>Feature sequence001 400 326 gene locus_tag LOCUS_t00010 400 326 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 787 515 gene locus_tag LOCUS_00010 787 515 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_00010 3462 1054 gene locus_tag LOCUS_00020 gene lon 3462 1054 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_00020 4856 3591 gene locus_tag LOCUS_00030 gene clpX 4856 3591 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_00030 5636 5037 gene locus_tag LOCUS_00040 gene clpP 5636 5037 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_00040 7051 5747 gene locus_tag LOCUS_00050 gene tig 7051 5747 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_00050 7200 7117 gene locus_tag LOCUS_t00020 7200 7117 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8752 7262 gene locus_tag LOCUS_00060 8752 7262 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_00060 9801 8749 gene locus_tag LOCUS_00070 9801 8749 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_00070 10334 9864 gene locus_tag LOCUS_00080 10334 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11901 10432 gene locus_tag LOCUS_00090 gene ppx 11901 10432 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_00090 14045 11898 gene locus_tag LOCUS_00100 14045 11898 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_00100 15177 14134 gene locus_tag LOCUS_00110 gene doeB 15177 14134 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401275.1 protein_id gnl|my_center|LOCUS_00110 15966 15190 gene locus_tag LOCUS_00120 15966 15190 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090612.1 protein_id gnl|my_center|LOCUS_00120 16649 15969 gene locus_tag LOCUS_00130 16649 15969 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_00130 17707 16646 gene locus_tag LOCUS_00140 17707 16646 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_00140 18260 17709 gene locus_tag LOCUS_00150 18260 17709 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_00150 19372 18257 gene locus_tag LOCUS_00160 19372 18257 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088873174.1 protein_id gnl|my_center|LOCUS_00160 19490 20494 gene locus_tag LOCUS_00170 gene purM 19490 20494 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312859.1 protein_id gnl|my_center|LOCUS_00170 20482 21132 gene locus_tag LOCUS_00180 gene purN 20482 21132 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_00180 21192 21314 gene locus_tag LOCUS_00190 21192 21314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21798 21376 gene locus_tag LOCUS_00200 gene ndk 21798 21376 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390018.1 protein_id gnl|my_center|LOCUS_00200 21896 22705 gene locus_tag LOCUS_00210 21896 22705 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_00210 22702 22944 gene locus_tag LOCUS_00220 22702 22944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24700 22946 gene locus_tag LOCUS_00230 24700 22946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25548 24802 gene locus_tag LOCUS_00240 25548 24802 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176257.1 protein_id gnl|my_center|LOCUS_00240 25604 25683 gene locus_tag LOCUS_t00030 25604 25683 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27504 26014 gene locus_tag LOCUS_00250 27504 26014 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_00250 27620 29269 gene locus_tag LOCUS_00260 27620 29269 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_00260 29266 29964 gene locus_tag LOCUS_00270 29266 29964 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388158.1 protein_id gnl|my_center|LOCUS_00270 29961 31064 gene locus_tag LOCUS_00280 gene lptF 29961 31064 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_00280 31066 32160 gene locus_tag LOCUS_00290 gene lptG 31066 32160 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_00290 32160 34334 gene locus_tag LOCUS_00300 gene lptD 32160 34334 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_00300 34376 35614 gene locus_tag LOCUS_00310 34376 35614 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625938.1 protein_id gnl|my_center|LOCUS_00310 35611 36621 gene locus_tag LOCUS_00320 gene pdxA 35611 36621 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388191.1 protein_id gnl|my_center|LOCUS_00320 36901 36635 gene locus_tag LOCUS_00330 36901 36635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36824 37432 gene locus_tag LOCUS_00340 36824 37432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38966 37449 gene locus_tag LOCUS_00350 38966 37449 CDS product putative 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265854.1 protein_id gnl|my_center|LOCUS_00350 39643 39005 gene locus_tag LOCUS_00360 gene gmk 39643 39005 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_00360 40529 39648 gene locus_tag LOCUS_00370 40529 39648 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_00370 40614 41375 gene locus_tag LOCUS_00380 40614 41375 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_00380 41848 41372 gene locus_tag LOCUS_00390 41848 41372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42153 41848 gene locus_tag LOCUS_00400 42153 41848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42718 42137 gene locus_tag LOCUS_00410 42718 42137 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920592.1 protein_id gnl|my_center|LOCUS_00410 43181 42774 gene locus_tag LOCUS_00420 gene hisI 43181 42774 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_00420 44371 43178 gene locus_tag LOCUS_00430 gene metC 44371 43178 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_00430 44529 45296 gene locus_tag LOCUS_00440 44529 45296 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385286.1 protein_id gnl|my_center|LOCUS_00440 45348 46472 gene locus_tag LOCUS_00450 45348 46472 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_00450 46535 47443 gene locus_tag LOCUS_00460 46535 47443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48144 47458 gene locus_tag LOCUS_00470 48144 47458 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971224.1 protein_id gnl|my_center|LOCUS_00470 48331 48149 gene locus_tag LOCUS_00480 48331 48149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48463 49122 gene locus_tag LOCUS_00490 48463 49122 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337086.1 protein_id gnl|my_center|LOCUS_00490 49122 49898 gene locus_tag LOCUS_00500 gene hyi 49122 49898 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531398.1 protein_id gnl|my_center|LOCUS_00500 49970 51634 gene locus_tag LOCUS_00510 49970 51634 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_00510 51692 52648 gene locus_tag LOCUS_00520 51692 52648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_00520 52659 53618 gene locus_tag LOCUS_00530 52659 53618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_00530 54065 53628 gene locus_tag LOCUS_00540 54065 53628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 55240 54062 gene locus_tag LOCUS_00550 55240 54062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55455 55817 gene locus_tag LOCUS_00560 55455 55817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57046 55814 gene locus_tag LOCUS_00570 57046 55814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_00570 58032 57109 gene locus_tag LOCUS_00580 58032 57109 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_00580 59246 58221 gene locus_tag LOCUS_00590 59246 58221 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_00590 60213 59248 gene locus_tag LOCUS_00600 60213 59248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_00600 61145 60213 gene locus_tag LOCUS_00610 61145 60213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 protein_id gnl|my_center|LOCUS_00610 62133 61150 gene locus_tag LOCUS_00620 62133 61150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906119.1 protein_id gnl|my_center|LOCUS_00620 63787 62213 gene locus_tag LOCUS_00630 63787 62213 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815878.1 protein_id gnl|my_center|LOCUS_00630 64577 63945 gene locus_tag LOCUS_00640 gene upp 64577 63945 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384917.1 protein_id gnl|my_center|LOCUS_00640 65842 64610 gene locus_tag LOCUS_00650 65842 64610 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089973.1 protein_id gnl|my_center|LOCUS_00650 67095 65839 gene locus_tag LOCUS_00660 67095 65839 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216144.1 protein_id gnl|my_center|LOCUS_00660 68682 67108 gene locus_tag LOCUS_00670 68682 67108 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 protein_id gnl|my_center|LOCUS_00670 68790 70349 gene locus_tag LOCUS_00680 68790 70349 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064158.1 protein_id gnl|my_center|LOCUS_00680 70550 70960 gene locus_tag LOCUS_00690 70550 70960 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_00690 71003 71416 gene locus_tag LOCUS_00700 71003 71416 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_00700 71621 71430 gene locus_tag LOCUS_00710 71621 71430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 71765 71899 gene locus_tag LOCUS_00720 71765 71899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 71930 72232 gene locus_tag LOCUS_00730 71930 72232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00730 73756 72272 gene locus_tag LOCUS_00740 73756 72272 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_00740 73922 75499 gene locus_tag LOCUS_00750 73922 75499 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_00750 75731 76675 gene locus_tag LOCUS_00760 75731 76675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 protein_id gnl|my_center|LOCUS_00760 76668 77501 gene locus_tag LOCUS_00770 gene gsiD 76668 77501 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930908.1 protein_id gnl|my_center|LOCUS_00770 77501 78298 gene locus_tag LOCUS_00780 77501 78298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_00780 78295 79263 gene locus_tag LOCUS_00790 78295 79263 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_00790 80248 79253 gene locus_tag LOCUS_00800 80248 79253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973979.1 protein_id gnl|my_center|LOCUS_00800 80359 81342 gene locus_tag LOCUS_00810 80359 81342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 protein_id gnl|my_center|LOCUS_00810 81417 82484 gene locus_tag LOCUS_00820 81417 82484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973977.1 protein_id gnl|my_center|LOCUS_00820 82481 84133 gene locus_tag LOCUS_00830 82481 84133 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973978.1 protein_id gnl|my_center|LOCUS_00830 84287 85537 gene locus_tag LOCUS_00840 84287 85537 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099398.1 protein_id gnl|my_center|LOCUS_00840 85630 87021 gene locus_tag LOCUS_00850 85630 87021 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_00850 87018 88268 gene locus_tag LOCUS_00860 87018 88268 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524302.1 protein_id gnl|my_center|LOCUS_00860 88268 88549 gene locus_tag LOCUS_00870 88268 88549 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536552.