>Feature sequence01 1279 233 gene locus_tag LOCUS_00010 1279 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_00010 2334 1306 gene locus_tag LOCUS_00020 2334 1306 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_00020 3461 2331 gene locus_tag LOCUS_00030 3461 2331 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_00030 4809 3466 gene locus_tag LOCUS_00040 4809 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_00040 4994 6211 gene locus_tag LOCUS_00050 4994 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6300 7034 gene locus_tag LOCUS_00060 gene menH 6300 7034 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706155.1 protein_id gnl|my_center|LOCUS_00060 7081 8196 gene locus_tag LOCUS_00070 7081 8196 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929099.1 protein_id gnl|my_center|LOCUS_00070 8242 9207 gene locus_tag LOCUS_00080 8242 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10198 9980 gene locus_tag LOCUS_00090 10198 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10717 10265 gene locus_tag LOCUS_00100 10717 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10910 11437 gene locus_tag LOCUS_00110 10910 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11415 11669 gene locus_tag LOCUS_00120 11415 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11670 11873 gene locus_tag LOCUS_00130 11670 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11964 12290 gene locus_tag LOCUS_00140 11964 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14845 12377 gene locus_tag LOCUS_00150 14845 12377 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_00150 15513 14851 gene locus_tag LOCUS_00160 15513 14851 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_00160 16680 15688 gene locus_tag LOCUS_00170 16680 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18220 16718 gene locus_tag LOCUS_00180 gene malQ 18220 16718 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_00180 19580 18240 gene locus_tag LOCUS_00190 19580 18240 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_00190 19579 20385 gene locus_tag LOCUS_00200 19579 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20506 21069 gene locus_tag LOCUS_00210 20506 21069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21905 21066 gene locus_tag LOCUS_00220 gene murI 21905 21066 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141495.1 protein_id gnl|my_center|LOCUS_00220 22003 22950 gene locus_tag LOCUS_00230 22003 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22961 24073 gene locus_tag LOCUS_00240 22961 24073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24153 24902 gene locus_tag LOCUS_00250 24153 24902 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_00250 24902 25717 gene locus_tag LOCUS_00260 24902 25717 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_00260 25807 27708 gene locus_tag LOCUS_00270 25807 27708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27639 28793 gene locus_tag LOCUS_00280 27639 28793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28811 29881 gene locus_tag LOCUS_00290 gene tgt 28811 29881 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_00290 30568 29924 gene locus_tag LOCUS_00300 30568 29924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32487 30565 gene locus_tag LOCUS_00310 32487 30565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32904 32488 gene locus_tag LOCUS_00320 32904 32488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34035 33088 gene locus_tag LOCUS_00330 34035 33088 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_00330 34237 35199 gene locus_tag LOCUS_00340 34237 35199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35332 36501 gene locus_tag LOCUS_00350 35332 36501 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_00350 36503 37462 gene locus_tag LOCUS_00360 36503 37462 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_00360 38562 37459 gene locus_tag LOCUS_00370 38562 37459 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969759.1 protein_id gnl|my_center|LOCUS_00370 38634 39581 gene locus_tag LOCUS_00380 38634 39581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39578 42241 gene locus_tag LOCUS_00390 39578 42241 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_00390 42238 43296 gene locus_tag LOCUS_00400 42238 43296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 43293 44792 gene locus_tag LOCUS_00410 43293 44792 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_00410 44789 45361 gene locus_tag LOCUS_00420 44789 45361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 45764 45354 gene locus_tag LOCUS_00430 45764 45354 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 protein_id gnl|my_center|LOCUS_00430 45859 47124 gene locus_tag LOCUS_00440 45859 47124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47143 48363 gene locus_tag LOCUS_00450 47143 48363 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_00450 48363 49691 gene locus_tag LOCUS_00460 48363 49691 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_00460 49706 50551 gene locus_tag LOCUS_00470 49706 50551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50553 51506 gene locus_tag LOCUS_00480 50553 51506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51551 52171 gene locus_tag LOCUS_00490 51551 52171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52938 52234 gene locus_tag LOCUS_00500 52938 52234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53061 54671 gene locus_tag LOCUS_00510 53061 54671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54674 55333 gene locus_tag LOCUS_00520 54674 55333 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_00520 55412 55750 gene locus_tag LOCUS_00530 55412 55750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 57293 55833 gene locus_tag LOCUS_00540 57293 55833 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_00540 57768 57325 gene locus_tag LOCUS_00550 57768 57325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59407 57854 gene locus_tag LOCUS_00560 59407 57854 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_00560 59518 60624 gene locus_tag LOCUS_00570 gene hisC 59518 60624 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_00570 60621 61202 gene locus_tag LOCUS_00580 60621 61202 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173992.1 protein_id gnl|my_center|LOCUS_00580 61204 61998 gene locus_tag LOCUS_00590 61204 61998 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_00590 62000 64138 gene locus_tag LOCUS_00600 62000 64138 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_00600 64533 64162 gene locus_tag LOCUS_00610 64533 64162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65352 64612 gene locus_tag LOCUS_00620 65352 64612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66214 65342 gene locus_tag LOCUS_00630 66214 65342 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_00630 66702 66217 gene locus_tag LOCUS_00640 66702 66217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 67220 66699 gene locus_tag LOCUS_00650 gene coaD 67220 66699 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_00650 68995 67220 gene locus_tag LOCUS_00660 gene typA 68995 67220 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_00660 69129 69899 gene locus_tag LOCUS_00670 69129 69899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 69896 73300 gene locus_tag LOCUS_00680 69896 73300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73310 74524 gene locus_tag LOCUS_00690 73310 74524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 74534 75850 gene locus_tag LOCUS_00700 gene rimO 74534 75850 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_00700 75825 76421 gene locus_tag LOCUS_00710 gene pgsA 75825 76421 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_00710 76418 77068 gene locus_tag LOCUS_00720 gene upp 76418 77068 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_00720 77065 78312 gene locus_tag LOCUS_00730 77065 78312 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228938.1 protein_id gnl|my_center|LOCUS_00730 78369 78962 gene locus_tag LOCUS_00740 gene nth 78369 78962 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886934.1 protein_id gnl|my_center|LOCUS_00740 78956 79510 gene locus_tag LOCUS_00750 78956 79510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 79521 79793 gene locus_tag LOCUS_00760 79521 79793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79882 82587 gene locus_tag LOCUS_00770 79882 82587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 82607 83569 gene locus_tag LOCUS_00780 82607 83569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 83541 84260 gene locus_tag LOCUS_00790 83541 84260 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326130.1 protein_id gnl|my_center|LOCUS_00790 84898 84257 gene locus_tag LOCUS_00800 84898 84257 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057765.1 protein_id gnl|my_center|LOCUS_00800 84934 85722 gene locus_tag LOCUS_00810 gene trmJ 84934 85722 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947473.1 protein_id gnl|my_center|LOCUS_00810 86674 85634 gene locus_tag LOCUS_00820 86674 85634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 87402 86671 gene locus_tag LOCUS_00830 87402 86671 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_00830 87872 87399 gene locus_tag LOCUS_00840 87872 87399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 88723 87869 gene locus_tag LOCUS_00850 gene cdaA 88723 87869 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_00850 90063 88720 gene locus_tag LOCUS_00860 gene lysA 90063 88720 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_00860 90125 90916 gene locus_tag LOCUS_00870 90125 90916 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_00870 90913 92238 gene locus_tag LOCUS_00880 gene der 90913 92238 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_00880 92238 92858 gene locus_tag LOCUS_00890 gene plsY 92238 92858 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081723.1 protein_id gnl|my_center|LOCUS_00890 92855 93679 gene locus_tag LOCUS_00900 gene rsmA 92855 93679 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_00900 93663 94553 gene locus_tag LOCUS_00910 gene ispE 93663 94553 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_00910 95131 94538 gene locus_tag LOCUS_00920 95131 94538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 95224 96486 gene locus_tag LOCUS_00930 gene secD 95224 96486 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144152.1 protein_id gnl|my_center|LOCUS_00930 96486 97517 gene locus_tag LOCUS_00940 gene secF 96486 97517 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144153.1 protein_id gnl|my_center|LOCUS_00940 97627 97962 gene locus_tag LOCUS_00950 gene rpsF 97627 97962 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462318.1 protein_id gnl|my_center|LOCUS_00950 97973 98434 gene locus_tag LOCUS_00960 97973 98434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 98473 99504 gene locus_tag LOCUS_00970 gene pheS 98473 99504 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143121.1 protein_id gnl|my_center|LOCUS_00970 99514 101892 gene locus_tag LOCUS_00980 gene pheT 99514 101892 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_00980 102000 103736 gene locus_tag LOCUS_00990 102000 103736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 103812 105725 gene locus_tag LOCUS_01000 103812 105725 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_01000 105770 106876 gene locus_tag LOCUS_01010 105770 106876 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_01010 106887 108146 gene locus_tag LOCUS_01020 106887 108146 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_01020 108196 108846 gene locus_tag LOCUS_01030 gene queE 108196 108846 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 protein_id gnl|my_center|LOCUS_01030 109272 108913 gene locus_tag LOCUS_01040 109272 108913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 109899 109486 gene locus_tag LOCUS_01050 109899 109486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 110124 110050 gene locus_tag LOCUS_t00010 110124 110050 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 110182 111735 gene locus_tag LOCUS_01060 gene metG 110182 111735 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080396.1 protein_id gnl|my_center|LOCUS_01060 111732 112586 gene locus_tag LOCUS_01070 111732 112586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 112680 113276 gene locus_tag LOCUS_01080 112680 113276 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 protein_id gnl|my_center|LOCUS_01080 113703 113266 gene locus_tag LOCUS_01090 113703 113266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 115103 113676 gene locus_tag LOCUS_01100 115103 113676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01100 115801 115082 gene locus_tag LOCUS_01110 115801 115082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 116690 116103 gene locus_tag LOCUS_01120 gene cysE 116690 116103 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_01120 117706 116687 gene locus_tag LOCUS_01130 gene cysK 117706 116687 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_01130 119261 117780 gene locus_tag LOCUS_01140 119261 117780 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_01140 120308 119397 gene locus_tag LOCUS_01150 120308 119397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 120893 120327 gene locus_tag LOCUS_01160 gene rfbC 120893 120327 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958478.1 protein_id gnl|my_center|LOCUS_01160 121001 120915 gene locus_tag LOCUS_t00020 121001 120915 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 122062 121031 gene locus_tag LOCUS_01170 122062 121031 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816877.1 protein_id gnl|my_center|LOCUS_01170 124047 122059 gene locus_tag LOCUS_01180 gene pcrA 124047 122059 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_01180 124046 124498 gene locus_tag LOCUS_01190 124046 124498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 124559 124633 gene locus_tag LOCUS_t00030 124559 124633 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 124735 125091 gene locus_tag LOCUS_01200 124735 125091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 125359 125610 gene locus_tag LOCUS_01210 125359 125610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 125789 126136 gene locus_tag LOCUS_01220 125789 126136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 126399 126019 gene locus_tag LOCUS_01230 126399 126019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 127422 126799 gene locus_tag LOCUS_01240 127422 126799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 129452 127419 gene locus_tag LOCUS_01250 129452 127419 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530263.1 protein_id gnl|my_center|LOCUS_01250 129360 129268 gene locus_tag LOCUS_t00040 129360 129268 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 129564 130772 gene locus_tag LOCUS_01260 129564 130772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 132335 130782 gene locus_tag LOCUS_01270 132335 130782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 132510 132941 gene locus_tag LOCUS_01280 132510 132941 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722083.1 protein_id gnl|my_center|LOCUS_01280 133497 132892 gene locus_tag LOCUS_01290 133497 132892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 133566 134609 gene locus_tag LOCUS_01300 133566 134609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 134609 134953 gene locus_tag LOCUS_01310 134609 134953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 135020 136324 gene locus_tag LOCUS_01320 135020 136324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 136332 136901 gene locus_tag LOCUS_01330 136332 136901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 136911 137378 gene locus_tag LOCUS_01340 136911 137378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 137667 137446 gene locus_tag LOCUS_01350 137667 137446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 138024 137788 gene locus_tag LOCUS_01360 138024 137788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 138321 138070 gene locus_tag LOCUS_01370 138321 138070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 138796 140244 gene locus_tag LOCUS_01380 138796 140244 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_01380 140248 141036 gene locus_tag LOCUS_01390 140248 141036 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_01390 141156 141551 gene locus_tag LOCUS_01400 141156 141551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 141551 142621 gene locus_tag LOCUS_01410 141551 142621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 142621 144084 gene locus_tag LOCUS_01420 142621 144084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 144081 145160 gene locus_tag LOCUS_01430 144081 145160 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928611.1 protein_id gnl|my_center|LOCUS_01430 145164 148325 gene locus_tag LOCUS_01440 145164 148325 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_01440 148407 151175 gene locus_tag LOCUS_01450 148407 151175 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227836.1 protein_id gnl|my_center|LOCUS_01450 151219 152379 gene locus_tag LOCUS_01460 gene odhB 151219 152379 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065167.1 protein_id gnl|my_center|LOCUS_01460 152382 153779 gene locus_tag LOCUS_01470 gene lpdA 152382 153779 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227834.1 protein_id gnl|my_center|LOCUS_01470 153901 155151 gene locus_tag LOCUS_01480 153901 155151 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_01480 158023 155303 gene locus_tag LOCUS_01490 gene acnA 158023 155303 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_01490 158262 158059 gene locus_tag LOCUS_01500 158262 158059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 159642 158308 gene locus_tag LOCUS_01510 159642 158308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 161985 159685 gene locus_tag LOCUS_01520 161985 159685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 162095 163315 gene locus_tag LOCUS_01530 162095 163315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 164020 163328 gene locus_tag LOCUS_01540 164020 163328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 164275 164565 gene locus_tag LOCUS_01550 164275 164565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 165522 166169 gene locus_tag LOCUS_01560 165522 166169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 166691 166248 gene locus_tag LOCUS_01570 166691 166248 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082285506.1 protein_id gnl|my_center|LOCUS_01570 167692 166688 gene locus_tag LOCUS_01580 167692 166688 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_01580 167597 167908 gene locus_tag LOCUS_01590 167597 167908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 169523 167985 gene locus_tag LOCUS_01600 169523 167985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 171160 169523 gene locus_tag LOCUS_01610 171160 169523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 171669 172853 gene locus_tag LOCUS_01620 171669 172853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 172861 174720 gene locus_tag LOCUS_01630 172861 174720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 174708 177065 gene locus_tag LOCUS_01640 174708 177065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 179292 177067 gene locus_tag LOCUS_01650 179292 177067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 181510 179300 gene locus_tag LOCUS_01660 181510 179300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 187024 181601 gene locus_tag LOCUS_01670 187024 181601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 187181 187666 gene locus_tag LOCUS_01680 187181 187666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 187615 189897 gene locus_tag LOCUS_01690 187615 189897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 189899 190219 gene locus_tag LOCUS_01700 189899 190219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 190366 191283 gene locus_tag LOCUS_01710 gene selD 190366 191283 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_01710 191896 191294 gene locus_tag LOCUS_01720 191896 191294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 192162 191911 gene locus_tag LOCUS_01730 192162 191911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 192294 192806 gene locus_tag LOCUS_01740 192294 192806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 194879 192879 gene locus_tag LOCUS_01750 194879 192879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 195539 194880 gene locus_tag LOCUS_01760 195539 194880 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_01760 195945 195511 gene locus_tag LOCUS_01770 195945 195511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 196103 196636 gene locus_tag LOCUS_01780 196103 196636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 200107 196643 gene locus_tag LOCUS_01790 200107 196643 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_01790 201504 200137 gene locus_tag LOCUS_01800 201504 200137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 201573 203636 gene locus_tag LOCUS_01810 201573 203636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 203772 204143 gene locus_tag LOCUS_01820 203772 204143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 204744 204115 gene locus_tag LOCUS_01830 204744 204115 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_01830 205976 204741 gene locus_tag LOCUS_01840 gene zigA 205976 204741 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_01840 206134 206406 gene locus_tag LOCUS_01850 gene rpsT 206134 206406 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583468.1 protein_id gnl|my_center|LOCUS_01850 206508 207350 gene locus_tag LOCUS_01860 206508 207350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 207451 208110 gene locus_tag LOCUS_01870 gene sdaAB 207451 208110 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_01870 208124 209017 gene locus_tag LOCUS_01880 gene sdaAA 208124 209017 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_01880 209423 209145 gene locus_tag LOCUS_01890 209423 209145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 210555 209347 gene locus_tag LOCUS_01900 210555 209347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 211667 210552 gene locus_tag LOCUS_01910 211667 210552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 211734 212816 gene locus_tag LOCUS_01920 gene mnmA 211734 212816 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140554.1 protein_id gnl|my_center|LOCUS_01920 213117 213428 gene locus_tag LOCUS_01930 213117 213428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 213799 213933 gene locus_tag LOCUS_01940 213799 213933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 214518 213946 gene locus_tag LOCUS_01950 214518 213946 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_01950 215549 214515 gene locus_tag LOCUS_01960 215549 214515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 216376 215546 gene locus_tag LOCUS_01970 216376 215546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 216437 217747 gene locus_tag LOCUS_01980 216437 217747 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_01980 217753 218649 gene locus_tag LOCUS_01990 217753 218649 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_01990 218646 219461 gene locus_tag LOCUS_02000 218646 219461 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_02000 219563 220339 gene locus_tag LOCUS_02010 219563 220339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 220718 220413 gene locus_tag LOCUS_02020 220718 220413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 220787 221248 gene locus_tag LOCUS_02030 220787 221248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence02 <1 790 gene locus_tag LOCUS_02040 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970002.1:protein-glutamate O-methyltransferase CheR 859 2202 gene locus_tag LOCUS_02050 859 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2217 4178 gene locus_tag LOCUS_02060 2217 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7584 4153 gene locus_tag LOCUS_02070 7584 4153 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394238.1 protein_id gnl|my_center|LOCUS_02070 7717 7592 gene locus_tag LOCUS_02080 7717 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8121 8858 gene locus_tag LOCUS_02090 8121 8858 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_02090 8866 9339 gene locus_tag LOCUS_02100 8866 9339 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 protein_id gnl|my_center|LOCUS_02100 9444 10058 gene locus_tag LOCUS_02110 9444 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 10264 10923 gene locus_tag LOCUS_02120 10264 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10939 11628 gene locus_tag LOCUS_02130 10939 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 11625 12314 gene locus_tag LOCUS_02140 11625 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 12311 13018 gene locus_tag LOCUS_02150 12311 13018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_02150 13029 13907 gene locus_tag LOCUS_02160 13029 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 14453 13920 gene locus_tag LOCUS_02170 14453 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 15652 14462 gene locus_tag LOCUS_02180 15652 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 17064 15649 gene locus_tag LOCUS_02190 17064 15649 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_02190 17157 17765 gene locus_tag LOCUS_02200 17157 17765 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_02200 17770 18966 gene locus_tag LOCUS_02210 17770 18966 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228412.1 protein_id gnl|my_center|LOCUS_02210 18983 19471 gene locus_tag LOCUS_02220 gene ribE 18983 19471 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258065.1 protein_id gnl|my_center|LOCUS_02220 19792 19610 gene locus_tag LOCUS_02230 19792 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 19779 20300 gene locus_tag LOCUS_02240 19779 20300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 20303 23185 gene locus_tag LOCUS_02250 20303 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 23309 24565 gene locus_tag LOCUS_02260 23309 24565 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_02260 26252 24618 gene locus_tag LOCUS_02270 26252 24618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 27467 26289 gene locus_tag LOCUS_02280 27467 26289 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_02280 28426 27494 gene locus_tag LOCUS_02290 28426 27494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256682.1 protein_id gnl|my_center|LOCUS_02290 29387 28437 gene locus_tag LOCUS_02300 29387 28437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_02300 31053 29392 gene locus_tag LOCUS_02310 31053 29392 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972713.1 protein_id gnl|my_center|LOCUS_02310 32128 31112 gene locus_tag LOCUS_02320 32128 31112 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_02320 33141 32125 gene locus_tag LOCUS_02330 33141 32125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_02330 33207 36095 gene locus_tag LOCUS_02340 gene uvrA 33207 36095 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144220.1 protein_id gnl|my_center|LOCUS_02340 36549 36115 gene locus_tag LOCUS_02350 36549 36115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 37638 36640 gene locus_tag LOCUS_02360 37638 36640 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194032.1 protein_id gnl|my_center|LOCUS_02360 37707 38417 gene locus_tag LOCUS_02370 gene nfi 37707 38417 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_02370 38434 40107 gene locus_tag LOCUS_02380 38434 40107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 40143 41060 gene locus_tag LOCUS_02390 40143 41060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 41033 41587 gene locus_tag LOCUS_02400 41033 41587 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_02400 41633 41992 gene locus_tag LOCUS_02410 41633 41992 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_02410 41983 42477 gene locus_tag LOCUS_02420 41983 42477 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_02420 42474 44321 gene locus_tag LOCUS_02430 42474 44321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 44318 44875 gene locus_tag LOCUS_02440 44318 44875 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838121.1 protein_id gnl|my_center|LOCUS_02440 44872 46173 gene locus_tag LOCUS_02450 gene nuoF 44872 46173 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_02450 46173 47645 gene locus_tag LOCUS_02460 46173 47645 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_02460 47642 49093 gene locus_tag LOCUS_02470 47642 49093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 49090 49584 gene locus_tag LOCUS_02480 gene nuoI 49090 49584 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_02480 49601 50104 gene locus_tag LOCUS_02490 49601 50104 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_02490 50104 50403 gene locus_tag LOCUS_02500 gene nuoK 50104 50403 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_02500 50411 52378 gene locus_tag LOCUS_02510 gene nuoL 50411 52378 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_02510 52380 53888 gene locus_tag LOCUS_02520 52380 53888 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_02520 53885 55405 gene locus_tag LOCUS_02530 53885 55405 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404198.1 protein_id gnl|my_center|LOCUS_02530 55443 55526 gene locus_tag LOCUS_t00050 55443 55526 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 56683 55688 gene locus_tag LOCUS_02540 56683 55688 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_02540 57479 56703 gene locus_tag LOCUS_02550 gene etfB 57479 56703 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400673.1 protein_id gnl|my_center|LOCUS_02550 58196 57522 gene locus_tag LOCUS_02560 58196 57522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 59287 58517 gene locus_tag LOCUS_02570 59287 58517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 60640 59387 gene locus_tag LOCUS_02580 gene gltP 60640 59387 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368716.1 protein_id gnl|my_center|LOCUS_02580 61075 60650 gene locus_tag LOCUS_02590 61075 60650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 62306 61197 gene locus_tag LOCUS_02600 62306 61197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 64109 62403 gene locus_tag LOCUS_02610 64109 62403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 65379 64183 gene locus_tag LOCUS_02620 65379 64183 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928605.1 protein_id gnl|my_center|LOCUS_02620 67165 65372 gene locus_tag LOCUS_02630 gene uvrC 67165 65372 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143581.1 protein_id gnl|my_center|LOCUS_02630 67070 67261 gene locus_tag LOCUS_02640 67070 67261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 67272 68588 gene locus_tag LOCUS_02650 67272 68588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 68585 69523 gene locus_tag LOCUS_02660 68585 69523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_02660 69520 70398 gene locus_tag LOCUS_02670 69520 70398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 70515 72068 gene locus_tag LOCUS_02680 70515 72068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 72119 72583 gene locus_tag LOCUS_02690 72119 72583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 73811 72570 gene locus_tag LOCUS_02700 73811 72570 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707465.1 protein_id gnl|my_center|LOCUS_02700 74743 73811 gene locus_tag LOCUS_02710 gene mdh 74743 73811 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_02710 74857 75984 gene locus_tag LOCUS_02720 74857 75984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 76479 76000 gene locus_tag LOCUS_02730 76479 76000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 77636 76503 gene locus_tag LOCUS_02740 gene citZ 77636 76503 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_02740 77801 79012 gene locus_tag LOCUS_02750 gene tyrS 77801 79012 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_02750 79012 80454 gene locus_tag LOCUS_02760 79012 80454 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_02760 80444 81073 gene locus_tag LOCUS_02770 80444 81073 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_02770 81145 81687 gene locus_tag LOCUS_02780 81145 81687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 81733 82392 gene locus_tag LOCUS_02790 gene lipB 81733 82392 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_02790 82389 84023 gene locus_tag LOCUS_02800 82389 84023 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_02800 84143 85630 gene locus_tag LOCUS_02810 84143 85630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 85664 86548 gene locus_tag LOCUS_02820 85664 86548 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_02820 86529 89195 gene locus_tag LOCUS_02830 gene cphA 86529 89195 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144309.1 protein_id gnl|my_center|LOCUS_02830 89344 90372 gene locus_tag LOCUS_02840 gene tdh 89344 90372 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_02840 90396 91595 gene locus_tag LOCUS_02850 90396 91595 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_02850 91698 92786 gene locus_tag LOCUS_02860 91698 92786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 93574 92792 gene locus_tag LOCUS_02870 93574 92792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 94625 93717 gene locus_tag LOCUS_02880 94625 93717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 94918 94622 gene locus_tag LOCUS_02890 94918 94622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 95582 94935 gene locus_tag LOCUS_02900 95582 94935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 96211 95579 gene locus_tag LOCUS_02910 96211 95579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 96480 96208 gene locus_tag LOCUS_02920 96480 96208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 97122 96487 gene locus_tag LOCUS_02930 97122 96487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 98225 97119 gene locus_tag LOCUS_02940 98225 97119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 100426 98273 gene locus_tag LOCUS_02950 100426 98273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 102288 100423 gene locus_tag LOCUS_02960 102288 100423 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668661.1 protein_id gnl|my_center|LOCUS_02960 103598 102324 gene locus_tag LOCUS_02970 103598 102324 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 protein_id gnl|my_center|LOCUS_02970 104220 103654 gene locus_tag LOCUS_02980 104220 103654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 107102 104289 gene locus_tag LOCUS_02990 gene ppc 107102 104289 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_02990 108119 107169 gene locus_tag LOCUS_03000 108119 107169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 108246 108803 gene locus_tag LOCUS_03010 108246 108803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 109858 108806 gene locus_tag LOCUS_03020 gene amrS 109858 108806 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023371.1 protein_id gnl|my_center|LOCUS_03020 109889 111637 gene locus_tag LOCUS_03030 109889 111637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 111762 112403 gene locus_tag LOCUS_03040 111762 112403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 112404 113612 gene locus_tag LOCUS_03050 112404 113612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 113602 114831 gene locus_tag LOCUS_03060 113602 114831 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_03060 114854 116038 gene locus_tag LOCUS_03070 114854 116038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 116041 116754 gene locus_tag LOCUS_03080 116041 116754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 116772 119063 gene locus_tag LOCUS_03090 116772 119063 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480306.1 protein_id gnl|my_center|LOCUS_03090 119084 119644 gene locus_tag LOCUS_03100 119084 119644 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065398.1 protein_id gnl|my_center|LOCUS_03100 119662 121362 gene locus_tag LOCUS_03110 119662 121362 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_03110 121395 122294 gene locus_tag LOCUS_03120 121395 122294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 123219 122278 gene locus_tag LOCUS_03130 123219 122278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 123731 123216 gene locus_tag LOCUS_03140 123731 123216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056178.1 protein_id gnl|my_center|LOCUS_03140 124313 123822 gene locus_tag LOCUS_03150 124313 123822 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388086.1 protein_id gnl|my_center|LOCUS_03150 126236 124443 gene locus_tag LOCUS_03160 126236 124443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 127406 126297 gene locus_tag LOCUS_03170 127406 126297 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579170.1 protein_id gnl|my_center|LOCUS_03170 128394 127426 gene locus_tag LOCUS_03180 128394 127426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 128582 129631 gene locus_tag LOCUS_03190 128582 129631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 129988 129674 gene locus_tag LOCUS_03200 129988 129674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 130384 131154 gene locus_tag LOCUS_03210 130384 131154 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_03210 132188 131199 gene locus_tag LOCUS_03220 132188 131199 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_03220 134809 132347 gene locus_tag LOCUS_03230 134809 132347 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142062.1 protein_id gnl|my_center|LOCUS_03230 135281 134877 gene locus_tag LOCUS_03240 135281 134877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 135433 136149 gene locus_tag LOCUS_03250 135433 136149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 136158 138344 gene locus_tag LOCUS_03260 136158 138344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 141221 138369 gene locus_tag LOCUS_03270 gene polA 141221 138369 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940283.1 protein_id gnl|my_center|LOCUS_03270 141982 141218 gene locus_tag LOCUS_03280 141982 141218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 142095 142574 gene locus_tag LOCUS_03290 142095 142574 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_03290 143559 142576 gene locus_tag LOCUS_03300 gene hemB 143559 142576 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_03300 145397 143556 gene locus_tag LOCUS_03310 gene glmS 145397 143556 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 protein_id gnl|my_center|LOCUS_03310 146538 145504 gene locus_tag LOCUS_03320 146538 145504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 147580 146447 gene locus_tag LOCUS_03330 147580 146447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 147736 148752 gene locus_tag LOCUS_03340 gene chlG 147736 148752 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_03340 148880 149638 gene locus_tag LOCUS_03350 148880 149638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 150662 149823 gene locus_tag LOCUS_03360 150662 149823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 150978 