <1 1272 gene locus_tag LOCUS_55460 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261805.1:efflux RND transporter permease subunit 1484 2476 gene locus_tag LOCUS_55470 gene glsA 1484 2476 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212056.1 protein_id gnl|my_center|LOCUS_55470 2516 4054 gene locus_tag LOCUS_55480 2516 4054 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970122.1 protein_id gnl|my_center|LOCUS_55480 >Feature sequence0737 3030 811 gene locus_tag LOCUS_55490 3030 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 3520 3305 gene locus_tag LOCUS_55500 3520 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 3644 4624 gene locus_tag LOCUS_55510 3644 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 >Feature sequence0738 3123 13 gene locus_tag LOCUS_55520 3123 13 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_55520 3557 4303 gene locus_tag LOCUS_55530 3557 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 >Feature sequence0739 141 1040 gene locus_tag LOCUS_55540 141 1040 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_55540 1158 3665 gene locus_tag LOCUS_55550 1158 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 >Feature sequence0740 329 691 gene locus_tag LOCUS_55560 329 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 2525 1053 gene locus_tag LOCUS_55570 2525 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 3605 2916 gene locus_tag LOCUS_55580 3605 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 >Feature sequence0741 1270 4749 gene locus_tag LOCUS_55590 1270 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 >Feature sequence0742 146 889 gene locus_tag LOCUS_55600 146 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 1745 984 gene locus_tag LOCUS_55610 1745 984 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922179.1 protein_id gnl|my_center|LOCUS_55610 2110 2505 gene locus_tag LOCUS_55620 2110 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 2557 3588 gene locus_tag LOCUS_55630 2557 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 >Feature sequence0743 347 144 gene locus_tag LOCUS_55640 347 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 1578 652 gene locus_tag LOCUS_55650 gene pyrF 1578 652 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_55650 2698 1865 gene locus_tag LOCUS_55660 2698 1865 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_55660 2948 3529 gene locus_tag LOCUS_55670 2948 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 3716 4774 gene locus_tag LOCUS_55680 3716 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 >Feature sequence0744 598 831 gene locus_tag LOCUS_55690 598 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 2206 812 gene locus_tag LOCUS_55700 2206 812 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_55700 2971 2522 gene locus_tag LOCUS_55710 2971 2522 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_55710 4799 3096 gene locus_tag LOCUS_55720 4799 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 >Feature sequence0745 2491 116 gene locus_tag LOCUS_55730 2491 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 4428 2680 gene locus_tag LOCUS_55740 4428 2680 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_55740 >Feature sequence0746 <4793 721 gene locus_tag LOCUS_55750 <4793 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121648.1:excinuclease ABC subunit UvrA >Feature sequence0747 170 952 gene locus_tag LOCUS_55760 170 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 1362 1009 gene locus_tag LOCUS_55770 1362 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 1493 2674 gene locus_tag LOCUS_55780 1493 2674 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_55780 3765 2866 gene locus_tag LOCUS_55790 3765 2866 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_55790 4688 3789 gene locus_tag LOCUS_55800 4688 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 >Feature sequence0748 <1 743 gene locus_tag LOCUS_55810 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328624.1:DUF1552 domain-containing protein 736 3423 gene locus_tag LOCUS_55820 736 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 3457 4374 gene locus_tag LOCUS_55830 3457 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 >Feature sequence0749 48 503 gene locus_tag LOCUS_55840 48 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 1347 2786 gene locus_tag LOCUS_55850 1347 2786 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_55850 3843 2935 gene locus_tag LOCUS_55860 3843 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 >Feature sequence0750 2454 3329 gene locus_tag LOCUS_55870 2454 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 4661 3537 gene locus_tag LOCUS_55880 4661 3537 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776881.1 protein_id gnl|my_center|LOCUS_55880 >Feature sequence0751 382 816 gene locus_tag LOCUS_55890 382 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 950 2176 gene locus_tag LOCUS_55900 950 2176 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922154.1 protein_id gnl|my_center|LOCUS_55900 2404 2198 gene locus_tag LOCUS_55910 2404 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 2856 2581 gene locus_tag LOCUS_55920 2856 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 4757 3189 gene locus_tag LOCUS_55930 4757 3189 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_55930 >Feature sequence0752 1633 50 gene locus_tag LOCUS_55940 gene istA 1633 50 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_55940 2278 2084 gene locus_tag LOCUS_55950 2278 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 2618 2373 gene locus_tag LOCUS_55960 2618 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 3193 2813 gene locus_tag LOCUS_55970 3193 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 >Feature sequence0753 1692 130 gene locus_tag LOCUS_55980 1692 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 1814 2662 gene locus_tag LOCUS_55990 1814 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 <4757 2751 gene locus_tag LOCUS_56000 <4757 2751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615784.1:trypsin-like peptidase domain-containing protein >Feature sequence0754 456 818 gene locus_tag LOCUS_56010 456 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 882 1142 gene locus_tag LOCUS_56020 882 1142 CDS product DUF6429 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008692742.1 protein_id gnl|my_center|LOCUS_56020 1364 1185 gene locus_tag LOCUS_56030 1364 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 1829 1605 gene locus_tag LOCUS_56040 1829 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 2063 2407 gene locus_tag LOCUS_56050 2063 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 4151 2409 gene locus_tag LOCUS_56060 4151 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 >Feature sequence0755 2568 805 gene locus_tag LOCUS_56070 2568 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 2782 2558 gene locus_tag LOCUS_56080 2782 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 3160 3693 gene locus_tag LOCUS_56090 3160 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 3811 4632 gene locus_tag LOCUS_56100 3811 4632 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_56100 >Feature sequence0756 960 121 gene locus_tag LOCUS_56110 960 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 1144 989 gene locus_tag LOCUS_56120 1144 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 2917 1469 gene locus_tag LOCUS_56130 2917 1469 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 protein_id gnl|my_center|LOCUS_56130 3199 4098 gene locus_tag LOCUS_56140 3199 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 >Feature sequence0757 1714 653 gene locus_tag LOCUS_56150 gene cobT 1714 653 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_56150 2822 1788 gene locus_tag LOCUS_56160 2822 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56160 2976 3272 gene locus_tag LOCUS_56170 gene hlpB 2976 3272 CDS product HNH nuclease-like protein HlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245113.1 protein_id gnl|my_center|LOCUS_56170 3400 3927 gene locus_tag LOCUS_56180 3400 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 >Feature sequence0758 1421 162 gene locus_tag LOCUS_56190 1421 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 2369 1470 gene locus_tag LOCUS_56200 gene folD 2369 1470 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_56200 3314 2625 gene locus_tag LOCUS_56210 3314 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 3930 3463 gene locus_tag LOCUS_56220 3930 3463 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_56220 4276 4602 gene locus_tag LOCUS_56230 4276 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 >Feature sequence0759 1106 294 gene locus_tag LOCUS_56240 1106 294 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088697.1 protein_id gnl|my_center|LOCUS_56240 2266 1130 gene locus_tag LOCUS_56250 2266 1130 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_56250 2376 3389 gene locus_tag LOCUS_56260 2376 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 3504 4718 gene locus_tag LOCUS_56270 3504 4718 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_56270 >Feature sequence0760 1379 126 gene locus_tag LOCUS_56280 1379 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 <4717 1504 gene locus_tag LOCUS_56290 <4717 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088423.1:PAS domain S-box protein >Feature sequence0761 1197 52 gene locus_tag LOCUS_56300 1197 52 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_56300 1384 1456 gene locus_tag LOCUS_t00500 1384 1456 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2312 1521 gene locus_tag LOCUS_56310 2312 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 4470 2683 gene locus_tag LOCUS_56320 4470 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 >Feature sequence0762 491 117 gene locus_tag LOCUS_56330 gene rplV 491 117 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121604.1 protein_id gnl|my_center|LOCUS_56330 583 510 gene locus_tag LOCUS_t00510 583 510 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 878 588 gene locus_tag LOCUS_56340 gene rpsS 878 588 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_56340 1802 948 gene locus_tag LOCUS_56350 gene rplB 1802 948 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_56350 2271 1951 gene locus_tag LOCUS_56360 gene rplW 2271 1951 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_56360 2959 2294 gene locus_tag LOCUS_56370 gene rplD 2959 2294 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_56370 3524 3186 gene locus_tag LOCUS_56380 gene rpsJ 3524 3186 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_56380 <4685 3810 gene locus_tag LOCUS_56390 <4685 3810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081841.1:elongation factor G >Feature sequence0763 549 88 gene locus_tag LOCUS_56400 549 88 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 protein_id gnl|my_center|LOCUS_56400 4138 641 gene locus_tag LOCUS_56410 4138 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 >Feature sequence0764 <4662 3892 gene locus_tag LOCUS_56420 <4662 3892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008663584.1:serine/threonine-protein kinase >Feature sequence0765 4012 881 gene locus_tag LOCUS_56430 4012 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 >Feature sequence0766 73 1212 gene locus_tag LOCUS_56440 73 1212 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_56440 1980 1279 gene locus_tag LOCUS_56450 1980 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 2226 2002 gene locus_tag LOCUS_56460 2226 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 2463 3230 gene locus_tag LOCUS_56470 2463 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 3349 4248 gene locus_tag LOCUS_56480 3349 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 >Feature sequence0767 552 139 gene locus_tag LOCUS_56490 552 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 1306 755 gene locus_tag LOCUS_56500 1306 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 1569 1868 gene locus_tag LOCUS_56510 gene rpmA 1569 1868 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_56510 2091 2567 gene locus_tag LOCUS_56520 2091 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 3027 3275 gene locus_tag LOCUS_56530 3027 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 4430 3393 gene locus_tag LOCUS_56540 4430 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 >Feature sequence0768 222 455 gene locus_tag LOCUS_56550 222 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 567 1616 gene locus_tag LOCUS_56560 567 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 1645 2892 gene locus_tag LOCUS_56570 1645 2892 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_56570 3018 4604 gene locus_tag LOCUS_56580 3018 4604 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_56580 >Feature sequence0769 606 130 gene locus_tag LOCUS_56590 606 130 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_56590 2457 880 gene locus_tag LOCUS_56600 2457 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 3476 2487 gene locus_tag LOCUS_56610 3476 2487 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615365.1 protein_id gnl|my_center|LOCUS_56610 4519 3473 gene locus_tag LOCUS_56620 4519 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 >Feature sequence0770 954 151 gene locus_tag LOCUS_56630 954 151 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120403.1 protein_id gnl|my_center|LOCUS_56630 1792 1031 gene locus_tag LOCUS_56640 1792 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 2372 1953 gene locus_tag LOCUS_56650 2372 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 3505 2678 gene locus_tag LOCUS_56660 3505 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 4603 3725 gene locus_tag LOCUS_56670 4603 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 >Feature sequence0771 2504 987 gene locus_tag LOCUS_56680 2504 987 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082693.1 protein_id gnl|my_center|LOCUS_56680 3605 2574 gene locus_tag LOCUS_56690 3605 2574 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_56690 4533 3664 gene locus_tag LOCUS_56700 gene aroE 4533 3664 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_56700 >Feature sequence0772 3118 635 gene locus_tag LOCUS_56710 3118 635 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_56710 3368 3727 gene locus_tag LOCUS_56720 3368 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 3742 4221 gene locus_tag LOCUS_56730 3742 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 >Feature sequence0773 3999 463 gene locus_tag LOCUS_56740 3999 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 >Feature sequence0774 1684 440 gene locus_tag LOCUS_56750 1684 440 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_56750 3232 1703 gene locus_tag LOCUS_56760 3232 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 4536 3229 gene locus_tag LOCUS_56770 4536 3229 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_56770 >Feature sequence0775 280 1023 gene locus_tag LOCUS_56780 280 1023 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_56780 1020 2606 gene locus_tag LOCUS_56790 1020 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_56790 2650 3036 gene locus_tag LOCUS_56800 2650 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 3219 3713 gene locus_tag LOCUS_56810 3219 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 >Feature sequence0776 <1 2332 gene locus_tag LOCUS_56820 <1 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966435.1:fused MFS/spermidine synthase 2501 2731 gene locus_tag LOCUS_56830 2501 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 3043 4449 gene locus_tag LOCUS_56840 3043 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 >Feature sequence0777 1845 10 gene locus_tag LOCUS_56850 1845 10 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_56850 >Feature sequence0778 476 1936 gene locus_tag LOCUS_56860 476 1936 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_56860 1948 3327 gene locus_tag LOCUS_56870 1948 3327 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442740.1 protein_id gnl|my_center|LOCUS_56870 >Feature sequence0779 <1 639 gene locus_tag LOCUS_56880 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811913.1:chemotaxis response regulator protein-glutamate methylesterase 811 1686 gene locus_tag LOCUS_56890 811 1686 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_56890 2035 1697 gene locus_tag LOCUS_56900 2035 1697 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257356.1 protein_id gnl|my_center|LOCUS_56900 3671 2427 gene locus_tag LOCUS_56910 3671 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 >Feature sequence0780 1156 665 gene locus_tag LOCUS_56920 1156 665 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_56920 4366 1373 gene locus_tag LOCUS_56930 4366 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 >Feature sequence0781 2131 824 gene locus_tag LOCUS_56940 2131 824 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_56940 3377 2385 gene locus_tag LOCUS_56950 3377 2385 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_56950 3819 3445 gene locus_tag LOCUS_56960 3819 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 4154 4423 gene locus_tag LOCUS_56970 4154 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 >Feature sequence0782 3717 3451 gene locus_tag LOCUS_56980 3717 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 <4521 3851 gene locus_tag LOCUS_56990 <4521 3851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081278.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence0783 824 2032 gene locus_tag LOCUS_57000 824 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57000 2726 2145 gene locus_tag LOCUS_57010 2726 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57010 3033 2713 gene locus_tag LOCUS_57020 3033 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 >Feature sequence0784 125 532 gene locus_tag LOCUS_57030 125 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 564 2840 gene locus_tag LOCUS_57040 564 2840 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_57040 3491 3006 gene locus_tag LOCUS_57050 3491 3006 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_57050 4404 3496 gene locus_tag LOCUS_57060 4404 3496 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_57060 >Feature sequence0785 832 449 gene locus_tag LOCUS_57070 832 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 1253 945 gene locus_tag LOCUS_57080 1253 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 2627 1329 gene locus_tag LOCUS_57090 2627 1329 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_57090 2761 3471 gene locus_tag LOCUS_57100 2761 3471 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_57100 4334 3513 gene locus_tag LOCUS_57110 4334 3513 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118627.1 protein_id gnl|my_center|LOCUS_57110 >Feature sequence0786 1178 282 gene locus_tag LOCUS_57120 1178 282 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705540.1 protein_id gnl|my_center|LOCUS_57120 1582 1268 gene locus_tag LOCUS_57130 1582 1268 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122598.1 protein_id gnl|my_center|LOCUS_57130 3142 1619 gene locus_tag LOCUS_57140 3142 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 3308 4249 gene locus_tag LOCUS_57150 3308 4249 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_57150 >Feature sequence0787 1587 121 gene locus_tag LOCUS_57160 1587 121 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_57160 4460 1677 gene locus_tag LOCUS_57170 4460 1677 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922542.1 protein_id gnl|my_center|LOCUS_57170 >Feature sequence0788 1882 1184 gene locus_tag LOCUS_57180 1882 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 3458 2043 gene locus_tag LOCUS_57190 3458 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 <4484 3799 gene locus_tag LOCUS_57200 <4484 3799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117943.1:DUF1501 domain-containing protein >Feature sequence0789 637 155 gene locus_tag LOCUS_57210 637 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 938 1945 gene locus_tag LOCUS_57220 938 1945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_57220 2002 3276 gene locus_tag LOCUS_57230 2002 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 4249 3374 gene locus_tag LOCUS_57240 4249 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 >Feature sequence0790 2185 1196 gene locus_tag LOCUS_57250 2185 1196 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_57250 2306 3628 gene locus_tag LOCUS_57260 2306 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 3662 4471 gene locus_tag LOCUS_57270 3662 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 >Feature sequence0791 1029 121 gene locus_tag LOCUS_57280 1029 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 1562 1026 gene locus_tag LOCUS_57290 1562 1026 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_57290 2675 1662 gene locus_tag LOCUS_57300 2675 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 <4478 2847 gene locus_tag LOCUS_57310 <4478 2847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007340030.1:SPFH domain-containing protein >Feature sequence0792 569 1891 gene locus_tag LOCUS_57320 569 1891 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_57320 1958 3268 gene locus_tag LOCUS_57330 1958 3268 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_57330 3891 3292 gene locus_tag LOCUS_57340 3891 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 4262 3888 gene locus_tag LOCUS_57350 4262 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 >Feature sequence0793 1158 208 gene locus_tag LOCUS_57360 1158 208 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222265.1 protein_id gnl|my_center|LOCUS_57360 1283 1600 gene locus_tag LOCUS_57370 1283 1600 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810208.1 protein_id gnl|my_center|LOCUS_57370 3103 1760 gene locus_tag LOCUS_57380 3103 1760 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_57380 >Feature sequence0794 67 1524 gene locus_tag LOCUS_57390 67 1524 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_57390 2725 1529 gene locus_tag LOCUS_57400 gene nagA 2725 1529 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922541.1 protein_id gnl|my_center|LOCUS_57400 4001 3096 gene locus_tag LOCUS_57410 4001 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 >Feature sequence0795 1480 4101 gene locus_tag LOCUS_57420 1480 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 >Feature sequence0796 <1 1120 gene locus_tag LOCUS_57430 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942293.1:cytochrome bc complex cytochrome b subunit 1105 2580 gene locus_tag LOCUS_57440 1105 