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence002 1772 297 gene locus_tag LOCUS_00880 1772 297 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707489.1 protein_id gnl|my_center|LOCUS_00880 1857 2141 gene locus_tag LOCUS_00890 1857 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 2211 2522 gene locus_tag LOCUS_00900 2211 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626221.1 protein_id gnl|my_center|LOCUS_00900 2522 3019 gene locus_tag LOCUS_00910 2522 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3512 3021 gene locus_tag LOCUS_00920 3512 3021 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528792.1 protein_id gnl|my_center|LOCUS_00920 4588 3512 gene locus_tag LOCUS_00930 4588 3512 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339267.1 protein_id gnl|my_center|LOCUS_00930 4709 4921 gene locus_tag LOCUS_00940 4709 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5046 5261 gene locus_tag LOCUS_00950 5046 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 6504 5320 gene locus_tag LOCUS_00960 6504 5320 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 protein_id gnl|my_center|LOCUS_00960 7803 6580 gene locus_tag LOCUS_00970 7803 6580 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090553.1 protein_id gnl|my_center|LOCUS_00970 8843 7818 gene locus_tag LOCUS_00980 8843 7818 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090550.1 protein_id gnl|my_center|LOCUS_00980 9726 8848 gene locus_tag LOCUS_00990 9726 8848 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090549.1 protein_id gnl|my_center|LOCUS_00990 10455 9742 gene locus_tag LOCUS_01000 10455 9742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_01000 11270 10452 gene locus_tag LOCUS_01010 11270 10452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_01010 12183 11329 gene locus_tag LOCUS_01020 12183 11329 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_01020 12299 14356 gene locus_tag LOCUS_01030 12299 14356 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090545.1 protein_id gnl|my_center|LOCUS_01030 14353 16017 gene locus_tag LOCUS_01040 gene pimA 14353 16017 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090544.1 protein_id gnl|my_center|LOCUS_01040 16018 17217 gene locus_tag LOCUS_01050 gene pimC 16018 17217 CDS product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 protein_id gnl|my_center|LOCUS_01050 17224 18372 gene locus_tag LOCUS_01060 gene pimD 17224 18372 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_01060 18414 18719 gene locus_tag LOCUS_01070 18414 18719 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968800.1 protein_id gnl|my_center|LOCUS_01070 18719 19165 gene locus_tag LOCUS_01080 18719 19165 CDS product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530737.1 protein_id gnl|my_center|LOCUS_01080 20158 19178 gene locus_tag LOCUS_01090 20158 19178 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531159.1 protein_id gnl|my_center|LOCUS_01090 21969 20287 gene locus_tag LOCUS_01100 21969 20287 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530882.1 protein_id gnl|my_center|LOCUS_01100 22232 23173 gene locus_tag LOCUS_01110 22232 23173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 protein_id gnl|my_center|LOCUS_01110 23170 24024 gene locus_tag LOCUS_01120 23170 24024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_01120 24024 26069 gene locus_tag LOCUS_01130 24024 26069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_01130 26066 27772 gene locus_tag LOCUS_01140 gene ggt 26066 27772 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868894.1 protein_id gnl|my_center|LOCUS_01140 27766 29445 gene locus_tag LOCUS_01150 gene ggt 27766 29445 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_01150 29523 30869 gene locus_tag LOCUS_01160 29523 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 30873 32279 gene locus_tag LOCUS_01170 30873 32279 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104356.1 protein_id gnl|my_center|LOCUS_01170 32438 32286 gene locus_tag LOCUS_01180 32438 32286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 34233 32518 gene locus_tag LOCUS_01190 34233 32518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992440.1 protein_id gnl|my_center|LOCUS_01190 35369 34230 gene locus_tag LOCUS_01200 35369 34230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316066.1 protein_id gnl|my_center|LOCUS_01200 36355 35369 gene locus_tag LOCUS_01210 36355 35369 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973627.1 protein_id gnl|my_center|LOCUS_01210 38358 36406 gene locus_tag LOCUS_01220 38358 36406 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973626.1 protein_id gnl|my_center|LOCUS_01220 39416 38430 gene locus_tag LOCUS_01230 39416 38430 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_01230 39548 40252 gene locus_tag LOCUS_01240 39548 40252 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_01240 40809 40249 gene locus_tag LOCUS_01250 40809 40249 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389806.1 protein_id gnl|my_center|LOCUS_01250 41167 40817 gene locus_tag LOCUS_01260 41167 40817 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088415.1 protein_id gnl|my_center|LOCUS_01260 42536 41190 gene locus_tag LOCUS_01270 42536 41190 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112675.1 protein_id gnl|my_center|LOCUS_01270 43087 42533 gene locus_tag LOCUS_01280 gene pcaG 43087 42533 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083750.1 protein_id gnl|my_center|LOCUS_01280 43794 43084 gene locus_tag LOCUS_01290 gene pcaH 43794 43084 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_01290 43925 45022 gene locus_tag LOCUS_01300 43925 45022 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085701.1 protein_id gnl|my_center|LOCUS_01300 45022 46515 gene locus_tag LOCUS_01310 45022 46515 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965463.1 protein_id gnl|my_center|LOCUS_01310 46599 48101 gene locus_tag LOCUS_01320 46599 48101 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965463.1 protein_id gnl|my_center|LOCUS_01320 49518 48109 gene locus_tag LOCUS_01330 49518 48109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 49928 49536 gene locus_tag LOCUS_01340 49928 49536 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 protein_id gnl|my_center|LOCUS_01340 50910 49933 gene locus_tag LOCUS_01350 gene pip 50910 49933 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925856.1 protein_id gnl|my_center|LOCUS_01350 51370 50984 gene locus_tag LOCUS_01360 51370 50984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 51747 51328 gene locus_tag LOCUS_01370 51747 51328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 51846 52745 gene locus_tag LOCUS_01380 51846 52745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 52836 53873 gene locus_tag LOCUS_01390 52836 53873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 53950 54450 gene locus_tag LOCUS_01400 53950 54450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 55394 54411 gene locus_tag LOCUS_01410 55394 54411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 55564 56439 gene locus_tag LOCUS_01420 55564 56439 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_01420 57155 56889 gene locus_tag LOCUS_01430 57155 56889 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_01430 57336 58274 gene locus_tag LOCUS_01440 gene thyX 57336 58274 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_01440 58285 58707 gene locus_tag LOCUS_01450 58285 58707 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404734.1 protein_id gnl|my_center|LOCUS_01450 59135 58704 gene locus_tag LOCUS_01460 59135 58704 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206674.1 protein_id gnl|my_center|LOCUS_01460 60014 59154 gene locus_tag LOCUS_01470 60014 59154 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521366.1 protein_id gnl|my_center|LOCUS_01470 60095 60415 gene locus_tag LOCUS_01480 60095 60415 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114934.1 protein_id gnl|my_center|LOCUS_01480 60425 60850 gene locus_tag LOCUS_01490 60425 60850 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_01490 60852 61298 gene locus_tag LOCUS_01500 60852 61298 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_01500 61309 62079 gene locus_tag LOCUS_01510 61309 62079 