150664 gene locus_tag LOCUS_03370 150978 150664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 154133 150957 gene locus_tag LOCUS_03380 154133 150957 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394238.1 protein_id gnl|my_center|LOCUS_03380 154226 155110 gene locus_tag LOCUS_03390 154226 155110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 155555 155184 gene locus_tag LOCUS_03400 gene rplT 155555 155184 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_03400 155809 155600 gene locus_tag LOCUS_03410 gene rpmI 155809 155600 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142779.1 protein_id gnl|my_center|LOCUS_03410 156415 155834 gene locus_tag LOCUS_03420 gene infC 156415 155834 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_03420 156649 157911 gene locus_tag LOCUS_03430 156649 157911 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227840.1 protein_id gnl|my_center|LOCUS_03430 157901 158917 gene locus_tag LOCUS_03440 157901 158917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 158928 159350 gene locus_tag LOCUS_03450 158928 159350 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 protein_id gnl|my_center|LOCUS_03450 159637 162627 gene locus_tag LOCUS_03460 159637 162627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 162713 165394 gene locus_tag LOCUS_03470 162713 165394 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_03470 165399 166685 gene locus_tag LOCUS_03480 165399 166685 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403834.1 protein_id gnl|my_center|LOCUS_03480 166685 167641 gene locus_tag LOCUS_03490 166685 167641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 167914 167645 gene locus_tag LOCUS_03500 167914 167645 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_03500 168735 167911 gene locus_tag LOCUS_03510 gene proC 168735 167911 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_03510 169289 168819 gene locus_tag LOCUS_03520 169289 168819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 169851 169282 gene locus_tag LOCUS_03530 169851 169282 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_03530 170175 170405 gene locus_tag LOCUS_03540 170175 170405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 170406 171143 gene locus_tag LOCUS_03550 170406 171143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 171189 173018 gene locus_tag LOCUS_03560 171189 173018 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_03560 173024 173932 gene locus_tag LOCUS_03570 173024 173932 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042498589.1 protein_id gnl|my_center|LOCUS_03570 173932 174210 gene locus_tag LOCUS_03580 173932 174210 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_03580 174207 174641 gene locus_tag LOCUS_03590 174207 174641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 174629 174862 gene locus_tag LOCUS_03600 174629 174862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 177319 174905 gene locus_tag LOCUS_03610 177319 174905 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_03610 177666 178187 gene locus_tag LOCUS_03620 177666 178187 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_03620 179197 178184 gene locus_tag LOCUS_03630 179197 178184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 180130 179237 gene locus_tag LOCUS_03640 180130 179237 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140650.1 protein_id gnl|my_center|LOCUS_03640 180806 180117 gene locus_tag LOCUS_03650 gene ftsE 180806 180117 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_03650 181594 180803 gene locus_tag LOCUS_03660 181594 180803 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_03660 182736 181591 gene locus_tag LOCUS_03670 gene csaB 182736 181591 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_03670 183437 182736 gene locus_tag LOCUS_03680 183437 182736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 183533 184828 gene locus_tag LOCUS_03690 183533 184828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 185879 184743 gene locus_tag LOCUS_03700 185879 184743 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_03700 186862 185876 gene locus_tag LOCUS_03710 gene dapE 186862 185876 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730316.1 protein_id gnl|my_center|LOCUS_03710 187797 186952 gene locus_tag LOCUS_03720 187797 186952 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_03720 187822 189600 gene locus_tag LOCUS_03730 187822 189600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 189603 192731 gene locus_tag LOCUS_03740 189603 192731 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_03740 193631 192735 gene locus_tag LOCUS_03750 gene dapF 193631 192735 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_03750 194536 193619 gene locus_tag LOCUS_03760 gene miaA 194536 193619 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143238.1 protein_id gnl|my_center|LOCUS_03760 195249 194533 gene locus_tag LOCUS_03770 195249 194533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 196821 195265 gene locus_tag LOCUS_03780 196821 195265 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_03780 197270 196860 gene locus_tag LOCUS_03790 197270 196860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 198156 197278 gene locus_tag LOCUS_03800 198156 197278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 199288 198161 gene locus_tag LOCUS_03810 199288 198161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 199634 199389 gene locus_tag LOCUS_03820 199634 199389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 200541 199657 gene locus_tag LOCUS_03830 200541 199657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 200609 202108 gene locus_tag LOCUS_03840 200609 202108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 203028 202072 gene locus_tag LOCUS_03850 gene rnz 203028 202072 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_03850 204902 203037 gene locus_tag LOCUS_03860 204902 203037 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_03860 206046 204979 gene locus_tag LOCUS_03870 206046 204979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 206149 207528 gene locus_tag LOCUS_03880 206149 207528 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084415488.1 protein_id gnl|my_center|LOCUS_03880 207714 208268 gene locus_tag LOCUS_03890 207714 208268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 209408 208296 gene locus_tag LOCUS_03900 209408 208296 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887217.1 protein_id gnl|my_center|LOCUS_03900 209464 209850 gene locus_tag LOCUS_03910 209464 209850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 210512 209964 gene locus_tag LOCUS_03920 210512 209964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence03 1523 1233 gene locus_tag LOCUS_03930 1523 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1874 1584 gene locus_tag LOCUS_03940 1874 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2740 1925 gene locus_tag LOCUS_03950 2740 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4624 2774 gene locus_tag LOCUS_03960 4624 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5808 4639 gene locus_tag LOCUS_03970 5808 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5910 6977 gene locus_tag LOCUS_03980 5910 6977 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_03980 6947 7939 gene locus_tag LOCUS_03990 6947 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8560 7946 gene locus_tag LOCUS_04000 8560 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10245 8689 gene locus_tag LOCUS_04010 10245 8689 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_04010 11664 10255 gene locus_tag LOCUS_04020 11664 10255 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072721720.1 protein_id gnl|my_center|LOCUS_04020 12463 11639 gene locus_tag LOCUS_04030 12463 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 13337 12480 gene locus_tag LOCUS_04040 13337 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14321 13368 gene locus_tag LOCUS_04050 14321 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 14453 15421 gene locus_tag LOCUS_04060 14453 15421 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_04060 15811 15431 gene locus_tag LOCUS_04070 15811 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 16984 15869 gene locus_tag LOCUS_04080 16984 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 17715 17056 gene locus_tag LOCUS_04090 gene msrA 17715 17056 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_04090 17738 17819 gene locus_tag LOCUS_t00060 17738 17819 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17905 18660 gene locus_tag LOCUS_04100 17905 18660 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_04100 18675 19709 gene locus_tag LOCUS_04110 18675 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 19785 21740 gene locus_tag LOCUS_04120 19785 21740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 22636 21749 gene locus_tag LOCUS_04130 gene xerD 22636 21749 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_04130 22776 24050 gene locus_tag LOCUS_04140 gene flhB 22776 24050 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_04140 24147 25274 gene locus_tag LOCUS_04150 24147 25274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 28015 25334 gene locus_tag LOCUS_04160 gene ppdK 28015 25334 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_04160 28923 28099 gene locus_tag LOCUS_04170 28923 28099 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_04170 29047 29523 gene locus_tag LOCUS_04180 29047 29523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 29533 30114 gene locus_tag LOCUS_04190 29533 30114 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228461.1 protein_id gnl|my_center|LOCUS_04190 30147 32057 gene locus_tag LOCUS_04200 30147 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 32054 32821 gene locus_tag LOCUS_04210 32054 32821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 33607 32825 gene locus_tag LOCUS_04220 gene tatC 33607 32825 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_04220 34215 33586 gene locus_tag LOCUS_04230 34215 33586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 34778 34212 gene locus_tag LOCUS_04240 gene raiA 34778 34212 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_04240 35148 34882 gene locus_tag LOCUS_04250 35148 34882 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548757.1 protein_id gnl|my_center|LOCUS_04250 35966 35175 gene locus_tag LOCUS_04260 35966 35175 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_04260 37473 35956 gene locus_tag LOCUS_04270 gene rny 37473 35956 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_04270 37592 37819 gene locus_tag LOCUS_04280 37592 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 38759 37737 gene locus_tag LOCUS_04290 38759 37737 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_04290 38828 39940 gene locus_tag LOCUS_04300 38828 39940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 39937 41259 gene locus_tag LOCUS_04310 39937 41259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 41329 41404 gene locus_tag LOCUS_t00070 41329 41404 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 41514 42293 gene locus_tag LOCUS_04320 41514 42293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 42290 43039 gene locus_tag LOCUS_04330 gene rsmG 42290 43039 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229055.1 protein_id gnl|my_center|LOCUS_04330 43085 43492 gene locus_tag LOCUS_04340 43085 43492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 44474 43542 gene locus_tag LOCUS_04350 44474 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 44619 46487 gene locus_tag LOCUS_04360 44619 46487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 47816 46407 gene locus_tag LOCUS_04370 47816 46407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 50263 47813 gene locus_tag LOCUS_04380 50263 47813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 50341 51243 gene locus_tag LOCUS_04390 50341 51243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 51240 51860 gene locus_tag LOCUS_04400 gene dcd 51240 51860 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_04400 51965 54703 gene locus_tag LOCUS_04410 51965 54703 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_04410 55728 54700 gene locus_tag LOCUS_04420 55728 54700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 55819 56193 gene locus_tag LOCUS_04430 55819 56193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 56641 56255 gene locus_tag LOCUS_04440 56641 56255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 57210 56731 gene locus_tag LOCUS_04450 57210 56731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 58417 57302 gene locus_tag LOCUS_04460 58417 57302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 59816 58491 gene locus_tag LOCUS_04470 59816 58491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943876.1 protein_id gnl|my_center|LOCUS_04470 60397 59798 gene locus_tag LOCUS_04480 60397 59798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 61259 60423 gene locus_tag LOCUS_04490 61259 60423 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_04490 62111 61263 gene locus_tag LOCUS_04500 62111 61263 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 protein_id gnl|my_center|LOCUS_04500 63244 62162 gene locus_tag LOCUS_04510 63244 62162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 63490 64797 gene locus_tag LOCUS_04520 63490 64797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 64896 65831 gene locus_tag LOCUS_04530 64896 65831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 65859 66896 gene locus_tag LOCUS_04540 65859 66896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 67712 66912 gene locus_tag LOCUS_04550 67712 66912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 68668 67709 gene locus_tag LOCUS_04560 68668 67709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_04560 68598 69185 gene locus_tag LOCUS_04570 68598 69185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 70654 69212 gene locus_tag LOCUS_04580 70654 69212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 71201 70755 gene locus_tag LOCUS_04590 71201 70755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 71349 71269 gene locus_tag LOCUS_t00080 71349 71269 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 71473 73077 gene locus_tag LOCUS_04600 gene pckA 71473 73077 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_04600 74803 73109 gene locus_tag LOCUS_04610 74803 73109 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668661.1 protein_id gnl|my_center|LOCUS_04610 75630 74800 gene locus_tag LOCUS_04620 75630 74800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 76399 75662 gene locus_tag LOCUS_04630 76399 75662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 76483 77850 gene locus_tag LOCUS_04640 gene hisS 76483 77850 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_04640 77847 79802 gene locus_tag LOCUS_04650 77847 79802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 80283 79954 gene locus_tag LOCUS_04660 80283 79954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 81700 80414 gene locus_tag LOCUS_04670 81700 80414 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707841.1 protein_id gnl|my_center|LOCUS_04670 83016 81781 gene locus_tag LOCUS_04680 83016 81781 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_04680 84521 83022 gene locus_tag LOCUS_04690 84521 83022 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548106.1 protein_id gnl|my_center|LOCUS_04690 85318 84503 gene locus_tag LOCUS_04700 85318 84503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 85560 85315 gene locus_tag LOCUS_04710 85560 85315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 86925 85573 gene locus_tag LOCUS_04720 86925 85573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 87650 86958 gene locus_tag LOCUS_04730 87650 86958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 88882 88130 gene locus_tag LOCUS_04740 gene istB 88882 88130 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122401609.1 protein_id gnl|my_center|LOCUS_04740 90465 88879 gene locus_tag LOCUS_04750 gene istA 90465 88879 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_04750 90960 91982 gene locus_tag LOCUS_04760 gene pseB 90960 91982 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639918.1 protein_id gnl|my_center|LOCUS_04760 91987 93138 gene locus_tag LOCUS_04770 gene pseC 91987 93138 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_04770 93128 95968 gene locus_tag LOCUS_04780 93128 95968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 97980 95980 gene locus_tag LOCUS_04790 97980 95980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 99314 98616 gene locus_tag LOCUS_04800 99314 98616 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_04800 100791 99712 gene locus_tag LOCUS_04810 gene pseI 100791 99712 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_04810 101480 100788 gene locus_tag LOCUS_04820 101480 100788 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975612.1 protein_id gnl|my_center|LOCUS_04820 102165 101482 gene locus_tag LOCUS_04830 102165 101482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 103353 102196 gene locus_tag LOCUS_04840 gene pseG 103353 102196 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_04840 104144 103353 gene locus_tag LOCUS_04850 104144 103353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 104244 105743 gene locus_tag LOCUS_04860 104244 105743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 105758 106231 gene locus_tag LOCUS_04870 105758 106231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 106274 107617 gene locus_tag LOCUS_04880 106274 107617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 107805 107614 gene locus_tag LOCUS_04890 107805 107614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 107838 108722 gene locus_tag LOCUS_04900 107838 108722 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_04900 108743 109069 gene locus_tag LOCUS_04910 108743 109069 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 protein_id gnl|my_center|LOCUS_04910 109042 110148 gene locus_tag LOCUS_04920 109042 110148 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_04920 111845 110586 gene locus_tag LOCUS_04930 111845 110586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 113447 112026 gene locus_tag LOCUS_04940 113447 112026 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143676.1 protein_id gnl|my_center|LOCUS_04940 114813 113449 gene locus_tag LOCUS_04950 114813 113449 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_04950 115492 114818 gene locus_tag LOCUS_04960 115492 114818 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_04960 116215 115502 gene locus_tag LOCUS_04970 116215 115502 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918095.1 protein_id gnl|my_center|LOCUS_04970 116904 116227 gene locus_tag LOCUS_04980 116904 116227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 116974 117609 gene locus_tag LOCUS_04990 116974 117609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 117620 118786 gene locus_tag LOCUS_05000 117620 118786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 119793 118783 gene locus_tag LOCUS_05010 119793 118783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 120930 119800 gene locus_tag LOCUS_05020 120930 119800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 121002 122225 gene locus_tag LOCUS_05030 121002 122225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 protein_id gnl|my_center|LOCUS_05030 122227 123456 gene locus_tag LOCUS_05040 122227 123456 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257396.1 protein_id gnl|my_center|LOCUS_05040 124834 123404 gene locus_tag LOCUS_05050 124834 123404 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_05050 124727 125140 gene locus_tag LOCUS_05060 124727 125140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 125492 125133 gene locus_tag LOCUS_05070 125492 125133 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 protein_id gnl|my_center|LOCUS_05070 126430 125516 gene locus_tag LOCUS_05080 126430 125516 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_05080 126553 126786 gene locus_tag LOCUS_05090 126553 126786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 128053 126743 gene locus_tag LOCUS_05100 128053 126743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 128537 128055 gene locus_tag LOCUS_05110 gene rnhA 128537 128055 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942713.1 protein_id gnl|my_center|LOCUS_05110 129273 128524 gene locus_tag LOCUS_05120 129273 128524 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527996.1 protein_id gnl|my_center|LOCUS_05120 131275 129275 gene locus_tag LOCUS_05130 131275 129275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 131888 131343 gene locus_tag LOCUS_05140 131888 131343 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_05140 132039 132641 gene locus_tag LOCUS_05150 132039 132641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 132994 132614 gene locus_tag LOCUS_05160 132994 132614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 133437 132991 gene locus_tag LOCUS_05170 133437 132991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 134034 133438 gene locus_tag LOCUS_05180 134034 133438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 134721 134098 gene locus_tag LOCUS_05190 134721 134098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 136172 134736 gene locus_tag LOCUS_05200 136172 134736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 137191 136169 gene locus_tag LOCUS_05210 137191 136169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 137679 137188 gene locus_tag LOCUS_05220 137679 137188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 138303 137680 gene locus_tag LOCUS_05230 138303 137680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 138453 139640 gene locus_tag LOCUS_05240 138453 139640 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_05240 139728 140600 gene locus_tag LOCUS_05250 139728 140600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 140617 141093 gene locus_tag LOCUS_05260 140617 141093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 141105 141683 gene locus_tag LOCUS_05270 141105 141683 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_05270 141939 142029 gene locus_tag LOCUS_t00090 141939 142029 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 142493 143098 gene locus_tag LOCUS_05280 142493 143098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 143174 145144 gene locus_tag LOCUS_05290 143174 145144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 145250 145178 gene locus_tag LOCUS_t00100 145250 145178 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 146074 145262 gene locus_tag LOCUS_05300 146074 145262 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181838.1 protein_id gnl|my_center|LOCUS_05300 147360 146071 gene locus_tag LOCUS_05310 147360 146071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 147404 148441 gene locus_tag LOCUS_05320 147404 148441 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_05320 148451 149854 gene locus_tag LOCUS_05330 148451 149854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 149878 151134 gene locus_tag LOCUS_05340 149878 151134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 151155 152144 gene locus_tag LOCUS_05350 151155 152144 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_05350 152526 152155 gene locus_tag LOCUS_05360 152526 152155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 153193 152582 gene locus_tag LOCUS_05370 153193 152582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 153345 153647 gene locus_tag LOCUS_05380 153345 153647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 153917 155203 gene locus_tag LOCUS_05390 153917 155203 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_05390 155604 155347 gene locus_tag LOCUS_05400 155604 155347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 156435 155713 gene locus_tag LOCUS_05410 156435 155713 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143590.1 protein_id gnl|my_center|LOCUS_05410 156615 160013 gene locus_tag LOCUS_05420 gene rpoB 156615 160013 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243626.1 protein_id gnl|my_center|LOCUS_05420 160139 161275 gene locus_tag LOCUS_05430 160139 161275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 162640 161465 gene locus_tag LOCUS_05440 162640 161465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 163173 162637 gene locus_tag LOCUS_05450 163173 162637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 165243 163252 gene locus_tag LOCUS_05460 165243 163252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 165884 165249 gene locus_tag LOCUS_05470 165884 165249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 166929 166003 gene locus_tag LOCUS_05480 166929 166003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 166868 167152 gene locus_tag LOCUS_05490 166868 167152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 168495 167149 gene locus_tag LOCUS_05500 168495 167149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 168933 168496 gene locus_tag LOCUS_05510 168933 168496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 168866 169270 gene locus_tag LOCUS_05520 168866 169270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 171714 169318 gene locus_tag LOCUS_05530 171714 169318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 172084 177750 gene locus_tag LOCUS_05540 172084 177750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 177895 178293 gene locus_tag LOCUS_05550 gene rpsL 177895 178293 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_05550 178329 178799 gene locus_tag LOCUS_05560 gene rpsG 178329 178799 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869932.1 protein_id gnl|my_center|LOCUS_05560 178818 180902 gene locus_tag LOCUS_05570 gene fusA 178818 180902 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05570 181068 181373 gene locus_tag LOCUS_05580 gene rpsJ 181068 181373 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_05580 181594 182229 gene locus_tag LOCUS_05590 gene rplC 181594 182229 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140089.1 protein_id gnl|my_center|LOCUS_05590 182235 182852 gene locus_tag LOCUS_05600 gene rplD 182235 182852 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_05600 182849 183148 gene locus_tag LOCUS_05610 gene rplW 182849 183148 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_05610 183163 183990 gene locus_tag LOCUS_05620 gene rplB 183163 183990 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_05620 183994 184266 gene locus_tag LOCUS_05630 gene rpsS 183994 184266 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_05630 184270 184698 gene locus_tag LOCUS_05640 184270 184698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 184703 185374 gene locus_tag LOCUS_05650 gene rpsC 184703 185374 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_05650 185361 185801 gene locus_tag LOCUS_05660 gene rplP 185361 185801 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143908.1 protein_id gnl|my_center|LOCUS_05660 185794 186024 gene locus_tag LOCUS_05670 185794 186024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 186056 186301 gene locus_tag LOCUS_05680 gene rpsQ 186056 186301 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_05680 186298 186666 gene locus_tag LOCUS_05690 gene rplN 186298 186666 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143905.1 protein_id gnl|my_center|LOCUS_05690 186727 187074 gene locus_tag LOCUS_05700 gene rplX 186727 187074 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_05700 187079 187660 gene locus_tag LOCUS_05710 gene rplE 187079 187660 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_05710 187653 187838 gene locus_tag LOCUS_05720 187653 187838 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_05720 187854 188261 gene locus_tag LOCUS_05730 gene rpsH 187854 188261 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_05730 188275 188838 gene locus_tag LOCUS_05740 gene rplF 188275 188838 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_05740 188848 189216 gene locus_tag LOCUS_05750 gene rplR 188848 189216 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_05750 189222 189785 gene locus_tag LOCUS_05760 gene rpsE 189222 189785 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174069.1 protein_id gnl|my_center|LOCUS_05760 189782 189973 gene locus_tag LOCUS_05770 gene rpmD 189782 189973 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_05770 189970 190506 gene locus_tag LOCUS_05780 gene rplO 189970 190506 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766081.1 protein_id gnl|my_center|LOCUS_05780 190588 191994 gene locus_tag LOCUS_05790 gene secY 190588 191994 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_05790 192011 192670 gene locus_tag LOCUS_05800 192011 192670 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393916.1 protein_id gnl|my_center|LOCUS_05800 192667 193488 gene locus_tag LOCUS_05810 gene map 192667 193488 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_05810 193485 193739 gene locus_tag LOCUS_05820 gene infA 193485 193739 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_05820 193872 194240 gene locus_tag LOCUS_05830 gene rpsM 193872 194240 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_05830 194350 194739 gene locus_tag LOCUS_05840 gene rpsK 194350 194739 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_05840 194754 195386 gene locus_tag LOCUS_05850 gene rpsD 194754 195386 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_05850 195410 196387 gene locus_tag LOCUS_05860 195410 196387 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_05860 196390 196743 gene locus_tag LOCUS_05870 gene rplQ 196390 196743 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_05870 196740 197558 gene locus_tag LOCUS_05880 gene truA 196740 197558 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143558.1 protein_id gnl|my_center|LOCUS_05880 197609 198094 gene locus_tag LOCUS_05890 gene rplM 197609 198094 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_05890 198099 198515 gene locus_tag LOCUS_05900 gene rpsI 198099 198515 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829714.1 protein_id gnl|my_center|LOCUS_05900 198629 199798 gene locus_tag LOCUS_05910 198629 199798 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_05910 199838 201415 gene locus_tag LOCUS_05920 gene serA 199838 201415 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391569.1 protein_id gnl|my_center|LOCUS_05920 202453 201410 gene locus_tag LOCUS_05930 202453 201410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 202496 202963 gene locus_tag LOCUS_05940 202496 202963 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_05940 202963 203889 gene locus_tag LOCUS_05950 202963 203889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 203972 205183 gene locus_tag LOCUS_05960 203972 205183 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence04 873 235 gene locus_tag LOCUS_05970 873 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 872 1540 gene locus_tag LOCUS_05980 872 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 1592 2020 gene locus_tag LOCUS_05990 1592 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2093 3586 gene locus_tag LOCUS_06000 2093 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3797 3591 gene locus_tag LOCUS_06010 3797 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4383 5303 gene locus_tag LOCUS_06020 gene rsmH 4383 5303 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_06020 5408 5689 gene locus_tag LOCUS_06030 5408 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5683 7395 gene locus_tag LOCUS_06040 5683 7395 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_06040 7392 8885 gene locus_tag LOCUS_06050 7392 8885 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_06050 8882 10264 gene locus_tag LOCUS_06060 8882 10264 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057393.1 protein_id gnl|my_center|LOCUS_06060 10261 11253 gene locus_tag LOCUS_06070 gene mraY 10261 11253 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_06070 11263 12606 gene locus_tag LOCUS_06080 gene murD 11263 12606 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_06080 12591 13727 gene locus_tag LOCUS_06090 gene ftsW 12591 13727 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_06090 13724 14863 gene locus_tag LOCUS_06100 gene murG 13724 14863 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_06100 14996 16513 gene locus_tag LOCUS_06110 gene murC 14996 16513 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_06110 16520 17398 gene locus_tag LOCUS_06120 gene murB 16520 17398 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_06120 18132 17494 gene locus_tag LOCUS_06130 18132 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 18074 18775 gene locus_tag LOCUS_06140 18074 18775 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_06140 18772 19122 gene locus_tag LOCUS_06150 18772 19122 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_06150 19156 20268 gene locus_tag LOCUS_06160 gene ftsZ 19156 20268 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_06160 20304 22982 gene locus_tag LOCUS_06170 gene ileS 20304 22982 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_06170 23168 23836 gene locus_tag LOCUS_06180 23168 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 23853 24869 gene locus_tag LOCUS_06190 23853 24869 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388517.1 protein_id gnl|my_center|LOCUS_06190 24932 25627 gene locus_tag LOCUS_06200 24932 25627 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_06200 25692 25850 gene locus_tag LOCUS_06210 25692 25850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 25847 27844 gene locus_tag LOCUS_06220 25847 27844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 27841 28233 gene locus_tag LOCUS_06230 27841 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 29603 28230 gene locus_tag LOCUS_06240 29603 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 30093 29632 gene locus_tag LOCUS_06250 30093 29632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 30817 30158 gene locus_tag LOCUS_06260 gene fsa 30817 30158 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_06260 31482 30886 gene locus_tag LOCUS_06270 31482 30886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 31650 32897 gene locus_tag LOCUS_06280 31650 32897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 32897 33502 gene locus_tag LOCUS_06290 32897 33502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 33512 34396 gene locus_tag LOCUS_06300 gene lgt 33512 34396 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171692.1 protein_id gnl|my_center|LOCUS_06300 34393 34707 gene locus_tag LOCUS_06310 34393 34707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 34728 36158 gene locus_tag LOCUS_06320 34728 36158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 37421 36171 gene locus_tag LOCUS_06330 37421 36171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 37511 38998 gene locus_tag LOCUS_06340 37511 38998 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_06340 39095 40378 gene locus_tag LOCUS_06350 39095 40378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 41330 40386 gene locus_tag LOCUS_06360 gene trxB 41330 40386 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_06360 42236 41376 gene locus_tag LOCUS_06370 42236 41376 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_06370 43403 42351 gene locus_tag LOCUS_06380 gene rpoD 43403 42351 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360364.1 protein_id gnl|my_center|LOCUS_06380 43641 44486 gene locus_tag LOCUS_06390 43641 44486 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259482.1 protein_id gnl|my_center|LOCUS_06390 44605 45918 gene locus_tag LOCUS_06400 44605 45918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 45953 47308 gene locus_tag LOCUS_06410 45953 47308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 49203 47293 gene locus_tag LOCUS_06420 49203 47293 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_06420 50128 49217 gene locus_tag LOCUS_06430 gene prmC 50128 49217 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_06430 51261 50152 gene locus_tag LOCUS_06440 gene prfA 51261 50152 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583170.1 protein_id gnl|my_center|LOCUS_06440 51335 51407 gene locus_tag LOCUS_t00110 51335 51407 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53359 51449 gene locus_tag LOCUS_06450 53359 51449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 53541 54554 gene locus_tag LOCUS_06460 53541 54554 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771244.1 protein_id gnl|my_center|LOCUS_06460 54879 56609 gene locus_tag LOCUS_06470 54879 56609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 56609 57919 gene locus_tag LOCUS_06480 56609 57919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 58006 59328 gene locus_tag LOCUS_06490 58006 59328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 59473 60606 gene locus_tag LOCUS_06500 59473 60606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 60619 62211 gene locus_tag LOCUS_06510 60619 62211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 62260 64008 gene locus_tag LOCUS_06520 62260 64008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 64566 64030 gene locus_tag LOCUS_06530 64566 64030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 65044 64577 gene locus_tag LOCUS_06540 gene bcp 65044 64577 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880283.1 protein_id gnl|my_center|LOCUS_06540 67008 65095 gene locus_tag LOCUS_06550 67008 65095 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_06550 67205 66993 gene locus_tag LOCUS_06560 67205 66993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 67339 67878 gene locus_tag LOCUS_06570 67339 67878 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084585.1 protein_id gnl|my_center|LOCUS_06570 68202 67894 gene locus_tag LOCUS_06580 68202 67894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 69477 68209 gene locus_tag LOCUS_06590 69477 68209 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 protein_id gnl|my_center|LOCUS_06590 70748 69474 gene locus_tag LOCUS_06600 70748 69474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 71349 70750 gene locus_tag LOCUS_06610 71349 70750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 72346 71354 gene locus_tag LOCUS_06620 72346 71354 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401457.1 protein_id gnl|my_center|LOCUS_06620 73413 72352 gene locus_tag LOCUS_06630 73413 72352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 73559 75301 gene locus_tag LOCUS_06640 73559 75301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 75382 76770 gene locus_tag LOCUS_06650 75382 76770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 76767 78083 gene locus_tag LOCUS_06660 76767 78083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 79613 78096 gene locus_tag LOCUS_06670 79613 78096 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393356.1 protein_id gnl|my_center|LOCUS_06670 79711 79911 gene locus_tag LOCUS_06680 79711 79911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 80201 79896 gene locus_tag LOCUS_06690 80201 79896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 80513 80229 