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 2577 3086 gene locus_tag LOCUS_57450 2577 3086 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_57450 >Feature sequence0797 <1 581 gene locus_tag LOCUS_57460 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921758.1:efflux RND transporter periplasmic adaptor subunit 594 4067 gene locus_tag LOCUS_57470 594 4067 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_57470 >Feature sequence0798 1863 199 gene locus_tag LOCUS_57480 1863 199 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_57480 3801 1981 gene locus_tag LOCUS_57490 gene dnaG 3801 1981 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120867.1 protein_id gnl|my_center|LOCUS_57490 >Feature sequence0799 289 1866 gene locus_tag LOCUS_57500 289 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 1863 2318 gene locus_tag LOCUS_57510 gene tcrA 1863 2318 CDS product acid-responsive two-component system response regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970747.1 protein_id gnl|my_center|LOCUS_57510 2322 4250 gene locus_tag LOCUS_57520 2322 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 >Feature sequence0800 846 298 gene locus_tag LOCUS_57530 846 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 1252 3489 gene locus_tag LOCUS_57540 1252 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 3638 4246 gene locus_tag LOCUS_57550 3638 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 >Feature sequence0801 62 883 gene locus_tag LOCUS_57560 62 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 885 1346 gene locus_tag LOCUS_57570 885 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 1343 2044 gene locus_tag LOCUS_57580 1343 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 2028 2378 gene locus_tag LOCUS_57590 2028 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 2432 2845 gene locus_tag LOCUS_57600 2432 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 2842 3357 gene locus_tag LOCUS_57610 2842 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 3269 3832 gene locus_tag LOCUS_57620 3269 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 >Feature sequence0802 <1 1193 gene locus_tag LOCUS_57630 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141384.1:tetratricopeptide repeat protein 1339 2664 gene locus_tag LOCUS_57640 1339 2664 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_57640 3505 2903 gene locus_tag LOCUS_57650 3505 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 >Feature sequence0803 1403 3022 gene locus_tag LOCUS_57660 1403 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 >Feature sequence0804 836 42 gene locus_tag LOCUS_57670 gene dapB 836 42 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_57670 2311 920 gene locus_tag LOCUS_57680 gene thrC 2311 920 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_57680 2466 3572 gene locus_tag LOCUS_57690 2466 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 4280 3711 gene locus_tag LOCUS_57700 4280 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 >Feature sequence0805 215 1738 gene locus_tag LOCUS_57710 215 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 1735 3309 gene locus_tag LOCUS_57720 1735 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 >Feature sequence0806 825 181 gene locus_tag LOCUS_57730 825 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 1681 959 gene locus_tag LOCUS_57740 1681 959 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088258909.1 protein_id gnl|my_center|LOCUS_57740 2369 1761 gene locus_tag LOCUS_57750 2369 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 4074 2371 gene locus_tag LOCUS_57760 4074 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 >Feature sequence0807 <1 1471 gene locus_tag LOCUS_57770 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008669069.1:ThuA domain-containing protein 2112 1684 gene locus_tag LOCUS_57780 2112 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 2407 3225 gene locus_tag LOCUS_57790 2407 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 3249 3968 gene locus_tag LOCUS_57800 3249 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 >Feature sequence0808 343 1728 gene locus_tag LOCUS_57810 343 1728 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921791.1 protein_id gnl|my_center|LOCUS_57810 1862 2809 gene locus_tag LOCUS_57820 1862 2809 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_57820 >Feature sequence0809 3167 4084 gene locus_tag LOCUS_57830 3167 4084 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921963.1 protein_id gnl|my_center|LOCUS_57830 >Feature sequence0810 589 4209 gene locus_tag LOCUS_57840 589 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 >Feature sequence0811 372 1355 gene locus_tag LOCUS_57850 gene pdxA 372 1355 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813085.1 protein_id gnl|my_center|LOCUS_57850 1402 2034 gene locus_tag LOCUS_57860 1402 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 2162 3391 gene locus_tag LOCUS_57870 2162 3391 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_57870 3446 4279 gene locus_tag LOCUS_57880 3446 4279 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_57880 >Feature sequence0812 2382 130 gene locus_tag LOCUS_57890 2382 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 2630 4126 gene locus_tag LOCUS_57900 2630 4126 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922622.1 protein_id gnl|my_center|LOCUS_57900 >Feature sequence0813 995 2170 gene locus_tag LOCUS_57910 995 2170 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_57910 2196 2381 gene locus_tag LOCUS_57920 2196 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 2427 2843 gene locus_tag LOCUS_57930 2427 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 2923 4278 gene locus_tag LOCUS_57940 gene argG 2923 4278 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259381.1 protein_id gnl|my_center|LOCUS_57940 >Feature sequence0814 3299 3535 gene locus_tag LOCUS_57950 3299 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 3538 3771 gene locus_tag LOCUS_57960 3538 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 >Feature sequence0815 <1 3132 gene locus_tag LOCUS_57970 <1 3132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008674544.1:[glutamate--ammonia-ligase] adenylyltransferase 3457 4263 gene locus_tag LOCUS_57980 3457 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 >Feature sequence0816 584 30 gene locus_tag LOCUS_57990 584 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 1096 581 gene locus_tag LOCUS_58000 1096 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 1542 1249 gene locus_tag LOCUS_58010 1542 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 2035 1640 gene locus_tag LOCUS_58020 2035 1640 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_58020 3943 2054 gene locus_tag LOCUS_58030 gene lepB 3943 2054 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442624.1 protein_id gnl|my_center|LOCUS_58030 >Feature sequence0817 210 1337 gene locus_tag LOCUS_58040 210 1337 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_58040 1340 1849 gene locus_tag LOCUS_58050 gene tadA 1340 1849 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_58050 1963 3393 gene locus_tag LOCUS_58060 1963 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 >Feature sequence0818 439 1491 gene locus_tag LOCUS_58070 439 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 1862 3145 gene locus_tag LOCUS_58080 1862 3145 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_58080 3540 4244 gene locus_tag LOCUS_58090 3540 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 >Feature sequence0819 356 1249 gene locus_tag LOCUS_58100 356 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 1655 3811 gene locus_tag LOCUS_58110 1655 3811 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_58110 >Feature sequence0820 <1 1955 gene locus_tag LOCUS_58120 <1 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929290.1:VCBS repeat-containing protein >Feature sequence0821 >Feature sequence0822 157 1575 gene locus_tag LOCUS_58130 157 1575 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_58130 1592 1849 gene locus_tag LOCUS_58140 1592 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 1846 2313 gene locus_tag LOCUS_58150 1846 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 2300 2584 gene locus_tag LOCUS_58160 2300 2584 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921550.1 protein_id gnl|my_center|LOCUS_58160 2655 3014 gene locus_tag LOCUS_58170 2655 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 3034 3885 gene locus_tag LOCUS_58180 3034 3885 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_58180 >Feature sequence0823 413 3838 gene locus_tag LOCUS_58190 gene carB 413 3838 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123580.1 protein_id gnl|my_center|LOCUS_58190 3918 4220 gene locus_tag LOCUS_58200 3918 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 >Feature sequence0824 1383 2639 gene locus_tag LOCUS_58210 1383 2639 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257129.1 protein_id gnl|my_center|LOCUS_58210 2765 4195 gene locus_tag LOCUS_58220 2765 4195 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_58220 >Feature sequence0825 1 4017 gene locus_tag LOCUS_58230 1 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 >Feature sequence0826 1145 1975 gene locus_tag LOCUS_58240 1145 1975 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 protein_id gnl|my_center|LOCUS_58240 >Feature sequence0827 2 313 gene locus_tag LOCUS_58250 2 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 543 3923 gene locus_tag LOCUS_58260 543 3923 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_58260 >Feature sequence0828 1566 2330 gene locus_tag LOCUS_58270 1566 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 2409 3002 gene locus_tag LOCUS_58280 2409 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 4009 3122 gene locus_tag LOCUS_58290 4009 3122 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_58290 >Feature sequence0829 <1 1235 gene locus_tag LOCUS_58300 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 1336 2532 gene locus_tag LOCUS_58310 gene amrB 1336 2532 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173000.1 protein_id gnl|my_center|LOCUS_58310 >Feature sequence0830 93 1181 gene locus_tag LOCUS_58320 93 1181 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_58320 1178 2377 gene locus_tag LOCUS_58330 1178 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120295.1 protein_id gnl|my_center|LOCUS_58330 2520 4154 gene locus_tag LOCUS_58340 2520 4154 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_58340 >Feature sequence0831 151 888 gene locus_tag LOCUS_58350 151 888 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227987.1 protein_id gnl|my_center|LOCUS_58350 >Feature sequence0832 351 1826 gene locus_tag LOCUS_58360 351 1826 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_58360 2192 2833 gene locus_tag LOCUS_58370 2192 2833 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856201.1 protein_id gnl|my_center|LOCUS_58370 2913 3377 gene locus_tag LOCUS_58380 2913 3377 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 protein_id gnl|my_center|LOCUS_58380 3470 3841 gene locus_tag LOCUS_58390 3470 3841 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 protein_id gnl|my_center|LOCUS_58390 >Feature sequence0833 545 799 gene locus_tag LOCUS_58400 545 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 808 2808 gene locus_tag LOCUS_58410 808 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 3066 3464 gene locus_tag LOCUS_58420 3066 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 4074 3670 gene locus_tag LOCUS_58430 4074 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 >Feature sequence0834 <1 2292 gene locus_tag LOCUS_58440 <1 2292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037247075.1:DNA gyrase subunit B 3964 2645 gene locus_tag LOCUS_58450 3964 2645 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_58450 >Feature sequence0835 1236 151 gene locus_tag LOCUS_58460 1236 151 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_58460 1383 2663 gene locus_tag LOCUS_58470 gene argA 1383 2663 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 protein_id gnl|my_center|LOCUS_58470 3084 3157 gene locus_tag LOCUS_t00520 3084 3157 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3164 3236 gene locus_tag LOCUS_t00530 3164 3236 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3328 3400 gene locus_tag LOCUS_t00540 3328 3400 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4009 3452 gene locus_tag LOCUS_58480 4009 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 >Feature sequence0836 1529 1047 gene locus_tag LOCUS_58490 gene tssE 1529 1047 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 protein_id gnl|my_center|LOCUS_58490 2519 1587 gene locus_tag LOCUS_58500 2519 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 3383 2577 gene locus_tag LOCUS_58510 3383 2577 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463815.1 protein_id gnl|my_center|LOCUS_58510 4093 3428 gene locus_tag LOCUS_58520 4093 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 >Feature sequence0837 362 2452 gene locus_tag LOCUS_58530 gene ligA 362 2452 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_58530 2721 3137 gene locus_tag LOCUS_58540 2721 3137 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769565.1 protein_id gnl|my_center|LOCUS_58540 3149 3532 gene locus_tag LOCUS_58550 3149 3532 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_58550 3560 3937 gene locus_tag LOCUS_58560 3560 3937 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_58560 >Feature sequence0838 932 606 gene locus_tag LOCUS_58570 932 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 2114 1011 gene locus_tag LOCUS_58580 2114 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 2526 2122 gene locus_tag LOCUS_58590 2526 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 2765 2523 gene locus_tag LOCUS_58600 2765 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 4065 2857 gene locus_tag LOCUS_58610 gene thiO 4065 2857 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103297.1 protein_id gnl|my_center|LOCUS_58610 >Feature sequence0839 631 2985 gene locus_tag LOCUS_58620 631 2985 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_58620 >Feature sequence0840 4161 1144 gene locus_tag LOCUS_58630 4161 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 >Feature sequence0841 758 549 gene locus_tag LOCUS_58640 758 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 1329 904 gene locus_tag LOCUS_58650 1329 904 CDS product DUF6210 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081499.1 protein_id gnl|my_center|LOCUS_58650 4001 1566 gene locus_tag LOCUS_58660 4001 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 >Feature sequence0842 599 1423 gene locus_tag LOCUS_58670 599 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 2394 1762 gene locus_tag LOCUS_58680 2394 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 2985 2416 gene locus_tag LOCUS_58690 2985 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 >Feature sequence0843 >Feature sequence0844 1563 643 gene locus_tag LOCUS_58700 gene xerD 1563 643 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_58700 1924 4101 gene locus_tag LOCUS_58710 1924 4101 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_58710 >Feature sequence0845 1124 129 gene locus_tag LOCUS_58720 1124 129 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618875.1 protein_id gnl|my_center|LOCUS_58720 4102 1130 gene locus_tag LOCUS_58730 4102 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 >Feature sequence0846 <1 714 gene locus_tag LOCUS_58740 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121488.1:ferredoxin family protein 698 952 gene locus_tag LOCUS_58750 698 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 1061 1285 gene locus_tag LOCUS_58760 1061 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 1285 1689 gene locus_tag LOCUS_58770 1285 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 1693 2979 gene locus_tag LOCUS_58780 1693 2979 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_58780 >Feature sequence0847 594 292 gene locus_tag LOCUS_58790 594 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 1027 686 gene locus_tag LOCUS_58800 1027 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 1502 1080 gene locus_tag LOCUS_58810 1502 1080 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_58810 3952 1649 gene locus_tag LOCUS_58820 3952 1649 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_58820 >Feature sequence0848 1843 17 gene locus_tag LOCUS_58830 gene kdpA 1843 17 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883954.1 protein_id gnl|my_center|LOCUS_58830 2065 1862 gene locus_tag LOCUS_58840 2065 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 2453 3787 gene locus_tag LOCUS_58850 gene algB 2453 3787 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_58850 >Feature sequence0849 618 3053 gene locus_tag LOCUS_58860 618 3053 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118122.1 protein_id gnl|my_center|LOCUS_58860 >Feature sequence0850 84 1229 gene locus_tag LOCUS_58870 gene lpxB 84 1229 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_58870 1371 2495 gene locus_tag LOCUS_58880 1371 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 3884 2586 gene locus_tag LOCUS_58890 3884 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 >Feature sequence0851 173 1984 gene locus_tag LOCUS_58900 173 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 2463 3842 gene locus_tag LOCUS_58910 2463 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 >Feature sequence0852 <1 2306 gene locus_tag LOCUS_58920 <1 2306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140643.1:VCBS repeat-containing protein <4098 2239 gene locus_tag LOCUS_58930 <4098 2239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence0853 1777 560 gene locus_tag LOCUS_58940 1777 560 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_58940 2580 1876 gene locus_tag LOCUS_58950 2580 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 3728 2598 gene locus_tag LOCUS_58960 3728 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 4013 3759 gene locus_tag LOCUS_58970 4013 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 >Feature sequence0854 1974 1441 gene locus_tag LOCUS_58980 1974 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 3765 3196 gene locus_tag LOCUS_58990 3765 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 >Feature sequence0855 1985 339 gene locus_tag LOCUS_59000 1985 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 3053 2001 gene locus_tag LOCUS_59010 3053 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 <4081 3055 gene locus_tag LOCUS_59020 <4081 3055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117943.1:DUF1501 domain-containing protein >Feature sequence0856 <1 885 gene locus_tag LOCUS_59030 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921875.1:prepilin-type N-terminal cleavage/methylation domain-containing protein 882 2495 gene locus_tag LOCUS_59040 882 2495 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_59040 >Feature sequence0857 114 947 gene locus_tag LOCUS_59050 114 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 950 1777 gene locus_tag LOCUS_59060 950 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 3131 1857 gene locus_tag LOCUS_59070 3131 1857 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930435.1 protein_id gnl|my_center|LOCUS_59070 3884 3156 gene locus_tag LOCUS_59080 3884 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 >Feature sequence0858 484 236 gene locus_tag LOCUS_59090 484 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 1157 489 gene locus_tag LOCUS_59100 1157 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 1569 1369 gene locus_tag LOCUS_59110 1569 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 1786 1571 gene locus_tag LOCUS_59120 1786 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 1989 1783 gene locus_tag LOCUS_59130 1989 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 3695 2139 gene locus_tag LOCUS_59140 3695 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 >Feature sequence0859 879 103 gene locus_tag LOCUS_59150 879 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 4003 950 gene locus_tag LOCUS_59160 4003 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 >Feature sequence0860 1187 105 gene locus_tag LOCUS_59170 1187 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 3987 1429 gene locus_tag LOCUS_59180 3987 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 >Feature sequence0861 171 755 gene locus_tag LOCUS_59190 171 755 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008652955.1 protein_id gnl|my_center|LOCUS_59190 752 1453 gene locus_tag LOCUS_59200 752 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 1523 3244 gene locus_tag LOCUS_59210 1523 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 3347 3982 gene locus_tag LOCUS_59220 3347 3982 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144386.1 protein_id gnl|my_center|LOCUS_59220 >Feature sequence0862 2095 914 gene locus_tag LOCUS_59230 2095 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 3358 2231 gene locus_tag LOCUS_59240 gene fbp 3358 2231 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_59240 3795 3730 gene locus_tag LOCUS_t00550 3795 3730 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3959 3888 gene locus_tag LOCUS_t00560 3959 3888 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4039 3964 gene locus_tag LOCUS_t00570 4039 3964 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0863 408 187 gene locus_tag LOCUS_59250 408 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 737 453 gene locus_tag LOCUS_59260 737 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 2993 768 gene locus_tag LOCUS_59270 2993 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 3211 3903 gene locus_tag LOCUS_59280 3211 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 >Feature sequence0864 <1 2609 gene locus_tag LOCUS_59290 <1 2609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein 2870 3652 gene locus_tag LOCUS_59300 2870 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 >Feature sequence0865 762 493 gene locus_tag LOCUS_59310 762 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 1116 811 gene locus_tag LOCUS_59320 1116 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 1480 1118 gene locus_tag LOCUS_59330 1480 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 2783 1524 gene locus_tag LOCUS_59340 2783 1524 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_59340 3928 2960 gene locus_tag LOCUS_59350 3928 2960 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_59350 >Feature sequence0866 350 87 gene locus_tag LOCUS_59360 350 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 620 2335 gene locus_tag LOCUS_59370 620 2335 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_59370 2457 2792 gene locus_tag LOCUS_59380 2457 2792 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329331.1 protein_id gnl|my_center|LOCUS_59380 >Feature sequence0867 <1 877 gene locus_tag LOCUS_59390 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000909802.1:2-aminoethylphosphonate ABC transport system, membrane component PhnV 1042 3888 gene locus_tag LOCUS_59400 1042 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 >Feature sequence0868 2970 1957 gene locus_tag LOCUS_59410 2970 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59410 >Feature sequence0869 2598 736 gene locus_tag LOCUS_59420 2598 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 3535 3284 gene locus_tag LOCUS_59430 3535 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 >Feature sequence0870 1968 361 gene locus_tag LOCUS_59440 1968 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 3017 2181 gene locus_tag LOCUS_59450 3017 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 3864 3292 gene locus_tag LOCUS_59460 3864 3292 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333306.1 protein_id gnl|my_center|LOCUS_59460 >Feature sequence0871 62 1852 gene locus_tag LOCUS_59470 62 1852 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_59470 2536 1913 gene locus_tag LOCUS_59480 2536 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 2648 3358 gene locus_tag LOCUS_59490 gene tsaB 2648 3358 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567077.1 protein_id gnl|my_center|LOCUS_59490 >Feature sequence0872 320 1459 gene locus_tag LOCUS_59500 320 1459 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_59500 1974 2576 gene locus_tag LOCUS_59510 1974 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59510 2834 3694 gene locus_tag LOCUS_59520 2834 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 >Feature sequence0873 2727 2113 gene locus_tag LOCUS_59530 2727 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 3245 2970 gene locus_tag LOCUS_59540 3245 2970 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257144.1 protein_id gnl|my_center|LOCUS_59540 >Feature sequence0874 1036 119 gene locus_tag LOCUS_59550 1036 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 1575 1165 gene locus_tag LOCUS_59560 1575 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 3353 1584 gene locus_tag LOCUS_59570 3353 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 <3986 3350 gene locus_tag LOCUS_59580 <3986 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964480.1:Fe-S cluster assembly protein SufD >Feature sequence0875 815 21 gene locus_tag LOCUS_59590 815 21 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967264.1 protein_id gnl|my_center|LOCUS_59590 1104 1949 gene locus_tag LOCUS_59600 1104 1949 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_59600 2078 3607 gene locus_tag LOCUS_59610 2078 3607 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_59610 >Feature sequence0876 1546 1157 gene locus_tag LOCUS_tm00010 1546 1157 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2168 1749 gene locus_tag LOCUS_59620 2168 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 2406 3923 gene locus_tag LOCUS_59630 2406 3923 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_59630 >Feature sequence0877 803 180 gene locus_tag LOCUS_59640 803 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 3671 930 gene locus_tag LOCUS_59650 3671 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 >Feature sequence0878 574 648 gene locus_tag LOCUS_t00580 574 648 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2247 580 gene locus_tag LOCUS_59660 2247 580 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197532628.1 protein_id gnl|my_center|LOCUS_59660 2459 2247 gene locus_tag LOCUS_59670 2459 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 3049 2645 gene locus_tag LOCUS_59680 3049 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 <3949 3046 gene locus_tag LOCUS_59690 <3949 3046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123622.1:DnaB-like helicase C-terminal domain-containing protein >Feature sequence0879 131 1576 gene locus_tag LOCUS_59700 131 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 1793 3901 gene locus_tag LOCUS_59710 1793 3901 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_59710 >Feature sequence0880 <1 2607 gene locus_tag LOCUS_59720 <1 2607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272458.1:calcium-transporting P-type ATPase, PMR1-type >Feature sequence0881 83 1048 gene locus_tag LOCUS_59730 83 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 1126 2454 gene locus_tag LOCUS_59740 1126 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 3697 2468 gene locus_tag LOCUS_59750 gene thrC 3697 2468 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_59750 >Feature sequence0882 1156 74 gene locus_tag LOCUS_59760 1156 74 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_59760 2232 1237 gene locus_tag LOCUS_59770 2232 1237 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_59770 2455 3105 gene locus_tag LOCUS_59780 2455 3105 CDS product ApaLI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256228.1 protein_id gnl|my_center|LOCUS_59780 >Feature sequence0883 117 1193 gene locus_tag LOCUS_59790 gene rlmN 117 1193 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622604.1 protein_id gnl|my_center|LOCUS_59790 1290 2678 gene locus_tag LOCUS_59800 1290 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59800 >Feature sequence0884 2184 1252 gene locus_tag LOCUS_59810 2184 1252 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_59810 2310 2873 gene locus_tag LOCUS_59820 2310 2873 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975272.1 protein_id gnl|my_center|LOCUS_59820 2956 3783 gene locus_tag LOCUS_59830 2956 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 >Feature sequence0885 547 1392 gene locus_tag LOCUS_59840 547 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 1522 3918 gene locus_tag LOCUS_59850 1522 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 >Feature sequence0886 26 2374 gene locus_tag LOCUS_59860 26 2374 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_59860 <3932 2508 gene locus_tag LOCUS_59870 <3932 2508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041976239.1:M14 family zinc carboxypeptidase >Feature sequence0887 1327 83 gene locus_tag LOCUS_59880 1327 83 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_59880 2260 1373 gene locus_tag LOCUS_59890 2260 1373 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_59890 2353 3222 gene locus_tag LOCUS_59900 2353 3222 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120542.1 protein_id gnl|my_center|LOCUS_59900 3922 3242 gene locus_tag LOCUS_59910 3922 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 >Feature sequence0888 <1 855 gene locus_tag LOCUS_59920 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002079042.1:response regulator 1001 789 gene locus_tag LOCUS_59930 1001 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 1364 1107 gene locus_tag LOCUS_59940 1364 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 1675 2388 gene locus_tag LOCUS_59950 1675 2388 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_59950 2616 2455 gene locus_tag LOCUS_59960 2616 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 3597 2758 gene locus_tag LOCUS_59970 3597 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 >Feature sequence0889 <1 1335 gene locus_tag LOCUS_59980 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921309.1:DUF1549 and DUF1553 domain-containing protein 1586 2875 gene locus_tag LOCUS_59990 1586 2875 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_59990 2928 3344 gene locus_tag LOCUS_60000 2928 3344 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_60000 3388 3804 gene locus_tag LOCUS_60010 3388 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 >Feature sequence0890 119 472 gene locus_tag LOCUS_60020 119 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 469 684 gene locus_tag LOCUS_60030 469 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 678 1199 gene locus_tag LOCUS_60040 678 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 2162 1281 gene locus_tag LOCUS_60050 2162 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 2382 2218 gene locus_tag LOCUS_60060 2382 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 2636 2379 gene locus_tag LOCUS_60070 2636 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 3553 2633 gene locus_tag LOCUS_60080 3553 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 >Feature sequence0891 232 2208 gene locus_tag LOCUS_60090 232 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 3624 2569 gene locus_tag LOCUS_60100 3624 2569 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921881.1 protein_id gnl|my_center|LOCUS_60100 >Feature sequence0892 1110 427 gene locus_tag LOCUS_60110 1110 427 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_60110 1371 1877 gene locus_tag LOCUS_60120 1371 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 1894 2313 gene locus_tag LOCUS_60130 1894 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 >Feature sequence0893 1137 343 gene locus_tag LOCUS_60140 1137 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 1459 2871 gene locus_tag LOCUS_60150 1459 2871 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_60150 2952 3887 gene locus_tag LOCUS_60160 2952 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 >Feature sequence0894 89 1405 gene locus_tag LOCUS_60170 89 1405 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_60170 1861 1788 gene locus_tag LOCUS_t00590 1861 1788 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0895 179 640 gene locus_tag LOCUS_60180 179 640 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_60180 <3888 649 gene locus_tag LOCUS_60190 <3888 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence0896 1246 2469 gene locus_tag LOCUS_60200 1246 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 2466 3797 gene locus_tag LOCUS_60210 2466 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 >Feature sequence0897 1213 647 gene locus_tag LOCUS_60220 1213 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 1648 1313 gene locus_tag LOCUS_60230 1648 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 3035 1695 gene locus_tag LOCUS_60240 gene eno 3035 1695 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103955.1 protein_id gnl|my_center|LOCUS_60240 >Feature sequence0898 <1 1190 gene locus_tag LOCUS_60250 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005079894.1:SulP family inorganic anion transporter 1414 3753 gene locus_tag LOCUS_60260 1414 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 >Feature sequence0899 529 3555 gene locus_tag LOCUS_60270 529 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 >Feature sequence0900 21 1298 gene locus_tag LOCUS_60280 21 1298 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_60280 1806 1363 gene locus_tag LOCUS_60290 1806 1363 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_60290 2291 1842 gene locus_tag LOCUS_60300 2291 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 2646 2323 gene locus_tag LOCUS_60310 2646 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 3064 2648 gene locus_tag LOCUS_60320 3064 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 3801 3073 gene locus_tag LOCUS_60330 3801 3073 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_60330 >Feature sequence0901 1681 122 gene locus_tag LOCUS_60340 1681 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 3100 1895 gene locus_tag LOCUS_60350 3100 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 <3857 3097 gene locus_tag LOCUS_60360 <3857 3097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259633.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme >Feature sequence0902 3508 1706 gene locus_tag LOCUS_60370 3508 1706 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460338.1 protein_id gnl|my_center|LOCUS_60370 >Feature sequence0903 283 843 gene locus_tag LOCUS_60380 gene rpoE 283 843 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_60380 >Feature sequence0904 3317 1209 gene locus_tag LOCUS_60390 3317 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 >Feature sequence0905 2282 573 gene locus_tag LOCUS_60400 gene hutU 2282 573 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_60400 2452 3582 gene locus_tag LOCUS_60410 2452 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 >Feature sequence0906 288 3821 gene locus_tag LOCUS_60420 288 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 >Feature sequence0907 >Feature sequence0908 1121 3 gene locus_tag LOCUS_60430 1121 3 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265760.1 protein_id gnl|my_center|LOCUS_60430 3206 1218 gene locus_tag LOCUS_60440 gene asnB 3206 1218 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525357.1 protein_id gnl|my_center|LOCUS_60440 <3832 3272 gene locus_tag LOCUS_60450 <3832 3272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121199.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence0909 1598 1810 gene locus_tag LOCUS_60460 1598 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 1807 2232 gene locus_tag LOCUS_60470 1807 2232 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_60470 3305 2262 gene locus_tag LOCUS_60480 gene ychF 3305 2262 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_60480 >Feature sequence0910 418 194 gene locus_tag LOCUS_60490 418 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 1096 836 gene locus_tag LOCUS_60500 1096 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60500 2051 1266 gene locus_tag LOCUS_60510 2051 1266 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335847.1 protein_id gnl|my_center|LOCUS_60510 2168 3121 gene locus_tag LOCUS_60520 2168 3121 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_60520 3138 3767 gene locus_tag LOCUS_60530 3138 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 >Feature sequence0911 1328 267 gene locus_tag LOCUS_60540 1328 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 1589 1515 gene locus_tag LOCUS_t00600 1589 1515 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1944 3518 gene locus_tag LOCUS_60550 1944 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 >Feature sequence0912 2589 1231 gene locus_tag LOCUS_60560 2589 1231 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143746.1 protein_id gnl|my_center|LOCUS_60560 2855 2930 gene locus_tag LOCUS_t00610 2855 2930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0913 1555 47 gene locus_tag LOCUS_60570 1555 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 2350 1700 gene locus_tag LOCUS_60580 2350 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 2994 2572 gene locus_tag LOCUS_60590 2994 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 <3800 3121 gene locus_tag LOCUS_60600 <3800 3121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122037.1:type III polyketide synthase >Feature sequence0914 1559 825 gene locus_tag LOCUS_60610 1559 825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_60610 2696 1566 gene locus_tag LOCUS_60620 2696 1566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_60620 3579 2731 gene locus_tag LOCUS_60630 3579 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 >Feature sequence0915 321 998 gene locus_tag LOCUS_60640 321 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 1349 2212 gene locus_tag LOCUS_60650 1349 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 2360 2776 gene locus_tag LOCUS_60660 2360 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 >Feature sequence0916 >Feature sequence0917 413 57 gene locus_tag LOCUS_60670 413 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 1280 555 gene locus_tag LOCUS_60680 1280 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 2052 1351 gene locus_tag LOCUS_60690 2052 1351 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_60690 3722 2103 gene locus_tag LOCUS_60700 3722 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 >Feature sequence0918 220 1158 gene locus_tag LOCUS_60710 220 1158 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259425.1 protein_id gnl|my_center|LOCUS_60710 1487 2464 gene locus_tag LOCUS_60720 1487 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 2500 2745 gene locus_tag LOCUS_60730 2500 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 >Feature sequence0919 1590 700 gene locus_tag LOCUS_60740 1590 700 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_60740 2029 1574 gene locus_tag LOCUS_60750 gene nusB 2029 1574 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_60750 2579 2112 gene locus_tag LOCUS_60760 gene ribE 2579 2112 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_60760 3081 2584 gene locus_tag LOCUS_60770 3081 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 <3766 3127 gene locus_tag LOCUS_60780 <3766 3127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000179608.1:transcription termination factor Rho >Feature sequence0920 >Feature sequence0921 436 131 gene locus_tag LOCUS_60790 gene nirD 436 131 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_60790 532 1116 gene locus_tag LOCUS_60800 gene cyaB 532 1116 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120856.1 protein_id gnl|my_center|LOCUS_60800 1247 2122 gene locus_tag LOCUS_60810 gene panC 1247 2122 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_60810 2205 3554 gene locus_tag LOCUS_60820 gene mgtE 2205 3554 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870202.1 protein_id gnl|my_center|LOCUS_60820 >Feature sequence0922 1831 1160 gene locus_tag LOCUS_60830 1831 1160 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259457.1 protein_id gnl|my_center|LOCUS_60830 2088 1861 gene locus_tag LOCUS_60840 2088 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 2353 2072 gene locus_tag LOCUS_60850 2353 2072 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_60850 3710 2418 gene locus_tag LOCUS_60860 3710 2418 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_60860 >Feature sequence0923 706 1869 gene locus_tag LOCUS_60870 706 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 1841 2698 gene locus_tag LOCUS_60880 1841 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 2749 3624 gene locus_tag LOCUS_60890 2749 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 >Feature sequence0924 1169 54 gene locus_tag LOCUS_60900 1169 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 1789 2706 gene locus_tag LOCUS_60910 1789 2706 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922368.1 protein_id gnl|my_center|LOCUS_60910 >Feature sequence0925 256 2778 gene locus_tag LOCUS_60920 256 2778 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249708.1 protein_id gnl|my_center|LOCUS_60920 1912 1988 gene locus_tag LOCUS_t00620 1912 1988 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2857 3705 gene locus_tag LOCUS_60930 2857 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 >Feature sequence0926 419 108 gene locus_tag LOCUS_60940 419 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 1912 602 gene locus_tag LOCUS_60950 1912 602 CDS product BBP7 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921355.1 protein_id gnl|my_center|LOCUS_60950 3549 2194 gene locus_tag LOCUS_60960 3549 2194 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 protein_id gnl|my_center|LOCUS_60960 >Feature sequence0927 <1 1011 gene locus_tag LOCUS_60970 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120539.1:acetylxylan esterase >Feature sequence0928 2319 1753 gene locus_tag LOCUS_60980 2319 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 3716 2508 gene locus_tag LOCUS_60990 3716 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 >Feature sequence0929 1113 376 gene locus_tag LOCUS_61000 1113 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 1441 1611 gene locus_tag LOCUS_61010 1441 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 3162 1924 gene locus_tag LOCUS_61020 gene fabF 3162 1924 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_61020 3401 3159 gene locus_tag LOCUS_61030 3401 3159 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_61030 >Feature sequence0930 2759 105 gene locus_tag LOCUS_61040 2759 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61040 3712 3146 gene locus_tag LOCUS_61050 3712 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 >Feature sequence0931 359 2470 gene locus_tag LOCUS_61060 359 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 >Feature sequence0932 694 101 gene locus_tag LOCUS_61070 694 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 1365 715 gene locus_tag LOCUS_61080 1365 715 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_61080 2178 1372 gene locus_tag LOCUS_61090 2178 1372 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_61090 <3706 2240 gene locus_tag LOCUS_61100 <3706 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666047.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0933 312 1295 gene locus_tag LOCUS_61110 gene coxB 312 1295 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 protein_id gnl|my_center|LOCUS_61110 1403 3106 gene locus_tag LOCUS_61120 gene ctaD 1403 3106 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533221.1 protein_id gnl|my_center|LOCUS_61120 3133 3555 gene locus_tag LOCUS_61130 3133 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 >Feature sequence0934 1012 2670 gene locus_tag LOCUS_61140 1012 2670 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921975.1 protein_id gnl|my_center|LOCUS_61140 >Feature sequence0935 1538 558 gene locus_tag LOCUS_61150 1538 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 <3689 1825 gene locus_tag LOCUS_61160 <3689 1825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002983660.1:Stp1/IreP family PP2C-type Ser/Thr phosphatase >Feature sequence0936 <1 896 gene locus_tag LOCUS_61170 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257673.1:cysteine desulfurase-like protein 2502 1078 gene locus_tag LOCUS_61180 2502 1078 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_61180 2627 3241 gene locus_tag LOCUS_61190 2627 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 >Feature sequence0937 1287 145 gene locus_tag LOCUS_61200 1287 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 1546 3087 gene locus_tag LOCUS_61210 1546 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 3404 3180 gene locus_tag LOCUS_61220 3404 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 >Feature sequence0938 106 1095 gene locus_tag LOCUS_61230 106 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 1111 1977 gene locus_tag LOCUS_61240 1111 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61240 2308 3546 gene locus_tag LOCUS_61250 2308 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_61250 >Feature sequence0939 <3665 3059 gene locus_tag LOCUS_61260 <3665 3059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583420.