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_01510 63104 62076 gene locus_tag LOCUS_01520 63104 62076 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090584.1 protein_id gnl|my_center|LOCUS_01520 63226 63507 gene locus_tag LOCUS_01530 63226 63507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 63534 63758 gene locus_tag LOCUS_01540 63534 63758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 63797 64174 gene locus_tag LOCUS_01550 63797 64174 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532560.1 protein_id gnl|my_center|LOCUS_01550 64178 64390 gene locus_tag LOCUS_01560 64178 64390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 64387 64944 gene locus_tag LOCUS_01570 64387 64944 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551593.1 protein_id gnl|my_center|LOCUS_01570 64941 65615 gene locus_tag LOCUS_01580 64941 65615 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_01580 65624 66115 gene locus_tag LOCUS_01590 65624 66115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 66115 66486 gene locus_tag LOCUS_01600 66115 66486 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237965.1 protein_id gnl|my_center|LOCUS_01600 66603 67838 gene locus_tag LOCUS_01610 66603 67838 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504198.1 protein_id gnl|my_center|LOCUS_01610 67933 68631 gene locus_tag LOCUS_01620 67933 68631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 69204 68638 gene locus_tag LOCUS_01630 69204 68638 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175700.1 protein_id gnl|my_center|LOCUS_01630 69725 69204 gene locus_tag LOCUS_01640 69725 69204 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965676.1 protein_id gnl|my_center|LOCUS_01640 71495 69813 gene locus_tag LOCUS_01650 71495 69813 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982156.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence003 1736 159 gene locus_tag LOCUS_01660 1736 159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_01660 3362 1770 gene locus_tag LOCUS_01670 3362 1770 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089435.1 protein_id gnl|my_center|LOCUS_01670 4418 3435 gene locus_tag LOCUS_01680 4418 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4617 4850 gene locus_tag LOCUS_01690 4617 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 5003 4929 gene locus_tag LOCUS_t00040 5003 4929 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5322 7247 gene locus_tag LOCUS_01700 5322 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 7921 7244 gene locus_tag LOCUS_01710 gene gph 7921 7244 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_01710 8024 9382 gene locus_tag LOCUS_01720 gene glmU 8024 9382 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_01720 9387 11210 gene locus_tag LOCUS_01730 gene glmS 9387 11210 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_01730 11291 12766 gene locus_tag LOCUS_01740 gene gabD 11291 12766 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_01740 12767 14143 gene locus_tag LOCUS_01750 gene gor 12767 14143 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_01750 14205 16103 gene locus_tag LOCUS_01760 14205 16103 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088369.1 protein_id gnl|my_center|LOCUS_01760 16100 18028 gene locus_tag LOCUS_01770 16100 18028 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_01770 19182 18025 gene locus_tag LOCUS_01780 19182 18025 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921422.1 protein_id gnl|my_center|LOCUS_01780 19481 19185 gene locus_tag LOCUS_01790 19481 19185 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528325.1 protein_id gnl|my_center|LOCUS_01790 19573 20955 gene locus_tag LOCUS_01800 19573 20955 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_01800 21013 22137 gene locus_tag LOCUS_01810 21013 22137 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_01810 22142 22876 gene locus_tag LOCUS_01820 22142 22876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 22873 24525 gene locus_tag LOCUS_01830 22873 24525 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_01830 24525 25847 gene locus_tag LOCUS_01840 gene gltX 24525 25847 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_01840 25854 27233 gene locus_tag LOCUS_01850 gene cysS 25854 27233 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_01850 27247 28176 gene locus_tag LOCUS_01860 27247 28176 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401703.1 protein_id gnl|my_center|LOCUS_01860 28282 30744 gene locus_tag LOCUS_01870 28282 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 30754 31107 gene locus_tag LOCUS_01880 30754 31107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01880 31101 31292 gene locus_tag LOCUS_01890 31101 31292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 31533 31219 gene locus_tag LOCUS_01900 31533 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 31619 32068 gene locus_tag LOCUS_01910 31619 32068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 32097 32963 gene locus_tag LOCUS_01920 32097 32963 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390999.1 protein_id gnl|my_center|LOCUS_01920 32968 33750 gene locus_tag LOCUS_01930 32968 33750 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969599.1 protein_id gnl|my_center|LOCUS_01930 33761 35476 gene locus_tag LOCUS_01940 33761 35476 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_01940 35682 37517 gene locus_tag LOCUS_01950 35682 37517 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_01950 37540 38622 gene locus_tag LOCUS_01960 37540 38622 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_01960 39896 38631 gene locus_tag LOCUS_01970 39896 38631 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070644.1 protein_id gnl|my_center|LOCUS_01970 39985 41124 gene locus_tag LOCUS_01980 gene rodA 39985 41124 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 protein_id gnl|my_center|LOCUS_01980 41753 41121 gene locus_tag LOCUS_01990 41753 41121 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 protein_id gnl|my_center|LOCUS_01990 42996 41758 gene locus_tag LOCUS_02000 gene kynU 42996 41758 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 protein_id gnl|my_center|LOCUS_02000 43154 43576 gene locus_tag LOCUS_02010 gene aroQ 43154 43576 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_02010 43573 44037 gene locus_tag LOCUS_02020 gene accB 43573 44037 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_02020 44056 45420 gene locus_tag LOCUS_02030 gene accC 44056 45420 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_02030 45428 46030 gene locus_tag LOCUS_02040 gene aat 45428 46030 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531356.1 protein_id gnl|my_center|LOCUS_02040 48107 46035 gene locus_tag LOCUS_02050 48107 46035 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088369.1 protein_id gnl|my_center|LOCUS_02050 48472 48092 gene locus_tag LOCUS_02060 48472 48092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 48926 48453 gene locus_tag LOCUS_02070 48926 48453 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_02070 49305 48946 gene locus_tag LOCUS_02080 49305 48946 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_02080 49375 49752 gene locus_tag LOCUS_02090 49375 49752 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191984393.1 protein_id gnl|my_center|LOCUS_02090 50164 53823 gene locus_tag LOCUS_02100 50164 53823 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_02100 54014 54475 gene locus_tag LOCUS_02110 54014 54475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 54877 54479 gene locus_tag LOCUS_02120 gene vapC 54877 54479 CDS product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 protein_id gnl|my_center|LOCUS_02120 55107 54877 gene locus_tag LOCUS_02130 gene vapB 55107 54877 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266698.1 protein_id gnl|my_center|LOCUS_02130 55662 55174 gene locus_tag LOCUS_02140 55662 55174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 57053 55659 gene locus_tag LOCUS_02150 57053 55659 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_02150 57306 57827 gene locus_tag LOCUS_02160 57306 57827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 58711 57824 gene locus_tag LOCUS_02170 58711 57824 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_02170 58774 59748 gene locus_tag LOCUS_02180 58774 59748 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_02180 61262 59745 gene locus_tag LOCUS_02190 61262 59745 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_02190 62280 61267 gene locus_tag LOCUS_02200 62280 61267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 63833 62289 gene locus_tag LOCUS_02210 63833 62289 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_02210 63909 64376 gene locus_tag LOCUS_02220 63909 64376 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_02220 64382 65542 gene locus_tag LOCUS_02230 64382 65542 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence004 289 1041 gene locus_tag LOCUS_02240 289 1041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 protein_id gnl|my_center|LOCUS_02240 1038 1763 gene locus_tag LOCUS_02250 1038 1763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 protein_id gnl|my_center|LOCUS_02250 1763 2659 gene locus_tag LOCUS_02260 1763 2659 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_02260 2656 3603 gene locus_tag LOCUS_02270 2656 3603 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_02270 3646 4905 gene locus_tag LOCUS_02280 3646 4905 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 protein_id gnl|my_center|LOCUS_02280 4964 5311 gene locus_tag LOCUS_02290 4964 5311 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_02290 5313 6365 gene