gene locus_tag LOCUS_06700 80513 80229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 80726 83815 gene locus_tag LOCUS_06710 80726 83815 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_06710 83812 85425 gene locus_tag LOCUS_06720 83812 85425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 85422 86912 gene locus_tag LOCUS_06730 85422 86912 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_06730 86909 87361 gene locus_tag LOCUS_06740 86909 87361 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089407.1 protein_id gnl|my_center|LOCUS_06740 87358 88197 gene locus_tag LOCUS_06750 87358 88197 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_06750 88194 88976 gene locus_tag LOCUS_06760 88194 88976 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 protein_id gnl|my_center|LOCUS_06760 88983 89510 gene locus_tag LOCUS_06770 88983 89510 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_06770 89507 90505 gene locus_tag LOCUS_06780 89507 90505 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_06780 90502 91281 gene locus_tag LOCUS_06790 90502 91281 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_06790 91295 92515 gene locus_tag LOCUS_06800 gene kynU 91295 92515 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_06800 92512 93843 gene locus_tag LOCUS_06810 92512 93843 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_06810 94206 93964 gene locus_tag LOCUS_06820 gene rpsR 94206 93964 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918874.1 protein_id gnl|my_center|LOCUS_06820 94367 94206 gene locus_tag LOCUS_06830 gene rpmG 94367 94206 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256375.1 protein_id gnl|my_center|LOCUS_06830 94535 94777 gene locus_tag LOCUS_06840 gene rpmB 94535 94777 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_06840 95524 96192 gene locus_tag LOCUS_06850 95524 96192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 96189 96863 gene locus_tag LOCUS_06860 96189 96863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_06860 96860 99358 gene locus_tag LOCUS_06870 96860 99358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974690.1 protein_id gnl|my_center|LOCUS_06870 99355 100404 gene locus_tag LOCUS_06880 99355 100404 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_06880 100482 101216 gene locus_tag LOCUS_06890 100482 101216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 102908 101229 gene locus_tag LOCUS_06900 102908 101229 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_06900 103807 102905 gene locus_tag LOCUS_06910 gene dapA 103807 102905 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_06910 103954 105678 gene locus_tag LOCUS_06920 103954 105678 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479713.1 protein_id gnl|my_center|LOCUS_06920 105703 107001 gene locus_tag LOCUS_06930 105703 107001 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_06930 107990 106935 gene locus_tag LOCUS_06940 107990 106935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 109936 108074 gene locus_tag LOCUS_06950 109936 108074 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_06950 111009 109936 gene locus_tag LOCUS_06960 111009 109936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 112818 111019 gene locus_tag LOCUS_06970 112818 111019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 112997 113632 gene locus_tag LOCUS_06980 112997 113632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_06980 113640 113724 gene locus_tag LOCUS_t00120 113640 113724 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 114383 113775 gene locus_tag LOCUS_06990 114383 113775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 114506 114685 gene locus_tag LOCUS_07000 114506 114685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 115211 114693 gene locus_tag LOCUS_07010 115211 114693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 116694 115354 gene locus_tag LOCUS_07020 116694 115354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07020 117786 116848 gene locus_tag LOCUS_07030 117786 116848 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141225.1 protein_id gnl|my_center|LOCUS_07030 119001 117904 gene locus_tag LOCUS_07040 gene ruvB 119001 117904 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143112.1 protein_id gnl|my_center|LOCUS_07040 119060 119692 gene locus_tag LOCUS_07050 119060 119692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_07050 120282 119689 gene locus_tag LOCUS_07060 gene ruvA 120282 119689 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907746.1 protein_id gnl|my_center|LOCUS_07060 120788 120279 gene locus_tag LOCUS_07070 gene ruvC 120788 120279 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_07070 121110 123491 gene locus_tag LOCUS_07080 121110 123491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 123620 124423 gene locus_tag LOCUS_07090 123620 124423 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_07090 125425 124424 gene locus_tag LOCUS_07100 125425 124424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 126674 125574 gene locus_tag LOCUS_07110 126674 125574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 127804 126692 gene locus_tag LOCUS_07120 127804 126692 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_07120 127855 129297 gene locus_tag LOCUS_07130 127855 129297 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357685.1 protein_id gnl|my_center|LOCUS_07130 129937 129329 gene locus_tag LOCUS_07140 129937 129329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 130641 129937 gene locus_tag LOCUS_07150 130641 129937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 131444 130638 gene locus_tag LOCUS_07160 gene folE2 131444 130638 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_07160 132191 131688 gene locus_tag LOCUS_07170 132191 131688 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_07170 132528 132235 gene locus_tag LOCUS_07180 132528 132235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 132627 133679 gene locus_tag LOCUS_07190 132627 133679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 134436 133672 gene locus_tag LOCUS_07200 134436 133672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 135349 134498 gene locus_tag LOCUS_07210 135349 134498 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_07210 137313 135346 gene locus_tag LOCUS_07220 137313 135346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 137410 138906 gene locus_tag LOCUS_07230 137410 138906 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_07230 138903 139874 gene locus_tag LOCUS_07240 138903 139874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 141260 139881 gene locus_tag LOCUS_07250 141260 139881 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_07250 142651 141257 gene locus_tag LOCUS_07260 142651 141257 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707048.1 protein_id gnl|my_center|LOCUS_07260 143057 142695 gene locus_tag LOCUS_07270 143057 142695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 143160 144488 gene locus_tag LOCUS_07280 143160 144488 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_07280 144485 145678 gene locus_tag LOCUS_07290 144485 145678 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_07290 145668 146027 gene locus_tag LOCUS_07300 145668 146027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 146038 148389 gene locus_tag LOCUS_07310 146038 148389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 148386 148856 gene locus_tag LOCUS_07320 gene ruvX 148386 148856 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_07320 148828 149169 gene locus_tag LOCUS_07330 148828 149169 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393141.1 protein_id gnl|my_center|LOCUS_07330 149255 150364 gene locus_tag LOCUS_07340 149255 150364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 150368 150841 gene locus_tag LOCUS_07350 150368 150841 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839906.1 protein_id gnl|my_center|LOCUS_07350 151295 151222 gene locus_tag LOCUS_t00130 151295 151222 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 151972 151340 gene locus_tag LOCUS_07360 151972 151340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 152098 152445 gene locus_tag LOCUS_07370 152098 152445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 152442 153338 gene locus_tag LOCUS_07380 152442 153338 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787777.1 protein_id gnl|my_center|LOCUS_07380 153342 154574 gene locus_tag LOCUS_07390 153342 154574 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551577.1 protein_id gnl|my_center|LOCUS_07390 155306 154602 gene locus_tag LOCUS_07400 155306 154602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 155428 155355 gene locus_tag LOCUS_t00140 155428 155355 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 155536 156054 gene locus_tag LOCUS_07410 155536 156054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 156813 156055 gene locus_tag LOCUS_07420 156813 156055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 157515 156886 gene locus_tag LOCUS_07430 157515 156886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence05 3080 1227 gene locus_tag LOCUS_07440 3080 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3140 5563 gene locus_tag LOCUS_07450 gene leuS 3140 5563 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_07450 6500 5577 gene locus_tag LOCUS_07460 6500 5577 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_07460 6861 6505 gene locus_tag LOCUS_07470 gene rsfS 6861 6505 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816526.1 protein_id gnl|my_center|LOCUS_07470 7527 6880 gene locus_tag LOCUS_07480 gene nadD 7527 6880 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080561922.1 protein_id gnl|my_center|LOCUS_07480 8810 7524 gene locus_tag LOCUS_07490 8810 7524 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081656456.1 protein_id gnl|my_center|LOCUS_07490 9922 8807 gene locus_tag LOCUS_07500 gene proB 9922 8807 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_07500 10961 9933 gene locus_tag LOCUS_07510 gene obgE 10961 9933 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_07510 10848 11291 gene locus_tag LOCUS_07520 10848 11291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11758 11204 gene locus_tag LOCUS_07530 gene lspA 11758 11204 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_07530 11873 12640 gene locus_tag LOCUS_07540 11873 12640 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_07540 12637 14028 gene locus_tag LOCUS_07550 12637 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 14705 13983 gene locus_tag LOCUS_07560 14705 13983 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_07560 16654 14708 gene locus_tag LOCUS_07570 16654 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 17955 16651 gene locus_tag LOCUS_07580 17955 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 18640 17975 gene locus_tag LOCUS_07590 18640 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 19817 18651 gene locus_tag LOCUS_07600 19817 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 20052 20213 gene locus_tag LOCUS_07610 20052 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 20284 20892 gene locus_tag LOCUS_07620 20284 20892 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_07620 20898 21791 gene locus_tag LOCUS_07630 20898 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 21788 22660 gene locus_tag LOCUS_07640 21788 22660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 22644 23300 gene locus_tag LOCUS_07650 22644 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 23300 23650 gene locus_tag LOCUS_07660 23300 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 23654 24703 gene locus_tag LOCUS_07670 23654 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 24741 25766 gene locus_tag LOCUS_07680 24741 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 25763 27862 gene locus_tag LOCUS_07690 25763 27862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 27862 28728 gene locus_tag LOCUS_07700 27862 28728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 28728 29645 gene locus_tag LOCUS_07710 28728 29645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 29647 29988 gene locus_tag LOCUS_07720 29647 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 29976 31541 gene locus_tag LOCUS_07730 29976 31541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 31559 32329 gene locus_tag LOCUS_07740 31559 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 32423 32938 gene locus_tag LOCUS_07750 32423 32938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 34247 32952 gene locus_tag LOCUS_07760 34247 32952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 35167 34238 gene locus_tag LOCUS_07770 35167 34238 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_07770 36231 35206 gene locus_tag LOCUS_07780 36231 35206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 38780 36228 gene locus_tag LOCUS_07790 38780 36228 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_07790 40001 38808 gene locus_tag LOCUS_07800 40001 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 42092 40068 gene locus_tag LOCUS_07810 42092 40068 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_07810 42081 43667 gene locus_tag LOCUS_07820 42081 43667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 43664 44620 gene locus_tag LOCUS_07830 43664 44620 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_07830 45842 44628 gene locus_tag LOCUS_07840 45842 44628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 47053 45959 gene locus_tag LOCUS_07850 47053 45959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 47928 47131 gene locus_tag LOCUS_07860 47928 47131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 48497 47946 gene locus_tag LOCUS_07870 gene def 48497 47946 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_07870 48822 48580 gene locus_tag LOCUS_07880 48822 48580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 48995 48834 gene locus_tag LOCUS_07890 48995 48834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 49275 49096 gene locus_tag LOCUS_07900 49275 49096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 49851 49279 gene locus_tag LOCUS_07910 49851 49279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 50951 49851 gene locus_tag LOCUS_07920 50951 49851 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_07920 51548 50964 gene locus_tag LOCUS_07930 51548 50964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 52908 51610 gene locus_tag LOCUS_07940 gene serS 52908 51610 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869753.1 protein_id gnl|my_center|LOCUS_07940 53572 52928 gene locus_tag LOCUS_07950 53572 52928 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329137.1 protein_id gnl|my_center|LOCUS_07950 53626 54279 gene locus_tag LOCUS_07960 53626 54279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 55054 54332 gene locus_tag LOCUS_07970 55054 54332 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_07970 56142 55396 gene locus_tag LOCUS_07980 56142 55396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 56824 56126 gene locus_tag LOCUS_07990 56824 56126 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_07990 57318 57485 gene locus_tag LOCUS_08000 57318 57485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 57516 58061 gene locus_tag LOCUS_08010 57516 58061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08010 58086 60032 gene locus_tag LOCUS_08020 58086 60032 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928558.1 protein_id gnl|my_center|LOCUS_08020 61009 60029 gene locus_tag LOCUS_08030 61009 60029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 61551 61006 gene locus_tag LOCUS_08040 61551 61006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 62983 61586 gene locus_tag LOCUS_08050 62983 61586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 63630 62980 gene locus_tag LOCUS_08060 63630 62980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 64261 63614 gene locus_tag LOCUS_08070 64261 63614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 64939 64265 gene locus_tag LOCUS_08080 64939 64265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 66060 64936 gene locus_tag LOCUS_08090 gene pilM 66060 64936 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_08090 67012 66062 gene locus_tag LOCUS_08100 67012 66062 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490359.1 protein_id gnl|my_center|LOCUS_08100 67729 67040 gene locus_tag LOCUS_08110 67729 67040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 68510 67746 gene locus_tag LOCUS_08120 68510 67746 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_08120 69274 68516 gene locus_tag LOCUS_08130 69274 68516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 69838 69347 gene locus_tag LOCUS_08140 69838 69347 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583243.1 protein_id gnl|my_center|LOCUS_08140 70060 71220 gene locus_tag LOCUS_08150 70060 71220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 71217 71447 gene locus_tag LOCUS_08160 71217 71447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 71444 72175 gene locus_tag LOCUS_08170 gene flgG 71444 72175 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405355.1 protein_id gnl|my_center|LOCUS_08170 72203 72982 gene locus_tag LOCUS_08180 gene flgG 72203 72982 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_08180 73027 73734 gene locus_tag LOCUS_08190 gene flgA 73027 73734 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037118.1 protein_id gnl|my_center|LOCUS_08190 73731 74360 gene locus_tag LOCUS_08200 73731 74360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 74373 75500 gene locus_tag LOCUS_08210 74373 75500 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869891.1 protein_id gnl|my_center|LOCUS_08210 75500 75943 gene locus_tag LOCUS_08220 75500 75943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 75940 76662 gene locus_tag LOCUS_08230 gene whiG 75940 76662 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_08230 76677 77078 gene locus_tag LOCUS_08240 76677 77078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 77211 77609 gene locus_tag LOCUS_08250 gene flgC 77211 77609 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081561.1 protein_id gnl|my_center|LOCUS_08250 77613 77990 gene locus_tag LOCUS_08260 77613 77990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 77998 79932 gene locus_tag LOCUS_08270 77998 79932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 79947 82052 gene locus_tag LOCUS_08280 gene flhA 79947 82052 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_08280 83817 82177 gene locus_tag LOCUS_08290 83817 82177 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461634.1 protein_id gnl|my_center|LOCUS_08290 84041 86662 gene locus_tag LOCUS_08300 gene clpB 84041 86662 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_08300 87110 86667 gene locus_tag LOCUS_08310 gene aroQ 87110 86667 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887424.1 protein_id gnl|my_center|LOCUS_08310 88303 87107 gene locus_tag LOCUS_08320 gene aroC 88303 87107 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805102.1 protein_id gnl|my_center|LOCUS_08320 88372 88836 gene locus_tag LOCUS_08330 88372 88836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 88893 89954 gene locus_tag LOCUS_08340 88893 89954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 89954 91144 gene locus_tag LOCUS_08350 89954 91144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 91398 91135 gene locus_tag LOCUS_08360 91398 91135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 91426 92430 gene locus_tag LOCUS_08370 91426 92430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 93344 92427 gene locus_tag LOCUS_08380 93344 92427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 93448 95277 gene locus_tag LOCUS_08390 93448 95277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 95336 96637 gene locus_tag LOCUS_08400 95336 96637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 96705 98372 gene locus_tag LOCUS_08410 96705 98372 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836509.1 protein_id gnl|my_center|LOCUS_08410 98347 99564 gene locus_tag LOCUS_08420 98347 99564 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_08420 100169 99525 gene locus_tag LOCUS_08430 100169 99525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 100336 100263 gene locus_tag LOCUS_t00150 100336 100263 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 100413 100338 gene locus_tag LOCUS_t00160 100413 100338 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 100518 100443 gene locus_tag LOCUS_t00170 100518 100443 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 101773 100748 gene locus_tag LOCUS_08440 101773 100748 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706496.1 protein_id gnl|my_center|LOCUS_08440 102555 101770 gene locus_tag LOCUS_08450 gene dapB 102555 101770 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936082.1 protein_id gnl|my_center|LOCUS_08450 103004 102552 gene locus_tag LOCUS_08460 103004 102552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 104248 103001 gene locus_tag LOCUS_08470 104248 103001 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_08470 106382 104253 gene locus_tag LOCUS_08480 gene pnp 106382 104253 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143141.1 protein_id gnl|my_center|LOCUS_08480 106752 106483 gene locus_tag LOCUS_08490 gene rpsO 106752 106483 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632621.1 protein_id gnl|my_center|LOCUS_08490 107528 106845 gene locus_tag LOCUS_08500 gene udk 107528 106845 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_08500 108079 107534 gene locus_tag LOCUS_08510 gene def 108079 107534 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142225.1 protein_id gnl|my_center|LOCUS_08510 108194 109054 gene locus_tag LOCUS_08520 108194 109054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 109098 110726 gene locus_tag LOCUS_08530 109098 110726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 111831 110710 gene locus_tag LOCUS_08540 111831 110710 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_08540 111900 113321 gene locus_tag LOCUS_08550 111900 113321 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_08550 113308 113808 gene locus_tag LOCUS_08560 113308 113808 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366433.1 protein_id gnl|my_center|LOCUS_08560 114297 113815 gene locus_tag LOCUS_08570 114297 113815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 114514 115110 gene locus_tag LOCUS_08580 114514 115110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 116230 115118 gene locus_tag LOCUS_08590 116230 115118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 118287 116227 gene locus_tag LOCUS_08600 gene uvrB 118287 116227 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141853.1 protein_id gnl|my_center|LOCUS_08600 118500 118297 gene locus_tag LOCUS_08610 118500 118297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 120251 118611 gene locus_tag LOCUS_08620 gene groL 120251 118611 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_08620 120597 120295 gene locus_tag LOCUS_08630 gene groES 120597 120295 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_08630 121345 120731 gene locus_tag LOCUS_08640 gene lexA 121345 120731 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_08640 121458 121850 gene locus_tag LOCUS_08650 121458 121850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 121955 123106 gene locus_tag LOCUS_08660 121955 123106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 123189 124055 gene locus_tag LOCUS_08670 123189 124055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 124350 124102 gene locus_tag LOCUS_08680 124350 124102 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232017.1 protein_id gnl|my_center|LOCUS_08680 124648 124361 gene locus_tag LOCUS_08690 gene rpsP 124648 124361 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392482.1 protein_id gnl|my_center|LOCUS_08690 126068 124683 gene locus_tag LOCUS_08700 gene ffh 126068 124683 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_08700 127048 126125 gene locus_tag LOCUS_08710 127048 126125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 127119 127913 gene locus_tag LOCUS_08720 127119 127913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 127910 130147 gene locus_tag LOCUS_08730 127910 130147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 130158 131105 gene locus_tag LOCUS_08740 130158 131105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 132372 131086 gene locus_tag LOCUS_08750 132372 131086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 132764 132369 gene locus_tag LOCUS_08760 132764 132369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 133534 132764 gene locus_tag LOCUS_08770 133534 132764 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_08770 134462 133536 gene locus_tag LOCUS_08780 134462 133536 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_08780 135509 134469 gene locus_tag LOCUS_08790 135509 134469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 135813 135502 gene locus_tag LOCUS_08800 135813 135502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 137239 135806 gene locus_tag LOCUS_08810 137239 135806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 137361 138131 gene locus_tag LOCUS_08820 137361 138131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_08820 138131 138901 gene locus_tag LOCUS_08830 138131 138901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 139011 140270 gene locus_tag LOCUS_08840 139011 140270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 140341 141183 gene locus_tag LOCUS_08850 140341 141183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 141189 142250 gene locus_tag LOCUS_08860 141189 142250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 142339 142803 gene locus_tag LOCUS_08870 142339 142803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 143017 143145 gene locus_tag LOCUS_08880 143017 143145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08880 143158 143283 gene locus_tag LOCUS_08890 143158 143283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence06 2071 167 gene locus_tag LOCUS_08900 2071 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2126 3289 gene locus_tag LOCUS_08910 gene hppD 2126 3289 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_08910 5939 3351 gene locus_tag LOCUS_08920 gene alaS 5939 3351 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142344.1 protein_id gnl|my_center|LOCUS_08920 6037 6417 gene locus_tag LOCUS_08930 6037 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 7139 6429 gene locus_tag LOCUS_08940 7139 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 9229 7220 gene locus_tag LOCUS_08950 9229 7220 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877796.1 protein_id gnl|my_center|LOCUS_08950 9358 10098 gene locus_tag LOCUS_08960 gene rph 9358 10098 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_08960 10095 12785 gene locus_tag LOCUS_08970 10095 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 12905 13294 gene locus_tag LOCUS_08980 12905 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13291 13797 gene locus_tag LOCUS_08990 13291 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 14107 13712 gene locus_tag LOCUS_09000 14107 13712 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_09000 14586 14104 gene locus_tag LOCUS_09010 gene ybeY 14586 14104 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288749.1 protein_id gnl|my_center|LOCUS_09010 16054 14564 gene locus_tag LOCUS_09020 16054 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 16318 16145 gene locus_tag LOCUS_09030 gene rpsU 16318 16145 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055893.1 protein_id gnl|my_center|LOCUS_09030 16732 16400 gene locus_tag LOCUS_09040 16732 16400 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_09040 16948 16745 gene locus_tag LOCUS_09050 16948 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 17643 16945 gene locus_tag LOCUS_09060 17643 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 18217 17624 gene locus_tag LOCUS_09070 gene rpoE 18217 17624 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_09070 18319 18672 gene locus_tag LOCUS_09080 18319 18672 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256425.1 protein_id gnl|my_center|LOCUS_09080 18682 19281 gene locus_tag LOCUS_09090 gene recR 18682 19281 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_09090 19963 19271 gene locus_tag LOCUS_09100 19963 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 21485 19971 gene locus_tag LOCUS_09110 gene lysS 21485 19971 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_09110 22207 21557 gene locus_tag LOCUS_09120 22207 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 23254 22508 gene locus_tag LOCUS_09130 23254 22508 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_09130 23815 23300 gene locus_tag LOCUS_09140 23815 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 24345 23875 gene locus_tag LOCUS_09150 24345 23875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 24949 24458 gene locus_tag LOCUS_09160 24949 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 25336 25728 gene locus_tag LOCUS_09170 25336 25728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 26502 25792 gene locus_tag LOCUS_09180 26502 25792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 26682 26879 gene locus_tag LOCUS_09190 26682 26879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 27110 26901 gene locus_tag LOCUS_09200 27110 26901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 27004 28320 gene locus_tag LOCUS_09210 27004 28320 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931023.1 protein_id gnl|my_center|LOCUS_09210 28317 29963 gene locus_tag LOCUS_09220 28317 29963 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_09220 29963 30367 gene locus_tag LOCUS_09230 29963 30367 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_09230 30373 31251 gene locus_tag LOCUS_09240 gene era 30373 31251 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_09240 32189 31248 gene locus_tag LOCUS_09250 32189 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 34039 32213 gene locus_tag LOCUS_09260 gene recQ 34039 32213 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_09260 34414 34133 gene locus_tag LOCUS_09270 34414 34133 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257727.1 protein_id gnl|my_center|LOCUS_09270 35515 34568 gene locus_tag LOCUS_09280 35515 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 34965 34876 gene locus_tag LOCUS_t00180 34965 34876 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36319 35576 gene locus_tag LOCUS_09290 36319 35576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 37372 36419 gene locus_tag LOCUS_09300 37372 36419 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162498650.1 protein_id gnl|my_center|LOCUS_09300 39234 37420 gene locus_tag LOCUS_09310 gene htpG 39234 37420 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287997.1 protein_id gnl|my_center|LOCUS_09310 39286 39555 gene locus_tag LOCUS_09320 39286 39555 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391328.1 protein_id gnl|my_center|LOCUS_09320 39932 39552 gene locus_tag LOCUS_09330 39932 39552 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816377.1 protein_id gnl|my_center|LOCUS_09330 40203 39958 gene locus_tag LOCUS_09340 40203 39958 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144400.1 protein_id gnl|my_center|LOCUS_09340 40323 41498 gene locus_tag LOCUS_09350 40323 41498 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_09350 42575 41550 gene locus_tag LOCUS_09360 42575 41550 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_09360 44199 42565 gene locus_tag LOCUS_09370 44199 42565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 44400 44612 gene locus_tag LOCUS_09380 44400 44612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 44619 45470 gene locus_tag LOCUS_09390 44619 45470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 45474 46325 gene locus_tag LOCUS_09400 45474 46325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 46340 47251 gene locus_tag LOCUS_09410 46340 47251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 47248 47430 gene locus_tag LOCUS_09420 47248 47430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 47433 48410 gene locus_tag LOCUS_09430 gene galT 47433 48410 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_09430 49377 48385 gene locus_tag LOCUS_09440 gene galT 49377 48385 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_09440 49427 50050 gene locus_tag LOCUS_09450 49427 50050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 50047 51207 gene locus_tag LOCUS_09460 gene galK 50047 51207 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 protein_id gnl|my_center|LOCUS_09460 52113 51211 gene locus_tag LOCUS_09470 52113 51211 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_09470 53140 52169 gene locus_tag LOCUS_09480 53140 52169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523473.1 protein_id gnl|my_center|LOCUS_09480 54654 53137 gene locus_tag LOCUS_09490 54654 53137 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_09490 55742 54651 gene locus_tag LOCUS_09500 55742 54651 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142349.1 protein_id gnl|my_center|LOCUS_09500 55850 57460 gene locus_tag LOCUS_09510 55850 57460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 58073 57426 gene locus_tag LOCUS_09520 58073 57426 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974311.1 protein_id gnl|my_center|LOCUS_09520 58687 58079 gene locus_tag LOCUS_09530 58687 58079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 59581 58709 gene locus_tag LOCUS_09540 59581 58709 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 protein_id gnl|my_center|LOCUS_09540 60671 59583 gene locus_tag LOCUS_09550 gene mutY 60671 59583 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674242.1 protein_id gnl|my_center|LOCUS_09550 60733 61407 gene locus_tag LOCUS_09560 60733 61407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 61412 62686 gene locus_tag LOCUS_09570 61412 62686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 63350 62712 gene locus_tag LOCUS_09580 gene rpe 63350 62712 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_09580 64096 63347 gene locus_tag LOCUS_09590 gene rnc 64096 63347 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_09590 65345 64101 gene locus_tag LOCUS_09600 gene fabF 65345 64101 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_09600 65667 65407 gene locus_tag LOCUS_09610 gene acpP 65667 65407 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_09610 66425 65682 gene locus_tag LOCUS_09620 gene fabG 66425 65682 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_09620 67375 66422 gene locus_tag LOCUS_09630 gene fabD 67375 66422 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_09630 68373 67351 gene locus_tag LOCUS_09640 68373 67351 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_09640 69215 68373 gene locus_tag LOCUS_09650 69215 68373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 69162 69482 gene locus_tag LOCUS_09660 69162 69482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 69667 69443 gene locus_tag LOCUS_09670 gene rpmF 69667 69443 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869850.1 protein_id gnl|my_center|LOCUS_09670 70106 69612 gene locus_tag LOCUS_09680 70106 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 70659 70195 gene locus_tag LOCUS_09690 gene smpB 70659 70195 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_09690 70852 71871 gene locus_tag LOCUS_09700 70852 71871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 72352 71789 gene locus_tag LOCUS_09710 72352 71789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 72404 73246 gene locus_tag LOCUS_09720 72404 73246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 73298 73371 gene locus_tag LOCUS_t00190 73298 73371 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 73377 73449 gene locus_tag LOCUS_t00200 73377 73449 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 73484 73559 gene locus_tag LOCUS_t00210 73484 73559 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 73706 74107 gene locus_tag LOCUS_09730 73706 74107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 74176 75507 gene locus_tag LOCUS_09740 gene nhaD 74176 75507 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_09740 75733 77070 gene locus_tag LOCUS_09750 75733 77070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 77074 77667 gene locus_tag LOCUS_09760 77074 77667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 77664 78470 gene locus_tag LOCUS_09770 77664 78470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 78587 79510 gene locus_tag LOCUS_09780 78587 79510 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869103.1 protein_id gnl|my_center|LOCUS_09780 79507 80064 gene locus_tag LOCUS_09790 79507 80064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09790 80654 80325 gene locus_tag LOCUS_09800 80654 80325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 81000 82196 gene locus_tag LOCUS_09810 81000 82196 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790938.1 protein_id gnl|my_center|LOCUS_09810 82330 83367 gene locus_tag LOCUS_09820 82330 83367 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_09820 83436 84995 gene locus_tag LOCUS_09830 83436 84995 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_09830 86140 84992 gene locus_tag LOCUS_09840 86140 84992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 86316 87554 gene locus_tag LOCUS_09850 86316 87554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 88168 87632 gene locus_tag LOCUS_09860 88168 87632 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966411.1 protein_id gnl|my_center|LOCUS_09860 88211 89176 gene locus_tag LOCUS_09870 88211 89176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 90581 89181 gene locus_tag LOCUS_09880 gene hydA 90581 89181 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_09880 90795 92153 gene locus_tag LOCUS_09890 90795 92153 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563248.1 protein_id gnl|my_center|LOCUS_09890 92163 93458 gene locus_tag LOCUS_09900 gene preA 92163 93458 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895509.1 protein_id gnl|my_center|LOCUS_09900 93508 94377 gene locus_tag LOCUS_09910 93508 94377 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_09910 94384 95709 gene locus_tag LOCUS_09920 94384 95709 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_09920 95723 97240 gene locus_tag LOCUS_09930 95723 97240 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228418.1 protein_id gnl|my_center|LOCUS_09930 97253 98719 gene locus_tag LOCUS_09940 97253 98719 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_09940 98777 100123 gene locus_tag LOCUS_09950 98777 100123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 100181 101218 gene locus_tag LOCUS_09960 100181 101218 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258940.1 protein_id gnl|my_center|LOCUS_09960 101226 103040 gene locus_tag LOCUS_09970 101226 103040 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_09970 103074 104714 gene locus_tag LOCUS_09980 103074 104714 