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence0940 543 845 gene locus_tag LOCUS_61270 543 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 863 1291 gene locus_tag LOCUS_61280 863 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 3091 3441 gene locus_tag LOCUS_61290 3091 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 >Feature sequence0941 <1 1452 gene locus_tag LOCUS_61300 <1 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615465.1:PSD1 and planctomycete cytochrome C domain-containing protein 1529 2080 gene locus_tag LOCUS_61310 1529 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 2152 3561 gene locus_tag LOCUS_61320 2152 3561 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_61320 >Feature sequence0942 3541 2267 gene locus_tag LOCUS_61330 3541 2267 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_61330 >Feature sequence0943 155 445 gene locus_tag LOCUS_61340 155 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 665 3493 gene locus_tag LOCUS_61350 665 3493 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_61350 >Feature sequence0944 135 1277 gene locus_tag LOCUS_61360 gene tatC 135 1277 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_61360 1414 3510 gene locus_tag LOCUS_61370 1414 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 >Feature sequence0945 739 332 gene locus_tag LOCUS_61380 gene vapC 739 332 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 protein_id gnl|my_center|LOCUS_61380 972 736 gene locus_tag LOCUS_61390 972 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 1102 2229 gene locus_tag LOCUS_61400 1102 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 2582 2235 gene locus_tag LOCUS_61410 2582 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 2821 2579 gene locus_tag LOCUS_61420 2821 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 3168 2851 gene locus_tag LOCUS_61430 3168 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 >Feature sequence0946 216 1736 gene locus_tag LOCUS_61440 gene lysS 216 1736 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_61440 1993 3426 gene locus_tag LOCUS_61450 1993 3426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_61450 >Feature sequence0947 >Feature sequence0948 2226 2909 gene locus_tag LOCUS_61460 2226 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 >Feature sequence0949 246 2312 gene locus_tag LOCUS_61470 246 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 2306 3607 gene locus_tag LOCUS_61480 2306 3607 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_61480 >Feature sequence0950 820 80 gene locus_tag LOCUS_61490 820 80 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_61490 2042 825 gene locus_tag LOCUS_61500 2042 825 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_61500 3499 2354 gene locus_tag LOCUS_61510 3499 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 >Feature sequence0951 251 87 gene locus_tag LOCUS_61520 251 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 676 329 gene locus_tag LOCUS_61530 676 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 >Feature sequence0952 967 2217 gene locus_tag LOCUS_61540 967 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 2468 3490 gene locus_tag LOCUS_61550 2468 3490 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_61550 >Feature sequence0953 2236 32 gene locus_tag LOCUS_61560 2236 32 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767848.1 protein_id gnl|my_center|LOCUS_61560 2652 3005 gene locus_tag LOCUS_61570 2652 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021271.1 protein_id gnl|my_center|LOCUS_61570 >Feature sequence0954 65 1324 gene locus_tag LOCUS_61580 65 1324 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_61580 1407 2633 gene locus_tag LOCUS_61590 1407 2633 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_61590 >Feature sequence0955 243 437 gene locus_tag LOCUS_61600 243 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 542 1921 gene locus_tag LOCUS_61610 542 1921 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_61610 2568 2786 gene locus_tag LOCUS_61620 2568 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 >Feature sequence0956 1170 175 gene locus_tag LOCUS_61630 1170 175 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_61630 3447 1171 gene locus_tag LOCUS_61640 3447 1171 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_61640 >Feature sequence0957 1035 742 gene locus_tag LOCUS_61650 1035 742 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976351.1 protein_id gnl|my_center|LOCUS_61650 1196 1834 gene locus_tag LOCUS_61660 1196 1834 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140605.1 protein_id gnl|my_center|LOCUS_61660 2444 1992 gene locus_tag LOCUS_61670 2444 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 >Feature sequence0958 1142 1966 gene locus_tag LOCUS_61680 1142 1966 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270259.1 protein_id gnl|my_center|LOCUS_61680 1979 2512 gene locus_tag LOCUS_61690 1979 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 2651 3421 gene locus_tag LOCUS_61700 2651 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 >Feature sequence0959 230 958 gene locus_tag LOCUS_61710 gene rnc 230 958 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120177.1 protein_id gnl|my_center|LOCUS_61710 984 1301 gene locus_tag LOCUS_61720 984 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 1568 1335 gene locus_tag LOCUS_61730 1568 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 3495 1615 gene locus_tag LOCUS_61740 3495 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 >Feature sequence0960 1787 495 gene locus_tag LOCUS_61750 1787 495 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_61750 3467 2268 gene locus_tag LOCUS_61760 3467 2268 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_61760 >Feature sequence0961 178 1071 gene locus_tag LOCUS_61770 gene dapA 178 1071 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_61770 1475 1894 gene locus_tag LOCUS_61780 1475 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 1872 3506 gene locus_tag LOCUS_61790 1872 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 >Feature sequence0962 100 405 gene locus_tag LOCUS_61800 100 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 1242 430 gene locus_tag LOCUS_61810 1242 430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810326.1 protein_id gnl|my_center|LOCUS_61810 2179 1235 gene locus_tag LOCUS_61820 2179 1235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_61820 3502 2264 gene locus_tag LOCUS_61830 3502 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 >Feature sequence0963 271 879 gene locus_tag LOCUS_61840 gene yihX 271 879 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175743.1 protein_id gnl|my_center|LOCUS_61840 922 1674 gene locus_tag LOCUS_61850 922 1674 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921911.1 protein_id gnl|my_center|LOCUS_61850 1988 3232 gene locus_tag LOCUS_61860 1988 3232 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120806.1 protein_id gnl|my_center|LOCUS_61860 3246 3455 gene locus_tag LOCUS_61870 3246 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 >Feature sequence0964 959 372 gene locus_tag LOCUS_61880 959 372 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_61880 1184 1753 gene locus_tag LOCUS_61890 1184 1753 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_61890 1755 2054 gene locus_tag LOCUS_61900 1755 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 2051 2275 gene locus_tag LOCUS_61910 2051 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61910 >Feature sequence0965 2 574 gene locus_tag LOCUS_61920 2 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 774 1247 gene locus_tag LOCUS_61930 774 1247 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034360921.1 protein_id gnl|my_center|LOCUS_61930 1252 3084 gene locus_tag LOCUS_61940 1252 3084 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_61940 3214 3501 gene locus_tag LOCUS_61950 3214 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 >Feature sequence0966 6 1331 gene locus_tag LOCUS_61960 6 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 1876 1409 gene locus_tag LOCUS_61970 1876 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 >Feature sequence0967 537 3392 gene locus_tag LOCUS_61980 537 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 >Feature sequence0968 492 1508 gene locus_tag LOCUS_61990 492 1508 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_61990 1692 2516 gene locus_tag LOCUS_62000 gene cysT 1692 2516 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_62000 2506 3453 gene locus_tag LOCUS_62010 gene cysW 2506 3453 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_62010 >Feature sequence0969 >Feature sequence0970 1670 225 gene locus_tag LOCUS_62020 1670 225 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942594.1 protein_id gnl|my_center|LOCUS_62020 1989 3446 gene locus_tag LOCUS_62030 gene atoC 1989 3446 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389139.1 protein_id gnl|my_center|LOCUS_62030 >Feature sequence0971 >Feature sequence0972 1955 2875 gene locus_tag LOCUS_62040 1955 2875 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_62040 >Feature sequence0973 629 1993 gene locus_tag LOCUS_62050 629 1993 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921329.1 protein_id gnl|my_center|LOCUS_62050 3513 2254 gene locus_tag LOCUS_62060 3513 2254 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_62060 >Feature sequence0974 1798 1091 gene locus_tag LOCUS_62070 1798 1091 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_62070 2873 1914 gene locus_tag LOCUS_62080 gene miaA 2873 1914 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118401.1 protein_id gnl|my_center|LOCUS_62080 3327 2878 gene locus_tag LOCUS_62090 3327 2878 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172875.1 protein_id gnl|my_center|LOCUS_62090 >Feature sequence0975 407 1903 gene locus_tag LOCUS_62100 407 1903 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_62100 2482 1910 gene locus_tag LOCUS_62110 2482 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 <3509 2515 gene locus_tag LOCUS_62120 <3509 2515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921626.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0976 1396 104 gene locus_tag LOCUS_62130 1396 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_62130 1654 2106 gene locus_tag LOCUS_62140 1654 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 2638 2171 gene locus_tag LOCUS_62150 2638 2171 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_62150 3358 2795 gene locus_tag LOCUS_62160 3358 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 >Feature sequence0977 299 84 gene locus_tag LOCUS_62170 299 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 931 215 gene locus_tag LOCUS_62180 931 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 1530 925 gene locus_tag LOCUS_62190 1530 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 1915 1766 gene locus_tag LOCUS_62200 1915 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 2371 2171 gene locus_tag LOCUS_62210 2371 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 >Feature sequence0978 751 296 gene locus_tag LOCUS_62220 751 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 1193 810 gene locus_tag LOCUS_62230 1193 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 1715 1314 gene locus_tag LOCUS_62240 1715 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 2432 1752 gene locus_tag LOCUS_62250 2432 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 3327 2470 gene locus_tag LOCUS_62260 3327 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 >Feature sequence0979 1654 17 gene locus_tag LOCUS_62270 1654 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 1849 2319 gene locus_tag LOCUS_62280 1849 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 <3497 2659 gene locus_tag LOCUS_62290 <3497 2659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121201.1:excinuclease ABC subunit UvrC >Feature sequence0980 1141 137 gene locus_tag LOCUS_62300 1141 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 2633 1299 gene locus_tag LOCUS_62310 gene thiC 2633 1299 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326663.1 protein_id gnl|my_center|LOCUS_62310 2899 3330 gene locus_tag LOCUS_62320 2899 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 >Feature sequence0981 >Feature sequence0982 1153 2079 gene locus_tag LOCUS_62330 gene nadA 1153 2079 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_62330 >Feature sequence0983 2046 922 gene locus_tag LOCUS_62340 2046 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 <3481 2144 gene locus_tag LOCUS_62350 <3481 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162015939.1:fumarylacetoacetase >Feature sequence0984 1317 136 gene locus_tag LOCUS_62360 1317 136 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922679.1 protein_id gnl|my_center|LOCUS_62360 1427 3058 gene locus_tag LOCUS_62370 1427 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 >Feature sequence0985 222 959 gene locus_tag LOCUS_62380 222 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 982 1692 gene locus_tag LOCUS_62390 982 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 2343 1705 gene locus_tag LOCUS_62400 2343 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 2608 2417 gene locus_tag LOCUS_62410 2608 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 2821 2982 gene locus_tag LOCUS_62420 2821 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 >Feature sequence0986 2083 1271 gene locus_tag LOCUS_62430 2083 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 2748 2089 gene locus_tag LOCUS_62440 2748 2089 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_62440 3074 3382 gene locus_tag LOCUS_62450 3074 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 >Feature sequence0987 708 208 gene locus_tag LOCUS_62460 708 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 939 3374 gene locus_tag LOCUS_62470 939 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 >Feature sequence0988 937 191 gene locus_tag LOCUS_62480 937 191 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_62480 3270 985 gene locus_tag LOCUS_62490 3270 985 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149111241.1 protein_id gnl|my_center|LOCUS_62490 >Feature sequence0989 1610 30 gene locus_tag LOCUS_62500 1610 30 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970067.1 protein_id gnl|my_center|LOCUS_62500 1807 2148 gene locus_tag LOCUS_62510 1807 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 2249 2950 gene locus_tag LOCUS_62520 2249 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 >Feature sequence0990 98 2260 gene locus_tag LOCUS_62530 gene ppk1 98 2260 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141500.1 protein_id gnl|my_center|LOCUS_62530 2877 2590 gene locus_tag LOCUS_62540 2877 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 >Feature sequence0991 766 95 gene locus_tag LOCUS_62550 766 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 1269 2792 gene locus_tag LOCUS_62560 1269 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 <3412 2872 gene locus_tag LOCUS_62570 <3412 2872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056358.1:TIGR00300 family protein >Feature sequence0992 <1 743 gene locus_tag LOCUS_62580 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119258.1:ABC transporter permease subunit 1137 871 gene locus_tag LOCUS_62590 1137 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 2309 1341 gene locus_tag LOCUS_62600 2309 1341 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139457001.1 protein_id gnl|my_center|LOCUS_62600 3367 2414 gene locus_tag LOCUS_62610 3367 2414 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_62610 >Feature sequence0993 3 467 gene locus_tag LOCUS_62620 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 801 3320 gene locus_tag LOCUS_62630 801 3320 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118036.1 protein_id gnl|my_center|LOCUS_62630 >Feature sequence0994 19 576 gene locus_tag LOCUS_62640 19 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 1834 662 gene locus_tag LOCUS_62650 1834 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62650 3036 1831 gene locus_tag LOCUS_62660 3036 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 >Feature sequence0995 <1 1051 gene locus_tag LOCUS_62670 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 1048 3297 gene locus_tag LOCUS_62680 1048 3297 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666047.1 protein_id gnl|my_center|LOCUS_62680 >Feature sequence0996 572 1705 gene locus_tag LOCUS_62690 gene hemW 572 1705 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_62690 2136 2226 gene locus_tag LOCUS_t00630 2136 2226 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0997 <1 2203 gene locus_tag LOCUS_62700 <1 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123700.1:UvrD-helicase domain-containing protein >Feature sequence0998 2931 1636 gene locus_tag LOCUS_62710 2931 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 >Feature sequence0999 471 1112 gene locus_tag LOCUS_62720 471 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 1159 2031 gene locus_tag LOCUS_62730 1159 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 2049 2252 gene locus_tag LOCUS_62740 2049 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 2243 2584 gene locus_tag LOCUS_62750 2243 2584 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_62750 2626 3318 gene locus_tag LOCUS_62760 2626 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62760 >Feature sequence1000 1058 1879 gene locus_tag LOCUS_62770 1058 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 2580 3263 gene locus_tag LOCUS_62780 2580 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 >Feature sequence1001 19 714 gene locus_tag LOCUS_62790 19 714 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_62790 1162 1572 gene locus_tag LOCUS_62800 1162 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 1864 2208 gene locus_tag LOCUS_62810 1864 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 2202 2558 gene locus_tag LOCUS_62820 gene tnpB 2202 2558 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624622.1 protein_id gnl|my_center|LOCUS_62820 >Feature sequence1002 424 1728 gene locus_tag LOCUS_62830 424 1728 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_62830 1750 2484 gene locus_tag LOCUS_62840 1750 2484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_62840 >Feature sequence1003 519 58 gene locus_tag LOCUS_62850 gene htdZ 519 58 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_62850 609 1058 gene locus_tag LOCUS_62860 609 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 1425 2807 gene locus_tag LOCUS_62870 1425 2807 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_62870 3107 2847 gene locus_tag LOCUS_62880 gene infA 3107 2847 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933820.1 protein_id gnl|my_center|LOCUS_62880 >Feature sequence1004 120 3170 gene locus_tag LOCUS_62890 120 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 >Feature sequence1005 886 1206 gene locus_tag LOCUS_62900 886 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 1203 3017 gene locus_tag LOCUS_62910 1203 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 >Feature sequence1006 1881 94 gene locus_tag LOCUS_62920 1881 94 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_62920 2179 2583 gene locus_tag LOCUS_62930 2179 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 2635 2979 gene locus_tag LOCUS_62940 gene hypA 2635 2979 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_62940 >Feature sequence1007 2380 1808 gene locus_tag LOCUS_62950 2380 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 3207 2569 gene locus_tag LOCUS_62960 3207 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62960 >Feature sequence1008 <1 1335 gene locus_tag LOCUS_62970 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118727.1:DUF1501 domain-containing protein 1917 3233 gene locus_tag LOCUS_62980 1917 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 >Feature sequence1009 986 81 gene locus_tag LOCUS_62990 986 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62990 1415 1882 gene locus_tag LOCUS_63000 1415 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63000 >Feature sequence1010 1631 69 gene locus_tag LOCUS_63010 1631 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 3204 1618 gene locus_tag LOCUS_63020 3204 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 >Feature sequence1011 755 414 gene locus_tag LOCUS_63030 755 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 985 752 gene locus_tag LOCUS_63040 985 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 1241 1032 gene locus_tag LOCUS_63050 1241 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 <3327 1252 gene locus_tag LOCUS_63060 <3327 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404233.1:DNA topoisomerase IV subunit A >Feature sequence1012 1403 603 gene locus_tag LOCUS_63070 1403 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 2672 1413 gene locus_tag LOCUS_63080 2672 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 3176 2868 gene locus_tag LOCUS_63090 3176 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 >Feature sequence1013 1247 597 gene locus_tag LOCUS_63100 1247 597 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_63100 2825 1743 gene locus_tag LOCUS_63110 2825 1743 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_63110 >Feature sequence1014 <1 679 gene locus_tag LOCUS_63120 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036515.1:bifunctional lysylphosphatidylglycerol flippase/synthetase MprF 676 1443 gene locus_tag LOCUS_63130 676 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 1425 2363 gene locus_tag LOCUS_63140 1425 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 2363 3058 gene locus_tag LOCUS_63150 2363 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_63150 >Feature sequence1015 481 287 gene locus_tag LOCUS_63160 481 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 1756 821 gene locus_tag LOCUS_63170 1756 821 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259643.1 protein_id gnl|my_center|LOCUS_63170 3020 1779 gene locus_tag LOCUS_63180 gene hutI 3020 1779 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673322.1 protein_id gnl|my_center|LOCUS_63180 >Feature sequence1016 2559 991 gene