locus_tag LOCUS_02300 5313 6365 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_02300 6367 7824 gene locus_tag LOCUS_02310 6367 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 9524 7821 gene locus_tag LOCUS_02320 gene cobJ 9524 7821 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105215.1 protein_id gnl|my_center|LOCUS_02320 10243 9512 gene locus_tag LOCUS_02330 10243 9512 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526969.1 protein_id gnl|my_center|LOCUS_02330 10869 10243 gene locus_tag LOCUS_02340 10869 10243 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_02340 12185 10866 gene locus_tag LOCUS_02350 gene cobG 12185 10866 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193383855.1 protein_id gnl|my_center|LOCUS_02350 12483 12271 gene locus_tag LOCUS_02360 12483 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12380 12874 gene locus_tag LOCUS_02370 12380 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12884 13456 gene locus_tag LOCUS_02380 12884 13456 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975789.1 protein_id gnl|my_center|LOCUS_02380 13456 14535 gene locus_tag LOCUS_02390 13456 14535 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061689.1 protein_id gnl|my_center|LOCUS_02390 14532 15467 gene locus_tag LOCUS_02400 14532 15467 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975791.1 protein_id gnl|my_center|LOCUS_02400 15464 17977 gene locus_tag LOCUS_02410 gene ctaD 15464 17977 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061692.1 protein_id gnl|my_center|LOCUS_02410 17952 18278 gene locus_tag LOCUS_02420 17952 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 18364 19845 gene locus_tag LOCUS_02430 18364 19845 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_02430 20005 21546 gene locus_tag LOCUS_02440 20005 21546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931079.1 protein_id gnl|my_center|LOCUS_02440 21622 23664 gene locus_tag LOCUS_02450 21622 23664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_02450 23661 24551 gene locus_tag LOCUS_02460 23661 24551 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095723.1 protein_id gnl|my_center|LOCUS_02460 24548 25495 gene locus_tag LOCUS_02470 24548 25495 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_02470 26352 25492 gene locus_tag LOCUS_02480 26352 25492 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393794.1 protein_id gnl|my_center|LOCUS_02480 27614 26349 gene locus_tag LOCUS_02490 27614 26349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_02490 29230 27680 gene locus_tag LOCUS_02500 29230 27680 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_02500 29337 31088 gene locus_tag LOCUS_02510 29337 31088 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_02510 31114 31893 gene locus_tag LOCUS_02520 31114 31893 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 protein_id gnl|my_center|LOCUS_02520 32045 31890 gene locus_tag LOCUS_02530 32045 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 31987 32772 gene locus_tag LOCUS_02540 31987 32772 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226014528.1 protein_id gnl|my_center|LOCUS_02540 32789 33829 gene locus_tag LOCUS_02550 32789 33829 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339534.1 protein_id gnl|my_center|LOCUS_02550 33834 35132 gene locus_tag LOCUS_02560 33834 35132 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244067.1 protein_id gnl|my_center|LOCUS_02560 35129 35881 gene locus_tag LOCUS_02570 35129 35881 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969973.1 protein_id gnl|my_center|LOCUS_02570 35901 36227 gene locus_tag LOCUS_02580 35901 36227 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_02580 37179 36220 gene locus_tag LOCUS_02590 37179 36220 CDS product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113941.1 protein_id gnl|my_center|LOCUS_02590 38049 37225 gene locus_tag LOCUS_02600 38049 37225 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_02600 38115 38525 gene locus_tag LOCUS_02610 38115 38525 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_02610 39526 38543 gene locus_tag LOCUS_02620 gene htpX 39526 38543 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989629.1 protein_id gnl|my_center|LOCUS_02620 40090 39536 gene locus_tag LOCUS_02630 40090 39536 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219822.1 protein_id gnl|my_center|LOCUS_02630 40989 40219 gene locus_tag LOCUS_02640 40989 40219 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314989.1 protein_id gnl|my_center|LOCUS_02640 41956 41012 gene locus_tag LOCUS_02650 41956 41012 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_02650 42138 42758 gene locus_tag LOCUS_02660 42138 42758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_02660 46545 42748 gene locus_tag LOCUS_02670 46545 42748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 46616 48241 gene locus_tag LOCUS_02680 46616 48241 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970328.1 protein_id gnl|my_center|LOCUS_02680 48492 49061 gene locus_tag LOCUS_02690 48492 49061 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265800.1 protein_id gnl|my_center|LOCUS_02690 50251 49058 gene locus_tag LOCUS_02700 50251 49058 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085256.1 protein_id gnl|my_center|LOCUS_02700 50541 50260 gene locus_tag LOCUS_02710 50541 50260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 51128 50538 gene locus_tag LOCUS_02720 51128 50538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 51661 51125 gene locus_tag LOCUS_02730 51661 51125 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_02730 51702 52709 gene locus_tag LOCUS_02740 51702 52709 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_02740 52776 53651 gene locus_tag LOCUS_02750 52776 53651 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_02750 53662 56394 gene locus_tag LOCUS_02760 53662 56394 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388124.1 protein_id gnl|my_center|LOCUS_02760 56391 58457 gene locus_tag LOCUS_02770 56391 58457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388125.1 protein_id gnl|my_center|LOCUS_02770 59000 58461 gene locus_tag LOCUS_02780 59000 58461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 59917 58997 gene locus_tag LOCUS_02790 59917 58997 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968807.1 protein_id gnl|my_center|LOCUS_02790 61460 60186 gene locus_tag LOCUS_02800 gene hisS 61460 60186 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_02800 62234 61524 gene locus_tag LOCUS_02810 62234 61524 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530344.1 protein_id gnl|my_center|LOCUS_02810 63166 62246 gene locus_tag LOCUS_02820 63166 62246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 63263 63745 gene locus_tag LOCUS_02830 gene bfr 63263 63745 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_02830 63959 63759 gene locus_tag LOCUS_02840 63959 63759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 64065 64199 gene locus_tag LOCUS_02850 64065 64199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 64209 64481 gene locus_tag LOCUS_02860 64209 64481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 64532 65452 gene locus_tag LOCUS_02870 64532 65452 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973218.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence005 <1 1574 gene locus_tag LOCUS_02880 <1 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072522.1:DUF885 domain-containing protein 2581 1571 gene locus_tag LOCUS_02890 2581 1571 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973039.1 protein_id gnl|my_center|LOCUS_02890 4434 2578 gene locus_tag LOCUS_02900 4434 2578 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225594.1 protein_id gnl|my_center|LOCUS_02900 5399 4434 gene locus_tag LOCUS_02910 5399 4434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_02910 7020 5443 gene locus_tag LOCUS_02920 7020 5443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974864.1 protein_id gnl|my_center|LOCUS_02920 7244 8509 gene locus_tag LOCUS_02930 7244 8509 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494235.1 protein_id gnl|my_center|LOCUS_02930 9486 8515 gene locus_tag LOCUS_02940 9486 8515 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947574.1 protein_id gnl|my_center|LOCUS_02940 9522 11093 gene locus_tag LOCUS_02950 9522 11093 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 protein_id gnl|my_center|LOCUS_02950 11090 11488 gene locus_tag LOCUS_02960 11090 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 11955 11485 gene locus_tag LOCUS_02970 11955 11485 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 protein_id gnl|my_center|LOCUS_02970 12222 13208 gene locus_tag LOCUS_02980 12222 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13213 13503 gene locus_tag LOCUS_02990 13213 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 13519 15171 gene locus_tag LOCUS_03000 13519 15171 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 protein_id gnl|my_center|LOCUS_03000 15161 15682 gene locus_tag LOCUS_03010 15161 15682 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 protein_id gnl|my_center|LOCUS_03010 15926 15756 gene locus_tag LOCUS_03020 15926 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16181 17434 gene locus_tag LOCUS_03030 16181 17434 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 protein_id gnl|my_center|LOCUS_03030 17445 17720 gene locus_tag LOCUS_03040 17445 17720 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 protein_id gnl|my_center|LOCUS_03040 17717 20674 gene locus_tag LOCUS_03050 17717 20674 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_03050 20661 21257 gene locus_tag LOCUS_03060 