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_09980 105323 104745 gene locus_tag LOCUS_09990 105323 104745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 105939 105334 gene locus_tag LOCUS_10000 105939 105334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 106286 105942 gene locus_tag LOCUS_10010 106286 105942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 107760 106294 gene locus_tag LOCUS_10020 107760 106294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 107869 108303 gene locus_tag LOCUS_10030 gene arfB 107869 108303 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_10030 109172 108300 gene locus_tag LOCUS_10040 109172 108300 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_10040 109217 110323 gene locus_tag LOCUS_10050 109217 110323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 110351 111277 gene locus_tag LOCUS_10060 110351 111277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 111301 113679 gene locus_tag LOCUS_10070 gene hrpB 111301 113679 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298481.1 protein_id gnl|my_center|LOCUS_10070 113737 115068 gene locus_tag LOCUS_10080 113737 115068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 115055 115852 gene locus_tag LOCUS_10090 115055 115852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 115852 117186 gene locus_tag LOCUS_10100 115852 117186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 117183 121790 gene locus_tag LOCUS_10110 117183 121790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 121802 122458 gene locus_tag LOCUS_10120 121802 122458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 123488 122466 gene locus_tag LOCUS_10130 123488 122466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 123790 124446 gene locus_tag LOCUS_10140 123790 124446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 125821 124592 gene locus_tag LOCUS_10150 125821 124592 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971927.1 protein_id gnl|my_center|LOCUS_10150 126216 125875 gene locus_tag LOCUS_10160 126216 125875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 126729 126358 gene locus_tag LOCUS_10170 126729 126358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 126942 127898 gene locus_tag LOCUS_10180 126942 127898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 127895 129142 gene locus_tag LOCUS_10190 127895 129142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 129378 129908 gene locus_tag LOCUS_10200 129378 129908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 130076 130270 gene locus_tag LOCUS_10210 130076 130270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 130493 131536 gene locus_tag LOCUS_10220 130493 131536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 131768 132355 gene locus_tag LOCUS_10230 131768 132355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 132657 132391 gene locus_tag LOCUS_10240 132657 132391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 133534 132734 gene locus_tag LOCUS_10250 133534 132734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 133708 134505 gene locus_tag LOCUS_10260 133708 134505 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974725.1 protein_id gnl|my_center|LOCUS_10260 134687 135385 gene locus_tag LOCUS_10270 134687 135385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 136564 135431 gene locus_tag LOCUS_10280 136564 135431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 138488 136569 gene locus_tag LOCUS_10290 138488 136569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 139278 138832 gene locus_tag LOCUS_10300 139278 138832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 139740 139925 gene locus_tag LOCUS_10310 139740 139925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 140240 141019 gene locus_tag LOCUS_10320 140240 141019 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence07 2354 540 gene locus_tag LOCUS_10330 gene lepA 2354 540 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_10330 2437 3792 gene locus_tag LOCUS_10340 2437 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3795 4937 gene locus_tag LOCUS_10350 3795 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 6113 4920 gene locus_tag LOCUS_10360 gene lpxB 6113 4920 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141866.1 protein_id gnl|my_center|LOCUS_10360 6925 6110 gene locus_tag LOCUS_10370 gene lpxA 6925 6110 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_10370 7371 6922 gene locus_tag LOCUS_10380 gene fabZ 7371 6922 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_10380 8266 7361 gene locus_tag LOCUS_10390 gene lpxC 8266 7361 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141863.1 protein_id gnl|my_center|LOCUS_10390 9309 8272 gene locus_tag LOCUS_10400 gene lpxD 9309 8272 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_10400 9782 9306 gene locus_tag LOCUS_10410 9782 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 11800 9782 gene locus_tag LOCUS_10420 11800 9782 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141861.1 protein_id gnl|my_center|LOCUS_10420 12019 11804 gene locus_tag LOCUS_10430 12019 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 11951 12979 gene locus_tag LOCUS_10440 11951 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144331.1 protein_id gnl|my_center|LOCUS_10440 14148 13243 gene locus_tag LOCUS_10450 14148 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 14680 14165 gene locus_tag LOCUS_10460 gene rimI 14680 14165 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_10460 15372 14677 gene locus_tag LOCUS_10470 gene tsaB 15372 14677 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_10470 15827 15369 gene locus_tag LOCUS_10480 15827 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 16142 18556 gene locus_tag LOCUS_10490 16142 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 19229 20056 gene locus_tag LOCUS_10500 gene hag 19229 20056 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_10500 20132 20222 gene locus_tag LOCUS_t00220 20132 20222 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20246 21100 gene locus_tag LOCUS_10510 20246 21100 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228026.1 protein_id gnl|my_center|LOCUS_10510 21153 21227 gene locus_tag LOCUS_t00230 21153 21227 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21232 22281 gene locus_tag LOCUS_10520 gene tilS 21232 22281 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_10520 22291 24147 gene locus_tag LOCUS_10530 gene ftsH 22291 24147 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_10530 25373 24231 gene locus_tag LOCUS_10540 gene rlmB 25373 24231 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144167.1 protein_id gnl|my_center|LOCUS_10540 25836 25345 gene locus_tag LOCUS_10550 25836 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 27271 25829 gene locus_tag LOCUS_10560 gene cysS 27271 25829 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_10560 27438 27746 gene locus_tag LOCUS_10570 27438 27746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 28649 27885 gene locus_tag LOCUS_10580 28649 27885 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_10580 29233 28697 gene locus_tag LOCUS_10590 29233 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 29508 30707 gene locus_tag LOCUS_10600 29508 30707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 31471 30767 gene locus_tag LOCUS_10610 31471 30767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 31550 32446 gene locus_tag LOCUS_10620 31550 32446 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028572.1 protein_id gnl|my_center|LOCUS_10620 32516 33175 gene locus_tag LOCUS_10630 32516 33175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 33203 35566 gene locus_tag LOCUS_10640 33203 35566 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_10640 35762 36550 gene locus_tag LOCUS_10650 35762 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 37178 36618 gene locus_tag LOCUS_10660 37178 36618 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_10660 37564 37178 gene locus_tag LOCUS_10670 37564 37178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 39293 37647 gene locus_tag LOCUS_10680 39293 37647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 40549 39290 gene locus_tag LOCUS_10690 40549 39290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 41300 40683 gene locus_tag LOCUS_10700 41300 40683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 42300 41287 gene locus_tag LOCUS_10710 42300 41287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10710 42663 43730 gene locus_tag LOCUS_10720 42663 43730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 43839 44072 gene locus_tag LOCUS_10730 43839 44072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 45177 44170 gene locus_tag LOCUS_10740 45177 44170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 46238 45177 gene locus_tag LOCUS_10750 46238 45177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 47130 46276 gene locus_tag LOCUS_10760 47130 46276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 50111 47127 gene locus_tag LOCUS_10770 50111 47127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 51193 50108 gene locus_tag LOCUS_10780 gene lptG 51193 50108 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_10780 52311 51190 gene locus_tag LOCUS_10790 gene lptG 52311 51190 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_10790 52388 54052 gene locus_tag LOCUS_10800 gene lnt 52388 54052 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141729.1 protein_id gnl|my_center|LOCUS_10800 54049 54744 gene locus_tag LOCUS_10810 54049 54744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 54741 56141 gene locus_tag LOCUS_10820 54741 56141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 57215 56157 gene locus_tag LOCUS_10830 57215 56157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 58033 57215 gene locus_tag LOCUS_10840 58033 57215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 58310 58606 gene locus_tag LOCUS_10850 58310 58606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 58701 59018 gene locus_tag LOCUS_10860 58701 59018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 59099 60241 gene locus_tag LOCUS_10870 59099 60241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 60256 62418 gene locus_tag LOCUS_10880 gene topA 60256 62418 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143190.1 protein_id gnl|my_center|LOCUS_10880 62415 63731 gene locus_tag LOCUS_10890 gene trmFO 62415 63731 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645028.1 protein_id gnl|my_center|LOCUS_10890 64374 63715 gene locus_tag LOCUS_10900 64374 63715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 64727 65260 gene locus_tag LOCUS_10910 64727 65260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 65398 66222 gene locus_tag LOCUS_10920 65398 66222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10920 66868 66398 gene locus_tag LOCUS_10930 66868 66398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 67023 67661 gene locus_tag LOCUS_10940 67023 67661 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_10940 67669 68571 gene locus_tag LOCUS_10950 gene xerD 67669 68571 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_10950 68616 70382 gene locus_tag LOCUS_10960 68616 70382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 70379 72949 gene locus_tag LOCUS_10970 70379 72949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 72956 74206 gene locus_tag LOCUS_10980 72956 74206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 74161 75132 gene locus_tag LOCUS_10990 gene lipA 74161 75132 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_10990 75132 76100 gene locus_tag LOCUS_11000 gene pdhA 75132 76100 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730030.1 protein_id gnl|my_center|LOCUS_11000 76104 77078 gene locus_tag LOCUS_11010 76104 77078 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_11010 77103 78506 gene locus_tag LOCUS_11020 77103 78506 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989651.1 protein_id gnl|my_center|LOCUS_11020 78521 79144 gene locus_tag LOCUS_11030 78521 79144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 79141 79773 gene locus_tag LOCUS_11040 79141 79773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 79794 81212 gene locus_tag LOCUS_11050 gene lpdA 79794 81212 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_11050 81225 84419 gene locus_tag LOCUS_11060 81225 84419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 84425 85306 gene locus_tag LOCUS_11070 84425 85306 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 protein_id gnl|my_center|LOCUS_11070 85303 86295 gene locus_tag LOCUS_11080 85303 86295 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 protein_id gnl|my_center|LOCUS_11080 86292 87086 gene locus_tag LOCUS_11090 86292 87086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228167.1 protein_id gnl|my_center|LOCUS_11090 87105 87674 gene locus_tag LOCUS_11100 gene cobO 87105 87674 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_11100 87680 88684 gene locus_tag LOCUS_11110 gene cobT 87680 88684 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_11110 88681 89748 gene locus_tag LOCUS_11120 88681 89748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 89745 90395 gene locus_tag LOCUS_11130 89745 90395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 91128 90406 gene locus_tag LOCUS_11140 91128 90406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 93187 91157 gene locus_tag LOCUS_11150 93187 91157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 93872 93333 gene locus_tag LOCUS_11160 93872 93333 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090910.1 protein_id gnl|my_center|LOCUS_11160 94038 94652 gene locus_tag LOCUS_11170 gene ahpC 94038 94652 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761950.1 protein_id gnl|my_center|LOCUS_11170 94785 95501 gene locus_tag LOCUS_11180 94785 95501 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_11180 96650 95514 gene locus_tag LOCUS_11190 96650 95514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 97327 96731 gene locus_tag LOCUS_11200 97327 96731 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_11200 97620 97339 gene locus_tag LOCUS_11210 97620 97339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 98069 97608 gene locus_tag LOCUS_11220 98069 97608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 98451 98062 gene locus_tag LOCUS_11230 98451 98062 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_11230 98506 99276 gene locus_tag LOCUS_11240 98506 99276 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383377.1 protein_id gnl|my_center|LOCUS_11240 101068 99284 gene locus_tag LOCUS_11250 101068 99284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 102873 101092 gene locus_tag LOCUS_11260 102873 101092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 102872 103699 gene locus_tag LOCUS_11270 102872 103699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 103963 103709 gene locus_tag LOCUS_11280 103963 103709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 104776 103964 gene locus_tag LOCUS_11290 104776 103964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 105845 104901 gene locus_tag LOCUS_11300 105845 104901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 106870 106181 gene locus_tag LOCUS_11310 106870 106181 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391460.1 protein_id gnl|my_center|LOCUS_11310 106912 108492 gene locus_tag LOCUS_11320 106912 108492 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730582.1 protein_id gnl|my_center|LOCUS_11320 109852 108479 gene locus_tag LOCUS_11330 gene purB 109852 108479 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257052.1 protein_id gnl|my_center|LOCUS_11330 111729 109858 gene locus_tag LOCUS_11340 111729 109858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 111832 113271 gene locus_tag LOCUS_11350 111832 113271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 113517 113284 gene locus_tag LOCUS_11360 113517 113284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 113745 113533 gene locus_tag LOCUS_11370 113745 113533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 115645 113735 gene locus_tag LOCUS_11380 115645 113735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228612.1 protein_id gnl|my_center|LOCUS_11380 117432 115642 gene locus_tag LOCUS_11390 117432 115642 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369303.1 protein_id gnl|my_center|LOCUS_11390 118772 117429 gene locus_tag LOCUS_11400 118772 117429 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_11400 120160 118769 gene locus_tag LOCUS_11410 120160 118769 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_11410 120209 120643 gene locus_tag LOCUS_11420 120209 120643 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140609.1 protein_id gnl|my_center|LOCUS_11420 121333 120656 gene locus_tag LOCUS_11430 121333 120656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 121461 121793 gene locus_tag LOCUS_11440 121461 121793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 121882 122478 gene locus_tag LOCUS_11450 121882 122478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 122497 122862 gene locus_tag LOCUS_11460 122497 122862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 124030 122894 gene locus_tag LOCUS_11470 124030 122894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 124664 124092 gene locus_tag LOCUS_11480 124664 124092 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_11480 125976 124678 gene locus_tag LOCUS_11490 125976 124678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 126653 125973 gene locus_tag LOCUS_11500 126653 125973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_11500 126753 127223 gene locus_tag LOCUS_11510 126753 127223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 128921 127239 gene locus_tag LOCUS_11520 128921 127239 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550172.1 protein_id gnl|my_center|LOCUS_11520 129086 129466 gene locus_tag LOCUS_11530 129086 129466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 129463 129636 gene locus_tag LOCUS_11540 129463 129636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 131019 129637 gene locus_tag LOCUS_11550 131019 129637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 131098 131928 gene locus_tag LOCUS_11560 131098 131928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 134275 131897 gene locus_tag LOCUS_11570 134275 131897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 134321 134983 gene locus_tag LOCUS_11580 134321 134983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 135047 136363 gene locus_tag LOCUS_11590 135047 136363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226511.1 protein_id gnl|my_center|LOCUS_11590 136659 136354 gene locus_tag LOCUS_11600 136659 136354 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929212.1 protein_id gnl|my_center|LOCUS_11600 136757 137035 gene locus_tag LOCUS_11610 136757 137035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence08 1033 518 gene locus_tag LOCUS_11620 1033 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1785 1051 gene locus_tag LOCUS_11630 1785 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1908 3290 gene locus_tag LOCUS_11640 1908 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4425 3340 gene locus_tag LOCUS_11650 4425 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4857 4498 gene locus_tag LOCUS_11660 4857 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 5249 5734 gene locus_tag LOCUS_11670 5249 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5738 6733 gene locus_tag LOCUS_11680 5738 6733 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_11680 6793 7854 gene locus_tag LOCUS_11690 6793 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7878 10394 gene locus_tag LOCUS_11700 7878 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 10899 11210 gene locus_tag LOCUS_11710 10899 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 11212 12387 gene locus_tag LOCUS_11720 11212 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 12782 14221 gene locus_tag LOCUS_11730 12782 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 14270 15208 gene locus_tag LOCUS_11740 14270 15208 CDS product enoyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871451.1 protein_id gnl|my_center|LOCUS_11740 16567 15167 gene locus_tag LOCUS_11750 16567 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 17265 16564 gene locus_tag LOCUS_11760 17265 16564 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385503.1 protein_id gnl|my_center|LOCUS_11760 17412 17945 gene locus_tag LOCUS_11770 17412 17945 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240310.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11770 18633 17953 gene locus_tag LOCUS_11780 18633 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 18788 19525 gene locus_tag LOCUS_11790 18788 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 19506 20447 gene locus_tag LOCUS_11800 19506 20447 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_11800 20444 21838 gene locus_tag LOCUS_11810 20444 21838 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036453339.1 protein_id gnl|my_center|LOCUS_11810 22874 21828 gene locus_tag LOCUS_11820 22874 21828 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_11820 25291 22871 gene locus_tag LOCUS_11830 25291 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 25827 25360 gene locus_tag LOCUS_11840 25827 25360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 26526 25894 gene locus_tag LOCUS_11850 26526 25894 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_11850 26592 27392 gene locus_tag LOCUS_11860 26592 27392 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918999.1 protein_id gnl|my_center|LOCUS_11860 27392 28843 gene locus_tag LOCUS_11870 27392 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 28918 33639 gene locus_tag LOCUS_11880 28918 33639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 33689 34102 gene locus_tag LOCUS_11890 33689 34102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 34796 34158 gene locus_tag LOCUS_11900 34796 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 34989 35759 gene locus_tag LOCUS_11910 34989 35759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 35756 36601 gene locus_tag LOCUS_11920 35756 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 37638 36598 gene locus_tag LOCUS_11930 37638 36598 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_11930 38529 37690 gene locus_tag LOCUS_11940 gene bla 38529 37690 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_11940 38759 39505 gene locus_tag LOCUS_11950 38759 39505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_11950 39520 41493 gene locus_tag LOCUS_11960 39520 41493 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_11960 41496 42257 gene locus_tag LOCUS_11970 41496 42257 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_11970 42290 44956 gene locus_tag LOCUS_11980 42290 44956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 47590 44963 gene locus_tag LOCUS_11990 47590 44963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 47970 50033 gene locus_tag LOCUS_12000 47970 50033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 52298 50049 gene locus_tag LOCUS_12010 52298 50049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 53902 52298 gene locus_tag LOCUS_12020 53902 52298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 55955 53940 gene locus_tag LOCUS_12030 55955 53940 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_12030 58279 56081 gene locus_tag LOCUS_12040 58279 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 58689 59081 gene locus_tag LOCUS_12050 58689 59081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 59754 59107 gene locus_tag LOCUS_12060 59754 59107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 60718 59807 gene locus_tag LOCUS_12070 60718 59807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 61145 60690 gene locus_tag LOCUS_12080 61145 60690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 61268 61612 gene locus_tag LOCUS_12090 61268 61612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 62064 62498 gene locus_tag LOCUS_12100 62064 62498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 62555 63196 gene locus_tag LOCUS_12110 62555 63196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 63193 63552 gene locus_tag LOCUS_12120 63193 63552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 64141 63713 gene locus_tag LOCUS_12130 64141 63713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 64116 64604 gene locus_tag LOCUS_12140 64116 64604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 64684 65499 gene locus_tag LOCUS_12150 64684 65499 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_12150 65962 66420 gene locus_tag LOCUS_12160 65962 66420 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_12160 68038 66515 gene locus_tag LOCUS_12170 68038 66515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 68991 68044 gene locus_tag LOCUS_12180 68991 68044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 69395 69847 gene locus_tag LOCUS_12190 gene rpiB 69395 69847 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_12190 69855 71066 gene locus_tag LOCUS_12200 69855 71066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 71129 71764 gene locus_tag LOCUS_12210 71129 71764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_12210 71806 72099 gene locus_tag LOCUS_12220 gene eutM 71806 72099 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_12220 72172 72486 gene locus_tag LOCUS_12230 72172 72486 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056789.1 protein_id gnl|my_center|LOCUS_12230 72555 73967 gene locus_tag LOCUS_12240 72555 73967 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_12240 73979 75355 gene locus_tag LOCUS_12250 73979 75355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 75352 76335 gene locus_tag LOCUS_12260 75352 76335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 76340 76615 gene locus_tag LOCUS_12270 76340 76615 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_12270 76620 76901 gene locus_tag LOCUS_12280 76620 76901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 77009 78493 gene locus_tag LOCUS_12290 77009 78493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 78910 78509 gene locus_tag LOCUS_12300 78910 78509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 79319 78915 gene locus_tag LOCUS_12310 79319 78915 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_12310 79398 81179 gene locus_tag LOCUS_12320 79398 81179 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_12320 81287 83272 gene locus_tag LOCUS_12330 81287 83272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 83297 83590 gene locus_tag LOCUS_12340 83297 83590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 84842 83679 gene locus_tag LOCUS_12350 84842 83679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 86328 84937 gene locus_tag LOCUS_12360 gene hemN 86328 84937 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403512.1 protein_id gnl|my_center|LOCUS_12360 87302 86328 gene locus_tag LOCUS_12370 gene hemE 87302 86328 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_12370 87894 87421 gene locus_tag LOCUS_12380 87894 87421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 88082 88960 gene locus_tag LOCUS_12390 88082 88960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 89014 91167 gene locus_tag LOCUS_12400 89014 91167 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_12400 91776 91171 gene locus_tag LOCUS_12410 91776 91171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 91867 92664 gene locus_tag LOCUS_12420 91867 92664 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887914.1 protein_id gnl|my_center|LOCUS_12420 92661 93704 gene locus_tag LOCUS_12430 92661 93704 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177684.1 protein_id gnl|my_center|LOCUS_12430 93704 94783 gene locus_tag LOCUS_12440 93704 94783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 96359 94785 gene locus_tag LOCUS_12450 96359 94785 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228999.1 protein_id gnl|my_center|LOCUS_12450 96507 98204 gene locus_tag LOCUS_12460 96507 98204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 99302 98223 gene locus_tag LOCUS_12470 gene ugpC 99302 98223 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_12470 100113 99427 gene locus_tag LOCUS_12480 100113 99427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 100270 102132 gene locus_tag LOCUS_12490 100270 102132 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_12490 102668 102129 gene locus_tag LOCUS_12500 102668 102129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 102795 104336 gene locus_tag LOCUS_12510 102795 104336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 104414 105076 gene locus_tag LOCUS_12520 104414 105076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 105783 105073 gene locus_tag LOCUS_12530 105783 105073 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_12530 107655 105793 gene locus_tag LOCUS_12540 107655 105793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 108626 107652 gene locus_tag LOCUS_12550 108626 107652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 109609 108623 gene locus_tag LOCUS_12560 109609 108623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 109690 110172 gene locus_tag LOCUS_12570 109690 110172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 110838 110332 gene locus_tag LOCUS_12580 110838 110332 CDS product DNA recombination-mediator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929135.1 protein_id gnl|my_center|LOCUS_12580 110903 113212 gene locus_tag LOCUS_12590 gene pcrA 110903 113212 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058290.1 protein_id gnl|my_center|LOCUS_12590 113751 113209 gene locus_tag LOCUS_12600 113751 113209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 113955 116081 gene locus_tag LOCUS_12610 113955 116081 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_12610 116250 117374 gene locus_tag LOCUS_12620 116250 117374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 118165 117452 gene locus_tag LOCUS_12630 118165 117452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 118938 118249 gene locus_tag LOCUS_12640 118938 118249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 119158 119892 gene locus_tag LOCUS_12650 119158 119892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 120319 119900 gene locus_tag LOCUS_12660 120319 119900 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_12660 121764 120331 gene locus_tag LOCUS_12670 gene atpD 121764 120331 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142564.1 protein_id gnl|my_center|LOCUS_12670 122657 121776 gene locus_tag LOCUS_12680 gene atpG 122657 121776 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_12680 124191 122668 gene locus_tag LOCUS_12690 gene atpA 124191 122668 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 protein_id gnl|my_center|LOCUS_12690 124773 124237 gene locus_tag LOCUS_12700 124773 124237 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_12700 125306 124770 gene locus_tag LOCUS_12710 125306 124770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 125749 125303 gene locus_tag LOCUS_12720 125749 125303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 126121 125789 gene locus_tag LOCUS_12730 126121 125789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 127001 126186 gene locus_tag LOCUS_12740 gene atpB 127001 126186 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_12740 127470 126967 gene locus_tag LOCUS_12750 127470 126967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 127639 127463 gene locus_tag LOCUS_12760 127639 127463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 127726 128556 gene locus_tag LOCUS_12770 127726 128556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 129396 128566 gene locus_tag LOCUS_12780 129396 128566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 129700 130455 gene locus_tag LOCUS_12790 129700 130455 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142662.1 protein_id gnl|my_center|LOCUS_12790 130823 131146 gene locus_tag LOCUS_12800 130823 131146 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_12800 131322 132665 gene locus_tag LOCUS_12810 131322 132665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 133116 132713 gene locus_tag LOCUS_tm00010 133116 132713 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 133360 133166 gene locus_tag LOCUS_12820 133360 133166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 133518 134024 gene locus_tag LOCUS_12830 133518 134024 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence09 435 280 gene locus_tag LOCUS_12840 435 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 461 1153 gene locus_tag LOCUS_12850 461 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2122 1358 gene locus_tag LOCUS_12860 2122 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2869 2213 gene locus_tag LOCUS_12870 2869 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4202 3000 gene locus_tag LOCUS_12880 4202 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5353 4421 gene locus_tag LOCUS_12890 5353 4421 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257747.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12890 6197 5565 gene locus_tag LOCUS_12900 6197 5565 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383604.1 protein_id gnl|my_center|LOCUS_12900 8033 6273 gene locus_tag LOCUS_12910 8033 6273 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_12910 8476 8030 gene locus_tag LOCUS_12920 8476 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8486 11653 gene locus_tag LOCUS_12930 8486 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13478 11673 gene locus_tag LOCUS_12940 13478 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14028 13726 gene locus_tag LOCUS_12950 14028 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14187 14038 gene locus_tag LOCUS_12960 14187 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 14319 14834 gene locus_tag LOCUS_12970 14319 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 15740 14844 gene locus_tag LOCUS_12980 15740 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 15968 17197 gene locus_tag LOCUS_12990 15968 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 19050 17218 gene locus_tag LOCUS_13000 gene yegI 19050 17218 CDS product protein kinase YegI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640171.1 protein_id gnl|my_center|LOCUS_13000 19765 19043 gene locus_tag LOCUS_13010 19765 19043 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119062.1 protein_id gnl|my_center|LOCUS_13010 20506 19844 gene locus_tag LOCUS_13020 20506 19844 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003151.1 protein_id gnl|my_center|LOCUS_13020 21409 20594 gene locus_tag LOCUS_13030 21409 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 21483 22724 gene locus_tag LOCUS_13040 21483 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 22721 24349 gene locus_tag LOCUS_13050 22721 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 24346 25650 gene locus_tag LOCUS_13060 24346 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 26296 25631 gene locus_tag LOCUS_13070 26296 25631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 26930 26412 gene locus_tag LOCUS_13080 26930 26412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 27175 26960 gene locus_tag LOCUS_13090 27175 26960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 27685 27200 gene locus_tag LOCUS_13100 27685 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 28737 27568 gene locus_tag LOCUS_13110 28737 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 29993 28914 gene locus_tag LOCUS_13120 29993 28914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 30166 30870 gene locus_tag LOCUS_13130 30166 30870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 30912 31613 gene locus_tag LOCUS_13140 30912 31613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 31610 32764 gene locus_tag LOCUS_13150 31610 32764 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_13150 32761 34455 gene locus_tag LOCUS_13160 32761 34455 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_13160 34737 35159 gene locus_tag LOCUS_13170 34737 35159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 35733 35164 gene locus_tag LOCUS_13180 35733 35164 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258445.1 protein_id gnl|my_center|LOCUS_13180 35614 35916 gene locus_tag LOCUS_13190 35614 35916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 36388 35948 gene locus_tag LOCUS_13200 36388 35948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 36670 36476 gene locus_tag LOCUS_13210 36670 36476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 36610 36846 gene locus_tag LOCUS_13220 36610 36846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 36846 37256 gene locus_tag LOCUS_13230 36846 37256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 38193 37288 gene locus_tag LOCUS_13240 38193 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 38342 39088 gene locus_tag LOCUS_13250 38342 39088 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_13250 39264 40529 gene locus_tag LOCUS_13260 39264 40529 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_13260 40563 41420 gene locus_tag LOCUS_13270 40563 41420 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_13270 41420 42592 gene locus_tag LOCUS_13280 41420 42592 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 protein_id gnl|my_center|LOCUS_13280 45645 42619 gene locus_tag LOCUS_13290 45645 42619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 45830 47506 gene locus_tag LOCUS_13300 45830 47506 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_13300 47941 47519 gene locus_tag LOCUS_13310 47941 47519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 48749 47964 gene locus_tag LOCUS_13320 48749 47964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 48865 49899 gene locus_tag LOCUS_13330 48865 49899 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_13330 50604 49933 gene locus_tag LOCUS_13340 50604 49933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 50679 51725 gene locus_tag LOCUS_13350 gene nadA 50679 51725 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_13350 51728 53350 gene locus_tag LOCUS_13360 gene nadB 51728 53350 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_13360 54638 53256 gene locus_tag LOCUS_13370 gene hflX 54638 53256 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_13370 55417 54641 gene locus_tag LOCUS_13380 55417 54641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 56721 55417 gene locus_tag LOCUS_13390 56721 55417 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143270.1 protein_id gnl|my_center|LOCUS_13390 58118 56724 gene locus_tag LOCUS_13400 gene dnaB 58118 56724 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_13400 58560 58111 gene locus_tag LOCUS_13410 gene rplI 58560 58111 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_13410 59130 58636 gene locus_tag LOCUS_13420 59130 58636 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040149.1 protein_id gnl|my_center|LOCUS_13420 59235 59726 gene locus_tag LOCUS_13430 