locus_tag LOCUS_63190 2559 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 <3314 2626 gene locus_tag LOCUS_63200 <3314 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392042.1:glycosyltransferase >Feature sequence1017 1244 813 gene locus_tag LOCUS_63210 1244 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 1594 2169 gene locus_tag LOCUS_63220 1594 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 3109 2624 gene locus_tag LOCUS_63230 3109 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 >Feature sequence1018 605 282 gene locus_tag LOCUS_63240 605 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 798 2201 gene locus_tag LOCUS_63250 798 2201 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_63250 3202 2285 gene locus_tag LOCUS_63260 3202 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 >Feature sequence1019 212 18 gene locus_tag LOCUS_63270 212 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 1328 297 gene locus_tag LOCUS_63280 1328 297 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112406.1 protein_id gnl|my_center|LOCUS_63280 2193 2864 gene locus_tag LOCUS_63290 2193 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 >Feature sequence1020 1875 730 gene locus_tag LOCUS_63300 gene mnmE 1875 730 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887659.1 protein_id gnl|my_center|LOCUS_63300 2660 1872 gene locus_tag LOCUS_63310 2660 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 <3277 2657 gene locus_tag LOCUS_63320 <3277 2657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324342.1:GTPase ObgE >Feature sequence1021 1851 1336 gene locus_tag LOCUS_63330 1851 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 2162 1923 gene locus_tag LOCUS_63340 2162 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 2718 2104 gene locus_tag LOCUS_63350 2718 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 >Feature sequence1022 <1 540 gene locus_tag LOCUS_63360 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262485.1:tRNA adenylyltransferase 2155 686 gene locus_tag LOCUS_63370 2155 686 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_63370 2271 3101 gene locus_tag LOCUS_63380 2271 3101 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_63380 >Feature sequence1023 165 929 gene locus_tag LOCUS_63390 165 929 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919165.1 protein_id gnl|my_center|LOCUS_63390 1420 1824 gene locus_tag LOCUS_63400 1420 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 3128 1896 gene locus_tag LOCUS_63410 3128 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 >Feature sequence1024 812 3139 gene locus_tag LOCUS_63420 812 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 >Feature sequence1025 2478 826 gene locus_tag LOCUS_63430 2478 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 >Feature sequence1026 <1 1366 gene locus_tag LOCUS_63440 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898974.1:ABC transporter permease <3253 1449 gene locus_tag LOCUS_63450 <3253 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence1027 260 1753 gene locus_tag LOCUS_63460 260 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63460 1728 3170 gene locus_tag LOCUS_63470 1728 3170 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123376.1 protein_id gnl|my_center|LOCUS_63470 >Feature sequence1028 208 711 gene locus_tag LOCUS_63480 208 711 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337215.1 protein_id gnl|my_center|LOCUS_63480 907 3105 gene locus_tag LOCUS_63490 907 3105 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_63490 >Feature sequence1029 <3226 2 gene locus_tag LOCUS_63500 <3226 2 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein >Feature sequence1030 1700 45 gene locus_tag LOCUS_63510 1700 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 2149 2922 gene locus_tag LOCUS_63520 2149 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 >Feature sequence1031 140 844 gene locus_tag LOCUS_63530 gene rpsC 140 844 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_63530 783 1196 gene locus_tag LOCUS_63540 gene rplP 783 1196 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_63540 1213 1455 gene locus_tag LOCUS_63550 gene rpmC 1213 1455 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326804.1 protein_id gnl|my_center|LOCUS_63550 1460 1786 gene locus_tag LOCUS_63560 gene rpsQ 1460 1786 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812390.1 protein_id gnl|my_center|LOCUS_63560 1882 2250 gene locus_tag LOCUS_63570 gene rplN 1882 2250 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_63570 2290 2658 gene locus_tag LOCUS_63580 gene rplX 2290 2658 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326807.1 protein_id gnl|my_center|LOCUS_63580 >Feature sequence1032 45 1571 gene locus_tag LOCUS_63590 45 1571 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_63590 2582 1614 gene locus_tag LOCUS_63600 2582 1614 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_63600 >Feature sequence1033 <1 698 gene locus_tag LOCUS_63610 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257047.1:1,4-alpha-glucan branching protein GlgB 909 1598 gene locus_tag LOCUS_63620 909 1598 CDS product RedB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616158.1 protein_id gnl|my_center|LOCUS_63620 >Feature sequence1034 336 554 gene locus_tag LOCUS_63630 336 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 556 744 gene locus_tag LOCUS_63640 556 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 1005 1238 gene locus_tag LOCUS_63650 1005 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 1338 1568 gene locus_tag LOCUS_63660 1338 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 2295 1636 gene locus_tag LOCUS_63670 gene cobC 2295 1636 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_63670 >Feature sequence1035 <1 951 gene locus_tag LOCUS_63680 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082368.1:FtsH protease activity modulator HflK 974 2020 gene locus_tag LOCUS_63690 974 2020 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113077.1 protein_id gnl|my_center|LOCUS_63690 2171 3124 gene locus_tag LOCUS_63700 2171 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 >Feature sequence1036 773 1963 gene locus_tag LOCUS_63710 773 1963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_63710 2086 3030 gene locus_tag LOCUS_63720 2086 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 >Feature sequence1037 >Feature sequence1038 >Feature sequence1039 <1 657 gene locus_tag LOCUS_63730 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008807565.1:dihydrodipicolinate synthase family protein 1819 848 gene locus_tag LOCUS_63740 1819 848 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_63740 2762 1758 gene locus_tag LOCUS_63750 2762 1758 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_63750 >Feature sequence1040 1243 83 gene locus_tag LOCUS_63760 1243 83 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_63760 1402 2802 gene locus_tag LOCUS_63770 1402 2802 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_63770 >Feature sequence1041 188 970 gene locus_tag LOCUS_63780 188 970 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_63780 982 2370 gene locus_tag LOCUS_63790 982 2370 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_63790 >Feature sequence1042 <1 624 gene locus_tag LOCUS_63800 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404121.1:chromosomal replication initiator protein DnaA 837 1949 gene locus_tag LOCUS_63810 gene dnaN 837 1949 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_63810 2170 2706 gene locus_tag LOCUS_63820 2170 2706 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946524.1 protein_id gnl|my_center|LOCUS_63820 2743 3126 gene locus_tag LOCUS_63830 2743 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 >Feature sequence1043 <1 1356 gene locus_tag LOCUS_63840 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118978.1:serine/threonine-protein kinase 1702 2367 gene locus_tag LOCUS_63850 1702 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 >Feature sequence1044 826 374 gene locus_tag LOCUS_63860 826 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 2024 864 gene locus_tag LOCUS_63870 2024 864 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_63870 >Feature sequence1045 118 1611 gene locus_tag LOCUS_63880 118 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 1628 2920 gene locus_tag LOCUS_63890 gene xseA 1628 2920 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_63890 >Feature sequence1046 <1 1227 gene locus_tag LOCUS_63900 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269356.1:RHS repeat-associated core domain-containing protein 1243 1860 gene locus_tag LOCUS_63910 1243 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 2024 3163 gene locus_tag LOCUS_63920 gene tssA 2024 3163 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_63920 >Feature sequence1047 152 820 gene locus_tag LOCUS_63930 152 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 937 1512 gene locus_tag LOCUS_63940 937 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 1551 2522 gene locus_tag LOCUS_63950 1551 2522 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_63950 >Feature sequence1048 227 472 gene locus_tag LOCUS_63960 227 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 628 807 gene locus_tag LOCUS_63970 628 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 829 1179 gene locus_tag LOCUS_63980 829 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63980 1483 3102 gene locus_tag LOCUS_63990 1483 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 >Feature sequence1049 <1 1507 gene locus_tag LOCUS_64000 <1 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein 2014 1565 gene locus_tag LOCUS_64010 gene ybeY 2014 1565 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_64010 2938 2018 gene locus_tag LOCUS_64020 2938 2018 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_64020 >Feature sequence1050 1933 503 gene locus_tag LOCUS_64030 1933 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 2184 2942 gene locus_tag LOCUS_64040 2184 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 >Feature sequence1051 2484 679 gene locus_tag LOCUS_64050 2484 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 >Feature sequence1052 >Feature sequence1053 1885 752 gene locus_tag LOCUS_64060 1885 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64060 2984 2229 gene locus_tag LOCUS_64070 2984 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 >Feature sequence1054 1417 2805 gene locus_tag LOCUS_64080 1417 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 >Feature sequence1055 1185 118 gene locus_tag LOCUS_64090 1185 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 2358 1369 gene locus_tag LOCUS_64100 2358 1369 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_64100 >Feature sequence1056 276 749 gene locus_tag LOCUS_64110 276 749 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_64110 762 2111 gene locus_tag LOCUS_64120 762 2111 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_64120 >Feature sequence1057 355 1605 gene locus_tag LOCUS_64130 355 1605 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_64130 1847 3055 gene locus_tag LOCUS_64140 1847 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 >Feature sequence1058 1455 406 gene locus_tag LOCUS_64150 1455 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64150 2235 1582 gene locus_tag LOCUS_64160 2235 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 2673 2281 gene locus_tag LOCUS_64170 2673 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 >Feature sequence1059 <1 597 gene locus_tag LOCUS_64180 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069810170.1:ATP-binding protein 2019 601 gene locus_tag LOCUS_64190 2019 601 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_64190 >Feature sequence1060 145 1464 gene locus_tag LOCUS_64200 145 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 3013 1853 gene locus_tag LOCUS_64210 3013 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 >Feature sequence1061 155 2341 gene locus_tag LOCUS_64220 155 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64220 2860 2477 gene locus_tag LOCUS_64230 2860 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 >Feature sequence1062 362 75 gene locus_tag LOCUS_64240 362 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 956 501 gene locus_tag LOCUS_64250 gene trmL 956 501 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_64250 >Feature sequence1063 282 695 gene locus_tag LOCUS_64260 282 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 880 692 gene locus_tag LOCUS_64270 880 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 2191 896 gene locus_tag LOCUS_64280 2191 896 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976261.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64280 2856 2311 gene locus_tag LOCUS_64290 2856 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64290 >Feature sequence1064 2934 1525 gene locus_tag LOCUS_64300 gene hemG 2934 1525 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_64300 >Feature sequence1065 200 2977 gene locus_tag LOCUS_64310 200 2977 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 protein_id gnl|my_center|LOCUS_64310 >Feature sequence1066 685 32 gene locus_tag LOCUS_64320 685 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 1720 788 gene locus_tag LOCUS_64330 1720 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 2875 1814 gene locus_tag LOCUS_64340 2875 1814 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 protein_id gnl|my_center|LOCUS_64340 >Feature sequence1067 115 831 gene locus_tag LOCUS_64350 115 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 >Feature sequence1068 <1 1531 gene locus_tag LOCUS_64360 <1 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037253001.1:polysaccharide biosynthesis tyrosine autokinase 1662 2441 gene locus_tag LOCUS_64370 1662 2441 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644575.1 protein_id gnl|my_center|LOCUS_64370 <3076 2448 gene locus_tag LOCUS_64380 <3076 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921976.1:polysaccharide biosynthesis/export family protein >Feature sequence1069 650 1942 gene locus_tag LOCUS_64390 650 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 <3075 2247 gene locus_tag LOCUS_64400 <3075 2247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119307.1:PIG-L family deacetylase >Feature sequence1070 249 593 gene locus_tag LOCUS_64410 249 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 617 1660 gene locus_tag LOCUS_64420 617 1660 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156491.1 protein_id gnl|my_center|LOCUS_64420 1878 2996 gene locus_tag LOCUS_64430 gene speY 1878 2996 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_64430 >Feature sequence1071 2018 2920 gene locus_tag LOCUS_64440 2018 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 >Feature sequence1072 1184 48 gene locus_tag LOCUS_64450 1184 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 1742 2407 gene locus_tag LOCUS_64460 1742 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 2623 2961 gene locus_tag LOCUS_64470 2623 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 >Feature sequence1073 2019 1198 gene locus_tag LOCUS_64480 2019 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 2919 2176 gene locus_tag LOCUS_64490 2919 2176 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228457.1 protein_id gnl|my_center|LOCUS_64490 >Feature sequence1074 1092 82 gene locus_tag LOCUS_64500 1092 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 2683 1373 gene locus_tag LOCUS_64510 2683 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_64510 >Feature sequence1075 <1 855 gene locus_tag LOCUS_64520 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141963.1:NB-ARC domain-containing protein 1780 881 gene locus_tag LOCUS_64530 1780 881 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 protein_id gnl|my_center|LOCUS_64530 <3026 1821 gene locus_tag LOCUS_64540 <3026 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257221.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence1076 247 2844 gene locus_tag LOCUS_64550 247 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 >Feature sequence1077 <1 1415 gene locus_tag LOCUS_64560 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH-quinone oxidoreductase subunit M 1412 2941 gene locus_tag LOCUS_64570 1412 2941 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_64570 >Feature sequence1078 2560 191 gene locus_tag LOCUS_64580 2560 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 >Feature sequence1079 2505 1657 gene locus_tag LOCUS_64590 2505 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 2819 2526 gene locus_tag LOCUS_64600 2819 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 >Feature sequence1080 <1 1163 gene locus_tag LOCUS_64610 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943144.1:sigma-54 dependent transcriptional regulator >Feature sequence1081 1194 1619 gene locus_tag LOCUS_64620 1194 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 1630 2595 gene locus_tag LOCUS_64630 1630 2595 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021352.1 protein_id gnl|my_center|LOCUS_64630 >Feature sequence1082 954 1619 gene locus_tag LOCUS_64640 954 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 1924 2571 gene locus_tag LOCUS_64650 1924 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 >Feature sequence1083 <1 976 gene locus_tag LOCUS_64660 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081315.1:magnesium/cobalt transporter CorA 1080 2480 gene locus_tag LOCUS_64670 1080 2480 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_64670 2556 2906 gene locus_tag LOCUS_64680 2556 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 >Feature sequence1084 >Feature sequence1085 >Feature sequence1086 129 2852 gene locus_tag LOCUS_64690 gene tssH 129 2852 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_64690 >Feature sequence1087 128 745 gene locus_tag LOCUS_64700 128 745 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_64700 794 1300 gene locus_tag LOCUS_64710 794 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 2973 1345 gene locus_tag LOCUS_64720 2973 1345 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923057.1 protein_id gnl|my_center|LOCUS_64720 >Feature sequence1088 451 2952 gene locus_tag LOCUS_64730 451 2952 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_64730 >Feature sequence1089 >Feature sequence1090 189 40 gene locus_tag LOCUS_64740 189 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 384 202 gene locus_tag LOCUS_64750 384 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 820 431 gene locus_tag LOCUS_64760 820 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64760 978 1247 gene locus_tag LOCUS_64770 978 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 2327 1356 gene locus_tag LOCUS_64780 2327 1356 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_64780 >Feature sequence1091 932 279 gene locus_tag LOCUS_64790 932 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 1081 1938 gene locus_tag LOCUS_64800 1081 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64800 1935 2483 gene locus_tag LOCUS_64810 1935 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 >Feature sequence1092 <1 970 gene locus_tag LOCUS_64820 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein note possible pseudo, frameshifted 1799 2047 gene locus_tag LOCUS_64830 1799 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 2080 2259 gene locus_tag LOCUS_64840 2080 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 2327 2836 gene locus_tag LOCUS_64850 2327 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 >Feature sequence1093 290 667 gene locus_tag LOCUS_64860 gene rpsL 290 667 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081846.1 protein_id gnl|my_center|LOCUS_64860 776 1015 gene locus_tag LOCUS_64870 776 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64870 1070 1543 gene locus_tag LOCUS_64880 gene rpsG 1070 1543 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_64880 >Feature sequence1094 703 149 gene locus_tag LOCUS_64890 703 149 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169876.1 protein_id gnl|my_center|LOCUS_64890 1035 2774 gene locus_tag LOCUS_64900 gene ptsP 1035 2774 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_64900 >Feature sequence1095 2168 15 gene locus_tag LOCUS_64910 2168 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 >Feature sequence1096 1 1206 gene locus_tag LOCUS_64920 1 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 1358 1284 gene locus_tag LOCUS_t00640 1358 1284 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1097 575 826 gene locus_tag LOCUS_64930 575 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 898 1119 gene locus_tag LOCUS_64940 898 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 1116 2189 gene locus_tag LOCUS_64950 1116 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 2149 2847 gene locus_tag LOCUS_64960 2149 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64960 >Feature sequence1098 2014 107 gene locus_tag LOCUS_64970 2014 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 >Feature sequence1099 472 924 gene locus_tag LOCUS_64980 472 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64980 1124 1615 gene locus_tag LOCUS_64990 1124 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 1635 1979 gene locus_tag LOCUS_65000 1635 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 >Feature sequence1100 <1 2160 gene locus_tag LOCUS_65010 <1 2160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein >Feature sequence1101 613 1215 gene locus_tag LOCUS_65020 613 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 1231 1485 gene locus_tag LOCUS_65030 1231 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 1789 2346 gene locus_tag LOCUS_65040 1789 2346 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_65040 >Feature sequence1102 1823 972 gene locus_tag LOCUS_65050 gene tsf 1823 972 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_65050 <2876 2086 gene locus_tag LOCUS_65060 <2876 2086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122857.1:30S ribosomal protein S2 >Feature sequence1103 <2874 2237 gene locus_tag LOCUS_65070 <2874 2237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121932.1:FdhF/YdeP family oxidoreductase >Feature sequence1104 110 343 gene locus_tag LOCUS_65080 110 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 1895 480 gene locus_tag LOCUS_65090 1895 480 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941684.1 protein_id gnl|my_center|LOCUS_65090 2772 1912 gene locus_tag LOCUS_65100 2772 1912 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_65100 >Feature sequence1105 