20661 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 21867 21451 gene locus_tag LOCUS_03070 21867 21451 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_03070 22133 21879 gene locus_tag LOCUS_03080 22133 21879 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_03080 23540 22227 gene locus_tag LOCUS_03090 23540 22227 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_03090 25245 23668 gene locus_tag LOCUS_03100 25245 23668 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_03100 25329 26474 gene locus_tag LOCUS_03110 25329 26474 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931145.1 protein_id gnl|my_center|LOCUS_03110 26481 27611 gene locus_tag LOCUS_03120 26481 27611 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_03120 27626 28078 gene locus_tag LOCUS_03130 27626 28078 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_03130 30109 28079 gene locus_tag LOCUS_03140 30109 28079 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975924.1 protein_id gnl|my_center|LOCUS_03140 30410 30114 gene locus_tag LOCUS_03150 30410 30114 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512816.1 protein_id gnl|my_center|LOCUS_03150 30351 31457 gene locus_tag LOCUS_03160 gene bmt 30351 31457 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975909.1 protein_id gnl|my_center|LOCUS_03160 31576 32826 gene locus_tag LOCUS_03170 31576 32826 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092587370.1 protein_id gnl|my_center|LOCUS_03170 32865 33566 gene locus_tag LOCUS_03180 32865 33566 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_03180 33566 34219 gene locus_tag LOCUS_03190 33566 34219 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_03190 34216 35772 gene locus_tag LOCUS_03200 34216 35772 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967775.1 protein_id gnl|my_center|LOCUS_03200 38195 35769 gene locus_tag LOCUS_03210 38195 35769 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_03210 39231 38209 gene locus_tag LOCUS_03220 39231 38209 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_03220 39472 41139 gene locus_tag LOCUS_03230 39472 41139 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_03230 41270 42175 gene locus_tag LOCUS_03240 41270 42175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095091852.1 protein_id gnl|my_center|LOCUS_03240 42172 43077 gene locus_tag LOCUS_03250 42172 43077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532882.1 protein_id gnl|my_center|LOCUS_03250 43070 45124 gene locus_tag LOCUS_03260 43070 45124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_03260 45465 45070 gene locus_tag LOCUS_03270 45465 45070 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_03270 46064 45462 gene locus_tag LOCUS_03280 46064 45462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 46879 46064 gene locus_tag LOCUS_03290 46879 46064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 49287 46876 gene locus_tag LOCUS_03300 49287 46876 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_03300 50273 49332 gene locus_tag LOCUS_03310 50273 49332 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969617.1 protein_id gnl|my_center|LOCUS_03310 51143 50274 gene locus_tag LOCUS_03320 51143 50274 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314319.1 protein_id gnl|my_center|LOCUS_03320 52899 51259 gene locus_tag LOCUS_03330 52899 51259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 54011 52917 gene locus_tag LOCUS_03340 54011 52917 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_03340 56005 54014 gene locus_tag LOCUS_03350 56005 54014 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_03350 56842 56018 gene locus_tag LOCUS_03360 56842 56018 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_03360 56937 58136 gene locus_tag LOCUS_03370 56937 58136 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104360.1 protein_id gnl|my_center|LOCUS_03370 58297 58551 gene locus_tag LOCUS_03380 58297 58551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 58548 58988 gene locus_tag LOCUS_03390 58548 58988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389554.1 protein_id gnl|my_center|LOCUS_03390 58996 59292 gene locus_tag LOCUS_03400 58996 59292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 59550 59711 gene locus_tag LOCUS_03410 59550 59711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence006 499 71 gene locus_tag LOCUS_03420 499 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 1058 1852 gene locus_tag LOCUS_03430 1058 1852 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173807.1 protein_id gnl|my_center|LOCUS_03430 1857 3236 gene locus_tag LOCUS_03440 1857 3236 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173806.1 protein_id gnl|my_center|LOCUS_03440 3677 3240 gene locus_tag LOCUS_03450 gene trxC 3677 3240 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_03450 3779 4906 gene locus_tag LOCUS_03460 gene zapE 3779 4906 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_03460 5426 4914 gene locus_tag LOCUS_03470 5426 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5508 5798 gene locus_tag LOCUS_03480 5508 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 5795 6529 gene locus_tag LOCUS_03490 gene mdh 5795 6529 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388965.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 6558 7727 gene locus_tag LOCUS_03500 gene sucC 6558 7727 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_03500 7727 8605 gene locus_tag LOCUS_03510 gene sucD 7727 8605 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_03510 8665 11520 gene locus_tag LOCUS_03520 8665 11520 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_03520 11547 12764 gene locus_tag LOCUS_03530 gene odhB 11547 12764 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_03530 12768 14174 gene locus_tag LOCUS_03540 gene lpdA 12768 14174 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_03540 15937 14171 gene locus_tag LOCUS_03550 15937 14171 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_03550 16679 16053 gene locus_tag LOCUS_03560 16679 16053 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390496.1 protein_id gnl|my_center|LOCUS_03560 17602 16676 gene locus_tag LOCUS_03570 17602 16676 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388975.1 protein_id gnl|my_center|LOCUS_03570 18282 17581 gene locus_tag LOCUS_03580 18282 17581 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470606.1 protein_id gnl|my_center|LOCUS_03580 18938 18282 gene locus_tag LOCUS_03590 gene fsa 18938 18282 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 protein_id gnl|my_center|LOCUS_03590 19069 21180 gene locus_tag LOCUS_03600 19069 21180 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529032.1 protein_id gnl|my_center|LOCUS_03600 21656 21177 gene locus_tag LOCUS_03610 21656 21177 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_03610 21747 22319 gene locus_tag LOCUS_03620 21747 22319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384992.1 protein_id gnl|my_center|LOCUS_03620 22326 23318 gene locus_tag LOCUS_03630 gene meaB 22326 23318 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_03630 23406 23699 gene locus_tag LOCUS_03640 gene rpmB 23406 23699 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387963.1 protein_id gnl|my_center|LOCUS_03640 24248 23751 gene locus_tag LOCUS_03650 24248 23751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 24783 24259 gene locus_tag LOCUS_03660 24783 24259 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_03660 25432 24809 gene locus_tag LOCUS_03670 25432 24809 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_03670 25694 26248 gene locus_tag LOCUS_03680 25694 26248 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_03680 26248 27777 gene locus_tag LOCUS_03690 gene atpA 26248 27777 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388979.1 protein_id gnl|my_center|LOCUS_03690 27798 28682 gene locus_tag LOCUS_03700 27798 28682 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_03700 28719 30143 gene locus_tag LOCUS_03710 gene atpD 28719 30143 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_03710 30146 30547 gene locus_tag LOCUS_03720 30146 30547 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_03720 30618 31427 gene locus_tag LOCUS_03730 30618 31427 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_03730 31442 32647 gene locus_tag LOCUS_03740 31442 32647 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_03740 33853 32651 gene locus_tag LOCUS_03750 gene pcaF 33853 32651 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522007.1 protein_id gnl|my_center|LOCUS_03750 34074 35090 gene locus_tag LOCUS_03760 gene iolG 34074 35090 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193713.1 protein_id gnl|my_center|LOCUS_03760 35087 35863 gene locus_tag LOCUS_03770 35087 35863 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975713.1 protein_id gnl|my_center|LOCUS_03770 35896 36102 gene locus_tag LOCUS_03780 35896 36102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 36102 36488 gene locus_tag LOCUS_03790 36102 36488 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256880.1 protein_id gnl|my_center|LOCUS_03790 36610 36485 gene locus_tag LOCUS_03800 36610 36485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 37794 36607 gene locus_tag LOCUS_03810 37794 36607 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_03810 38590 37805 gene locus_tag LOCUS_03820 38590 37805 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088574.1 protein_id gnl|my_center|LOCUS_03820 38665 39804 gene locus_tag LOCUS_03830 38665 39804 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_03830 40607 39801 gene locus_tag LOCUS_03840 40607 39801 