gene rlmH 59235 59726 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923277.1 protein_id gnl|my_center|LOCUS_13430 59723 60160 gene locus_tag LOCUS_13440 59723 60160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 60160 61821 gene locus_tag LOCUS_13450 gene argS 60160 61821 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_13450 61911 63146 gene locus_tag LOCUS_13460 61911 63146 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_13460 63143 64078 gene locus_tag LOCUS_13470 63143 64078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 65598 64006 gene locus_tag LOCUS_13480 65598 64006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 66398 65595 gene locus_tag LOCUS_13490 66398 65595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 66527 69529 gene locus_tag LOCUS_13500 66527 69529 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938263.1 protein_id gnl|my_center|LOCUS_13500 71167 69635 gene locus_tag LOCUS_13510 71167 69635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 71313 71876 gene locus_tag LOCUS_13520 71313 71876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 71866 72951 gene locus_tag LOCUS_13530 71866 72951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 72948 73559 gene locus_tag LOCUS_13540 72948 73559 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_13540 73571 74596 gene locus_tag LOCUS_13550 73571 74596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 74647 75990 gene locus_tag LOCUS_13560 74647 75990 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 protein_id gnl|my_center|LOCUS_13560 76047 76268 gene locus_tag LOCUS_13570 76047 76268 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 protein_id gnl|my_center|LOCUS_13570 76279 77220 gene locus_tag LOCUS_13580 76279 77220 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 protein_id gnl|my_center|LOCUS_13580 77255 78034 gene locus_tag LOCUS_13590 77255 78034 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939802.1 protein_id gnl|my_center|LOCUS_13590 78158 78418 gene locus_tag LOCUS_13600 78158 78418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 78492 80042 gene locus_tag LOCUS_13610 78492 80042 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886744.1 protein_id gnl|my_center|LOCUS_13610 80077 80748 gene locus_tag LOCUS_13620 80077 80748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 80783 81328 gene locus_tag LOCUS_13630 80783 81328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 81325 81777 gene locus_tag LOCUS_13640 81325 81777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 81774 82490 gene locus_tag LOCUS_13650 gene lptB 81774 82490 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782293.1 protein_id gnl|my_center|LOCUS_13650 82487 83659 gene locus_tag LOCUS_13660 82487 83659 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_13660 83685 84956 gene locus_tag LOCUS_13670 gene ahcY 83685 84956 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_13670 85190 85023 gene locus_tag LOCUS_13680 85190 85023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 85240 86796 gene locus_tag LOCUS_13690 85240 86796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 86882 88369 gene locus_tag LOCUS_13700 86882 88369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 88817 88371 gene locus_tag LOCUS_13710 88817 88371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 88840 89325 gene locus_tag LOCUS_13720 88840 89325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 92677 89345 gene locus_tag LOCUS_13730 92677 89345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 92810 93103 gene locus_tag LOCUS_13740 92810 93103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 93981 93100 gene locus_tag LOCUS_13750 93981 93100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 94028 95098 gene locus_tag LOCUS_13760 94028 95098 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203205.1 protein_id gnl|my_center|LOCUS_13760 97320 95161 gene locus_tag LOCUS_13770 97320 95161 CDS product cAMP/cGMP-dependent 3',5'-cyclic-AMP/GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910893.1 protein_id gnl|my_center|LOCUS_13770 98084 97368 gene locus_tag LOCUS_13780 gene yycF 98084 97368 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_13780 98243 99532 gene locus_tag LOCUS_13790 98243 99532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 99555 100889 gene locus_tag LOCUS_13800 99555 100889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 102009 100900 gene locus_tag LOCUS_13810 102009 100900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 102092 103255 gene locus_tag LOCUS_13820 102092 103255 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_13820 103271 103573 gene locus_tag LOCUS_13830 103271 103573 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946611.1 protein_id gnl|my_center|LOCUS_13830 103602 105038 gene locus_tag LOCUS_13840 103602 105038 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_13840 105043 106242 gene locus_tag LOCUS_13850 105043 106242 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_13850 106716 106249 gene locus_tag LOCUS_13860 106716 106249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 108801 107122 gene locus_tag LOCUS_13870 108801 107122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 110483 108798 gene locus_tag LOCUS_13880 110483 108798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 112036 110480 gene locus_tag LOCUS_13890 112036 110480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 114006 112039 gene locus_tag LOCUS_13900 114006 112039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 114256 114912 gene locus_tag LOCUS_13910 114256 114912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 115719 114919 gene locus_tag LOCUS_13920 115719 114919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 116198 116977 gene locus_tag LOCUS_13930 116198 116977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 117973 117026 gene locus_tag LOCUS_13940 117973 117026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 118156 118860 gene locus_tag LOCUS_13950 118156 118860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 118857 119825 gene locus_tag LOCUS_13960 gene draG 118857 119825 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_13960 119990 121792 gene locus_tag LOCUS_13970 119990 121792 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_13970 121789 124422 gene locus_tag LOCUS_13980 121789 124422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 124419 125471 gene locus_tag LOCUS_13990 124419 125471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144142.1 protein_id gnl|my_center|LOCUS_13990 125468 127144 gene locus_tag LOCUS_14000 125468 127144 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_14000 128073 127264 gene locus_tag LOCUS_14010 128073 127264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 128338 128946 gene locus_tag LOCUS_14020 128338 128946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 129170 129097 gene locus_tag LOCUS_t00240 129170 129097 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 130214 129249 gene locus_tag LOCUS_14030 130214 129249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 130841 130383 gene locus_tag LOCUS_14040 130841 130383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14040 131076 131558 gene locus_tag LOCUS_14050 131076 131558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 131625 132023 gene locus_tag LOCUS_14060 131625 132023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 132359 132431 gene locus_tag LOCUS_t00250 132359 132431 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 <1 770 gene locus_tag LOCUS_14070 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140537.1:GTP-binding protein 758 1798 gene locus_tag LOCUS_14080 758 1798 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_14080 1798 2076 gene locus_tag LOCUS_14090 1798 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3720 2473 gene locus_tag LOCUS_14100 3720 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3764 4129 gene locus_tag LOCUS_14110 3764 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5211 4243 gene locus_tag LOCUS_14120 5211 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5330 5854 gene locus_tag LOCUS_14130 5330 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6360 5869 gene locus_tag LOCUS_14140 6360 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6986 6402 gene locus_tag LOCUS_14150 6986 6402 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_14150 7639 6983 gene locus_tag LOCUS_14160 gene coaE 7639 6983 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_14160 7714 8625 gene locus_tag LOCUS_14170 7714 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 9269 8661 gene locus_tag LOCUS_14180 9269 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 12133 9233 gene locus_tag LOCUS_14190 12133 9233 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_14190 12420 13421 gene locus_tag LOCUS_14200 12420 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 13519 14946 gene locus_tag LOCUS_14210 13519 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 15012 15683 gene locus_tag LOCUS_14220 15012 15683 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226357.1 protein_id gnl|my_center|LOCUS_14220 17966 15705 gene locus_tag LOCUS_14230 17966 15705 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_14230 19363 17963 gene locus_tag LOCUS_14240 19363 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 20082 19357 gene locus_tag LOCUS_14250 20082 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 20996 20079 gene locus_tag LOCUS_14260 gene hemC 20996 20079 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141022.1 protein_id gnl|my_center|LOCUS_14260 21937 20993 gene locus_tag LOCUS_14270 21937 20993 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392568.1 protein_id gnl|my_center|LOCUS_14270 22813 21953 gene locus_tag LOCUS_14280 22813 21953 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_14280 23709 22810 gene locus_tag LOCUS_14290 23709 22810 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_14290 24503 23706 gene locus_tag LOCUS_14300 24503 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 25239 25514 gene locus_tag LOCUS_14310 25239 25514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 26750 25554 gene locus_tag LOCUS_14320 26750 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 27714 26830 gene locus_tag LOCUS_14330 27714 26830 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_14330 28893 27778 gene locus_tag LOCUS_14340 28893 27778 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_14340 30455 28899 gene locus_tag LOCUS_14350 gene guaA 30455 28899 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439265.1 protein_id gnl|my_center|LOCUS_14350 30632 30483 gene locus_tag LOCUS_14360 30632 30483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 32198 31146 gene locus_tag LOCUS_14370 gene recF 32198 31146 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058276.1 protein_id gnl|my_center|LOCUS_14370 33400 32282 gene locus_tag LOCUS_14380 gene dnaN 33400 32282 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_14380 35548 34229 gene locus_tag LOCUS_14390 gene dnaA 35548 34229 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_14390 35898 36041 gene locus_tag LOCUS_14400 gene rpmH 35898 36041 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776864.1 protein_id gnl|my_center|LOCUS_14400 36041 36427 gene locus_tag LOCUS_14410 36041 36427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 36424 36651 gene locus_tag LOCUS_14420 gene yidD 36424 36651 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690475.1 protein_id gnl|my_center|LOCUS_14420 36676 37491 gene locus_tag LOCUS_14430 36676 37491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 37488 38078 gene locus_tag LOCUS_14440 37488 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 38088 39434 gene locus_tag LOCUS_14450 gene mnmE 38088 39434 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_14450 39703 40464 gene locus_tag LOCUS_14460 39703 40464 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142662.1 protein_id gnl|my_center|LOCUS_14460 40943 40476 gene locus_tag LOCUS_14470 40943 40476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 41872 40940 gene locus_tag LOCUS_14480 41872 40940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 42037 43746 gene locus_tag LOCUS_14490 gene hutU 42037 43746 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_14490 43863 45023 gene locus_tag LOCUS_14500 gene hutI 43863 45023 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036762.1 protein_id gnl|my_center|LOCUS_14500 45044 46666 gene locus_tag LOCUS_14510 45044 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 46663 48204 gene locus_tag LOCUS_14520 gene hutH 46663 48204 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_14520 48201 48896 gene locus_tag LOCUS_14530 48201 48896 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142608.1 protein_id gnl|my_center|LOCUS_14530 48899 49828 gene locus_tag LOCUS_14540 48899 49828 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_14540 49801 50982 gene locus_tag LOCUS_14550 49801 50982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 51090 52124 gene locus_tag LOCUS_14560 gene hrcA 51090 52124 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228404.1 protein_id gnl|my_center|LOCUS_14560 52124 52777 gene locus_tag LOCUS_14570 52124 52777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 52770 54674 gene locus_tag LOCUS_14580 gene dnaK 52770 54674 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_14580 54713 55804 gene locus_tag LOCUS_14590 gene dnaJ 54713 55804 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_14590 57605 55815 gene locus_tag LOCUS_14600 57605 55815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 57660 58259 gene locus_tag LOCUS_14610 57660 58259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 58411 59196 gene locus_tag LOCUS_14620 58411 59196 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404249.1 protein_id gnl|my_center|LOCUS_14620 59264 59497 gene locus_tag LOCUS_14630 59264 59497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 59570 60265 gene locus_tag LOCUS_14640 59570 60265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 60347 60682 gene locus_tag LOCUS_14650 60347 60682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 61281 60685 gene locus_tag LOCUS_14660 61281 60685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 62047 61259 gene locus_tag LOCUS_14670 62047 61259 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902207.1 protein_id gnl|my_center|LOCUS_14670 65571 62044 gene locus_tag LOCUS_14680 gene smc 65571 62044 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143312.1 protein_id gnl|my_center|LOCUS_14680 66030 66242 gene locus_tag LOCUS_14690 66030 66242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 66432 67070 gene locus_tag LOCUS_14700 66432 67070 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_14700 67176 68396 gene locus_tag LOCUS_14710 gene metK 67176 68396 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 protein_id gnl|my_center|LOCUS_14710 68393 70750 gene locus_tag LOCUS_14720 68393 70750 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_14720 71838 70747 gene locus_tag LOCUS_14730 71838 70747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 71909 72841 gene locus_tag LOCUS_14740 gene ilvC 71909 72841 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_14740 72862 73536 gene locus_tag LOCUS_14750 72862 73536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 73577 74524 gene locus_tag LOCUS_14760 73577 74524 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_14760 74544 75650 gene locus_tag LOCUS_14770 74544 75650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 75647 77800 gene locus_tag LOCUS_14780 75647 77800 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_14780 77818 79608 gene locus_tag LOCUS_14790 77818 79608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 79608 80699 gene locus_tag LOCUS_14800 79608 80699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 80962 81132 gene locus_tag LOCUS_14810 80962 81132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 81284 82372 gene locus_tag LOCUS_14820 gene gmd 81284 82372 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388006.1 protein_id gnl|my_center|LOCUS_14820 82392 83291 gene locus_tag LOCUS_14830 82392 83291 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_14830 84084 83299 gene locus_tag LOCUS_14840 84084 83299 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_14840 85252 84071 gene locus_tag LOCUS_14850 85252 84071 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_14850 85409 86545 gene locus_tag LOCUS_14860 85409 86545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 87706 86564 gene locus_tag LOCUS_14870 87706 86564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 88815 87703 gene locus_tag LOCUS_14880 88815 87703 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929363.1 protein_id gnl|my_center|LOCUS_14880 90035 88812 gene locus_tag LOCUS_14890 90035 88812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 91426 90035 gene locus_tag LOCUS_14900 91426 90035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 92003 91416 gene locus_tag LOCUS_14910 92003 91416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 93120 91993 gene locus_tag LOCUS_14920 93120 91993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 94488 93163 gene locus_tag LOCUS_14930 94488 93163 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_14930 94894 94592 gene locus_tag LOCUS_14940 94894 94592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 94785 96008 gene locus_tag LOCUS_14950 94785 96008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 95989 97029 gene locus_tag LOCUS_14960 95989 97029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 97081 98724 gene locus_tag LOCUS_14970 97081 98724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 98721 100886 gene locus_tag LOCUS_14980 98721 100886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 102614 100935 gene locus_tag LOCUS_14990 102614 100935 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_14990 102927 102619 gene locus_tag LOCUS_15000 102927 102619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 102960 103430 gene locus_tag LOCUS_15010 102960 103430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 104286 103603 gene locus_tag LOCUS_15020 gene queC 104286 103603 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_15020 106238 104283 gene locus_tag LOCUS_15030 106238 104283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 106343 107002 gene locus_tag LOCUS_15040 106343 107002 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389560.1 protein_id gnl|my_center|LOCUS_15040 107022 107840 gene locus_tag LOCUS_15050 107022 107840 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_15050 107840 108967 gene locus_tag LOCUS_15060 107840 108967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 109024 109272 gene locus_tag LOCUS_15070 109024 109272 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_15070 109358 109612 gene locus_tag LOCUS_15080 109358 109612 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256135.1 protein_id gnl|my_center|LOCUS_15080 109624 110220 gene locus_tag LOCUS_15090 109624 110220 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_15090 110231 111226 gene locus_tag LOCUS_15100 110231 111226 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438415.1 protein_id gnl|my_center|LOCUS_15100 111244 112065 gene locus_tag LOCUS_15110 111244 112065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 112156 113292 gene locus_tag LOCUS_15120 112156 113292 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101329.1 protein_id gnl|my_center|LOCUS_15120 113488 113766 gene locus_tag LOCUS_15130 113488 113766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 113770 114171 gene locus_tag LOCUS_15140 113770 114171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 114392 115240 gene locus_tag LOCUS_15150 114392 115240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 115240 115575 gene locus_tag LOCUS_15160 115240 115575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 115572 116939 gene locus_tag LOCUS_15170 115572 116939 CDS product DUF2791 family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875950.1 protein_id gnl|my_center|LOCUS_15170 116929 119160 gene locus_tag LOCUS_15180 116929 119160 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875951.1 protein_id gnl|my_center|LOCUS_15180 119818 119177 gene locus_tag LOCUS_15190 119818 119177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 119706 120659 gene locus_tag LOCUS_15200 119706 120659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 120688 121527 gene locus_tag LOCUS_15210 gene pgoN 120688 121527 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_15210 122201 121539 gene locus_tag LOCUS_15220 122201 121539 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 protein_id gnl|my_center|LOCUS_15220 122419 122126 gene locus_tag LOCUS_15230 122419 122126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 123835 122558 gene locus_tag LOCUS_15240 123835 122558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 124000 124614 gene locus_tag LOCUS_15250 gene nox 124000 124614 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227925.1 protein_id gnl|my_center|LOCUS_15250 124732 125970 gene locus_tag LOCUS_15260 124732 125970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 127122 125998 gene locus_tag LOCUS_15270 127122 125998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 128944 127151 gene locus_tag LOCUS_15280 128944 127151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928901.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence11 1754 570 gene locus_tag LOCUS_15290 1754 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1884 2897 gene locus_tag LOCUS_15300 1884 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3033 3299 gene locus_tag LOCUS_15310 3033 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 4109 3588 gene locus_tag LOCUS_15320 4109 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4614 4102 gene locus_tag LOCUS_15330 4614 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5994 4624 gene locus_tag LOCUS_15340 gene nrfD 5994 4624 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_15340 6782 5991 gene locus_tag LOCUS_15350 6782 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9109 6767 gene locus_tag LOCUS_15360 9109 6767 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_15360 9731 9126 gene locus_tag LOCUS_15370 9731 9126 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_15370 10606 9863 gene locus_tag LOCUS_15380 gene fabG 10606 9863 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_15380 10658 10867 gene locus_tag LOCUS_15390 10658 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 12129 10864 gene locus_tag LOCUS_15400 12129 10864 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031187.1 protein_id gnl|my_center|LOCUS_15400 12283 13383 gene locus_tag LOCUS_15410 gene queG 12283 13383 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083539.1 protein_id gnl|my_center|LOCUS_15410 13440 13742 gene locus_tag LOCUS_15420 13440 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 14707 13823 gene locus_tag LOCUS_15430 14707 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 14780 16879 gene locus_tag LOCUS_15440 14780 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 17001 18038 gene locus_tag LOCUS_15450 17001 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 18890 18039 gene locus_tag LOCUS_15460 gene htpX 18890 18039 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_15460 19731 18952 gene locus_tag LOCUS_15470 gene pdxJ 19731 18952 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004969731.1 protein_id gnl|my_center|LOCUS_15470 26699 19731 gene locus_tag LOCUS_15480 26699 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 26815 28623 gene locus_tag LOCUS_15490 26815 28623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 28620 29759 gene locus_tag LOCUS_15500 28620 29759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 29831 30214 gene locus_tag LOCUS_15510 29831 30214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 30224 31243 gene locus_tag LOCUS_15520 30224 31243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 31345 32727 gene locus_tag LOCUS_15530 31345 32727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 33112 32711 gene locus_tag LOCUS_15540 33112 32711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 33818 33471 gene locus_tag LOCUS_15550 33818 33471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 34228 33827 gene locus_tag LOCUS_15560 34228 33827 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249283.1 protein_id gnl|my_center|LOCUS_15560 37615 34238 gene locus_tag LOCUS_15570 37615 34238 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449873.1 protein_id gnl|my_center|LOCUS_15570 38564 37605 gene locus_tag LOCUS_15580 38564 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 38623 39768 gene locus_tag LOCUS_15590 gene acdA 38623 39768 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_15590 39773 40405 gene locus_tag LOCUS_15600 39773 40405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 40454 41551 gene locus_tag LOCUS_15610 40454 41551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 41901 42368 gene locus_tag LOCUS_15620 41901 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 42489 42415 gene locus_tag LOCUS_t00260 42489 42415 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 42628 42535 gene locus_tag LOCUS_t00270 42628 42535 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 42817 44112 gene locus_tag LOCUS_15630 42817 44112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 44709 44170 gene locus_tag LOCUS_15640 44709 44170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 47283 44755 gene locus_tag LOCUS_15650 47283 44755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 47638 47294 gene locus_tag LOCUS_15660 47638 47294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 51025 47705 gene locus_tag LOCUS_15670 51025 47705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 51126 52535 gene locus_tag LOCUS_15680 51126 52535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 53811 52540 gene locus_tag LOCUS_15690 gene rlmD 53811 52540 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 protein_id gnl|my_center|LOCUS_15690 53749 54912 gene locus_tag LOCUS_15700 53749 54912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 54966 56624 gene locus_tag LOCUS_15710 gene ettA 54966 56624 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_15710 56629 57621 gene locus_tag LOCUS_15720 gene glcK 56629 57621 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_15720 59368 57629 gene locus_tag LOCUS_15730 59368 57629 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_15730 59367 62105 gene locus_tag LOCUS_15740 59367 62105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 62102 62737 gene locus_tag LOCUS_15750 62102 62737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 62798 63646 gene locus_tag LOCUS_15760 62798 63646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 63696 65030 gene locus_tag LOCUS_15770 63696 65030 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141561.1 protein_id gnl|my_center|LOCUS_15770 65050 66546 gene locus_tag LOCUS_15780 65050 66546 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_15780 66642 67331 gene locus_tag LOCUS_15790 66642 67331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 67391 68713 gene locus_tag LOCUS_15800 67391 68713 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_15800 69603 68686 gene locus_tag LOCUS_15810 69603 68686 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_15810 69535 70539 gene locus_tag LOCUS_15820 69535 70539 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_15820 70532 72250 gene locus_tag LOCUS_15830 70532 72250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 72318 72683 gene locus_tag LOCUS_15840 72318 72683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 73327 72746 gene locus_tag LOCUS_15850 73327 72746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 74289 73363 gene locus_tag LOCUS_15860 74289 73363 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_15860 77429 74418 gene locus_tag LOCUS_15870 77429 74418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 77566 79686 gene locus_tag LOCUS_15880 77566 79686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 80884 79655 gene locus_tag LOCUS_15890 80884 79655 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942824.1 protein_id gnl|my_center|LOCUS_15890 81599 80871 gene locus_tag LOCUS_15900 81599 80871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142892.1 protein_id gnl|my_center|LOCUS_15900 82396 81599 gene locus_tag LOCUS_15910 82396 81599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057948.1 protein_id gnl|my_center|LOCUS_15910 83436 82393 gene locus_tag LOCUS_15920 83436 82393 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530006.1 protein_id gnl|my_center|LOCUS_15920 84354 83437 gene locus_tag LOCUS_15930 84354 83437 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_15930 85467 84367 gene locus_tag LOCUS_15940 85467 84367 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142349.1 protein_id gnl|my_center|LOCUS_15940 86357 85512 gene locus_tag LOCUS_15950 86357 85512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 86827 86357 gene locus_tag LOCUS_15960 86827 86357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 88413 86824 gene locus_tag LOCUS_15970 gene murJ 88413 86824 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141471.1 protein_id gnl|my_center|LOCUS_15970 88990 88406 gene locus_tag LOCUS_15980 88990 88406 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140779.1 protein_id gnl|my_center|LOCUS_15980 89071 89997 gene locus_tag LOCUS_15990 89071 89997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 89994 90530 gene locus_tag LOCUS_16000 89994 90530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 92100 90550 gene locus_tag LOCUS_16010 92100 90550 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_16010 92600 92103 gene locus_tag LOCUS_16020 92600 92103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 92991 92632 gene locus_tag LOCUS_16030 92991 92632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 93414 93067 gene locus_tag LOCUS_16040 93414 93067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 94313 93411 gene locus_tag LOCUS_16050 gene folD 94313 93411 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448683.1 protein_id gnl|my_center|LOCUS_16050 94717 94310 gene locus_tag LOCUS_16060 94717 94310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 94844 96286 gene locus_tag LOCUS_16070 94844 96286 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228743.1 protein_id gnl|my_center|LOCUS_16070 98575 96311 gene locus_tag LOCUS_16080 98575 96311 CDS product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392752.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence12 <1 729 gene locus_tag LOCUS_16090 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766109.1:ATP-binding protein 848 1744 gene locus_tag LOCUS_16100 848 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3217 1820 gene locus_tag LOCUS_16110 3217 1820 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_16110 3879 3454 gene locus_tag LOCUS_16120 3879 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3997 4593 gene locus_tag LOCUS_16130 gene yihA 3997 4593 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_16130 5504 4590 gene locus_tag LOCUS_16140 gene lgt 5504 4590 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_16140 5816 5544 gene locus_tag LOCUS_16150 5816 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6348 5917 gene locus_tag LOCUS_16160 6348 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 7058 6345 gene locus_tag LOCUS_16170 7058 6345 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_16170 7169 7612 gene locus_tag LOCUS_16180 7169 7612 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 protein_id gnl|my_center|LOCUS_16180 7644 7730 gene locus_tag LOCUS_t00280 7644 7730 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8445 7789 gene locus_tag LOCUS_16190 8445 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16190 8693 8433 gene locus_tag LOCUS_16200 8693 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 9087 8707 gene locus_tag LOCUS_16210 gene cheY 9087 8707 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_16210 9466 9233 gene locus_tag LOCUS_16220 9466 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 9630 10025 gene locus_tag LOCUS_16230 gene erpA 9630 10025 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_16230 10295 11083 gene locus_tag LOCUS_16240 10295 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16240 11189 11599 gene locus_tag LOCUS_16250 11189 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 12201 11731 gene locus_tag LOCUS_16260 12201 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 12281 13189 gene locus_tag LOCUS_16270 gene speB 12281 13189 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_16270 15315 13222 gene locus_tag LOCUS_16280 15315 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 16097 15342 gene locus_tag LOCUS_16290 16097 15342 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_16290 16366 16094 gene locus_tag LOCUS_16300 16366 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 18803 16368 gene locus_tag LOCUS_16310 gene gyrA 18803 16368 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_16310 18908 18980 gene locus_tag LOCUS_t00290 18908 18980 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19041 20666 gene locus_tag LOCUS_16320 19041 20666 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_16320 22243 20609 gene locus_tag LOCUS_16330 22243 20609 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144137.1 protein_id gnl|my_center|LOCUS_16330 23664 22279 gene locus_tag LOCUS_16340 23664 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 23823 24407 gene locus_tag LOCUS_16350 23823 24407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 24410 24913 gene locus_tag LOCUS_16360 24410 24913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 24892 26031 gene locus_tag LOCUS_16370 24892 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 26355 26041 gene locus_tag LOCUS_16380 26355 26041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 28639 26372 gene locus_tag LOCUS_16390 28639 26372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 28739 31126 gene locus_tag LOCUS_16400 28739 31126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 31123 32766 gene locus_tag LOCUS_16410 31123 32766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 33797 33066 gene locus_tag LOCUS_16420 33797 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 34623 33952 gene locus_tag LOCUS_16430 34623 33952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 35392 34628 gene locus_tag LOCUS_16440 35392 34628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 36250 35453 gene locus_tag LOCUS_16450 36250 35453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 38255 36243 gene locus_tag LOCUS_16460 38255 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 39078 38317 gene locus_tag LOCUS_16470 39078 38317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 39665 39099 gene locus_tag LOCUS_16480 39665 39099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 39800 41380 gene locus_tag LOCUS_16490 39800 41380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 41377 42168 gene locus_tag LOCUS_16500 41377 42168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 42172 43713 gene locus_tag LOCUS_16510 42172 43713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 43723 45540 gene locus_tag LOCUS_16520 43723 45540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 45962 45687 gene locus_tag LOCUS_16530 45962 45687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 46067 47722 gene locus_tag LOCUS_16540 46067 47722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16540 47848 48483 gene locus_tag LOCUS_16550 47848 48483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 48480 48773 gene locus_tag LOCUS_16560 48480 48773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 48884 49552 gene locus_tag LOCUS_16570 48884 49552 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_16570 49536 49934 gene locus_tag LOCUS_16580 49536 49934 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_16580 49996 50886 gene locus_tag LOCUS_16590 49996 50886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 50883 53204 gene locus_tag LOCUS_16600 50883 53204 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_16600 54626 53265 gene locus_tag LOCUS_16610 54626 53265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 57978 54616 gene locus_tag LOCUS_16620 57978 54616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 58046 58885 gene locus_tag LOCUS_16630 58046 58885 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_16630 58878 59831 gene locus_tag LOCUS_16640 58878 59831 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_16640 60667 59828 gene locus_tag LOCUS_16650 60667 59828 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_16650 61047 60664 gene locus_tag LOCUS_16660 61047 60664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 61084 61332 gene locus_tag LOCUS_16670 61084 61332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 61835 61347 gene locus_tag LOCUS_16680 61835 61347 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919598.1 protein_id gnl|my_center|LOCUS_16680 62460 61906 gene locus_tag LOCUS_16690 62460 61906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 62761 63930 gene locus_tag LOCUS_16700 62761 63930 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_16700 64898 63927 gene locus_tag LOCUS_16710 64898 63927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 66061 64904 gene locus_tag LOCUS_16720 gene chrA 66061 64904 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_16720 66501 66067 gene locus_tag LOCUS_16730 66501 66067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 66566 67084 gene locus_tag LOCUS_16740 66566 67084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 68039 67287 gene locus_tag LOCUS_16750 68039 67287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 69218 68262 gene locus_tag LOCUS_16760 69218 68262 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_16760 70817 69243 gene locus_tag LOCUS_16770 gene cryB 70817 69243 CDS product cryptochrome/photolyase CryB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339023.1 protein_id gnl|my_center|LOCUS_16770 72824 70821 gene locus_tag LOCUS_16780 72824 70821 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_16780 73449 72826 gene locus_tag LOCUS_16790 73449 72826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 73568 74854 gene locus_tag LOCUS_16800 73568 74854 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_16800 75749 74877 gene locus_tag LOCUS_16810 75749 74877 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403636.1 protein_id gnl|my_center|LOCUS_16810 76441 75746 gene locus_tag LOCUS_16820 76441 75746 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_16820 77093 76455 gene locus_tag LOCUS_16830 77093 76455 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704788.1 protein_id gnl|my_center|LOCUS_16830 77120 77644 gene locus_tag LOCUS_16840 77120 77644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 77914 77675 gene locus_tag LOCUS_16850 77914 77675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 78264 77911 gene locus_tag LOCUS_16860 78264 77911 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_16860 78257 78760 gene locus_tag LOCUS_16870 78257 78760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 79487 78741 gene locus_tag LOCUS_16880 79487 78741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 79545 80522 gene locus_tag LOCUS_16890 79545 80522 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618895.1 protein_id gnl|my_center|LOCUS_16890 80938 80549 gene locus_tag LOCUS_16900 80938 80549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 81608 80940 gene locus_tag LOCUS_16910 81608 80940 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_16910 82014 81616 gene locus_tag LOCUS_16920 82014 81616 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_16920 82182 83246 gene locus_tag LOCUS_16930 82182 83246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229405.1 protein_id gnl|my_center|LOCUS_16930 86041 83342 gene locus_tag LOCUS_16940 86041 83342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 86150 86554 gene locus_tag LOCUS_16950 86150 86554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 86579 87208 gene locus_tag LOCUS_16960 86579 87208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 87232 87612 gene locus_tag LOCUS_16970 87232 87612 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090412.1 protein_id gnl|my_center|LOCUS_16970 87720 88022 gene locus_tag LOCUS_16980 87720 88022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 88450 89679 gene locus_tag LOCUS_16990 88450 89679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 91032 91472 gene locus_tag LOCUS_17000 91032 91472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17000 91679 91951 gene locus_tag LOCUS_17010 91679 91951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 92713 92216 gene locus_tag LOCUS_17020 92713 92216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 93383 93853 gene locus_tag LOCUS_17030 93383 93853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043125671.1 protein_id gnl|my_center|LOCUS_17030 94449 94078 gene locus_tag LOCUS_17040 94449 94078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 95057 94422 gene locus_tag LOCUS_17050 95057 94422 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225458.1 protein_id gnl|my_center|LOCUS_17050 95151 96683 gene locus_tag LOCUS_17060 gene istA 95151 96683 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_17060 96640 97230 gene locus_tag LOCUS_17070 96640 97230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17070 97202 97492 gene locus_tag LOCUS_17080 97202 97492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17080 >Feature sequence13 <1 837 gene locus_tag LOCUS_17090 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054993407.