1312 386 gene locus_tag LOCUS_65110 1312 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65110 2666 1374 gene locus_tag LOCUS_65120 2666 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_65120 >Feature sequence1106 1270 104 gene locus_tag LOCUS_65130 1270 104 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_65130 2465 1590 gene locus_tag LOCUS_65140 gene rfaP 2465 1590 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_65140 >Feature sequence1107 512 306 gene locus_tag LOCUS_65150 512 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 1083 529 gene locus_tag LOCUS_65160 1083 529 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922237.1 protein_id gnl|my_center|LOCUS_65160 2266 1127 gene locus_tag LOCUS_65170 2266 1127 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_65170 >Feature sequence1108 1537 1061 gene locus_tag LOCUS_65180 1537 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 1663 2775 gene locus_tag LOCUS_65190 1663 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 >Feature sequence1109 52 480 gene locus_tag LOCUS_65200 52 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 482 1468 gene locus_tag LOCUS_65210 gene moaA 482 1468 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_65210 1488 2243 gene locus_tag LOCUS_65220 1488 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 >Feature sequence1110 413 108 gene locus_tag LOCUS_65230 413 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 1011 436 gene locus_tag LOCUS_65240 1011 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 >Feature sequence1111 738 274 gene locus_tag LOCUS_65250 738 274 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922010.1 protein_id gnl|my_center|LOCUS_65250 1279 731 gene locus_tag LOCUS_65260 1279 731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101141.1 protein_id gnl|my_center|LOCUS_65260 2598 1276 gene locus_tag LOCUS_65270 2598 1276 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_65270 >Feature sequence1112 1264 482 gene locus_tag LOCUS_65280 1264 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 <2839 1640 gene locus_tag LOCUS_65290 <2839 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876698.1:DUF11 domain-containing protein >Feature sequence1113 650 117 gene locus_tag LOCUS_65300 650 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65300 2101 647 gene locus_tag LOCUS_65310 2101 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 <2839 2005 gene locus_tag LOCUS_65320 <2839 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971120.1:cytochrome c oxidase assembly protein >Feature sequence1114 94 300 gene locus_tag LOCUS_65330 94 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 401 2281 gene locus_tag LOCUS_65340 gene mutL 401 2281 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918581.1 protein_id gnl|my_center|LOCUS_65340 >Feature sequence1115 1560 136 gene locus_tag LOCUS_65350 1560 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 1781 2776 gene locus_tag LOCUS_65360 1781 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 >Feature sequence1116 2603 1242 gene locus_tag LOCUS_65370 2603 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 >Feature sequence1117 2417 933 gene locus_tag LOCUS_65380 2417 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 >Feature sequence1118 <2818 152 gene locus_tag LOCUS_65390 <2818 152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812871.1:alpha-2-macroglobulin >Feature sequence1119 >Feature sequence1120 2001 67 gene locus_tag LOCUS_65400 2001 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 >Feature sequence1121 611 1948 gene locus_tag LOCUS_65410 611 1948 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 protein_id gnl|my_center|LOCUS_65410 >Feature sequence1122 1824 262 gene locus_tag LOCUS_65420 1824 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 2632 1928 gene locus_tag LOCUS_65430 2632 1928 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814050.1 protein_id gnl|my_center|LOCUS_65430 >Feature sequence1123 1178 357 gene locus_tag LOCUS_65440 1178 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 1597 1211 gene locus_tag LOCUS_65450 1597 1211 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_65450 <2778 1829 gene locus_tag LOCUS_65460 <2778 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812767.1:ABC transporter ATP-binding protein >Feature sequence1124 1972 896 gene locus_tag LOCUS_65470 gene bioB 1972 896 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_65470 >Feature sequence1125 <1 1305 gene locus_tag LOCUS_65480 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870115.1:response regulator 1420 2538 gene locus_tag LOCUS_65490 1420 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_65490 >Feature sequence1126 844 2676 gene locus_tag LOCUS_65500 844 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 >Feature sequence1127 321 55 gene locus_tag LOCUS_65510 321 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 2217 343 gene locus_tag LOCUS_65520 2217 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_65520 >Feature sequence1128 1443 406 gene locus_tag LOCUS_65530 1443 406 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113004.1 protein_id gnl|my_center|LOCUS_65530 2672 1440 gene locus_tag LOCUS_65540 2672 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 >Feature sequence1129 574 1077 gene locus_tag LOCUS_65550 574 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 1530 2057 gene locus_tag LOCUS_65560 1530 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65560 2146 2676 gene locus_tag LOCUS_65570 2146 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 >Feature sequence1130 1370 144 gene locus_tag LOCUS_65580 1370 144 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_65580 2505 1444 gene locus_tag LOCUS_65590 gene gap 2505 1444 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_65590 >Feature sequence1131 232 810 gene locus_tag LOCUS_65600 232 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 1950 904 gene locus_tag LOCUS_65610 1950 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 2056 2697 gene locus_tag LOCUS_65620 2056 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65620 >Feature sequence1132 <1 785 gene locus_tag LOCUS_65630 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003907117.1:radical SAM protein 809 1549 gene locus_tag LOCUS_65640 809 1549 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730515.1 protein_id gnl|my_center|LOCUS_65640 >Feature sequence1133 444 139 gene locus_tag LOCUS_65650 444 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 2552 477 gene locus_tag LOCUS_65660 2552 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 >Feature sequence1134 2057 342 gene locus_tag LOCUS_65670 2057 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65670 <2752 2158 gene locus_tag LOCUS_65680 <2752 2158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881351.1:YqaA family protein >Feature sequence1135 1330 143 gene locus_tag LOCUS_65690 1330 143 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_65690 2578 1517 gene locus_tag LOCUS_65700 2578 1517 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_65700 >Feature sequence1136 1624 956 gene locus_tag LOCUS_65710 1624 956 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238149.1 protein_id gnl|my_center|LOCUS_65710 2341 1634 gene locus_tag LOCUS_65720 2341 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 >Feature sequence1137 1263 274 gene locus_tag LOCUS_65730 1263 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843404.1 protein_id gnl|my_center|LOCUS_65730 1488 1336 gene locus_tag LOCUS_65740 1488 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 1684 1481 gene locus_tag LOCUS_65750 1684 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 2614 1784 gene locus_tag LOCUS_65760 2614 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 >Feature sequence1138 308 138 gene locus_tag LOCUS_65770 308 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 457 900 gene locus_tag LOCUS_65780 457 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65780 1811 1425 gene locus_tag LOCUS_65790 1811 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 2036 2446 gene locus_tag LOCUS_65800 2036 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 >Feature sequence1139 1898 573 gene locus_tag LOCUS_65810 gene ltrA 1898 573 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_65810 >Feature sequence1140 307 1689 gene locus_tag LOCUS_65820 307 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 >Feature sequence1141 <1 1189 gene locus_tag LOCUS_65830 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038419441.1:mechanosensitive ion channel 2678 1476 gene locus_tag LOCUS_65840 2678 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 >Feature sequence1142 >Feature sequence1143 681 1625 gene locus_tag LOCUS_65850 681 1625 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_65850 2524 1844 gene locus_tag LOCUS_65860 2524 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 >Feature sequence1144 1791 445 gene locus_tag LOCUS_65870 1791 445 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899017.1 protein_id gnl|my_center|LOCUS_65870 >Feature sequence1145 542 2593 gene locus_tag LOCUS_65880 gene tssI 542 2593 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143801.1 protein_id gnl|my_center|LOCUS_65880 >Feature sequence1146 >Feature sequence1147 <1 579 gene locus_tag LOCUS_65890 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195870.1:thiamine pyrophosphate-binding protein >Feature sequence1148 1365 181 gene locus_tag LOCUS_65900 1365 181 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_65900 1718 1428 gene locus_tag LOCUS_65910 1718 1428 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_65910 2090 1779 gene locus_tag LOCUS_65920 2090 1779 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_65920 <2710 2146 gene locus_tag LOCUS_65930 <2710 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333582.1:phosphate propanoyltransferase >Feature sequence1149 2276 1158 gene locus_tag LOCUS_65940 2276 1158 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 protein_id gnl|my_center|LOCUS_65940 >Feature sequence1150 2293 185 gene locus_tag LOCUS_65950 2293 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 >Feature sequence1151 712 98 gene locus_tag LOCUS_65960 712 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 843 1613 gene locus_tag LOCUS_65970 843 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 1829 2341 gene locus_tag LOCUS_65980 1829 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 2351 2596 gene locus_tag LOCUS_65990 2351 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 >Feature sequence1152 <2701 2049 gene locus_tag LOCUS_66000 <2701 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257092.1:ATP-binding protein >Feature sequence1153 872 627 gene locus_tag LOCUS_66010 872 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66010 >Feature sequence1154 1174 38 gene locus_tag LOCUS_66020 1174 38 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_66020 2525 1299 gene locus_tag LOCUS_66030 2525 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 >Feature sequence1155 147 659 gene locus_tag LOCUS_66040 147 659 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_66040 744 1184 gene locus_tag LOCUS_66050 744 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 1188 1559 gene locus_tag LOCUS_66060 gene hisI 1188 1559 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_66060 1556 2434 gene locus_tag LOCUS_66070 gene hisG 1556 2434 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_66070 2487 2687 gene locus_tag LOCUS_66080 2487 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 >Feature sequence1156 929 45 gene locus_tag LOCUS_66090 gene prpB 929 45 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_66090 1102 2379 gene locus_tag LOCUS_66100 1102 2379 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_66100 >Feature sequence1157 1186 1884 gene locus_tag LOCUS_66110 1186 1884 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929431.1 protein_id gnl|my_center|LOCUS_66110 1911 2606 gene locus_tag LOCUS_66120 1911 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66120 >Feature sequence1158 578 366 gene locus_tag LOCUS_66130 578 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 820 614 gene locus_tag LOCUS_66140 820 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 1215 862 gene locus_tag LOCUS_66150 1215 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 1478 1254 gene locus_tag LOCUS_66160 1478 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 2233 1625 gene locus_tag LOCUS_66170 2233 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 >Feature sequence1159 >Feature sequence1160 226 504 gene locus_tag LOCUS_66180 226 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 2380 671 gene locus_tag LOCUS_66190 2380 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 >Feature sequence1161 143 2620 gene locus_tag LOCUS_66200 143 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 >Feature sequence1162 2510 1026 gene locus_tag LOCUS_66210 2510 1026 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922489.1 protein_id gnl|my_center|LOCUS_66210 >Feature sequence1163 89 1126 gene locus_tag LOCUS_66220 gene waaF 89 1126 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_66220 >Feature sequence1164 <1 1077 gene locus_tag LOCUS_66230 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122500.1:serine/threonine-protein kinase 1512 2192 gene locus_tag LOCUS_66240 1512 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 >Feature sequence1165 1389 145 gene locus_tag LOCUS_66250 1389 145 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142821.1 protein_id gnl|my_center|LOCUS_66250 >Feature sequence1166 635 1897 gene locus_tag LOCUS_66260 635 1897 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_66260 1949 2236 gene locus_tag LOCUS_66270 1949 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 2253 2639 gene locus_tag LOCUS_66280 2253 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 >Feature sequence1167 1180 803 gene locus_tag LOCUS_66290 1180 803 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_66290 >Feature sequence1168 <1 507 gene locus_tag LOCUS_66300 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003645499.1:elongation factor G >Feature sequence1169 803 195 gene locus_tag LOCUS_66310 803 195 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812379.1 protein_id gnl|my_center|LOCUS_66310 1407 865 gene locus_tag LOCUS_66320 1407 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 <2638 1476 gene locus_tag LOCUS_66330 <2638 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061304.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence1170 2036 1122 gene locus_tag LOCUS_66340 gene fhcD 2036 1122 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_66340 >Feature sequence1171 <1 1166 gene locus_tag LOCUS_66350 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089742.1:vanadium-dependent haloperoxidase 1449 1216 gene locus_tag LOCUS_66360 1449 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 >Feature sequence1172 <1 677 gene locus_tag LOCUS_66370 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121153.1:DUF1552 domain-containing protein 2197 791 gene locus_tag LOCUS_66380 2197 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 >Feature sequence1173 1773 259 gene locus_tag LOCUS_66390 1773 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 2291 1893 gene locus_tag LOCUS_66400 2291 1893 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_66400 2503 2288 gene locus_tag LOCUS_66410 2503 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 >Feature sequence1174 734 114 gene locus_tag LOCUS_66420 734 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 >Feature sequence1175 313 927 gene locus_tag LOCUS_66430 313 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 959 2428 gene locus_tag LOCUS_66440 959 2428 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_66440 >Feature sequence1176 1531 2589 gene locus_tag LOCUS_66450 1531 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 >Feature sequence1177 165 2582 gene locus_tag LOCUS_66460 gene hypF 165 2582 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_66460 >Feature sequence1178 2596 119 gene locus_tag LOCUS_66470 2596 119 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_66470 >Feature sequence1179 2091 859 gene locus_tag LOCUS_66480 gene dgoD 2091 859 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_66480 >Feature sequence1180 446 2545 gene locus_tag LOCUS_66490 446 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 >Feature sequence1181 1047 49 gene locus_tag LOCUS_66500 1047 49 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326204.1 protein_id gnl|my_center|LOCUS_66500 1169 2062 gene locus_tag LOCUS_66510 1169 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 >Feature sequence1182 >Feature sequence1183 554 1444 gene locus_tag LOCUS_66520 554 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 1578 2030 gene locus_tag LOCUS_66530 1578 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66530 2044 2571 gene locus_tag LOCUS_66540 2044 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 >Feature sequence1184 2139 1366 gene locus_tag LOCUS_66550 2139 1366 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298484.1 protein_id gnl|my_center|LOCUS_66550 2537 2136 gene locus_tag LOCUS_66560 2537 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 >Feature sequence1185 >Feature sequence1186 295 2490 gene locus_tag LOCUS_66570 295 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 >Feature sequence1187 1530 58 gene locus_tag LOCUS_66580 1530 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 >Feature sequence1188 335 2371 gene locus_tag LOCUS_66590 335 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 >Feature sequence1189 2556 166 gene locus_tag LOCUS_66600 2556 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 >Feature sequence1190 507 19 gene locus_tag LOCUS_66610 507 19 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_66610 656 1912 gene locus_tag LOCUS_66620 656 1912 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_66620 1959 2252 gene locus_tag LOCUS_66630 1959 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 2269 2454 gene locus_tag LOCUS_66640 2269 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66640 >Feature sequence1191 1323 40 gene locus_tag LOCUS_66650 1323 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 >Feature sequence1192 576 1925 gene locus_tag LOCUS_66660 576 1925 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_66660 2069 2545 gene locus_tag LOCUS_66670 gene moaC 2069 2545 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_66670 >Feature sequence1193 3 266 gene locus_tag LOCUS_66680 3 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 363 1547 gene locus_tag LOCUS_66690 363 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_66690 1544 1840 gene locus_tag LOCUS_66700 1544 1840 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_66700 >Feature sequence1194 273 2525 gene locus_tag LOCUS_66710 273 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 >Feature sequence1195 1791 718 gene locus_tag LOCUS_66720 1791 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 2513 1788 gene locus_tag LOCUS_66730 2513 1788 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_66730 >Feature sequence1196 319 2466 gene locus_tag LOCUS_66740 319 2466 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967414.1 protein_id gnl|my_center|LOCUS_66740 >Feature sequence1197 <1 678 gene locus_tag LOCUS_66750 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256700.1:4-hydroxyphenylpyruvate dioxygenase 845 1066 gene locus_tag LOCUS_66760 845 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 1229 2398 gene locus_tag LOCUS_66770 1229 2398 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_66770 >Feature sequence1198 >Feature sequence1199 1713 244 gene locus_tag LOCUS_66780 1713 244 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_66780 2292 2498 gene locus_tag LOCUS_66790 2292 2498 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 protein_id gnl|my_center|LOCUS_66790 >Feature sequence1200 >Feature sequence1201 1525 272 gene locus_tag LOCUS_66800 1525 272 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_66800 1765 1583 gene locus_tag LOCUS_66810 1765 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 >Feature sequence1202 1223 2266 gene locus_tag LOCUS_66820 1223 2266 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_66820 >Feature sequence1203 2058 190 gene locus_tag LOCUS_66830 2058 190 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_66830 >Feature sequence1204 149 514 gene locus_tag LOCUS_66840 149 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 >Feature sequence1205 72 881 gene locus_tag LOCUS_66850 72 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66850 954 1238 gene locus_tag LOCUS_66860 954 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 >Feature sequence1206 416 1675 gene locus_tag LOCUS_66870 416 1675 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151614010.1 protein_id gnl|my_center|LOCUS_66870 >Feature sequence1207 >Feature sequence1208 899 336 gene locus_tag LOCUS_66880 899 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 1809 892 gene locus_tag LOCUS_66890 1809 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 >Feature sequence1209 >Feature sequence1210 2056 761 gene locus_tag LOCUS_66900 2056 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 2508 2320 gene locus_tag LOCUS_66910 2508 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 >Feature sequence1211 89 1651 gene locus_tag LOCUS_66920 89 1651 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_66920 >Feature sequence1212 135 758 gene locus_tag LOCUS_66930 135 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 826 1437 gene locus_tag LOCUS_66940 826 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 >Feature sequence1213 2391 73 gene locus_tag LOCUS_66950 2391 73 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530050.1 protein_id gnl|my_center|LOCUS_66950 >Feature sequence1214 <1 869 gene locus_tag LOCUS_66960 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546813.