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064995.1 protein_id gnl|my_center|LOCUS_03840 41886 40600 gene locus_tag LOCUS_03850 41886 40600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_03850 42872 41883 gene locus_tag LOCUS_03860 42872 41883 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533375.1 protein_id gnl|my_center|LOCUS_03860 42980 43381 gene locus_tag LOCUS_03870 42980 43381 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064498.1 protein_id gnl|my_center|LOCUS_03870 43397 43873 gene locus_tag LOCUS_03880 43397 43873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 43874 44548 gene locus_tag LOCUS_03890 43874 44548 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387911.1 protein_id gnl|my_center|LOCUS_03890 44595 45155 gene locus_tag LOCUS_03900 44595 45155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 45345 45596 gene locus_tag LOCUS_03910 45345 45596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 46246 45593 gene locus_tag LOCUS_03920 gene nth 46246 45593 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_03920 46341 46901 gene locus_tag LOCUS_03930 46341 46901 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_03930 47004 47681 gene locus_tag LOCUS_03940 gene tsaB 47004 47681 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_03940 47678 48142 gene locus_tag LOCUS_03950 47678 48142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 48279 48698 gene locus_tag LOCUS_03960 48279 48698 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_03960 48814 49242 gene locus_tag LOCUS_03970 48814 49242 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_03970 49347 50180 gene locus_tag LOCUS_03980 49347 50180 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_03980 50186 50965 gene locus_tag LOCUS_03990 50186 50965 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_03990 53382 50962 gene locus_tag LOCUS_04000 53382 50962 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_04000 54809 53535 gene locus_tag LOCUS_04010 54809 53535 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_04010 55187 54981 gene locus_tag LOCUS_04020 55187 54981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 55174 57990 gene locus_tag LOCUS_04030 55174 57990 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531364.1 protein_id gnl|my_center|LOCUS_04030 59351 58065 gene locus_tag LOCUS_04040 59351 58065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence007 <1 548 gene locus_tag LOCUS_04050 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965110.1:heparinase II/III family protein 606 968 gene locus_tag LOCUS_04060 606 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 1506 943 gene locus_tag LOCUS_04070 1506 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 1736 1509 gene locus_tag LOCUS_04080 1736 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1908 2621 gene locus_tag LOCUS_04090 1908 2621 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_04090 2626 4047 gene locus_tag LOCUS_04100 2626 4047 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_04100 4044 4718 gene locus_tag LOCUS_04110 4044 4718 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_04110 4718 5269 gene locus_tag LOCUS_04120 4718 5269 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_04120 6132 5266 gene locus_tag LOCUS_04130 6132 5266 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_04130 6192 7400 gene locus_tag LOCUS_04140 gene larC 6192 7400 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_04140 7393 8211 gene locus_tag LOCUS_04150 gene larE 7393 8211 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921897.1 protein_id gnl|my_center|LOCUS_04150 8208 8885 gene locus_tag LOCUS_04160 gene larB 8208 8885 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_04160 8882 10186 gene locus_tag LOCUS_04170 gene larA 8882 10186 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_04170 10319 11314 gene locus_tag LOCUS_04180 10319 11314 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_04180 11393 11905 gene locus_tag LOCUS_04190 11393 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 11902 13221 gene locus_tag LOCUS_04200 11902 13221 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972785.1 protein_id gnl|my_center|LOCUS_04200 13617 13201 gene locus_tag LOCUS_04210 gene rnk 13617 13201 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388697.1 protein_id gnl|my_center|LOCUS_04210 14311 13844 gene locus_tag LOCUS_04220 gene rnhA 14311 13844 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390802.1 protein_id gnl|my_center|LOCUS_04220 15276 14308 gene locus_tag LOCUS_04230 15276 14308 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084133.1 protein_id gnl|my_center|LOCUS_04230 16242 15286 gene locus_tag LOCUS_04240 gene ispH 16242 15286 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537458.1 protein_id gnl|my_center|LOCUS_04240 16394 16918 gene locus_tag LOCUS_04250 16394 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 16940 17698 gene locus_tag LOCUS_04260 16940 17698 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391583.1 protein_id gnl|my_center|LOCUS_04260 17716 19185 gene locus_tag LOCUS_04270 17716 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 20073 19225 gene locus_tag LOCUS_04280 20073 19225 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_04280 21066 20137 gene locus_tag LOCUS_04290 21066 20137 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086114.1 protein_id gnl|my_center|LOCUS_04290 22529 21063 gene locus_tag LOCUS_04300 gene hydA 22529 21063 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086117.1 protein_id gnl|my_center|LOCUS_04300 23596 22526 gene locus_tag LOCUS_04310 23596 22526 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_04310 24593 23598 gene locus_tag LOCUS_04320 24593 23598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_04320 26048 24612 gene locus_tag LOCUS_04330 26048 24612 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 protein_id gnl|my_center|LOCUS_04330 26957 26058 gene locus_tag LOCUS_04340 26957 26058 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038810.1 protein_id gnl|my_center|LOCUS_04340 27041 28252 gene locus_tag LOCUS_04350 27041 28252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_04350 28278 29498 gene locus_tag LOCUS_04360 28278 29498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_04360 30576 29554 gene locus_tag LOCUS_04370 30576 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 32266 30638 gene locus_tag LOCUS_04380 32266 30638 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_04380 32447 33679 gene locus_tag LOCUS_04390 gene hemA 32447 33679 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533608.1 protein_id gnl|my_center|LOCUS_04390 33785 34258 gene locus_tag LOCUS_04400 33785 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 34524 35987 gene locus_tag LOCUS_04410 34524 35987 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_04410 35984 40507 gene locus_tag LOCUS_04420 gene gltB 35984 40507 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_04420 40607 41869 gene locus_tag LOCUS_04430 40607 41869 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391290.1 protein_id gnl|my_center|LOCUS_04430 41887 42657 gene locus_tag LOCUS_04440 41887 42657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 42735 43457 gene locus_tag LOCUS_04450 gene phoU 42735 43457 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_04450 43462 44163 gene locus_tag LOCUS_04460 gene phoB 43462 44163 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_04460 44285 45157 gene locus_tag LOCUS_04470 44285 45157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 47265 45154 gene locus_tag LOCUS_04480 47265 45154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 48664 47342 gene locus_tag LOCUS_04490 gene rfbH 48664 47342 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_04490 49635 48661 gene locus_tag LOCUS_04500 49635 48661 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_04500 50423 49629 gene locus_tag LOCUS_04510 gene rfbF 50423 49629 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_04510 51220 50504 gene locus_tag LOCUS_04520 51220 50504 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_04520 51327 52451 gene locus_tag LOCUS_04530 51327 52451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 53132 52464 gene locus_tag LOCUS_04540 53132 52464 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_04540 53831 53193 gene locus_tag LOCUS_04550 53831 53193 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 protein_id gnl|my_center|LOCUS_04550 54479 53898 gene locus_tag LOCUS_04560 54479 53898 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973484.1 protein_id gnl|my_center|LOCUS_04560 55592 54579 gene locus_tag LOCUS_04570 55592 54579 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968778.1 protein_id gnl|my_center|LOCUS_04570 55696 57216 gene locus_tag LOCUS_04580 55696 57216 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_04580 57252 57752 gene locus_tag LOCUS_04590 57252 57752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence008 323 811 gene locus_tag LOCUS_04600 323 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 814 1278 gene locus_tag LOCUS_04610 814 1278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_04610 1275 1985 gene locus_tag LOCUS_04620 1275 1985 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 protein_id gnl|my_center|LOCUS_04620 2854 1982 gene locus_tag LOCUS_04630 2854 1982 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731865.1 protein_id gnl|my_center|LOCUS_04630 4023 2851 gene locus_tag LOCUS_04640 4023 2851 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_04640 4942 4025 gene locus_tag LOCUS_04650 4942 4025 