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 910 2613 gene locus_tag LOCUS_17100 910 2613 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_17100 2973 2734 gene locus_tag LOCUS_17110 2973 2734 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_17110 3803 3024 gene locus_tag LOCUS_17120 3803 3024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723917.1 protein_id gnl|my_center|LOCUS_17120 4672 3800 gene locus_tag LOCUS_17130 4672 3800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_17130 4950 4738 gene locus_tag LOCUS_17140 4950 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4971 5927 gene locus_tag LOCUS_17150 4971 5927 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_17150 6552 5851 gene locus_tag LOCUS_17160 6552 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 7072 6557 gene locus_tag LOCUS_17170 7072 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 7335 7075 gene locus_tag LOCUS_17180 7335 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 8503 7328 gene locus_tag LOCUS_17190 8503 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 9156 8500 gene locus_tag LOCUS_17200 9156 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 9628 9137 gene locus_tag LOCUS_17210 9628 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 10305 9625 gene locus_tag LOCUS_17220 10305 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 10399 10992 gene locus_tag LOCUS_17230 10399 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11776 10958 gene locus_tag LOCUS_17240 11776 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 11821 13809 gene locus_tag LOCUS_17250 11821 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 14144 13866 gene locus_tag LOCUS_17260 14144 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17260 14618 14217 gene locus_tag LOCUS_17270 14618 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17270 14873 14694 gene locus_tag LOCUS_17280 14873 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 14829 14993 gene locus_tag LOCUS_17290 14829 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 16144 15152 gene locus_tag LOCUS_17300 16144 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 16806 17888 gene locus_tag LOCUS_17310 16806 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 19907 18078 gene locus_tag LOCUS_17320 gene aspS 19907 18078 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940622.1 protein_id gnl|my_center|LOCUS_17320 20015 21328 gene locus_tag LOCUS_17330 gene asnS 20015 21328 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_17330 21325 21528 gene locus_tag LOCUS_17340 21325 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 21525 21965 gene locus_tag LOCUS_17350 21525 21965 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_17350 22457 21975 gene locus_tag LOCUS_17360 22457 21975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 23879 22617 gene locus_tag LOCUS_17370 23879 22617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 24735 23959 gene locus_tag LOCUS_17380 24735 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 25481 24705 gene locus_tag LOCUS_17390 25481 24705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 25797 25486 gene locus_tag LOCUS_17400 25797 25486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 26899 25871 gene locus_tag LOCUS_17410 26899 25871 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_17410 27592 26936 gene locus_tag LOCUS_17420 27592 26936 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_17420 28500 27589 gene locus_tag LOCUS_17430 28500 27589 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246020.1 protein_id gnl|my_center|LOCUS_17430 28624 28989 gene locus_tag LOCUS_17440 28624 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 30271 28994 gene locus_tag LOCUS_17450 30271 28994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 31541 30276 gene locus_tag LOCUS_17460 31541 30276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 32317 31541 gene locus_tag LOCUS_17470 gene nusB 32317 31541 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141336.1 protein_id gnl|my_center|LOCUS_17470 33669 32323 gene locus_tag LOCUS_17480 gene accC 33669 32323 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142010.1 protein_id gnl|my_center|LOCUS_17480 34129 33674 gene locus_tag LOCUS_17490 34129 33674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 34691 34134 gene locus_tag LOCUS_17500 gene efp 34691 34134 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_17500 35347 34724 gene locus_tag LOCUS_17510 35347 34724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 35737 35447 gene locus_tag LOCUS_17520 35737 35447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 36414 35824 gene locus_tag LOCUS_17530 36414 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 37415 36744 gene locus_tag LOCUS_17540 37415 36744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 38349 37738 gene locus_tag LOCUS_17550 38349 37738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 39815 38394 gene locus_tag LOCUS_17560 39815 38394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 41395 39812 gene locus_tag LOCUS_17570 41395 39812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 41997 41392 gene locus_tag LOCUS_17580 41997 41392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 43823 42006 gene locus_tag LOCUS_17590 43823 42006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 43860 44621 gene locus_tag LOCUS_17600 43860 44621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 44704 46884 gene locus_tag LOCUS_17610 44704 46884 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_17610 46881 47456 gene locus_tag LOCUS_17620 gene rdgB 46881 47456 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172548.1 protein_id gnl|my_center|LOCUS_17620 49280 47463 gene locus_tag LOCUS_17630 49280 47463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 49402 50397 gene locus_tag LOCUS_17640 49402 50397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 51619 50408 gene locus_tag LOCUS_17650 51619 50408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_17650 53081 51645 gene locus_tag LOCUS_17660 53081 51645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 53245 54990 gene locus_tag LOCUS_17670 gene accC 53245 54990 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_17670 54987 56591 gene locus_tag LOCUS_17680 54987 56591 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_17680 56588 57034 gene locus_tag LOCUS_17690 gene mce 56588 57034 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_17690 57077 58228 gene locus_tag LOCUS_17700 gene sucC 57077 58228 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_17700 58253 59152 gene locus_tag LOCUS_17710 gene sucD 58253 59152 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114639.1 protein_id gnl|my_center|LOCUS_17710 59172 60179 gene locus_tag LOCUS_17720 gene corA 59172 60179 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_17720 60176 61378 gene locus_tag LOCUS_17730 60176 61378 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728145.1 protein_id gnl|my_center|LOCUS_17730 61378 62592 gene locus_tag LOCUS_17740 61378 62592 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_17740 63701 62670 gene locus_tag LOCUS_17750 63701 62670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 64530 63847 gene locus_tag LOCUS_17760 64530 63847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 66208 64535 gene locus_tag LOCUS_17770 66208 64535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 66927 66214 gene locus_tag LOCUS_17780 66927 66214 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_17780 67942 66947 gene locus_tag LOCUS_17790 67942 66947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_17790 68173 69165 gene locus_tag LOCUS_17800 68173 69165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 69465 69190 gene locus_tag LOCUS_17810 69465 69190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 71039 69462 gene locus_tag LOCUS_17820 71039 69462 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_17820 72076 71036 gene locus_tag LOCUS_17830 gene kdd 72076 71036 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_17830 72937 72083 gene locus_tag LOCUS_17840 72937 72083 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_17840 73164 73367 gene locus_tag LOCUS_17850 73164 73367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 73540 73842 gene locus_tag LOCUS_17860 73540 73842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 74151 73846 gene locus_tag LOCUS_17870 74151 73846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 74041 74757 gene locus_tag LOCUS_17880 74041 74757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17880 75950 74709 gene locus_tag LOCUS_17890 75950 74709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 76148 76576 gene locus_tag LOCUS_17900 76148 76576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17900 76579 76758 gene locus_tag LOCUS_17910 76579 76758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 77085 76897 gene locus_tag LOCUS_17920 77085 76897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 77782 77381 gene locus_tag LOCUS_17930 77782 77381 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_17930 78586 77810 gene locus_tag LOCUS_17940 78586 77810 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_17940 80139 78583 gene locus_tag LOCUS_17950 80139 78583 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_17950 80510 80367 gene locus_tag LOCUS_17960 80510 80367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 81683 80970 gene locus_tag LOCUS_17970 81683 80970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 81937 82368 gene locus_tag LOCUS_17980 81937 82368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 83795 82377 gene locus_tag LOCUS_17990 83795 82377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 85268 84126 gene locus_tag LOCUS_18000 85268 84126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_18000 87187 85343 gene locus_tag LOCUS_18010 87187 85343 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_18010 90636 87184 gene locus_tag LOCUS_18020 gene metH 90636 87184 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_18020 91051 91590 gene locus_tag LOCUS_18030 91051 91590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 91747 92052 gene locus_tag LOCUS_18040 91747 92052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 92253 92498 gene locus_tag LOCUS_18050 92253 92498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 92571 93095 gene locus_tag LOCUS_18060 92571 93095 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808562.1 protein_id gnl|my_center|LOCUS_18060 93095 93523 gene locus_tag LOCUS_18070 93095 93523 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_18070 93840 93520 gene locus_tag LOCUS_18080 93840 93520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131738742.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence14 256 951 gene locus_tag LOCUS_18090 256 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 948 3338 gene locus_tag LOCUS_18100 948 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3418 3762 gene locus_tag LOCUS_18110 3418 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 3775 4326 gene locus_tag LOCUS_18120 3775 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5303 4272 gene locus_tag LOCUS_18130 5303 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 6152 5340 gene locus_tag LOCUS_18140 6152 5340 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_18140 6203 7108 gene locus_tag LOCUS_18150 gene rapZ 6203 7108 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_18150 7108 8415 gene locus_tag LOCUS_18160 7108 8415 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_18160 9183 8425 gene locus_tag LOCUS_18170 9183 8425 CDS product Lpg2936 family Dot/Icm T4SS effector methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948621.1 protein_id gnl|my_center|LOCUS_18170 10535 9180 gene locus_tag LOCUS_18180 10535 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 12125 10554 gene locus_tag LOCUS_18190 12125 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 12374 12144 gene locus_tag LOCUS_18200 gene rpmE 12374 12144 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_18200 12471 15110 gene locus_tag LOCUS_18210 gene secA 12471 15110 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_18210 15290 15090 gene locus_tag LOCUS_18220 15290 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 15289 16260 gene locus_tag LOCUS_18230 gene prfB 15289 16260 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141233.1 protein_id gnl|my_center|LOCUS_18230 16271 17290 gene locus_tag LOCUS_18240 gene rfaE1 16271 17290 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_18240 17287 17781 gene locus_tag LOCUS_18250 gene rfaE2 17287 17781 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142636.1 protein_id gnl|my_center|LOCUS_18250 17786 18304 gene locus_tag LOCUS_18260 17786 18304 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144250.1 protein_id gnl|my_center|LOCUS_18260 18301 19629 gene locus_tag LOCUS_18270 18301 19629 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_18270 19626 20759 gene locus_tag LOCUS_18280 19626 20759 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143105.1 protein_id gnl|my_center|LOCUS_18280 20756 21235 gene locus_tag LOCUS_18290 20756 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 21301 21603 gene locus_tag LOCUS_18300 21301 21603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 21630 23027 gene locus_tag LOCUS_18310 21630 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 23080 23868 gene locus_tag LOCUS_18320 gene larE 23080 23868 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_18320 23865 24623 gene locus_tag LOCUS_18330 gene larB 23865 24623 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 protein_id gnl|my_center|LOCUS_18330 24620 25840 gene locus_tag LOCUS_18340 gene larC 24620 25840 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_18340 25888 26412 gene locus_tag LOCUS_18350 25888 26412 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173741.1 protein_id gnl|my_center|LOCUS_18350 27053 26430 gene locus_tag LOCUS_18360 27053 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 27234 27995 gene locus_tag LOCUS_18370 27234 27995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 28077 28850 gene locus_tag LOCUS_18380 gene xth 28077 28850 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_18380 29529 28801 gene locus_tag LOCUS_18390 gene ispD 29529 28801 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_18390 29904 29539 gene locus_tag LOCUS_18400 29904 29539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 31151 29970 gene locus_tag LOCUS_18410 31151 29970 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_18410 32480 31161 gene locus_tag LOCUS_18420 32480 31161 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_18420 33333 32467 gene locus_tag LOCUS_18430 33333 32467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 33484 34464 gene locus_tag LOCUS_18440 33484 34464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 34518 37049 gene locus_tag LOCUS_18450 gene mutS 34518 37049 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_18450 37708 37094 gene locus_tag LOCUS_18460 37708 37094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 38696 37803 gene locus_tag LOCUS_18470 38696 37803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 39988 38699 gene locus_tag LOCUS_18480 39988 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 40293 39982 gene locus_tag LOCUS_18490 40293 39982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 40606 40190 gene locus_tag LOCUS_18500 40606 40190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 41096 40860 gene locus_tag LOCUS_18510 41096 40860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 41544 41302 gene locus_tag LOCUS_18520 41544 41302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 42151 41774 gene locus_tag LOCUS_18530 42151 41774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 42697 42419 gene locus_tag LOCUS_18540 42697 42419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 42872 43642 gene locus_tag LOCUS_18550 42872 43642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 43693 44847 gene locus_tag LOCUS_18560 43693 44847 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_18560 44942 44870 gene locus_tag LOCUS_t00300 44942 44870 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45564 44983 gene locus_tag LOCUS_18570 gene pth 45564 44983 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_18570 46573 45572 gene locus_tag LOCUS_18580 46573 45572 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_18580 47994 46570 gene locus_tag LOCUS_18590 47994 46570 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_18590 49103 47991 gene locus_tag LOCUS_18600 gene rsgA 49103 47991 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_18600 50173 49103 gene locus_tag LOCUS_18610 50173 49103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 51567 50170 gene locus_tag LOCUS_18620 gene rsmB 51567 50170 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_18620 51801 51580 gene locus_tag LOCUS_18630 51801 51580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 52238 51822 gene locus_tag LOCUS_18640 52238 51822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 53654 52731 gene locus_tag LOCUS_18650 53654 52731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 53885 53661 gene locus_tag LOCUS_18660 53885 53661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 54043 55395 gene locus_tag LOCUS_18670 54043 55395 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229206.1 protein_id gnl|my_center|LOCUS_18670 55476 56600 gene locus_tag LOCUS_18680 gene gcvT 55476 56600 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_18680 56597 56965 gene locus_tag LOCUS_18690 gene gcvH 56597 56965 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_18690 56965 58353 gene locus_tag LOCUS_18700 gene gcvPA 56965 58353 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_18700 58346 59806 gene locus_tag LOCUS_18710 gene gcvPB 58346 59806 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_18710 60685 59816 gene locus_tag LOCUS_18720 60685 59816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 60757 61458 gene locus_tag LOCUS_18730 60757 61458 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929254.1 protein_id gnl|my_center|LOCUS_18730 62251 61439 gene locus_tag LOCUS_18740 62251 61439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 63966 62254 gene locus_tag LOCUS_18750 63966 62254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 67004 63966 gene locus_tag LOCUS_18760 67004 63966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 66982 68283 gene locus_tag LOCUS_18770 66982 68283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 68679 68299 gene locus_tag LOCUS_18780 gene rplL 68679 68299 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_18780 69288 68761 gene locus_tag LOCUS_18790 gene rplJ 69288 68761 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_18790 70292 69582 gene locus_tag LOCUS_18800 gene rplA 70292 69582 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810196.1 protein_id gnl|my_center|LOCUS_18800 70848 70423 gene locus_tag LOCUS_18810 gene rplK 70848 70423 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141598.1 protein_id gnl|my_center|LOCUS_18810 71450 70890 gene locus_tag LOCUS_18820 gene nusG 71450 70890 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_18820 71788 71477 gene locus_tag LOCUS_18830 71788 71477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 71892 71819 gene locus_tag LOCUS_t00310 71892 71819 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 72032 72937 gene locus_tag LOCUS_18840 72032 72937 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_18840 73180 73608 gene locus_tag LOCUS_18850 gene speD 73180 73608 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583767.1 protein_id gnl|my_center|LOCUS_18850 73676 74740 gene locus_tag LOCUS_18860 73676 74740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 76087 74756 gene locus_tag LOCUS_18870 gene miaB 76087 74756 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_18870 76890 76087 gene locus_tag LOCUS_18880 gene panB 76890 76087 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_18880 78898 76952 gene locus_tag LOCUS_18890 78898 76952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 79036 79311 gene locus_tag LOCUS_18900 79036 79311 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811866.1 protein_id gnl|my_center|LOCUS_18900 79301 79945 gene locus_tag LOCUS_18910 gene gmk 79301 79945 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_18910 79968 80171 gene locus_tag LOCUS_18920 79968 80171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 80180 81367 gene locus_tag LOCUS_18930 gene coaBC 80180 81367 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_18930 81319 83544 gene locus_tag LOCUS_18940 gene priA 81319 83544 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140029.1 protein_id gnl|my_center|LOCUS_18940 84009 83644 gene locus_tag LOCUS_18950 84009 83644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 84075 84425 gene locus_tag LOCUS_18960 84075 84425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18960 84495 84722 gene locus_tag LOCUS_18970 84495 84722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18970 84800 85885 gene locus_tag LOCUS_18980 gene recA 84800 85885 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_18980 86600 85893 gene locus_tag LOCUS_18990 86600 85893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_18990 87721 86606 gene locus_tag LOCUS_19000 87721 86606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 87799 87872 gene locus_tag LOCUS_t00320 87799 87872 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <88777 88213 gene locus_tag LOCUS_19010 <88777 88213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence15 77 1756 gene locus_tag LOCUS_19020 77 1756 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941660.1 protein_id gnl|my_center|LOCUS_19020 1877 2341 gene locus_tag LOCUS_19030 1877 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2410 3657 gene locus_tag LOCUS_19040 2410 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4759 3914 gene locus_tag LOCUS_19050 4759 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 5445 4870 gene locus_tag LOCUS_19060 5445 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 6584 5433 gene locus_tag LOCUS_19070 6584 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 7330 6581 gene locus_tag LOCUS_19080 gene tmpR 7330 6581 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_19080 7686 7327 gene locus_tag LOCUS_19090 7686 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 8462 7683 gene locus_tag LOCUS_19100 8462 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 9953 8739 gene locus_tag LOCUS_19110 gene rocD 9953 8739 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_19110 10877 9960 gene locus_tag LOCUS_19120 10877 9960 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086717.1 protein_id gnl|my_center|LOCUS_19120 12089 10881 gene locus_tag LOCUS_19130 12089 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 14105 12246 gene locus_tag LOCUS_19140 14105 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 14239 15363 gene locus_tag LOCUS_19150 14239 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 15360 15731 gene locus_tag LOCUS_19160 15360 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 15746 16201 gene locus_tag LOCUS_19170 15746 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 16279 17022 gene locus_tag LOCUS_19180 16279 17022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 17632 17024 gene locus_tag LOCUS_19190 17632 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 18348 17749 gene locus_tag LOCUS_19200 18348 17749 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928520.1 protein_id gnl|my_center|LOCUS_19200 19728 18496 gene locus_tag LOCUS_19210 19728 18496 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_19210 20358 19774 gene locus_tag LOCUS_19220 20358 19774 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_19220 20469 20397 gene locus_tag LOCUS_t00330 20469 20397 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20548 21657 gene locus_tag LOCUS_19230 20548 21657 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228247.1 protein_id gnl|my_center|LOCUS_19230 21654 22958 gene locus_tag LOCUS_19240 gene hemL 21654 22958 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_19240 22955 23650 gene locus_tag LOCUS_19250 22955 23650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_19250 23647 24948 gene locus_tag LOCUS_19260 23647 24948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 24945 26195 gene locus_tag LOCUS_19270 24945 26195 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_19270 26195 27424 gene locus_tag LOCUS_19280 26195 27424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_19280 27421 28659 gene locus_tag LOCUS_19290 gene skiZ 27421 28659 CDS product sporulation-delaying-protein transporter subunit SkiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232354.1 protein_id gnl|my_center|LOCUS_19290 28656 29546 gene locus_tag LOCUS_19300 gene panC 28656 29546 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084897.1 protein_id gnl|my_center|LOCUS_19300 29547 30212 gene locus_tag LOCUS_19310 29547 30212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19310 30316 30723 gene locus_tag LOCUS_19320 gene flgB 30316 30723 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_19320 30726 31115 gene locus_tag LOCUS_19330 gene flgC 30726 31115 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_19330 31121 31531 gene locus_tag LOCUS_19340 31121 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 31569 33149 gene locus_tag LOCUS_19350 gene fliF 31569 33149 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_19350 33153 34166 gene locus_tag LOCUS_19360 gene fliG 33153 34166 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_19360 34171 34983 gene locus_tag LOCUS_19370 34171 34983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 34980 36302 gene locus_tag LOCUS_19380 gene fliI 34980 36302 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_19380 36302 36769 gene locus_tag LOCUS_19390 36302 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 36822 38366 gene locus_tag LOCUS_19400 36822 38366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 38382 38918 gene locus_tag LOCUS_19410 gene flgD 38382 38918 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870071.1 protein_id gnl|my_center|LOCUS_19410 38915 39289 gene locus_tag LOCUS_19420 38915 39289 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_19420 39372 41903 gene locus_tag LOCUS_19430 39372 41903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 41909 42880 gene locus_tag LOCUS_19440 41909 42880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 42870 43187 gene locus_tag LOCUS_19450 42870 43187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 43184 43402 gene locus_tag LOCUS_19460 43184 43402 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816224.1 protein_id gnl|my_center|LOCUS_19460 43493 44185 gene locus_tag LOCUS_19470 43493 44185 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081357594.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19470 44190 44954 gene locus_tag LOCUS_19480 44190 44954 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_19480 44961 45533 gene locus_tag LOCUS_19490 44961 45533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 45539 46555 gene locus_tag LOCUS_19500 gene fliM 45539 46555 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_19500 46548 47708 gene locus_tag LOCUS_19510 gene fliY 46548 47708 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460753.1 protein_id gnl|my_center|LOCUS_19510 47713 48072 gene locus_tag LOCUS_19520 47713 48072 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_19520 48078 48632 gene locus_tag LOCUS_19530 48078 48632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 48625 49386 gene locus_tag LOCUS_19540 gene fliP 48625 49386 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_19540 49383 49652 gene locus_tag LOCUS_19550 gene fliQ 49383 49652 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_19550 49661 50446 gene locus_tag LOCUS_19560 gene fliR 49661 50446 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097739.1 protein_id gnl|my_center|LOCUS_19560 50450 51499 gene locus_tag LOCUS_19570 gene flhB 50450 51499 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_19570 51648 51451 gene locus_tag LOCUS_19580 51648 51451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 51602 53614 gene locus_tag LOCUS_19590 gene flhA 51602 53614 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359159.1 protein_id gnl|my_center|LOCUS_19590 53611 54387 gene locus_tag LOCUS_19600 53611 54387 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392322.1 protein_id gnl|my_center|LOCUS_19600 54391 56442 gene locus_tag LOCUS_19610 54391 56442 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_19610 56454 57077 gene locus_tag LOCUS_19620 56454 57077 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460745.1 protein_id gnl|my_center|LOCUS_19620 57089 57583 gene locus_tag LOCUS_19630 57089 57583 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902687.1 protein_id gnl|my_center|LOCUS_19630 57580 57816 gene locus_tag LOCUS_19640 57580 57816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 57885 58682 gene locus_tag LOCUS_19650 gene whiG 57885 58682 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_19650 58679 59161 gene locus_tag LOCUS_19660 58679 59161 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_19660 59154 60416 gene locus_tag LOCUS_19670 59154 60416 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892609.1 protein_id gnl|my_center|LOCUS_19670 60413 61000 gene locus_tag LOCUS_19680 60413 61000 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_19680 60997 61413 gene locus_tag LOCUS_19690 60997 61413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 63495 61399 gene locus_tag LOCUS_19700 gene ligA 63495 61399 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_19700 63686 64924 gene locus_tag LOCUS_19710 63686 64924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 65068 66318 gene locus_tag LOCUS_19720 65068 66318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 66748 66362 gene locus_tag LOCUS_19730 66748 66362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 66782 70015 gene locus_tag LOCUS_19740 gene addB 66782 70015 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_19740 70005 73574 gene locus_tag LOCUS_19750 gene addA 70005 73574 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_19750 74460 73630 gene locus_tag LOCUS_19760 74460 73630 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_19760 75361 74753 gene locus_tag LOCUS_19770 75361 74753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 75290 75577 gene locus_tag LOCUS_19780 75290 75577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 76520 75687 gene locus_tag LOCUS_19790 gene hag 76520 75687 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_19790 77527 76694 gene locus_tag LOCUS_19800 gene hag 77527 76694 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_19800 77739 78212 gene locus_tag LOCUS_19810 77739 78212 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444187.1 protein_id gnl|my_center|LOCUS_19810 78246 78854 gene locus_tag LOCUS_19820 78246 78854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 78851 81754 gene locus_tag LOCUS_19830 78851 81754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 82343 81756 gene locus_tag LOCUS_19840 82343 81756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 82723 82340 gene locus_tag LOCUS_19850 82723 82340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 82824 83510 gene locus_tag LOCUS_19860 82824 83510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence16 142 387 gene locus_tag LOCUS_19870 142 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 644 889 gene locus_tag LOCUS_19880 644 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1741 953 gene locus_tag LOCUS_19890 1741 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 3445 1976 gene locus_tag LOCUS_19900 3445 1976 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_19900 3555 4589 gene locus_tag LOCUS_19910 3555 4589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_19910 4586 5494 gene locus_tag LOCUS_19920 4586 5494 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_19920 5491 7203 gene locus_tag LOCUS_19930 5491 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7249 8610 gene locus_tag LOCUS_19940 7249 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 8607 9944 gene locus_tag LOCUS_19950 gene fliI 8607 9944 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 protein_id gnl|my_center|LOCUS_19950 10158 11510 gene locus_tag LOCUS_19960 10158 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 12859 11627 gene locus_tag LOCUS_19970 12859 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 15546 12886 gene locus_tag LOCUS_19980 15546 12886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 16911 15574 gene locus_tag LOCUS_19990 16911 15574 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941180.1 protein_id gnl|my_center|LOCUS_19990 17654 16917 gene locus_tag LOCUS_20000 17654 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 19075 17684 gene locus_tag LOCUS_20010 19075 17684 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_20010 20499 19075 gene locus_tag LOCUS_20020 20499 19075 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_20020 21473 20547 gene locus_tag LOCUS_20030 21473 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 21577 22611 gene locus_tag LOCUS_20040 21577 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 22618 23769 gene locus_tag LOCUS_20050 22618 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 23772 24317 gene locus_tag LOCUS_20060 23772 24317 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870074.1 protein_id gnl|my_center|LOCUS_20060 24379 25143 gene locus_tag LOCUS_20070 24379 25143 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943783.1 protein_id gnl|my_center|LOCUS_20070 25173 25955 gene locus_tag LOCUS_20080 gene flgG 25173 25955 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_20080 25969 26316 gene locus_tag LOCUS_20090 25969 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 26352 26693 gene locus_tag LOCUS_20100 26352 26693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 26704 27210 gene locus_tag LOCUS_20110 26704 27210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 27242 28804 gene locus_tag LOCUS_20120 gene flgK 27242 28804 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_20120 28814 29722 gene locus_tag LOCUS_20130 gene flgL 28814 29722 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_20130 29728 30192 gene locus_tag LOCUS_20140 29728 30192 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943666.1 protein_id gnl|my_center|LOCUS_20140 30197 30571 gene locus_tag LOCUS_20150 30197 30571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 30683 32005 gene locus_tag LOCUS_20160 gene flhF 30683 32005 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392312.1 protein_id gnl|my_center|LOCUS_20160 32005 32880 gene locus_tag LOCUS_20170 32005 32880 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_20170 33721 32915 gene locus_tag LOCUS_20180 33721 32915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 33860 35551 gene locus_tag LOCUS_20190 gene recN 33860 35551 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_20190 35535 36029 gene locus_tag LOCUS_20200 35535 36029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 36026 36520 gene locus_tag LOCUS_20210 36026 36520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 37133 36531 gene locus_tag LOCUS_20220 37133 36531 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_20220 38345 37281 gene locus_tag LOCUS_20230 38345 37281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 41543 38379 gene locus_tag LOCUS_20240 41543 38379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 42727 41708 gene locus_tag LOCUS_20250 42727 41708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 42841 43440 