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II 2393 1083 gene locus_tag LOCUS_66970 2393 1083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_66970 >Feature sequence1215 159 1256 gene locus_tag LOCUS_66980 159 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 1256 2374 gene locus_tag LOCUS_66990 1256 2374 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_66990 >Feature sequence1216 53 1048 gene locus_tag LOCUS_67000 53 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 >Feature sequence1217 728 24 gene locus_tag LOCUS_67010 gene mazG 728 24 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087265.1 protein_id gnl|my_center|LOCUS_67010 2075 1116 gene locus_tag LOCUS_67020 2075 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 >Feature sequence1218 1216 857 gene locus_tag LOCUS_67030 1216 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 2183 1266 gene locus_tag LOCUS_67040 2183 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 >Feature sequence1219 1419 289 gene locus_tag LOCUS_67050 1419 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 2325 1501 gene locus_tag LOCUS_67060 2325 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67060 >Feature sequence1220 1700 1002 gene locus_tag LOCUS_67070 1700 1002 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_67070 2244 1771 gene locus_tag LOCUS_67080 2244 1771 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330832.1 protein_id gnl|my_center|LOCUS_67080 >Feature sequence1221 >Feature sequence1222 321 1466 gene locus_tag LOCUS_67090 321 1466 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_67090 >Feature sequence1223 1311 238 gene locus_tag LOCUS_67100 1311 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 >Feature sequence1224 1055 327 gene locus_tag LOCUS_67110 1055 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 2241 1348 gene locus_tag LOCUS_67120 2241 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 >Feature sequence1225 1713 748 gene locus_tag LOCUS_67130 1713 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 2081 1710 gene locus_tag LOCUS_67140 2081 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 >Feature sequence1226 229 849 gene locus_tag LOCUS_67150 229 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 2332 944 gene locus_tag LOCUS_67160 2332 944 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_67160 >Feature sequence1227 >Feature sequence1228 1508 81 gene locus_tag LOCUS_67170 gene nusA 1508 81 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120487.1 protein_id gnl|my_center|LOCUS_67170 2379 1690 gene locus_tag LOCUS_67180 2379 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 >Feature sequence1229 >Feature sequence1230 <1 853 gene locus_tag LOCUS_67190 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403695.1:bacillithiol biosynthesis deacetylase BshB1 878 2020 gene locus_tag LOCUS_67200 878 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 >Feature sequence1231 1138 779 gene locus_tag LOCUS_67210 1138 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 <2407 1266 gene locus_tag LOCUS_67220 <2407 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201778950.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence1232 446 3 gene locus_tag LOCUS_67230 446 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 868 1356 gene locus_tag LOCUS_67240 868 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 1441 2226 gene locus_tag LOCUS_67250 1441 2226 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112467.1 protein_id gnl|my_center|LOCUS_67250 >Feature sequence1233 >Feature sequence1234 <1 1897 gene locus_tag LOCUS_67260 <1 1897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672758.1:DUF4178 domain-containing protein 1973 2164 gene locus_tag LOCUS_67270 1973 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 >Feature sequence1235 >Feature sequence1236 22 927 gene locus_tag LOCUS_67280 22 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 >Feature sequence1237 2311 980 gene locus_tag LOCUS_67290 2311 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 >Feature sequence1238 1002 538 gene locus_tag LOCUS_67300 1002 538 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_67300 1527 1132 gene locus_tag LOCUS_67310 1527 1132 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_67310 2015 1578 gene locus_tag LOCUS_67320 2015 1578 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922319.1 protein_id gnl|my_center|LOCUS_67320 >Feature sequence1239 <2386 1034 gene locus_tag LOCUS_67330 <2386 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence1240 4 804 gene locus_tag LOCUS_67340 4 804 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921300.1 protein_id gnl|my_center|LOCUS_67340 >Feature sequence1241 943 56 gene locus_tag LOCUS_67350 943 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 1362 1066 gene locus_tag LOCUS_67360 1362 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 1586 1359 gene locus_tag LOCUS_67370 1586 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 1871 2227 gene locus_tag LOCUS_67380 1871 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 >Feature sequence1242 2059 296 gene locus_tag LOCUS_67390 2059 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67390 2307 2104 gene locus_tag LOCUS_67400 2307 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 >Feature sequence1243 619 2 gene locus_tag LOCUS_67410 gene kynB 619 2 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198883.1 protein_id gnl|my_center|LOCUS_67410 1566 766 gene locus_tag LOCUS_67420 1566 766 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_67420 <2366 1579 gene locus_tag LOCUS_67430 <2366 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein >Feature sequence1244 1074 226 gene locus_tag LOCUS_67440 1074 226 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_67440 1342 2268 gene locus_tag LOCUS_67450 1342 2268 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038966.1 protein_id gnl|my_center|LOCUS_67450 >Feature sequence1245 1051 89 gene locus_tag LOCUS_67460 1051 89 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921674.1 protein_id gnl|my_center|LOCUS_67460 1756 1085 gene locus_tag LOCUS_67470 1756 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 >Feature sequence1246 1727 327 gene locus_tag LOCUS_67480 1727 327 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_67480 <2349 1645 gene locus_tag LOCUS_67490 <2349 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941139.1:ATP-binding protein >Feature sequence1247 >Feature sequence1248 >Feature sequence1249 <1 1444 gene locus_tag LOCUS_67500 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615945.1:terpene cyclase/mutase family protein >Feature sequence1250 98 1318 gene locus_tag LOCUS_67510 98 1318 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_67510 1962 1699 gene locus_tag LOCUS_67520 1962 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 1940 2104 gene locus_tag LOCUS_67530 1940 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 >Feature sequence1251 134 901 gene locus_tag LOCUS_67540 134 901 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_67540 1668 1213 gene locus_tag LOCUS_67550 1668 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 <2340 1832 gene locus_tag LOCUS_67560 <2340 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_039645979.1:peptide chain release factor-like protein >Feature sequence1252 464 537 gene locus_tag LOCUS_t00650 464 537 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 580 1854 gene locus_tag LOCUS_67570 580 1854 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_67570 >Feature sequence1253 170 691 gene locus_tag LOCUS_67580 170 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 >Feature sequence1254 378 1310 gene locus_tag LOCUS_67590 378 1310 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989402.1 protein_id gnl|my_center|LOCUS_67590 >Feature sequence1255 >Feature sequence1256 107 1147 gene locus_tag LOCUS_67600 107 1147 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122968.1 protein_id gnl|my_center|LOCUS_67600 1179 1724 gene locus_tag LOCUS_67610 1179 1724 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_67610 1872 2267 gene locus_tag LOCUS_67620 1872 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67620 >Feature sequence1257 >Feature sequence1258 131 367 gene locus_tag LOCUS_67630 131 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 383 832 gene locus_tag LOCUS_67640 gene rpsH 383 832 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_67640 958 1506 gene locus_tag LOCUS_67650 gene rplF 958 1506 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_67650 1642 2010 gene locus_tag LOCUS_67660 gene rplR 1642 2010 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 protein_id gnl|my_center|LOCUS_67660 >Feature sequence1259 1328 339 gene locus_tag LOCUS_67670 1328 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 1687 1445 gene locus_tag LOCUS_67680 1687 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 1978 1688 gene locus_tag LOCUS_67690 1978 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67690 >Feature sequence1260 46 669 gene locus_tag LOCUS_67700 46 669 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729516.1 protein_id gnl|my_center|LOCUS_67700 841 1074 gene locus_tag LOCUS_67710 841 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 1295 1143 gene locus_tag LOCUS_67720 1295 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 1906 1364 gene locus_tag LOCUS_67730 1906 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 >Feature sequence1261 179 1144 gene locus_tag LOCUS_67740 179 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672702.1 protein_id gnl|my_center|LOCUS_67740 1460 2281 gene locus_tag LOCUS_67750 1460 2281 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_67750 >Feature sequence1262 271 1236 gene locus_tag LOCUS_67760 gene pstC 271 1236 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_67760 >Feature sequence1263 <1 889 gene locus_tag LOCUS_67770 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205128.1:DUF1800 domain-containing protein >Feature sequence1264 304 2109 gene locus_tag LOCUS_67780 gene lepA 304 2109 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118463.1 protein_id gnl|my_center|LOCUS_67780 >Feature sequence1265 <1 1183 gene locus_tag LOCUS_67790 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118978.1:serine/threonine-protein kinase 1286 2254 gene locus_tag LOCUS_67800 1286 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 >Feature sequence1266 1995 205 gene locus_tag LOCUS_67810 1995 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 >Feature sequence1267 1685 297 gene locus_tag LOCUS_67820 1685 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333115.1 protein_id gnl|my_center|LOCUS_67820 >Feature sequence1268 1315 584 gene locus_tag LOCUS_67830 1315 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 <2278 1328 gene locus_tag LOCUS_67840 <2278 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665238.1:HRDC domain-containing protein >Feature sequence1269 <1 2171 gene locus_tag LOCUS_67850 <1 2171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816832.1:DUF1549 and DUF1553 domain-containing protein >Feature sequence1270 1764 193 gene locus_tag LOCUS_67860 1764 193 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_67860 >Feature sequence1271 >Feature sequence1272 322 1047 gene locus_tag LOCUS_67870 322 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 2171 1122 gene locus_tag LOCUS_67880 2171 1122 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986870.1 protein_id gnl|my_center|LOCUS_67880 >Feature sequence1273 300 524 gene locus_tag LOCUS_67890 300 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 779 955 gene locus_tag LOCUS_67900 779 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 1261 1082 gene locus_tag LOCUS_67910 1261 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67910 1827 1276 gene locus_tag LOCUS_67920 gene cobO 1827 1276 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530100.1 protein_id gnl|my_center|LOCUS_67920 >Feature sequence1274 >Feature sequence1275 364 2250 gene locus_tag LOCUS_67930 364 2250 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325434.1 protein_id gnl|my_center|LOCUS_67930 >Feature sequence1276 221 1129 gene locus_tag LOCUS_67940 221 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 1965 1240 gene locus_tag LOCUS_67950 1965 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950 >Feature sequence1277 825 250 gene locus_tag LOCUS_67960 825 250 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764969.1 protein_id gnl|my_center|LOCUS_67960 1419 922 gene locus_tag LOCUS_67970 1419 922 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_67970 2191 1571 gene locus_tag LOCUS_67980 2191 1571 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_67980 >Feature sequence1278 >Feature sequence1279 1118 93 gene locus_tag LOCUS_67990 gene prfB 1118 93 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881199.1 protein_id gnl|my_center|LOCUS_67990 1395 2129 gene locus_tag LOCUS_68000 1395 2129 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_68000 >Feature sequence1280 472 74 gene locus_tag LOCUS_68010 472 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 <2225 987 gene locus_tag LOCUS_68020 <2225 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118267.1:magnesium transporter >Feature sequence1281 1384 188 gene locus_tag LOCUS_68030 1384 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 >Feature sequence1282 <1 1237 gene locus_tag LOCUS_68040 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein <2216 1436 gene locus_tag LOCUS_68050 <2216 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524980.1:bifunctional enoyl-CoA hydratase/phosphate acetyltransferase >Feature sequence1283 2089 1220 gene locus_tag LOCUS_68060 2089 1220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_68060 >Feature sequence1284 1326 532 gene locus_tag LOCUS_68070 1326 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 1563 2120 gene locus_tag LOCUS_68080 1563 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 >Feature sequence1285 2071 908 gene locus_tag LOCUS_68090 gene nifS 2071 908 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_68090 >Feature sequence1286 1380 100 gene locus_tag LOCUS_68100 1380 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68100 >Feature sequence1287 <1 1364 gene locus_tag LOCUS_68110 <1 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435015.1:RNA polymerase factor sigma-54 >Feature sequence1288 >Feature sequence1289 <1 1450 gene locus_tag LOCUS_68120 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921309.1:DUF1549 and DUF1553 domain-containing protein >Feature sequence1290 743 901 gene locus_tag LOCUS_68130 743 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68130 1474 1178 gene locus_tag LOCUS_68140 1474 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 2002 1565 gene locus_tag LOCUS_68150 2002 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 >Feature sequence1291 279 1736 gene locus_tag LOCUS_68160 279 1736 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_68160 >Feature sequence1292 1932 16 gene locus_tag LOCUS_68170 1932 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 >Feature sequence1293 >Feature sequence1294 408 764 gene locus_tag LOCUS_68180 408 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 845 1381 gene locus_tag LOCUS_68190 845 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68190 1399 1650 gene locus_tag LOCUS_68200 1399 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68200 1713 1934 gene locus_tag LOCUS_68210 1713 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68210 >Feature sequence1295 >Feature sequence1296 504 1520 gene locus_tag LOCUS_68220 504 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68220 1858 1478 gene locus_tag LOCUS_68230 1858 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68230 2145 1855 gene locus_tag LOCUS_68240 2145 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 >Feature sequence1297 >Feature sequence1298 >Feature sequence1299 1094 153 gene locus_tag LOCUS_68250 1094 153 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_68250 1991 1146 gene locus_tag LOCUS_68260 1991 1146 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_68260 >Feature sequence1300 1491 646 gene locus_tag LOCUS_68270 1491 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 2129 1488 gene locus_tag LOCUS_68280 2129 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 >Feature sequence1301 313 714 gene locus_tag LOCUS_68290 313 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 >Feature sequence1302 >Feature sequence1303 72 1166 gene locus_tag LOCUS_68300 72 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 1171 2019 gene locus_tag LOCUS_68310 1171 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 >Feature sequence1304 1153 11 gene locus_tag LOCUS_68320 1153 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 <2132 1344 gene locus_tag LOCUS_68330 <2132 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262483.1:site-specific DNA-methyltransferase note possible pseudo, internal stop codon >Feature sequence1305 873 322 gene locus_tag LOCUS_68340 873 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 1118 915 gene locus_tag LOCUS_68350 1118 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 1264 1500 gene locus_tag LOCUS_68360 1264 1500 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_68360 1497 1886 gene locus_tag LOCUS_68370 1497 1886 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_68370 >Feature sequence1306 353 1021 gene locus_tag LOCUS_68380 353 1021 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090769.1 protein_id gnl|my_center|LOCUS_68380 1492 1923 gene locus_tag LOCUS_68390 1492 1923 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 protein_id gnl|my_center|LOCUS_68390 >Feature sequence1307 1465 533 gene locus_tag LOCUS_68400 gene cbl 1465 533 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011008.1 protein_id gnl|my_center|LOCUS_68400 >Feature sequence1308 320 643 gene locus_tag LOCUS_68410 320 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68410 1341 724 gene locus_tag LOCUS_68420 1341 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 1700 1431 gene locus_tag LOCUS_68430 1700 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 >Feature sequence1309 100 966 gene locus_tag LOCUS_68440 100 966 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_68440 1802 1089 gene locus_tag LOCUS_68450 1802 1089 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_68450 >Feature sequence1310 1967 1407 gene locus_tag LOCUS_68460 1967 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 >Feature sequence1311 676 200 gene locus_tag LOCUS_68470 676 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 1484 741 gene locus_tag LOCUS_68480 1484 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68480 <2104 1499 gene locus_tag LOCUS_68490 <2104 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927114.1:LPS export ABC transporter ATP-binding protein >Feature sequence1312 278 2083 gene locus_tag LOCUS_68500 278 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 >Feature sequence1313 548 66 gene locus_tag LOCUS_68510 548 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68510 1791 562 gene locus_tag LOCUS_68520 1791 562 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_68520 >Feature sequence1314 1266 1937 gene locus_tag LOCUS_68530 1266 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 >Feature sequence1315 >Feature sequence1316 2033 180 gene locus_tag LOCUS_68540 2033 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 >Feature sequence1317 >Feature sequence1318 <1 959 gene locus_tag LOCUS_68550 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120393.1:DUF1501 domain-containing protein >Feature sequence1319 117 1466 gene locus_tag LOCUS_68560 117 1466 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615609.1 protein_id gnl|my_center|LOCUS_68560 1547 1798 gene locus_tag LOCUS_68570 1547 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68570 >Feature sequence1320 >Feature sequence1321 582 1775 gene locus_tag LOCUS_68580 582 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 >Feature sequence1322 1972 26 gene locus_tag LOCUS_68590 1972 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 >Feature sequence1323 1102 95 gene locus_tag LOCUS_68600 1102 95 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_68600 1612 1415 gene locus_tag LOCUS_68610 1612 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 1943 1668 gene locus_tag LOCUS_68620 1943 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68620 >Feature sequence1324 1966 173 gene locus_tag LOCUS_68630 1966 173 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 protein_id gnl|my_center|LOCUS_68630 >Feature sequence1325 <1 2025 gene locus_tag LOCUS_68640 <1 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117890.1:DUF1592 domain-containing protein >Feature sequence1326 103 1407 gene locus_tag LOCUS_68650 103 1407 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_68650 >Feature sequence1327 <2027 682 gene locus_tag LOCUS_68660 <2027 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120393.1:DUF1501 domain-containing protein >Feature sequence1328 >Feature sequence1329 1949 1440 gene locus_tag LOCUS_68670 gene accB 1949 1440 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_68670 >Feature sequence1330 1926 664 gene locus_tag LOCUS_68680 1926 664 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_68680 >Feature sequence1331 511 1050 gene locus_tag LOCUS_68690 511 1050 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_68690 1047 2009 gene locus_tag LOCUS_68700 1047 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 >Feature sequence1332 1591 236 gene locus_tag LOCUS_68710 gene rho 1591 236 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_68710 >Feature sequence1333 132 503 gene locus_tag LOCUS_68720 132 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 530 1963 gene locus_tag LOCUS_68730 530 1963 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_68730 >Feature sequence1334 475 1479 gene locus_tag LOCUS_68740 475 1479 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337469.1 protein_id gnl|my_center|LOCUS_68740 1577 1855 gene locus_tag LOCUS_68750 1577 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68750 >Feature sequence1335 <1 796 gene locus_tag LOCUS_68760 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003343627.1:type VI secretion system baseplate subunit TssF 760 2007 gene locus_tag LOCUS_68770 gene tssG 760 2007 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_68770 >Feature sequence1336 315 133 gene locus_tag LOCUS_68780 315 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129052038.1 protein_id gnl|my_center|LOCUS_68780 561 340 gene locus_tag LOCUS_68790 561 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 920 558 gene locus_tag LOCUS_68800 920 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68800 2006 1398 gene locus_tag LOCUS_68810 2006 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68810 >Feature sequence1337 1742 30 gene locus_tag LOCUS_68820 1742 30 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_68820 >Feature sequence1338 654 1400 gene locus_tag LOCUS_68830 654 