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_04650 6686 4983 gene locus_tag LOCUS_04660 6686 4983 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 protein_id gnl|my_center|LOCUS_04660 7733 6801 gene locus_tag LOCUS_04670 gene fmt 7733 6801 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 protein_id gnl|my_center|LOCUS_04670 9236 7752 gene locus_tag LOCUS_04680 gene frc 9236 7752 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085940.1 protein_id gnl|my_center|LOCUS_04680 11028 9286 gene locus_tag LOCUS_04690 gene oxc 11028 9286 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085941.1 protein_id gnl|my_center|LOCUS_04690 11767 11069 gene locus_tag LOCUS_04700 11767 11069 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_04700 11988 13469 gene locus_tag LOCUS_04710 11988 13469 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088773.1 protein_id gnl|my_center|LOCUS_04710 13584 14582 gene locus_tag LOCUS_04720 13584 14582 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966990.1 protein_id gnl|my_center|LOCUS_04720 14658 15176 gene locus_tag LOCUS_04730 14658 15176 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113696.1 protein_id gnl|my_center|LOCUS_04730 15202 16902 gene locus_tag LOCUS_04740 15202 16902 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_04740 16899 19670 gene locus_tag LOCUS_04750 gene fdhF 16899 19670 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_04750 21926 19674 gene locus_tag LOCUS_04760 21926 19674 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_04760 23112 21937 gene locus_tag LOCUS_04770 23112 21937 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531116.1 protein_id gnl|my_center|LOCUS_04770 23248 24366 gene locus_tag LOCUS_04780 23248 24366 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_04780 25598 24363 gene locus_tag LOCUS_04790 25598 24363 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_04790 27201 25591 gene locus_tag LOCUS_04800 27201 25591 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 protein_id gnl|my_center|LOCUS_04800 27302 27871 gene locus_tag LOCUS_04810 27302 27871 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977283.1 protein_id gnl|my_center|LOCUS_04810 27932 28651 gene locus_tag LOCUS_04820 27932 28651 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_04820 28648 29082 gene locus_tag LOCUS_04830 28648 29082 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_04830 30274 29096 gene locus_tag LOCUS_04840 30274 29096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 31509 30286 gene locus_tag LOCUS_04850 31509 30286 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_04850 31801 32568 gene locus_tag LOCUS_04860 31801 32568 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088033.1 protein_id gnl|my_center|LOCUS_04860 34227 32626 gene locus_tag LOCUS_04870 34227 32626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_04870 35249 34332 gene locus_tag LOCUS_04880 35249 34332 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285667.1 protein_id gnl|my_center|LOCUS_04880 36201 35251 gene locus_tag LOCUS_04890 36201 35251 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030804.1 protein_id gnl|my_center|LOCUS_04890 37928 36291 gene locus_tag LOCUS_04900 37928 36291 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_04900 38022 39167 gene locus_tag LOCUS_04910 38022 39167 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083611.1 protein_id gnl|my_center|LOCUS_04910 39167 39499 gene locus_tag LOCUS_04920 39167 39499 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_04920 40837 39503 gene locus_tag LOCUS_04930 40837 39503 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_04930 41351 40854 gene locus_tag LOCUS_04940 41351 40854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 42856 41348 gene locus_tag LOCUS_04950 42856 41348 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_04950 42957 43139 gene locus_tag LOCUS_04960 42957 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 43790 43146 gene locus_tag LOCUS_04970 43790 43146 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_04970 44695 43787 gene locus_tag LOCUS_04980 gene ubiA 44695 43787 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090253.1 protein_id gnl|my_center|LOCUS_04980 46794 44719 gene locus_tag LOCUS_04990 46794 44719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 46921 47685 gene locus_tag LOCUS_05000 46921 47685 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388329.1 protein_id gnl|my_center|LOCUS_05000 47715 49082 gene locus_tag LOCUS_05010 47715 49082 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_05010 49102 49794 gene locus_tag LOCUS_05020 49102 49794 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974864.1 protein_id gnl|my_center|LOCUS_05020 49797 50114 gene locus_tag LOCUS_05030 49797 50114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 50111 50398 gene locus_tag LOCUS_05040 50111 50398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05040 50406 51047 gene locus_tag LOCUS_05050 gene scnC 50406 51047 CDS product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 protein_id gnl|my_center|LOCUS_05050 51106 51181 gene locus_tag LOCUS_t00050 51106 51181 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 51982 51218 gene locus_tag LOCUS_05060 51982 51218 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_05060 52112 52993 gene locus_tag LOCUS_05070 52112 52993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 53123 54643 gene locus_tag LOCUS_05080 53123 54643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_05080 54643 55593 gene locus_tag LOCUS_05090 54643 55593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_05090 55590 57437 gene locus_tag LOCUS_05100 55590 57437 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence009 1115 177 gene locus_tag LOCUS_05110 1115 177 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_05110 1234 2820 gene locus_tag LOCUS_05120 1234 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943012.1 protein_id gnl|my_center|LOCUS_05120 2862 4196 gene locus_tag LOCUS_05130 2862 4196 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063972.1 protein_id gnl|my_center|LOCUS_05130 5047 4193 gene locus_tag LOCUS_05140 5047 4193 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_05140 5098 6645 gene locus_tag LOCUS_05150 5098 6645 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064463.1 protein_id gnl|my_center|LOCUS_05150 6684 6905 gene locus_tag LOCUS_05160 6684 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6924 7118 gene locus_tag LOCUS_05170 6924 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7115 8518 gene locus_tag LOCUS_05180 gene gatA 7115 8518 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_05180 8554 9489 gene locus_tag LOCUS_05190 8554 9489 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929030.1 protein_id gnl|my_center|LOCUS_05190 9486 10511 gene locus_tag LOCUS_05200 9486 10511 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142495.1 protein_id gnl|my_center|LOCUS_05200 12406 10508 gene locus_tag LOCUS_05210 12406 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 13239 12406 gene locus_tag LOCUS_05220 13239 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 14139 13243 gene locus_tag LOCUS_05230 14139 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 15125 14184 gene locus_tag LOCUS_05240 15125 14184 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966848.1 protein_id gnl|my_center|LOCUS_05240 15179 15670 gene locus_tag LOCUS_05250 15179 15670 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551411.1 protein_id gnl|my_center|LOCUS_05250 15730 16752 gene locus_tag LOCUS_05260 15730 16752 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_05260 16784 19030 gene locus_tag LOCUS_05270 16784 19030 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_05270 19136 19408 gene locus_tag LOCUS_05280 19136 19408 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387924.1 protein_id gnl|my_center|LOCUS_05280 19405 21138 gene locus_tag LOCUS_05290 19405 21138 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176564.1 protein_id gnl|my_center|LOCUS_05290 23250 21145 gene locus_tag LOCUS_05300 gene ligA 23250 21145 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_05300 24959 23247 gene locus_tag LOCUS_05310 gene recN 24959 23247 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_05310 25781 24987 gene locus_tag LOCUS_05320 25781 24987 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_05320 26811 25822 gene locus_tag LOCUS_05330 gene lpxC 26811 25822 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035967.1 protein_id gnl|my_center|LOCUS_05330 28655 26973 gene locus_tag LOCUS_05340 gene ftsZ 28655 26973 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920397.1 protein_id gnl|my_center|LOCUS_05340 29999 28734 gene locus_tag LOCUS_05350 gene ftsA 29999 28734 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_05350 30866 30024 gene locus_tag LOCUS_05360 30866 30024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 31762 30854 gene locus_tag LOCUS_05370 31762 30854 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969744.1 protein_id gnl|my_center|LOCUS_05370 32682 31762 gene locus_tag LOCUS_05380 gene murB 32682 31762 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_05380 34097 32679 gene locus_tag LOCUS_05390 gene murC 34097 32679 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_05390 35233 34094 gene locus_tag LOCUS_05400 gene murG 35233 34094 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_05400 36354 35230 gene locus_tag LOCUS_05410 36354 35230 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_05410 37748 36354 gene locus_tag LOCUS_05420 gene murD 37748 36354 