gene locus_tag LOCUS_20260 42841 43440 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_20260 43523 43939 gene locus_tag LOCUS_20270 43523 43939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 44200 43958 gene locus_tag LOCUS_20280 44200 43958 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780840.1 protein_id gnl|my_center|LOCUS_20280 44330 45094 gene locus_tag LOCUS_20290 44330 45094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 46474 45122 gene locus_tag LOCUS_20300 46474 45122 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_20300 47910 46471 gene locus_tag LOCUS_20310 47910 46471 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_20310 48091 47921 gene locus_tag LOCUS_20320 48091 47921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 48065 48895 gene locus_tag LOCUS_20330 gene hslO 48065 48895 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142278.1 protein_id gnl|my_center|LOCUS_20330 48915 49586 gene locus_tag LOCUS_20340 48915 49586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 49583 50029 gene locus_tag LOCUS_20350 49583 50029 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391692.1 protein_id gnl|my_center|LOCUS_20350 51466 50030 gene locus_tag LOCUS_20360 51466 50030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 52483 51536 gene locus_tag LOCUS_20370 gene ccsB 52483 51536 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_20370 54441 52480 gene locus_tag LOCUS_20380 54441 52480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 54604 55890 gene locus_tag LOCUS_20390 gene hemA 54604 55890 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_20390 56647 55859 gene locus_tag LOCUS_20400 56647 55859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 57564 56644 gene locus_tag LOCUS_20410 57564 56644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 58400 57561 gene locus_tag LOCUS_20420 gene phnC 58400 57561 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808589.1 protein_id gnl|my_center|LOCUS_20420 59305 58397 gene locus_tag LOCUS_20430 59305 58397 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_20430 60744 59317 gene locus_tag LOCUS_20440 60744 59317 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_20440 61407 60763 gene locus_tag LOCUS_20450 61407 60763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 61504 61926 gene locus_tag LOCUS_20460 61504 61926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 61949 62923 gene locus_tag LOCUS_20470 61949 62923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 63032 63784 gene locus_tag LOCUS_20480 63032 63784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 65896 63800 gene locus_tag LOCUS_20490 65896 63800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 67917 65938 gene locus_tag LOCUS_20500 gene gyrB 67917 65938 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_20500 68089 69279 gene locus_tag LOCUS_20510 68089 69279 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_20510 71187 69163 gene locus_tag LOCUS_20520 71187 69163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 71191 71721 gene locus_tag LOCUS_20530 71191 71721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 73070 71709 gene locus_tag LOCUS_20540 73070 71709 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870047.1 protein_id gnl|my_center|LOCUS_20540 74367 73114 gene locus_tag LOCUS_20550 74367 73114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 74849 74364 gene locus_tag LOCUS_20560 74849 74364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 75119 76102 gene locus_tag LOCUS_20570 75119 76102 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132585.1 protein_id gnl|my_center|LOCUS_20570 76903 76076 gene locus_tag LOCUS_20580 76903 76076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 77946 76885 gene locus_tag LOCUS_20590 77946 76885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 78080 78286 gene locus_tag LOCUS_20600 78080 78286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20600 78356 78676 gene locus_tag LOCUS_20610 78356 78676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20610 78797 79360 gene locus_tag LOCUS_20620 78797 79360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 79551 80531 gene locus_tag LOCUS_20630 79551 80531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 81208 80483 gene locus_tag LOCUS_20640 81208 80483 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_20640 81441 81941 gene locus_tag LOCUS_20650 81441 81941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence17 1405 1893 gene locus_tag LOCUS_20660 gene ispF 1405 1893 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_20660 1992 2132 gene locus_tag LOCUS_20670 1992 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2138 2590 gene locus_tag LOCUS_20680 2138 2590 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618785.1 protein_id gnl|my_center|LOCUS_20680 4063 2855 gene locus_tag LOCUS_20690 gene pcaF 4063 2855 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096753.1 protein_id gnl|my_center|LOCUS_20690 5290 4091 gene locus_tag LOCUS_20700 5290 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 6126 5287 gene locus_tag LOCUS_20710 6126 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 7027 6215 gene locus_tag LOCUS_20720 gene paaG 7027 6215 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_20720 7837 7040 gene locus_tag LOCUS_20730 7837 7040 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_20730 8526 7834 gene locus_tag LOCUS_20740 8526 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 9509 8526 gene locus_tag LOCUS_20750 gene menB 9509 8526 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639989.1 protein_id gnl|my_center|LOCUS_20750 9844 9506 gene locus_tag LOCUS_20760 9844 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 9983 10675 gene locus_tag LOCUS_20770 9983 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10672 11586 gene locus_tag LOCUS_20780 10672 11586 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_20780 11654 12979 gene locus_tag LOCUS_20790 gene pepP 11654 12979 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_20790 13660 12983 gene locus_tag LOCUS_20800 13660 12983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 14790 13753 gene locus_tag LOCUS_20810 gene pdhA 14790 13753 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_20810 15673 14813 gene locus_tag LOCUS_20820 15673 14813 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920726.1 protein_id gnl|my_center|LOCUS_20820 15747 16862 gene locus_tag LOCUS_20830 15747 16862 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 protein_id gnl|my_center|LOCUS_20830 17883 16849 gene locus_tag LOCUS_20840 gene mltG 17883 16849 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_20840 20157 17956 gene locus_tag LOCUS_20850 20157 17956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 20272 21504 gene locus_tag LOCUS_20860 20272 21504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 21537 22805 gene locus_tag LOCUS_20870 21537 22805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 24339 22690 gene locus_tag LOCUS_20880 24339 22690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 protein_id gnl|my_center|LOCUS_20880 25699 24368 gene locus_tag LOCUS_20890 25699 24368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_20890 27488 25686 gene locus_tag LOCUS_20900 27488 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 29026 27563 gene locus_tag LOCUS_20910 29026 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 29666 29088 gene locus_tag LOCUS_20920 29666 29088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 29756 30082 gene locus_tag LOCUS_20930 29756 30082 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633725.1 protein_id gnl|my_center|LOCUS_20930 30573 30079 gene locus_tag LOCUS_20940 30573 30079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 31187 30549 gene locus_tag LOCUS_20950 31187 30549 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243167.1 protein_id gnl|my_center|LOCUS_20950 33386 31188 gene locus_tag LOCUS_20960 33386 31188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 33551 33904 gene locus_tag LOCUS_20970 33551 33904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 33926 35254 gene locus_tag LOCUS_20980 33926 35254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 35364 36536 gene locus_tag LOCUS_20990 35364 36536 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_20990 36580 39108 gene locus_tag LOCUS_21000 36580 39108 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_21000 39110 40522 gene locus_tag LOCUS_21010 39110 40522 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_21010 40571 42013 gene locus_tag LOCUS_21020 40571 42013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 42092 43171 gene locus_tag LOCUS_21030 gene apbC 42092 43171 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_21030 43181 43741 gene locus_tag LOCUS_21040 43181 43741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 44760 43801 gene locus_tag LOCUS_21050 44760 43801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 46316 44916 gene locus_tag LOCUS_21060 46316 44916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 46469 47719 gene locus_tag LOCUS_21070 46469 47719 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_21070 48364 47753 gene locus_tag LOCUS_21080 48364 47753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 49639 48377 gene locus_tag LOCUS_21090 49639 48377 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_21090 49708 50037 gene locus_tag LOCUS_21100 49708 50037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 50671 50045 gene locus_tag LOCUS_21110 50671 50045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 51816 50668 gene locus_tag LOCUS_21120 51816 50668 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_21120 53696 51813 gene locus_tag LOCUS_21130 53696 51813 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_21130 54913 53693 gene locus_tag LOCUS_21140 54913 53693 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_21140 55635 54910 gene locus_tag LOCUS_21150 55635 54910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 56723 55632 gene locus_tag LOCUS_21160 gene wlbD 56723 55632 CDS product O-antigen biosynthesis protein WlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447875.1 protein_id gnl|my_center|LOCUS_21160 57856 56720 gene locus_tag LOCUS_21170 57856 56720 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530155.1 protein_id gnl|my_center|LOCUS_21170 58452 57853 gene locus_tag LOCUS_21180 58452 57853 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_21180 59435 58449 gene locus_tag LOCUS_21190 59435 58449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21190 59565 60308 gene locus_tag LOCUS_21200 59565 60308 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_21200 60328 60549 gene locus_tag LOCUS_21210 60328 60549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 60546 62753 gene locus_tag LOCUS_21220 60546 62753 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228865.1 protein_id gnl|my_center|LOCUS_21220 62854 63615 gene locus_tag LOCUS_21230 62854 63615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 64242 63751 gene locus_tag LOCUS_21240 64242 63751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 65581 64421 gene locus_tag LOCUS_21250 65581 64421 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_21250 66558 65578 gene locus_tag LOCUS_21260 66558 65578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 66663 68363 gene locus_tag LOCUS_21270 66663 68363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 69113 68379 gene locus_tag LOCUS_21280 69113 68379 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_21280 69741 69166 gene locus_tag LOCUS_21290 69741 69166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 70219 69722 gene locus_tag LOCUS_21300 70219 69722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 71471 70314 gene locus_tag LOCUS_21310 71471 70314 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_21310 72502 71486 gene locus_tag LOCUS_21320 gene glpX 72502 71486 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632957.1 protein_id gnl|my_center|LOCUS_21320 74116 72545 gene locus_tag LOCUS_21330 74116 72545 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142234.1 protein_id gnl|my_center|LOCUS_21330 75925 74126 gene locus_tag LOCUS_21340 gene pyk 75925 74126 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080342.1 protein_id gnl|my_center|LOCUS_21340 77235 75955 gene locus_tag LOCUS_21350 gene eno 77235 75955 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_21350 77545 77237 gene locus_tag LOCUS_21360 77545 77237 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence18 1702 878 gene locus_tag LOCUS_21370 1702 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3392 1695 gene locus_tag LOCUS_21380 3392 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 3536 3610 gene locus_tag LOCUS_t00340 3536 3610 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3781 6045 gene locus_tag LOCUS_21390 3781 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6130 7743 gene locus_tag LOCUS_21400 6130 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 8250 7759 gene locus_tag LOCUS_21410 8250 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 8676 9629 gene locus_tag LOCUS_21420 8676 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 11424 9679 gene locus_tag LOCUS_21430 11424 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 12248 11457 gene locus_tag LOCUS_21440 12248 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 12458 12838 gene locus_tag LOCUS_21450 12458 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 14172 12856 gene locus_tag LOCUS_21460 14172 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 14455 15141 gene locus_tag LOCUS_21470 14455 15141 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481612.1 protein_id gnl|my_center|LOCUS_21470 15144 15983 gene locus_tag LOCUS_21480 15144 15983 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086566.1 protein_id gnl|my_center|LOCUS_21480 15995 17749 gene locus_tag LOCUS_21490 15995 17749 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_21490 17746 18321 gene locus_tag LOCUS_21500 17746 18321 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_21500 18328 18711 gene locus_tag LOCUS_21510 18328 18711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 18723 19322 gene locus_tag LOCUS_21520 18723 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 19319 19522 gene locus_tag LOCUS_21530 19319 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 19522 20106 gene locus_tag LOCUS_21540 gene scuA 19522 20106 CDS product cytochrome c oxidase assembly accessory protein ScuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245947.1 protein_id gnl|my_center|LOCUS_21540 20908 20186 gene locus_tag LOCUS_21550 20908 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 21625 21107 gene locus_tag LOCUS_21560 21625 21107 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258700.1 protein_id gnl|my_center|LOCUS_21560 21713 22213 gene locus_tag LOCUS_21570 21713 22213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 22280 22882 gene locus_tag LOCUS_21580 22280 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 24305 22920 gene locus_tag LOCUS_21590 24305 22920 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_21590 24396 27251 gene locus_tag LOCUS_21600 24396 27251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 27258 28592 gene locus_tag LOCUS_21610 27258 28592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 29059 28589 gene locus_tag LOCUS_21620 29059 28589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 30230 29217 gene locus_tag LOCUS_21630 30230 29217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 31034 30294 gene locus_tag LOCUS_21640 31034 30294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 30991 31215 gene locus_tag LOCUS_21650 30991 31215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 31333 32646 gene locus_tag LOCUS_21660 31333 32646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 34254 32752 gene locus_tag LOCUS_21670 34254 32752 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118815.1 protein_id gnl|my_center|LOCUS_21670 35735 34251 gene locus_tag LOCUS_21680 35735 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 35843 36769 gene locus_tag LOCUS_21690 35843 36769 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_21690 37880 36771 gene locus_tag LOCUS_21700 37880 36771 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_21700 38650 37973 gene locus_tag LOCUS_21710 38650 37973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932143.1 protein_id gnl|my_center|LOCUS_21710 39915 38647 gene locus_tag LOCUS_21720 39915 38647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933266.1 protein_id gnl|my_center|LOCUS_21720 41161 39917 gene locus_tag LOCUS_21730 41161 39917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933266.1 protein_id gnl|my_center|LOCUS_21730 42413 41166 gene locus_tag LOCUS_21740 42413 41166 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140350.1 protein_id gnl|my_center|LOCUS_21740 43760 42423 gene locus_tag LOCUS_21750 43760 42423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 43870 45348 gene locus_tag LOCUS_21760 43870 45348 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_21760 46878 45406 gene locus_tag LOCUS_21770 46878 45406 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_21770 47825 46866 gene locus_tag LOCUS_21780 47825 46866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 48791 47838 gene locus_tag LOCUS_21790 48791 47838 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_21790 49672 48794 gene locus_tag LOCUS_21800 gene menB 49672 48794 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_21800 51425 49677 gene locus_tag LOCUS_21810 gene menD 51425 49677 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_21810 52726 51422 gene locus_tag LOCUS_21820 52726 51422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 53046 52762 gene locus_tag LOCUS_21830 53046 52762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 52927 53784 gene locus_tag LOCUS_21840 52927 53784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 53781 54521 gene locus_tag LOCUS_21850 gene ubiE 53781 54521 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704116.1 protein_id gnl|my_center|LOCUS_21850 55071 54484 gene locus_tag LOCUS_21860 55071 54484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 55096 55659 gene locus_tag LOCUS_21870 55096 55659 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_21870 55708 56736 gene locus_tag LOCUS_21880 55708 56736 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_21880 56768 57577 gene locus_tag LOCUS_21890 56768 57577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 57577 58113 gene locus_tag LOCUS_21900 57577 58113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 58110 60008 gene locus_tag LOCUS_21910 gene mrdA 58110 60008 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530035.1 protein_id gnl|my_center|LOCUS_21910 60018 60872 gene locus_tag LOCUS_21920 60018 60872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 60961 61764 gene locus_tag LOCUS_21930 gene minD 60961 61764 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_21930 61783 62298 gene locus_tag LOCUS_21940 61783 62298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 62309 63538 gene locus_tag LOCUS_21950 gene rodA 62309 63538 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141486.1 protein_id gnl|my_center|LOCUS_21950 64876 63545 gene locus_tag LOCUS_21960 64876 63545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 68030 64881 gene locus_tag LOCUS_21970 68030 64881 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974364.1 protein_id gnl|my_center|LOCUS_21970 69594 68014 gene locus_tag LOCUS_21980 69594 68014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 70280 69591 gene locus_tag LOCUS_21990 70280 69591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 70428 70510 gene locus_tag LOCUS_t00350 70428 70510 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 70522 70597 gene locus_tag LOCUS_t00360 70522 70597 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 70636 71850 gene locus_tag LOCUS_22000 gene tuf 70636 71850 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583343.1 protein_id gnl|my_center|LOCUS_22000 71957 72241 gene locus_tag LOCUS_22010 gene gatC 71957 72241 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_22010 72656 72312 gene locus_tag LOCUS_22020 72656 72312 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257768.1 protein_id gnl|my_center|LOCUS_22020 73036 72653 gene locus_tag LOCUS_22030 73036 72653 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257767.1 protein_id gnl|my_center|LOCUS_22030 74096 74269 gene locus_tag LOCUS_22040 74096 74269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 74269 74868 gene locus_tag LOCUS_22050 74269 74868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 <75821 75008 gene locus_tag LOCUS_22060 <75821 75008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681436.1:ATP-binding protein note possible pseudo, frameshifted >Feature sequence19 <1 1361 gene locus_tag LOCUS_22070 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197951145.1:DNA polymerase/3'-5' exonuclease PolX 1409 1960 gene locus_tag LOCUS_22080 1409 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3892 1964 gene locus_tag LOCUS_22090 3892 1964 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963802.1 protein_id gnl|my_center|LOCUS_22090 4317 3889 gene locus_tag LOCUS_22100 gene nrdR 4317 3889 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_22100 4414 4857 gene locus_tag LOCUS_22110 4414 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5707 4826 gene locus_tag LOCUS_22120 5707 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6842 5709 gene locus_tag LOCUS_22130 6842 5709 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_22130 7877 6870 gene locus_tag LOCUS_22140 7877 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 8092 7874 gene locus_tag LOCUS_22150 8092 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 8347 9588 gene locus_tag LOCUS_22160 8347 9588 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256400.1 protein_id gnl|my_center|LOCUS_22160 9585 10484 gene locus_tag LOCUS_22170 9585 10484 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256399.1 protein_id gnl|my_center|LOCUS_22170 10481 11353 gene locus_tag LOCUS_22180 10481 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 11447 12247 gene locus_tag LOCUS_22190 11447 12247 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_22190 12257 13645 gene locus_tag LOCUS_22200 gene radA 12257 13645 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674860.1 protein_id gnl|my_center|LOCUS_22200 14061 13654 gene locus_tag LOCUS_22210 14061 13654 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_22210 14884 14069 gene locus_tag LOCUS_22220 14884 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 14965 15951 gene locus_tag LOCUS_22230 14965 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 17498 15903 gene locus_tag LOCUS_22240 17498 15903 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_22240 17541 18131 gene locus_tag LOCUS_22250 17541 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 18756 18145 gene locus_tag LOCUS_22260 18756 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 18932 19846 gene locus_tag LOCUS_22270 18932 19846 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141235.1 protein_id gnl|my_center|LOCUS_22270 22482 19918 gene locus_tag LOCUS_22280 22482 19918 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_22280 22813 22532 gene locus_tag LOCUS_22290 22813 22532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 22911 24155 gene locus_tag LOCUS_22300 22911 24155 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790944.1 protein_id gnl|my_center|LOCUS_22300 24236 28843 gene locus_tag LOCUS_22310 24236 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 28951 29640 gene locus_tag LOCUS_22320 28951 29640 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144114.1 protein_id gnl|my_center|LOCUS_22320 29644 30054 gene locus_tag LOCUS_22330 29644 30054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 30291 31142 gene locus_tag LOCUS_22340 30291 31142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 31217 31639 gene locus_tag LOCUS_22350 31217 31639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 32146 31697 gene locus_tag LOCUS_22360 gene ndk 32146 31697 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_22360 33663 32209 gene locus_tag LOCUS_22370 33663 32209 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_22370 33781 34074 gene locus_tag LOCUS_22380 33781 34074 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548757.1 protein_id gnl|my_center|LOCUS_22380 34900 34058 gene locus_tag LOCUS_22390 34900 34058 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_22390 35649 34885 gene locus_tag LOCUS_22400 35649 34885 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_22400 36080 35646 gene locus_tag LOCUS_22410 36080 35646 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_22410 36912 36085 gene locus_tag LOCUS_22420 36912 36085 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 protein_id gnl|my_center|LOCUS_22420 36955 38679 gene locus_tag LOCUS_22430 36955 38679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 38689 39531 gene locus_tag LOCUS_22440 38689 39531 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479550.1 protein_id gnl|my_center|LOCUS_22440 39561 43034 gene locus_tag LOCUS_22450 39561 43034 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969249.1 protein_id gnl|my_center|LOCUS_22450 44144 43041 gene locus_tag LOCUS_22460 gene ispG 44144 43041 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_22460 45352 44192 gene locus_tag LOCUS_22470 45352 44192 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_22470 46386 45352 gene locus_tag LOCUS_22480 46386 45352 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_22480 46651 46376 gene locus_tag LOCUS_22490 46651 46376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 47241 46651 gene locus_tag LOCUS_22500 gene frr 47241 46651 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_22500 48022 47228 gene locus_tag LOCUS_22510 gene pyrH 48022 47228 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_22510 48689 48024 gene locus_tag LOCUS_22520 gene tsf 48689 48024 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_22520 49606 48782 gene locus_tag LOCUS_22530 gene rpsB 49606 48782 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_22530 49810 50220 gene locus_tag LOCUS_22540 49810 50220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 50346 51620 gene locus_tag LOCUS_22550 gene murA 50346 51620 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143118.1 protein_id gnl|my_center|LOCUS_22550 51617 53056 gene locus_tag LOCUS_22560 51617 53056 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929233.1 protein_id gnl|my_center|LOCUS_22560 54507 53020 gene locus_tag LOCUS_22570 54507 53020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 54953 54576 gene locus_tag LOCUS_22580 54953 54576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 57344 55041 gene locus_tag LOCUS_22590 57344 55041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 57457 57873 gene locus_tag LOCUS_22600 57457 57873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 57936 59075 gene locus_tag LOCUS_22610 57936 59075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 59147 60025 gene locus_tag LOCUS_22620 59147 60025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 60025 61404 gene locus_tag LOCUS_22630 60025 61404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 61409 61747 gene locus_tag LOCUS_22640 61409 61747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 61747 62169 gene locus_tag LOCUS_22650 61747 62169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 62169 62888 gene locus_tag LOCUS_22660 gene fliP 62169 62888 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_22660 62895 63167 gene locus_tag LOCUS_22670 gene fliQ 62895 63167 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_22670 63174 64037 gene locus_tag LOCUS_22680 gene fliR 63174 64037 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405298.1 protein_id gnl|my_center|LOCUS_22680 64151 64318 gene locus_tag LOCUS_22690 64151 64318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 64845 64351 gene locus_tag LOCUS_22700 64845 64351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 64964 65590 gene locus_tag LOCUS_22710 64964 65590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 65642 66028 gene locus_tag LOCUS_22720 65642 66028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 66475 66110 gene locus_tag LOCUS_22730 66475 66110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 66888 66475 gene locus_tag LOCUS_22740 66888 66475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 66904 67341 gene locus_tag LOCUS_22750 66904 67341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 68689 67382 gene locus_tag LOCUS_22760 68689 67382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_22760 69789 68686 gene locus_tag LOCUS_22770 69789 68686 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_22770 70691 69786 gene locus_tag LOCUS_22780 70691 69786 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_22780 <71265 70727 gene locus_tag LOCUS_22790 <71265 70727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259235.1:S8 family peptidase >Feature sequence20 630 1403 gene locus_tag LOCUS_22800 630 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1907 1833 gene locus_tag LOCUS_t00370 1907 1833 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2086 3357 gene locus_tag LOCUS_22810 2086 3357 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_22810 3399 4343 gene locus_tag LOCUS_22820 3399 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 4410 5414 gene locus_tag LOCUS_22830 4410 5414 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_22830 5426 6976 gene locus_tag LOCUS_22840 5426 6976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_22840 6973 8097 gene locus_tag LOCUS_22850 6973 8097 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_22850 8097 9038 gene locus_tag LOCUS_22860 8097 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 10132 9035 gene locus_tag LOCUS_22870 10132 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 10721 10326 gene locus_tag LOCUS_22880 10721 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 11128 10718 gene locus_tag LOCUS_22890 gene fliS 11128 10718 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860686.1 protein_id gnl|my_center|LOCUS_22890 12897 11140 gene locus_tag LOCUS_22900 gene fliD 12897 11140 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392286.1 protein_id gnl|my_center|LOCUS_22900 13302 12907 gene locus_tag LOCUS_22910 13302 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 13795 13364 gene locus_tag LOCUS_22920 13795 13364 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223931.1 protein_id gnl|my_center|LOCUS_22920 14086 13811 gene locus_tag LOCUS_22930 14086 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 16350 14137 gene locus_tag LOCUS_22940 16350 14137 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 protein_id gnl|my_center|LOCUS_22940 16874 16350 gene locus_tag LOCUS_22950 16874 16350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22950 19228 17477 gene locus_tag LOCUS_22960 19228 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 20291 19266 gene locus_tag LOCUS_22970 20291 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 21178 20516 gene locus_tag LOCUS_22980 21178 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 22818 21295 gene locus_tag LOCUS_22990 22818 21295 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_22990 22888 23772 gene locus_tag LOCUS_23000 22888 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 23769 24788 gene locus_tag LOCUS_23010 gene tsaD 23769 24788 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_23010 25214 25077 gene locus_tag LOCUS_23020 25214 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 26834 25383 gene locus_tag LOCUS_23030 26834 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 26841 28109 gene locus_tag LOCUS_23040 gene glcF 26841 28109 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227984.1 protein_id gnl|my_center|LOCUS_23040 29146 28106 gene locus_tag LOCUS_23050 gene queA 29146 28106 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_23050 30351 29143 gene locus_tag LOCUS_23060 30351 29143 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_23060 30993 30433 gene locus_tag LOCUS_23070 gene lepB 30993 30433 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_23070 31801 31010 gene locus_tag LOCUS_23080 31801 31010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 33484 31808 gene locus_tag LOCUS_23090 33484 31808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 34314 33508 gene locus_tag LOCUS_23100 34314 33508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 34503 35072 gene locus_tag LOCUS_23110 gene hpt 34503 35072 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_23110 35069 35527 gene locus_tag LOCUS_23120 35069 35527 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_23120 35553 36755 gene locus_tag LOCUS_23130 gene nusA 35553 36755 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_23130 36791 37003 gene locus_tag LOCUS_23140 36791 37003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 37091 39460 gene locus_tag LOCUS_23150 37091 39460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 39473 39856 gene locus_tag LOCUS_23160 gene rbfA 39473 39856 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_23160 40056 39817 gene locus_tag LOCUS_23170 40056 39817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 39976 40887 gene locus_tag LOCUS_23180 39976 40887 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_23180 40884 41744 gene locus_tag LOCUS_23190 gene truB 40884 41744 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_23190 42870 41713 gene locus_tag LOCUS_23200 gene wecB 42870 41713 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187374459.1 protein_id gnl|my_center|LOCUS_23200 44012 42867 gene locus_tag LOCUS_23210 44012 42867 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_23210 45298 44018 gene locus_tag LOCUS_23220 45298 44018 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144352.1 protein_id gnl|my_center|LOCUS_23220 45768 45316 gene locus_tag LOCUS_23230 45768 45316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 46457 45855 gene locus_tag LOCUS_23240 46457 45855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 47378 46497 gene locus_tag LOCUS_23250 47378 46497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 47845 47438 gene locus_tag LOCUS_23260 gene rplS 47845 47438 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186516.1 protein_id gnl|my_center|LOCUS_23260 47971 48354 gene locus_tag LOCUS_23270 47971 48354 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_23270 49129 48374 gene locus_tag LOCUS_23280 49129 48374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 51269 49119 gene locus_tag LOCUS_23290 gene fadJ 51269 49119 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424986.1 protein_id gnl|my_center|LOCUS_23290 52598 51297 gene locus_tag LOCUS_23300 52598 51297 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_23300 52815 52743 gene locus_tag LOCUS_t00380 52815 52743 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 52903 54276 gene locus_tag LOCUS_23310 52903 54276 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229206.1 protein_id gnl|my_center|LOCUS_23310 54578 54198 gene locus_tag LOCUS_23320 54578 54198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 54637 55143 gene locus_tag LOCUS_23330 54637 55143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 56327 55209 gene locus_tag LOCUS_23340 56327 55209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 57800 56346 gene locus_tag LOCUS_23350 57800 56346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 58919 57882 gene locus_tag LOCUS_23360 58919 57882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 59980 58991 gene locus_tag LOCUS_23370 gene dusB 59980 58991 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_23370 60364 59987 gene locus_tag LOCUS_23380 60364 59987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 60511 60738 gene locus_tag LOCUS_23390 60511 60738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 61922 60807 gene locus_tag LOCUS_23400 61922 60807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 63639 61957 gene locus_tag LOCUS_23410 63639 61957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 65628 63643 gene locus_tag LOCUS_23420 65628 63643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 65761 66921 gene locus_tag LOCUS_23430 65761 66921 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_23430 67185 67664 gene locus_tag LOCUS_23440 67185 67664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 67682 68005 gene locus_tag LOCUS_23450 gene nirD 67682 68005 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_23450 70162 68171 gene locus_tag LOCUS_23460 gene acs 70162 68171 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence21 6802 3410 gene locus_tag LOCUS_23470 6802 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 8060 6912 gene locus_tag LOCUS_23480 8060 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 9252 8077 gene locus_tag LOCUS_23490 9252 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 10303 9254 gene locus_tag LOCUS_23500 10303 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 11001 10303 gene locus_tag LOCUS_23510 11001 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 11840 11031 gene locus_tag LOCUS_23520 11840 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 12195 14465 gene locus_tag LOCUS_23530 12195 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 14479 16749 gene locus_tag LOCUS_23540 14479 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 16837 18891 gene locus_tag LOCUS_23550 16837 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 19045 20331 gene locus_tag LOCUS_23560 19045 20331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 20410 20856 gene locus_tag LOCUS_23570 20410 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 20913 21197 gene locus_tag LOCUS_23580 20913 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 21235 22287 gene locus_tag LOCUS_23590 gene phaC 21235 22287 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 protein_id gnl|my_center|LOCUS_23590 22329 23981 gene locus_tag LOCUS_23600 22329 23981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 23978 25621 gene locus_tag LOCUS_23610 23978 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 25621 26259 gene locus_tag LOCUS_23620 25621 26259 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_23620 26252 27253 gene locus_tag LOCUS_23630 26252 27253 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_23630 27312 30191 gene locus_tag LOCUS_23640 27312 30191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 30243 31787 gene locus_tag LOCUS_23650 30243 31787 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_23650 31814 32560 gene locus_tag LOCUS_23660 gene fabG 31814 32560 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_23660 