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 2003 1425 gene locus_tag LOCUS_68840 2003 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68840 >Feature sequence1339 377 78 gene locus_tag LOCUS_68850 377 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 1863 418 gene locus_tag LOCUS_68860 gene ffh 1863 418 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_68860 >Feature sequence1340 <1 877 gene locus_tag LOCUS_68870 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073422.1:AAA family ATPase 992 1972 gene locus_tag LOCUS_68880 992 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68880 >Feature sequence1341 415 203 gene locus_tag LOCUS_68890 415 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 808 455 gene locus_tag LOCUS_68900 808 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 1658 840 gene locus_tag LOCUS_68910 1658 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 >Feature sequence1342 <1979 581 gene locus_tag LOCUS_68920 <1979 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260488.1:prenyltransferase/squalene oxidase repeat-containing protein >Feature sequence1343 51 1604 gene locus_tag LOCUS_68930 51 1604 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_68930 >Feature sequence1344 270 1337 gene locus_tag LOCUS_68940 270 1337 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186744778.1 protein_id gnl|my_center|LOCUS_68940 >Feature sequence1345 1119 55 gene locus_tag LOCUS_68950 gene trpS 1119 55 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_68950 1213 1962 gene locus_tag LOCUS_68960 1213 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 >Feature sequence1346 1623 25 gene locus_tag LOCUS_68970 gene cimA 1623 25 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_68970 1622 1807 gene locus_tag LOCUS_68980 1622 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68980 >Feature sequence1347 226 1194 gene locus_tag LOCUS_68990 226 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 1596 1790 gene locus_tag LOCUS_69000 1596 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 >Feature sequence1348 >Feature sequence1349 <1 620 gene locus_tag LOCUS_69010 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980453.1:DUF3501 family protein 720 953 gene locus_tag LOCUS_69020 720 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 1892 1044 gene locus_tag LOCUS_69030 1892 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 >Feature sequence1350 92 1279 gene locus_tag LOCUS_69040 92 1279 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_69040 >Feature sequence1351 1004 510 gene locus_tag LOCUS_69050 1004 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69050 1749 1504 gene locus_tag LOCUS_69060 1749 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 >Feature sequence1352 950 357 gene locus_tag LOCUS_69070 950 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 >Feature sequence1353 >Feature sequence1354 524 222 gene locus_tag LOCUS_69080 524 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69080 886 1155 gene locus_tag LOCUS_69090 886 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69090 >Feature sequence1355 >Feature sequence1356 302 739 gene locus_tag LOCUS_69100 302 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 712 1872 gene locus_tag LOCUS_69110 712 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69110 >Feature sequence1357 901 1269 gene locus_tag LOCUS_69120 901 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69120 1277 1894 gene locus_tag LOCUS_69130 1277 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69130 >Feature sequence1358 1221 1829 gene locus_tag LOCUS_69140 gene lexA 1221 1829 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_69140 >Feature sequence1359 50 484 gene locus_tag LOCUS_69150 50 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_69150 661 1383 gene locus_tag LOCUS_69160 661 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 1380 1874 gene locus_tag LOCUS_69170 1380 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 >Feature sequence1360 978 1751 gene locus_tag LOCUS_69180 978 1751 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_69180 >Feature sequence1361 276 1082 gene locus_tag LOCUS_69190 276 1082 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948378.1 protein_id gnl|my_center|LOCUS_69190 >Feature sequence1362 541 1806 gene locus_tag LOCUS_69200 541 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69200 >Feature sequence1363 499 206 gene locus_tag LOCUS_69210 499 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 570 818 gene locus_tag LOCUS_69220 570 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 1721 939 gene locus_tag LOCUS_69230 1721 939 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112457.1 protein_id gnl|my_center|LOCUS_69230 >Feature sequence1364 >Feature sequence1365 808 281 gene locus_tag LOCUS_69240 808 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 1810 1067 gene locus_tag LOCUS_69250 1810 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 >Feature sequence1366 >Feature sequence1367 <1890 866 gene locus_tag LOCUS_69260 <1890 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein >Feature sequence1368 1689 229 gene locus_tag LOCUS_69270 1689 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69270 >Feature sequence1369 614 1864 gene locus_tag LOCUS_69280 614 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 >Feature sequence1370 >Feature sequence1371 1108 20 gene locus_tag LOCUS_69290 1108 20 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_69290 >Feature sequence1372 1066 773 gene locus_tag LOCUS_69300 1066 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 <1869 1074 gene locus_tag LOCUS_69310 <1869 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258472.1:cytochrome P450 >Feature sequence1373 1016 153 gene locus_tag LOCUS_69320 gene ilvE 1016 153 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_69320 1748 1038 gene locus_tag LOCUS_69330 1748 1038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_69330 >Feature sequence1374 981 79 gene locus_tag LOCUS_69340 981 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 >Feature sequence1375 456 49 gene locus_tag LOCUS_69350 456 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 698 1117 gene locus_tag LOCUS_69360 698 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 >Feature sequence1376 982 71 gene locus_tag LOCUS_69370 gene mshM 982 71 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_69370 1132 1548 gene locus_tag LOCUS_69380 1132 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 >Feature sequence1377 1555 695 gene locus_tag LOCUS_69390 1555 695 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_69390 >Feature sequence1378 >Feature sequence1379 420 1139 gene locus_tag LOCUS_69400 420 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 1770 1231 gene locus_tag LOCUS_69410 1770 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 >Feature sequence1380 823 1311 gene locus_tag LOCUS_69420 823 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69420 >Feature sequence1381 1665 37 gene locus_tag LOCUS_69430 gene groL 1665 37 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_69430 >Feature sequence1382 167 1168 gene locus_tag LOCUS_69440 167 1168 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_69440 1626 1799 gene locus_tag LOCUS_69450 1626 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 >Feature sequence1383 >Feature sequence1384 71 490 gene locus_tag LOCUS_69460 71 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_69460 497 652 gene locus_tag LOCUS_69470 497 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69470 1042 884 gene locus_tag LOCUS_69480 1042 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69480 >Feature sequence1385 <1 1462 gene locus_tag LOCUS_69490 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616218.1:cytochrome c peroxidase 1149 1240 gene locus_tag LOCUS_t00660 1149 1240 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1473 1754 gene locus_tag LOCUS_69500 1473 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 >Feature sequence1386 360 1613 gene locus_tag LOCUS_69510 360 1613 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_69510 >Feature sequence1387 502 1596 gene locus_tag LOCUS_69520 502 1596 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_69520 >Feature sequence1388 <1823 624 gene locus_tag LOCUS_69530 <1823 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266501.1:transglutaminase family protein >Feature sequence1389 <1819 583 gene locus_tag LOCUS_69540 <1819 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528919.1:glucose-6-phosphate dehydrogenase >Feature sequence1390 2 1018 gene locus_tag LOCUS_69550 2 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 >Feature sequence1391 314 1093 gene locus_tag LOCUS_69560 314 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 >Feature sequence1392 136 1680 gene locus_tag LOCUS_69570 136 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 >Feature sequence1393 >Feature sequence1394 >Feature sequence1395 1209 472 gene locus_tag LOCUS_69580 1209 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 >Feature sequence1396 169 1761 gene locus_tag LOCUS_69590 169 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 >Feature sequence1397 >Feature sequence1398 1550 894 gene locus_tag LOCUS_69600 1550 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69600 >Feature sequence1399 <1 511 gene locus_tag LOCUS_69610 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117790.1:porin 622 957 gene locus_tag LOCUS_69620 622 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 >Feature sequence1400 1739 129 gene locus_tag LOCUS_69630 1739 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 >Feature sequence1401 >Feature sequence1402 <1 513 gene locus_tag LOCUS_69640 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705617.1:class I SAM-dependent methyltransferase 1745 510 gene locus_tag LOCUS_69650 1745 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69650 >Feature sequence1403 751 62 gene locus_tag LOCUS_69660 751 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 881 1201 gene locus_tag LOCUS_69670 881 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 1703 1263 gene locus_tag LOCUS_69680 1703 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 >Feature sequence1404 >Feature sequence1405 >Feature sequence1406 >Feature sequence1407 1653 916 gene locus_tag LOCUS_69690 1653 916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525001.1 protein_id gnl|my_center|LOCUS_69690 >Feature sequence1408 <1 1634 gene locus_tag LOCUS_69700 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809919.1:RNA polymerase sigma factor >Feature sequence1409 325 1596 gene locus_tag LOCUS_69710 gene metK 325 1596 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_69710 >Feature sequence1410 170 781 gene locus_tag LOCUS_69720 170 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 1673 789 gene locus_tag LOCUS_69730 gene nadC 1673 789 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840153.1 protein_id gnl|my_center|LOCUS_69730 >Feature sequence1411 1523 87 gene locus_tag LOCUS_69740 1523 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 >Feature sequence1412 1654 599 gene locus_tag LOCUS_69750 1654 599 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_69750 >Feature sequence1413 >Feature sequence1414 >Feature sequence1415 107 1279 gene locus_tag LOCUS_69760 107 1279 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_69760 >Feature sequence1416 971 1198 gene locus_tag LOCUS_69770 971 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 >Feature sequence1417 383 33 gene locus_tag LOCUS_69780 383 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 691 398 gene locus_tag LOCUS_69790 691 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 >Feature sequence1418 1442 24 gene locus_tag LOCUS_69800 gene tssK 1442 24 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616050.1 protein_id gnl|my_center|LOCUS_69800 >Feature sequence1419 1682 297 gene locus_tag LOCUS_69810 1682 297 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_69810 >Feature sequence1420 190 1650 gene locus_tag LOCUS_69820 190 1650 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_69820 >Feature sequence1421 <1 587 gene locus_tag LOCUS_69830 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245829.1:adenylyl-sulfate kinase 905 1663 gene locus_tag LOCUS_69840 905 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 >Feature sequence1422 132 812 gene locus_tag LOCUS_69850 132 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 816 1517 gene locus_tag LOCUS_69860 816 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 >Feature sequence1423 427 1485 gene locus_tag LOCUS_69870 427 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 >Feature sequence1424 1393 263 gene locus_tag LOCUS_69880 1393 263 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_69880 >Feature sequence1425 >Feature sequence1426 >Feature sequence1427 85 786 gene locus_tag LOCUS_69890 85 786 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_69890 827 1084 gene locus_tag LOCUS_69900 827 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 1084 1509 gene locus_tag LOCUS_69910 1084 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 >Feature sequence1428 >Feature sequence1429 1086 1511 gene locus_tag LOCUS_69920 1086 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 >Feature sequence1430 333 1529 gene locus_tag LOCUS_69930 333 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 >Feature sequence1431 183 944 gene locus_tag LOCUS_69940 183 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69940 >Feature sequence1432 >Feature sequence1433 646 1221 gene locus_tag LOCUS_69950 646 1221 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_69950 1280 1627 gene locus_tag LOCUS_69960 1280 1627 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_69960 >Feature sequence1434 <1 638 gene locus_tag LOCUS_69970 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013340.1:Stk1 family PASTA domain-containing Ser/Thr kinase 664 1134 gene locus_tag LOCUS_69980 664 1134 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058135.1 protein_id gnl|my_center|LOCUS_69980 1185 1631 gene locus_tag LOCUS_69990 1185 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 >Feature sequence1435 564 124 gene locus_tag LOCUS_70000 564 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 <1684 588 gene locus_tag LOCUS_70010 <1684 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching protein GlgX >Feature sequence1436 >Feature sequence1437 1081 1632 gene locus_tag LOCUS_70020 1081 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 >Feature sequence1438 116 1252 gene locus_tag LOCUS_70030 116 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 >Feature sequence1439 1413 106 gene locus_tag LOCUS_70040 1413 106 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_70040 >Feature sequence1440 1609 221 gene locus_tag LOCUS_70050 1609 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70050 >Feature sequence1441 103 942 gene locus_tag LOCUS_70060 103 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_70060 1258 1013 gene locus_tag LOCUS_70070 1258 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70070 >Feature sequence1442 168 1610 gene locus_tag LOCUS_70080 168 1610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_70080 >Feature sequence1443 411 79 gene locus_tag LOCUS_70090 411 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70090 1446 604 gene locus_tag LOCUS_70100 1446 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 >Feature sequence1444 1293 127 gene locus_tag LOCUS_70110 gene mexE 1293 127 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_70110 >Feature sequence1445 1517 24 gene locus_tag LOCUS_70120 1517 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70120 >Feature sequence1446 1150 905 gene locus_tag LOCUS_70130 1150 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70130 >Feature sequence1447 >Feature sequence1448 1136 1363 gene locus_tag LOCUS_70140 1136 1363 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_70140 >Feature sequence1449 >Feature sequence1450 606 166 gene locus_tag LOCUS_70150 606 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70150 1046 594 gene locus_tag LOCUS_70160 1046 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 1637 1110 gene locus_tag LOCUS_70170 1637 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 >Feature sequence1451 1016 177 gene locus_tag LOCUS_70180 1016 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 1558 1181 gene locus_tag LOCUS_70190 1558 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 >Feature sequence1452 220 783 gene locus_tag LOCUS_70200 220 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123624.1 protein_id gnl|my_center|LOCUS_70200 >Feature sequence1453 862 125 gene locus_tag LOCUS_70210 862 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 >Feature sequence1454 425 57 gene locus_tag LOCUS_70220 425 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 754 1419 gene locus_tag LOCUS_70230 754 1419 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361855.1 protein_id gnl|my_center|LOCUS_70230 1620 1429 gene locus_tag LOCUS_70240 1620 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 >Feature sequence1455 >Feature sequence1456 1 1437 gene locus_tag LOCUS_70250 1 1437 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479717.1 protein_id gnl|my_center|LOCUS_70250 >Feature sequence1457 >Feature sequence1458 >Feature sequence1459 674 1528 gene locus_tag LOCUS_70260 674 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70260 >Feature sequence1460 >Feature sequence1461 >Feature sequence1462 424 38 gene locus_tag LOCUS_70270 424 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 <1597 581 gene locus_tag LOCUS_70280 <1597 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172625959.1:MFS transporter >Feature sequence1463 >Feature sequence1464 >Feature sequence1465 >Feature sequence1466 834 1463 gene locus_tag LOCUS_70290 834 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 >Feature sequence1467 >Feature sequence1468 83 427 gene locus_tag LOCUS_70300 83 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 421 777 gene locus_tag LOCUS_70310 gene tnpB 421 777 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624622.1 protein_id gnl|my_center|LOCUS_70310 >Feature sequence1469 >Feature sequence1470 1507 779 gene locus_tag LOCUS_70320 1507 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 >Feature sequence1471 <1 961 gene locus_tag LOCUS_70330 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123970.1:PQQ-binding-like beta-propeller repeat protein 1057 1380 gene locus_tag LOCUS_70340 1057 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 >Feature sequence1472 >Feature sequence1473 <1571 18 gene locus_tag LOCUS_70350 <1571 18 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289081.1:IS66-like element ISH10B family transposase >Feature sequence1474 810 64 gene locus_tag LOCUS_70360 810 64 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525001.1 protein_id gnl|my_center|LOCUS_70360 <1571 1067 gene locus_tag LOCUS_70370 <1571 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926879.1:ABC transporter permease >Feature sequence1475 <1 801 gene locus_tag LOCUS_70380 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007340206.1:DUF1501 domain-containing protein 900 1442 gene locus_tag LOCUS_70390 900 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 >Feature sequence1476 174 1430 gene locus_tag LOCUS_70400 174 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 >Feature sequence1477 419 1429 gene locus_tag LOCUS_70410 419 1429 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890915.1 protein_id gnl|my_center|LOCUS_70410 >Feature sequence1478 1513 641 gene locus_tag LOCUS_70420 1513 641 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_70420 >Feature sequence1479 1250 156 gene locus_tag LOCUS_70430 1250 156 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728770.1 protein_id gnl|my_center|LOCUS_70430 >Feature sequence1480 652 44 gene locus_tag LOCUS_70440 652 44 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141420.1 protein_id gnl|my_center|LOCUS_70440 767 1519 gene locus_tag LOCUS_70450 767 1519 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 protein_id gnl|my_center|LOCUS_70450 >Feature sequence1481 118 1080 gene locus_tag LOCUS_70460 118 1080 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_70460 >Feature sequence1482 >Feature sequence1483 875 1480 gene locus_tag LOCUS_70470 875 1480 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334179.1 protein_id gnl|my_center|LOCUS_70470 >Feature sequence1484 1467 61 gene locus_tag LOCUS_70480 1467 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_70480 >Feature sequence1485 >Feature sequence1486 1489 404 gene locus_tag LOCUS_70490 1489 404 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_70490 >Feature sequence1487 1465 161 gene locus_tag LOCUS_70500 1465 161 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_70500 >Feature sequence1488 857 285 gene locus_tag LOCUS_70510 857 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70510 1307 885 gene locus_tag LOCUS_70520 1307 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70520 >Feature sequence1489 40 1251 gene locus_tag LOCUS_70530 40 1251 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_70530 >Feature sequence1490 >Feature sequence1491 >Feature sequence1492 510 1100 gene locus_tag LOCUS_70540 510 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 1254 1496 gene locus_tag LOCUS_70550 1254 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 >Feature sequence1493 1167 850 gene locus_tag LOCUS_70560 1167 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 >Feature sequence1494 537 935 gene locus_tag LOCUS_70570 gene crcB 537 935 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011704.1 protein_id gnl|my_center|LOCUS_70570 <1516 948 gene locus_tag LOCUS_70580 <1516 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922313.1:TIGR00730 family Rossman fold protein >Feature sequence1495 1366 752 gene locus_tag LOCUS_70590 1366 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70590 >Feature sequence1496 199 1299 gene locus_tag LOCUS_70600 199 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 >Feature sequence1497 <1 793 gene locus_tag LOCUS_70610 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence1498 1276 116 gene locus_tag LOCUS_70620 1276 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 >Feature sequence1499 310 894 gene locus_tag LOCUS_70630 310 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70630 >Feature sequence1500 1404 340 gene locus_tag LOCUS_70640 gene floA 1404 340 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_70640