32557 33810 gene locus_tag LOCUS_23670 32557 33810 CDS product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268358.1 protein_id gnl|my_center|LOCUS_23670 33868 35169 gene locus_tag LOCUS_23680 33868 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881423.1 protein_id gnl|my_center|LOCUS_23680 35191 36099 gene locus_tag LOCUS_23690 35191 36099 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_23690 36126 36974 gene locus_tag LOCUS_23700 36126 36974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 36996 37589 gene locus_tag LOCUS_23710 36996 37589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 37595 38380 gene locus_tag LOCUS_23720 37595 38380 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249754.1 protein_id gnl|my_center|LOCUS_23720 38377 39186 gene locus_tag LOCUS_23730 38377 39186 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_23730 39248 40504 gene locus_tag LOCUS_23740 39248 40504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 40521 42623 gene locus_tag LOCUS_23750 gene ppk1 40521 42623 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_23750 42783 44327 gene locus_tag LOCUS_23760 42783 44327 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994018.1 protein_id gnl|my_center|LOCUS_23760 45587 44394 gene locus_tag LOCUS_23770 45587 44394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 47395 45584 gene locus_tag LOCUS_23780 gene mutL 47395 45584 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_23780 47394 48158 gene locus_tag LOCUS_23790 47394 48158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 48155 48868 gene locus_tag LOCUS_23800 48155 48868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 48871 49461 gene locus_tag LOCUS_23810 48871 49461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 49461 50240 gene locus_tag LOCUS_23820 49461 50240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 50310 50717 gene locus_tag LOCUS_23830 50310 50717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 51675 50701 gene locus_tag LOCUS_23840 51675 50701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 51803 52957 gene locus_tag LOCUS_23850 gene alr 51803 52957 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_23850 53283 52978 gene locus_tag LOCUS_23860 53283 52978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 53550 54080 gene locus_tag LOCUS_23870 53550 54080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 54109 55149 gene locus_tag LOCUS_23880 54109 55149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 55205 55720 gene locus_tag LOCUS_23890 55205 55720 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_23890 55717 57168 gene locus_tag LOCUS_23900 gene sufB 55717 57168 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_23900 57183 57935 gene locus_tag LOCUS_23910 gene sufC 57183 57935 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_23910 57932 59143 gene locus_tag LOCUS_23920 gene sufD 57932 59143 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532159.1 protein_id gnl|my_center|LOCUS_23920 59140 60381 gene locus_tag LOCUS_23930 59140 60381 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_23930 60392 60841 gene locus_tag LOCUS_23940 60392 60841 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_23940 60845 61213 gene locus_tag LOCUS_23950 60845 61213 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971890.1 protein_id gnl|my_center|LOCUS_23950 62141 61254 gene locus_tag LOCUS_23960 62141 61254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 63343 62237 gene locus_tag LOCUS_23970 63343 62237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 63589 64551 gene locus_tag LOCUS_23980 63589 64551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 64551 65624 gene locus_tag LOCUS_23990 gene hemH 64551 65624 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957341.1 protein_id gnl|my_center|LOCUS_23990 65618 66412 gene locus_tag LOCUS_24000 65618 66412 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920946.1 protein_id gnl|my_center|LOCUS_24000 66498 67253 gene locus_tag LOCUS_24010 66498 67253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_24010 68488 67250 gene locus_tag LOCUS_24020 68488 67250 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256882.1 protein_id gnl|my_center|LOCUS_24020 69885 68485 gene locus_tag LOCUS_24030 69885 68485 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_24030 69948 70778 gene locus_tag LOCUS_24040 69948 70778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence22 16 114 gene locus_tag LOCUS_r00010 16 114 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 186 1040 gene locus_tag LOCUS_24050 186 1040 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_24050 1442 999 gene locus_tag LOCUS_24060 gene crcB 1442 999 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_24060 1543 2133 gene locus_tag LOCUS_24070 1543 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2130 2891 gene locus_tag LOCUS_24080 2130 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2947 3228 gene locus_tag LOCUS_24090 2947 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3406 3315 gene locus_tag LOCUS_t00390 3406 3315 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4209 3463 gene locus_tag LOCUS_24100 4209 3463 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 protein_id gnl|my_center|LOCUS_24100 5324 4206 gene locus_tag LOCUS_24110 gene ribD 5324 4206 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_24110 6091 5351 gene locus_tag LOCUS_24120 6091 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6519 6070 gene locus_tag LOCUS_24130 gene zur 6519 6070 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_24130 6582 7433 gene locus_tag LOCUS_24140 6582 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7567 8970 gene locus_tag LOCUS_24150 7567 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 10438 8978 gene locus_tag LOCUS_24160 gene gatB 10438 8978 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_24160 11919 10435 gene locus_tag LOCUS_24170 gene gatA 11919 10435 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_24170 12216 11983 gene locus_tag LOCUS_24180 12216 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 12385 13389 gene locus_tag LOCUS_24190 12385 13389 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_24190 13383 14075 gene locus_tag LOCUS_24200 13383 14075 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_24200 14103 14921 gene locus_tag LOCUS_24210 gene surE 14103 14921 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_24210 14922 15692 gene locus_tag LOCUS_24220 14922 15692 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_24220 15764 17155 gene locus_tag LOCUS_24230 gene tig 15764 17155 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_24230 17189 17830 gene locus_tag LOCUS_24240 gene clpP 17189 17830 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021624.1 protein_id gnl|my_center|LOCUS_24240 17867 19156 gene locus_tag LOCUS_24250 gene clpX 17867 19156 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_24250 19946 19233 gene locus_tag LOCUS_24260 19946 19233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 20420 20094 gene locus_tag LOCUS_24270 gene trxA 20420 20094 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_24270 20612 21355 gene locus_tag LOCUS_24280 20612 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 21476 22309 gene locus_tag LOCUS_24290 21476 22309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 23753 22332 gene locus_tag LOCUS_24300 gene mazG 23753 22332 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_24300 24865 23750 gene locus_tag LOCUS_24310 24865 23750 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814873.1 protein_id gnl|my_center|LOCUS_24310 28369 24899 gene locus_tag LOCUS_24320 gene mfd 28369 24899 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_24320 28461 28820 gene locus_tag LOCUS_24330 28461 28820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 28825 29265 gene locus_tag LOCUS_24340 28825 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 29317 31053 gene locus_tag LOCUS_24350 29317 31053 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967140.1 protein_id gnl|my_center|LOCUS_24350 31678 31043 gene locus_tag LOCUS_24360 31678 31043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 31910 32593 gene locus_tag LOCUS_24370 31910 32593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 32668 33324 gene locus_tag LOCUS_24380 32668 33324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 34397 33321 gene locus_tag LOCUS_24390 34397 33321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 34833 34519 gene locus_tag LOCUS_24400 34833 34519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 34946 35134 gene locus_tag LOCUS_24410 34946 35134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 35148 37658 gene locus_tag LOCUS_24420 35148 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 37915 37556 gene locus_tag LOCUS_24430 37915 37556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 37805 38338 gene locus_tag LOCUS_24440 37805 38338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 38344 38724 gene locus_tag LOCUS_24450 38344 38724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 38702 39754 gene locus_tag LOCUS_24460 38702 39754 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_24460 39763 39990 gene locus_tag LOCUS_24470 39763 39990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence23 171 773 gene locus_tag LOCUS_24480 171 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 869 997 gene locus_tag LOCUS_24490 869 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1010 1135 gene locus_tag LOCUS_24500 1010 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24500 1156 1959 gene locus_tag LOCUS_24510 1156 1959 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_24510 2529 2065 gene locus_tag LOCUS_24520 2529 2065 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216283.1 protein_id gnl|my_center|LOCUS_24520 2622 2550 gene locus_tag LOCUS_t00400 2622 2550 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3402 2638 gene locus_tag LOCUS_24530 3402 2638 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_24530 4624 3416 gene locus_tag LOCUS_24540 4624 3416 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_24540 4934 5836 gene locus_tag LOCUS_24550 4934 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 5873 6160 gene locus_tag LOCUS_24560 5873 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 7455 6151 gene locus_tag LOCUS_24570 7455 6151 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142769.1 protein_id gnl|my_center|LOCUS_24570 8629 7526 gene locus_tag LOCUS_24580 8629 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 9588 8740 gene locus_tag LOCUS_24590 gene ispH 9588 8740 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_24590 10877 9585 gene locus_tag LOCUS_24600 gene aroA 10877 9585 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_24600 10917 11351 gene locus_tag LOCUS_24610 10917 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 11348 11908 gene locus_tag LOCUS_24620 11348 11908 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143753.1 protein_id gnl|my_center|LOCUS_24620 11910 13094 gene locus_tag LOCUS_24630 11910 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 13129 14106 gene locus_tag LOCUS_24640 13129 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 14103 15143 gene locus_tag LOCUS_24650 14103 15143 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_24650 15140 16225 gene locus_tag LOCUS_24660 15140 16225 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143469.1 protein_id gnl|my_center|LOCUS_24660 16222 17652 gene locus_tag LOCUS_24670 16222 17652 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_24670 17654 18637 gene locus_tag LOCUS_24680 17654 18637 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_24680 18652 19155 gene locus_tag LOCUS_24690 18652 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 19155 20153 gene locus_tag LOCUS_24700 19155 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 20329 20550 gene locus_tag LOCUS_24710 20329 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 20677 20985 gene locus_tag LOCUS_24720 gene rplU 20677 20985 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_24720 21016 21282 gene locus_tag LOCUS_24730 gene rpmA 21016 21282 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_24730 21985 21359 gene locus_tag LOCUS_24740 21985 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 22334 22029 gene locus_tag LOCUS_24750 22334 22029 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_24750 22490 23263 gene locus_tag LOCUS_24760 22490 23263 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142502.1 protein_id gnl|my_center|LOCUS_24760 23755 23231 gene locus_tag LOCUS_24770 23755 23231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 23876 24829 gene locus_tag LOCUS_24780 23876 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 24810 25118 gene locus_tag LOCUS_24790 24810 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 26722 25115 gene locus_tag LOCUS_24800 26722 25115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 26923 28068 gene locus_tag LOCUS_24810 26923 28068 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_24810 28065 31142 gene locus_tag LOCUS_24820 28065 31142 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_24820 31165 33111 gene locus_tag LOCUS_24830 31165 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 34243 33134 gene locus_tag LOCUS_24840 34243 33134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 36297 34195 gene locus_tag LOCUS_24850 36297 34195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 37601 36294 gene locus_tag LOCUS_24860 37601 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 37897 37619 gene locus_tag LOCUS_24870 37897 37619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 38375 37890 gene locus_tag LOCUS_24880 38375 37890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 40479 38365 gene locus_tag LOCUS_24890 40479 38365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence24 105 860 gene locus_tag LOCUS_24900 105 860 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_24900 857 1924 gene locus_tag LOCUS_24910 857 1924 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_24910 1941 2972 gene locus_tag LOCUS_24920 gene rfbB 1941 2972 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_24920 2969 4372 gene locus_tag LOCUS_24930 2969 4372 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140971.1 protein_id gnl|my_center|LOCUS_24930 4374 5318 gene locus_tag LOCUS_24940 4374 5318 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142176.1 protein_id gnl|my_center|LOCUS_24940 5285 6442 gene locus_tag LOCUS_24950 5285 6442 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_24950 6439 7584 gene locus_tag LOCUS_24960 6439 7584 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141525.1 protein_id gnl|my_center|LOCUS_24960 7584 9110 gene locus_tag LOCUS_24970 7584 9110 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_24970 9136 9576 gene locus_tag LOCUS_24980 9136 9576 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256808.1 protein_id gnl|my_center|LOCUS_24980 9576 10571 gene locus_tag LOCUS_24990 gene galE 9576 10571 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_24990 10564 11925 gene locus_tag LOCUS_25000 gene glmM 10564 11925 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 protein_id gnl|my_center|LOCUS_25000 13419 11929 gene locus_tag LOCUS_25010 gene glpK 13419 11929 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 protein_id gnl|my_center|LOCUS_25010 13494 15179 gene locus_tag LOCUS_25020 13494 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 17125 15215 gene locus_tag LOCUS_25030 17125 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 17606 17109 gene locus_tag LOCUS_25040 17606 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 17722 18162 gene locus_tag LOCUS_25050 17722 18162 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948139.1 protein_id gnl|my_center|LOCUS_25050 18173 18715 gene locus_tag LOCUS_25060 gene rimM 18173 18715 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_25060 18712 19551 gene locus_tag LOCUS_25070 gene trmD 18712 19551 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_25070 19548 19970 gene locus_tag LOCUS_25080 19548 19970 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548117.1 protein_id gnl|my_center|LOCUS_25080 20056 20547 gene locus_tag LOCUS_25090 gene folK 20056 20547 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_25090 21492 20551 gene locus_tag LOCUS_25100 gene fmt 21492 20551 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_25100 21549 22814 gene locus_tag LOCUS_25110 21549 22814 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941150.1 protein_id gnl|my_center|LOCUS_25110 23169 22798 gene locus_tag LOCUS_25120 23169 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25120 23074 23412 gene locus_tag LOCUS_25130 23074 23412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 23409 24278 gene locus_tag LOCUS_25140 gene accD 23409 24278 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_25140 24275 25246 gene locus_tag LOCUS_25150 24275 25246 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405067.1 protein_id gnl|my_center|LOCUS_25150 25289 25528 gene locus_tag LOCUS_25160 25289 25528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 25585 27441 gene locus_tag LOCUS_25170 25585 27441 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_25170 27544 28539 gene locus_tag LOCUS_25180 27544 28539 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_25180 28544 29719 gene locus_tag LOCUS_25190 28544 29719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_25190 29738 30925 gene locus_tag LOCUS_25200 29738 30925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 30922 31659 gene locus_tag LOCUS_25210 30922 31659 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_25210 33744 31666 gene locus_tag LOCUS_25220 33744 31666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 34045 33770 gene locus_tag LOCUS_25230 34045 33770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 34175 34912 gene locus_tag LOCUS_25240 34175 34912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 34913 36238 gene locus_tag LOCUS_25250 34913 36238 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_25250 36419 37165 gene locus_tag LOCUS_25260 36419 37165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25260 >Feature sequence25 579 1556 gene locus_tag LOCUS_25270 579 1556 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_25270 1553 2359 gene locus_tag LOCUS_25280 1553 2359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867541.1 protein_id gnl|my_center|LOCUS_25280 2633 2346 gene locus_tag LOCUS_25290 2633 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2752 2824 gene locus_tag LOCUS_t00410 2752 2824 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2836 2911 gene locus_tag LOCUS_t00420 2836 2911 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4339 3026 gene locus_tag LOCUS_25300 4339 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 4562 4389 gene locus_tag LOCUS_25310 4562 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4483 5451 gene locus_tag LOCUS_25320 4483 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 5470 6969 gene locus_tag LOCUS_25330 5470 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 7483 6998 gene locus_tag LOCUS_25340 7483 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 7538 8944 gene locus_tag LOCUS_25350 gene selA 7538 8944 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_25350 8941 10797 gene locus_tag LOCUS_25360 gene selB 8941 10797 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_25360 10785 11510 gene locus_tag LOCUS_25370 10785 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 11694 11512 gene locus_tag LOCUS_25380 11694 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 12186 11767 gene locus_tag LOCUS_25390 gene queF 12186 11767 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762202.1 protein_id gnl|my_center|LOCUS_25390 13396 12212 gene locus_tag LOCUS_25400 13396 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 14210 13461 gene locus_tag LOCUS_25410 14210 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 14384 15523 gene locus_tag LOCUS_25420 gene ribD 14384 15523 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_25420 16580 15540 gene locus_tag LOCUS_25430 gene aroF 16580 15540 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_25430 16660 16818 gene locus_tag LOCUS_25440 16660 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 16828 17199 gene locus_tag LOCUS_25450 16828 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25450 17189 17557 gene locus_tag LOCUS_25460 17189 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 17656 18210 gene locus_tag LOCUS_25470 17656 18210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 18571 18269 gene locus_tag LOCUS_25480 18571 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 19890 18568 gene locus_tag LOCUS_25490 19890 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 20824 19868 gene locus_tag LOCUS_25500 20824 19868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 21842 20862 gene locus_tag LOCUS_25510 21842 20862 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_25510 21950 22936 gene locus_tag LOCUS_25520 21950 22936 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143758.1 protein_id gnl|my_center|LOCUS_25520 22937 24475 gene locus_tag LOCUS_25530 22937 24475 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583152.1 protein_id gnl|my_center|LOCUS_25530 24480 26534 gene locus_tag LOCUS_25540 24480 26534 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_25540 26582 27181 gene locus_tag LOCUS_25550 gene tmk 26582 27181 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057890.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence26 1335 274 gene locus_tag LOCUS_25560 1335 274 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_25560 1438 2589 gene locus_tag LOCUS_25570 1438 2589 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 protein_id gnl|my_center|LOCUS_25570 2586 3125 gene locus_tag LOCUS_25580 2586 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3219 3998 gene locus_tag LOCUS_25590 3219 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4706 4020 gene locus_tag LOCUS_25600 4706 4020 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_25600 4864 4790 gene locus_tag LOCUS_t00430 4864 4790 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5009 5605 gene locus_tag LOCUS_25610 5009 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 5784 5620 gene locus_tag LOCUS_25620 5784 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 5820 6647 gene locus_tag LOCUS_25630 gene uppP 5820 6647 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_25630 6637 6894 gene locus_tag LOCUS_25640 6637 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 7683 7102 gene locus_tag LOCUS_25650 7683 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 8946 7732 gene locus_tag LOCUS_25660 8946 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 9073 9684 gene locus_tag LOCUS_25670 9073 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 10303 9662 gene locus_tag LOCUS_25680 10303 9662 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_25680 10381 11487 gene locus_tag LOCUS_25690 10381 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 11535 12560 gene locus_tag LOCUS_25700 11535 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 12617 15634 gene locus_tag LOCUS_25710 12617 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 15631 16653 gene locus_tag LOCUS_25720 15631 16653 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 protein_id gnl|my_center|LOCUS_25720 16781 16699 gene locus_tag LOCUS_t00440 16781 16699 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16843 17211 gene locus_tag LOCUS_25730 16843 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 17208 18380 gene locus_tag LOCUS_25740 17208 18380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 19780 18731 gene locus_tag LOCUS_25750 19780 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 19880 20914 gene locus_tag LOCUS_25760 gene trpS 19880 20914 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_25760 20889 21614 gene locus_tag LOCUS_25770 20889 21614 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_25770 21575 22714 gene locus_tag LOCUS_25780 21575 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 22714 23718 gene locus_tag LOCUS_25790 22714 23718 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_25790 23921 25423 gene locus_tag LOCUS_r00020 23921 25423 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 25543 25617 gene locus_tag LOCUS_t00450 25543 25617 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 25631 25705 gene locus_tag LOCUS_t00460 25631 25705 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25720 25794 gene locus_tag LOCUS_t00470 25720 25794 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25971 26264 gene locus_tag LOCUS_25800 25971 26264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence27 1957 68 gene locus_tag LOCUS_25810 1957 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1992 3401 gene locus_tag LOCUS_25820 1992 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3482 7516 gene locus_tag LOCUS_25830 3482 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25830 9243 7600 gene locus_tag LOCUS_25840 9243 7600 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_25840 10490 9240 gene locus_tag LOCUS_25850 10490 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 10560 11657 gene locus_tag LOCUS_25860 gene ychF 10560 11657 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_25860 11751 12647 gene locus_tag LOCUS_25870 11751 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 12676 13026 gene locus_tag LOCUS_25880 12676 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 12945 13451 gene locus_tag LOCUS_25890 12945 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 14867 13482 gene locus_tag LOCUS_25900 14867 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 15697 14864 gene locus_tag LOCUS_25910 15697 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 15748 16299 gene locus_tag LOCUS_25920 15748 16299 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230895.1 protein_id gnl|my_center|LOCUS_25920 16314 17441 gene locus_tag LOCUS_25930 gene hemW 16314 17441 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_25930 17854 17438 gene locus_tag LOCUS_25940 17854 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 17863 18732 gene locus_tag LOCUS_25950 gene nadC 17863 18732 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_25950 18798 18962 gene locus_tag LOCUS_25960 18798 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 19174 19100 gene locus_tag LOCUS_t00480 19174 19100 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19400 19239 gene locus_tag LOCUS_25970 19400 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 19876 19454 gene locus_tag LOCUS_25980 19876 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 20163 19873 gene locus_tag LOCUS_25990 20163 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 20448 20173 gene locus_tag LOCUS_26000 20448 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 20577 21992 gene locus_tag LOCUS_26010 gene gltX 20577 21992 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence28 559 332 gene locus_tag LOCUS_26020 559 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1303 635 gene locus_tag LOCUS_26030 1303 635 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_26030 1402 2991 gene locus_tag LOCUS_26040 1402 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2988 3224 gene locus_tag LOCUS_26050 gene xseB 2988 3224 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545195.1 protein_id gnl|my_center|LOCUS_26050 3473 4912 gene locus_tag LOCUS_26060 3473 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 5855 4902 gene locus_tag LOCUS_26070 5855 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 5967 5894 gene locus_tag LOCUS_t00490 5967 5894 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7330 6011 gene locus_tag LOCUS_26080 7330 6011 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393972.1 protein_id gnl|my_center|LOCUS_26080 9546 7327 gene locus_tag LOCUS_26090 9546 7327 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141326.1 protein_id gnl|my_center|LOCUS_26090 9722 10660 gene locus_tag LOCUS_26100 9722 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 12127 10865 gene locus_tag LOCUS_26110 12127 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 12271 13179 gene locus_tag LOCUS_26120 gene rfbD 12271 13179 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_26120 14052 13180 gene locus_tag LOCUS_26130 14052 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 15903 14056 gene locus_tag LOCUS_26140 15903 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 16032 17033 gene locus_tag LOCUS_26150 16032 17033 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence29 1948 242 gene locus_tag LOCUS_26160 1948 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3287 2001 gene locus_tag LOCUS_26170 3287 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3391 4173 gene locus_tag LOCUS_26180 3391 4173 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_26180 4170 6323 gene locus_tag LOCUS_26190 4170 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 6372 9275 gene locus_tag LOCUS_26200 6372 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 9283 10257 gene locus_tag LOCUS_26210 gene add 9283 10257 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_26210 10260 10679 gene locus_tag LOCUS_26220 gene msrB 10260 10679 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_26220 10696 11460 gene locus_tag LOCUS_26230 10696 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 13561 11483 gene locus_tag LOCUS_26240 13561 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 13675 15483 gene locus_tag LOCUS_26250 13675 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence30 1364 435 gene locus_tag LOCUS_26260 1364 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3619 1361 gene locus_tag LOCUS_26270 3619 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3853 4635 gene locus_tag LOCUS_26280 3853 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4748 5311 gene locus_tag LOCUS_26290 4748 5311 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_26290 6962 5406 gene locus_tag LOCUS_26300 6962 5406 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_26300 8497 7046 gene locus_tag LOCUS_26310 8497 7046 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_26310 8722 9192 gene locus_tag LOCUS_26320 8722 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26320 9599 10033 gene locus_tag LOCUS_26330 9599 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 10023 10454 gene locus_tag LOCUS_26340 10023 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 11430 11627 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcaaccaacgctcaatggcccgg 12727 11801 gene locus_tag LOCUS_26350 12727 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 12957 12724 gene locus_tag LOCUS_26360 12957 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence31 1566 916 gene locus_tag LOCUS_26370 1566 916 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_26370 1678 4335 gene locus_tag LOCUS_26380 1678 4335 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142589.1 protein_id gnl|my_center|LOCUS_26380 4332 5393 gene locus_tag LOCUS_26390 4332 5393 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256874.1 protein_id gnl|my_center|LOCUS_26390 5810 5433 gene locus_tag LOCUS_26400 5810 5433 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_26400 6079 5807 gene locus_tag LOCUS_26410 6079 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 7377 6145 gene locus_tag LOCUS_26420 7377 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 7790 7377 gene locus_tag LOCUS_26430 7790 7377 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463773.1 protein_id gnl|my_center|LOCUS_26430 8536 7787 gene locus_tag LOCUS_26440 8536 7787 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_26440 10214 8589 gene locus_tag LOCUS_26450 10214 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence32 706 182 gene locus_tag LOCUS_26460 706 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1107 703 gene locus_tag LOCUS_26470 1107 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1638 3227 gene locus_tag LOCUS_26480 1638 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 3527 3252 gene locus_tag LOCUS_26490 3527 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26490 4503 3727 gene locus_tag LOCUS_26500 4503 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4624 5535 gene locus_tag LOCUS_26510 gene rocF 4624 5535 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258791.1 protein_id gnl|my_center|LOCUS_26510 6263 5592 gene locus_tag LOCUS_26520 6263 5592 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_26520 6293 8938 gene locus_tag LOCUS_26530 gene recG 6293 8938 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_26530 8923 9522 gene locus_tag LOCUS_26540 gene rsmD 8923 9522 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037534.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence33 538 188 gene locus_tag LOCUS_26550 gene tnpB 538 188 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125271662.1 protein_id gnl|my_center|LOCUS_26550 906 535 gene locus_tag LOCUS_26560 906 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1228 1028 gene locus_tag LOCUS_26570 1228 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2629 1349 gene locus_tag LOCUS_26580 2629 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3558 2626 gene locus_tag LOCUS_26590 3558 2626 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_26590 3615 4334 gene locus_tag LOCUS_26600 3615 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 4396 5115 gene locus_tag LOCUS_26610 gene nagB 4396 5115 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804961.1 protein_id gnl|my_center|LOCUS_26610 5482 8598 gene locus_tag LOCUS_26620 5482 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 8595 9932 gene locus_tag LOCUS_26630 8595 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence34 666 1457 gene locus_tag LOCUS_26640 666 1457 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496701.1 protein_id gnl|my_center|LOCUS_26640 1450 2214 gene locus_tag LOCUS_26650 1450 2214 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114755.1 protein_id gnl|my_center|LOCUS_26650 2282 2944 gene locus_tag LOCUS_26660 2282 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2950 4404 gene locus_tag LOCUS_26670 2950 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 5224 4361 gene locus_tag LOCUS_26680 5224 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 5246 5563 gene locus_tag LOCUS_26690 5246 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 5527 6939 gene locus_tag LOCUS_26700 5527 6939 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205436.1 protein_id gnl|my_center|LOCUS_26700 6936 7388 gene locus_tag LOCUS_26710 6936 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26710 7385 7687 gene locus_tag LOCUS_26720 7385 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26720 7885 8484 gene locus_tag LOCUS_26730 7885 8484 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933158.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence35 3099 820 gene locus_tag LOCUS_26740 3099 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3218 7153 gene locus_tag LOCUS_26750 3218 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 7150 7482 gene locus_tag LOCUS_26760 7150 7482 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence36 968 504 gene locus_tag LOCUS_26770 968 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1737 1015 gene locus_tag LOCUS_26780 1737 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2303 1809 gene locus_tag LOCUS_26790 2303 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2861 2421 gene locus_tag LOCUS_26800 2861 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 3545 3237 gene locus_tag LOCUS_26810 3545 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3984 4223 gene locus_tag LOCUS_26820 3984 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 4769 4311 gene locus_tag LOCUS_26830 4769 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 5500 6522 gene locus_tag LOCUS_26840 5500 6522 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_26840 <7500 6967 gene locus_tag LOCUS_26850 <7500 6967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256609.1:deoxyribodipyrimidine photo-lyase note possible pseudo, internal stop codon >Feature sequence37 1017 1583 gene locus_tag LOCUS_26860 1017 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1580 2350 gene locus_tag LOCUS_26870 1580 2350 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_26870 2347 3045 gene locus_tag LOCUS_26880 2347 3045 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838222.1 protein_id gnl|my_center|LOCUS_26880 3192 3749 gene locus_tag LOCUS_26890 3192 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 4553 3777 gene locus_tag LOCUS_26900 4553 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 5047 4703 gene locus_tag LOCUS_26910 5047 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 6120 5080 gene locus_tag LOCUS_26920 6120 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 6490 6101 gene locus_tag LOCUS_26930 6490 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 <7122 6487 gene locus_tag LOCUS_26940 <7122 6487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921294.1:DNA helicase RecQ >Feature sequence38 1577 174 gene locus_tag LOCUS_26950 1577 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1651 2673 gene locus_tag LOCUS_26960 gene gap 1651 2673 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_26960 2673 3890 gene locus_tag LOCUS_26970 2673 3890 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583493.1 protein_id gnl|my_center|LOCUS_26970 3910 4677 gene locus_tag LOCUS_26980 gene tpiA 3910 4677 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_26980 4806 6329 gene locus_tag LOCUS_26990 gene gpmI 4806 6329 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence39 1 1341 gene locus_tag LOCUS_27000 1 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1511 2191 gene locus_tag LOCUS_27010 1511 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2585 2184 gene locus_tag LOCUS_27020 2585 2184 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_27020 4539 2587 gene locus_tag LOCUS_27030 4539 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 4596 5195 gene locus_tag LOCUS_27040 4596 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence40 315 515 gene locus_tag LOCUS_27050 315 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 525 2177 gene locus_tag LOCUS_27060 525 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2193 4001 gene locus_tag LOCUS_27070 2193 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence41 1241 636 gene locus_tag LOCUS_27080 1241 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1604 1275 gene locus_tag LOCUS_27090 1604 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2935 1607 gene locus_tag LOCUS_27100 2935 1607 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_27100