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388707.1 protein_id gnl|my_center|LOCUS_05420 38844 37753 gene locus_tag LOCUS_05430 gene mraY 38844 37753 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_05430 40283 38850 gene locus_tag LOCUS_05440 gene murF 40283 38850 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_05440 41758 40280 gene locus_tag LOCUS_05450 41758 40280 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388710.1 protein_id gnl|my_center|LOCUS_05450 43502 41745 gene locus_tag LOCUS_05460 43502 41745 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_05460 44052 43513 gene locus_tag LOCUS_05470 44052 43513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 45010 44060 gene locus_tag LOCUS_05480 gene rsmH 45010 44060 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_05480 45471 45007 gene locus_tag LOCUS_05490 45471 45007 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388714.1 protein_id gnl|my_center|LOCUS_05490 46932 46204 gene locus_tag LOCUS_05500 46932 46204 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225956012.1 protein_id gnl|my_center|LOCUS_05500 47737 46997 gene locus_tag LOCUS_05510 47737 46997 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_05510 47857 48849 gene locus_tag LOCUS_05520 gene dctP 47857 48849 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967084.1 protein_id gnl|my_center|LOCUS_05520 49834 48851 gene locus_tag LOCUS_05530 49834 48851 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538203.1 protein_id gnl|my_center|LOCUS_05530 49916 50365 gene locus_tag LOCUS_05540 49916 50365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 50425 51810 gene locus_tag LOCUS_05550 50425 51810 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_05550 51807 52139 gene locus_tag LOCUS_05560 51807 52139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 52136 52498 gene locus_tag LOCUS_05570 52136 52498 CDS product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193180291.1 protein_id gnl|my_center|LOCUS_05570 53197 52502 gene locus_tag LOCUS_05580 53197 52502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 53233 53772 gene locus_tag LOCUS_05590 53233 53772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 54544 53759 gene locus_tag LOCUS_05600 gene paaG 54544 53759 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_05600 54808 54545 gene locus_tag LOCUS_05610 54808 54545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 <55807 55267 gene locus_tag LOCUS_05620 <55807 55267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061795.1:putative 2-aminoethylphosphonate ABC transporter permease subunit >Feature sequence010 1620 133 gene locus_tag LOCUS_05630 1620 133 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_05630 2336 1617 gene locus_tag LOCUS_05640 2336 1617 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992415.1 protein_id gnl|my_center|LOCUS_05640 2698 2333 gene locus_tag LOCUS_05650 2698 2333 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 protein_id gnl|my_center|LOCUS_05650 3613 2783 gene locus_tag LOCUS_05660 3613 2783 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_05660 4217 3639 gene locus_tag LOCUS_05670 4217 3639 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392602.1 protein_id gnl|my_center|LOCUS_05670 4354 4217 gene locus_tag LOCUS_05680 4354 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5259 4351 gene locus_tag LOCUS_05690 5259 4351 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241141.1 protein_id gnl|my_center|LOCUS_05690 6889 5264 gene locus_tag LOCUS_05700 gene ctaD 6889 5264 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971136.1 protein_id gnl|my_center|LOCUS_05700 7742 6906 gene locus_tag LOCUS_05710 gene coxB 7742 6906 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886286.1 protein_id gnl|my_center|LOCUS_05710 8099 10252 gene locus_tag LOCUS_05720 gene scpA 8099 10252 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_05720 11453 10272 gene locus_tag LOCUS_05730 11453 10272 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383177.1 protein_id gnl|my_center|LOCUS_05730 12514 11555 gene locus_tag LOCUS_05740 gene argC 12514 11555 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_05740 15664 12533 gene locus_tag LOCUS_05750 gene putA 15664 12533 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_05750 16521 15670 gene locus_tag LOCUS_05760 16521 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 16747 17517 gene locus_tag LOCUS_05770 16747 17517 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968041.1 protein_id gnl|my_center|LOCUS_05770 17547 19046 gene locus_tag LOCUS_05780 17547 19046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19216 19061 gene locus_tag LOCUS_05790 19216 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 19387 20847 gene locus_tag LOCUS_05800 19387 20847 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_05800 20860 22320 gene locus_tag LOCUS_05810 20860 22320 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_05810 22317 23552 gene locus_tag LOCUS_05820 gene dgaE 22317 23552 CDS product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 protein_id gnl|my_center|LOCUS_05820 23803 23573 gene locus_tag LOCUS_05830 23803 23573 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222784.1 protein_id gnl|my_center|LOCUS_05830 23938 24996 gene locus_tag LOCUS_05840 23938 24996 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_05840 25057 25377 gene locus_tag LOCUS_05850 25057 25377 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_05850 26725 25451 gene locus_tag LOCUS_05860 26725 25451 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_05860 27031 26738 gene locus_tag LOCUS_05870 27031 26738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 27168 27782 gene locus_tag LOCUS_05880 27168 27782 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_05880 27851 28297 gene locus_tag LOCUS_05890 27851 28297 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_05890 30732 28303 gene locus_tag LOCUS_05900 30732 28303 CDS product DNA translocase FtsK 4TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391452.1 protein_id gnl|my_center|LOCUS_05900 31922 30732 gene locus_tag LOCUS_05910 31922 30732 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626642.1 protein_id gnl|my_center|LOCUS_05910 32329 32027 gene locus_tag LOCUS_05920 32329 32027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 34855 32348 gene locus_tag LOCUS_05930 34855 32348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_05930 35562 34855 gene locus_tag LOCUS_05940 35562 34855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_05940 35639 36289 gene locus_tag LOCUS_05950 35639 36289 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_05950 36286 37398 gene locus_tag LOCUS_05960 36286 37398 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_05960 37535 38467 gene locus_tag LOCUS_05970 37535 38467 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242730.1 protein_id gnl|my_center|LOCUS_05970 38566 39276 gene locus_tag LOCUS_05980 38566 39276 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529995.1 protein_id gnl|my_center|LOCUS_05980 39289 39912 gene locus_tag LOCUS_05990 gene pth 39289 39912 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310747.1 protein_id gnl|my_center|LOCUS_05990 39914 41014 gene locus_tag LOCUS_06000 gene ychF 39914 41014 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_06000 41027 41929 gene locus_tag LOCUS_06010 41027 41929 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086191.1 protein_id gnl|my_center|LOCUS_06010 41946 42569 gene locus_tag LOCUS_06020 41946 42569 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_06020 43149 42745 gene locus_tag LOCUS_06030 43149 42745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 43669 43331 gene locus_tag LOCUS_06040 gene grxD 43669 43331 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548651.1 protein_id gnl|my_center|LOCUS_06040 43914 43681 gene locus_tag LOCUS_06050 43914 43681 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_06050 46115 43926 gene locus_tag LOCUS_06060 gene purL 46115 43926 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_06060 46804 46115 gene locus_tag LOCUS_06070 gene purQ 46804 46115 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_06070 47043 46804 gene locus_tag LOCUS_06080 gene purS 47043 46804 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_06080 47836 47111 gene locus_tag LOCUS_06090 47836 47111 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388469.1 protein_id gnl|my_center|LOCUS_06090 48711 47881 gene locus_tag LOCUS_06100 48711 47881 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809025.1 protein_id gnl|my_center|LOCUS_06100 49577 48708 gene locus_tag LOCUS_06110 49577 48708 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 protein_id gnl|my_center|LOCUS_06110 50406 49654 gene locus_tag LOCUS_06120 50406 49654 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_06120 51632 50406 gene locus_tag LOCUS_06130 51632 50406 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_06130 52195 51644 gene locus_tag LOCUS_06140 gene petA 52195 51644 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_06140 52379 52837 gene locus_tag LOCUS_06150 52379 52837 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388118.1 protein_id gnl|my_center|LOCUS_06150 52834 53673 gene locus_tag LOCUS_06160 gene hemF 52834 53673 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_06160 53933 53748 gene locus_tag LOCUS_06170 53933 53748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 54884 54042 gene locus_tag LOCUS_06180 gene speE 54884 54042 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371548.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence011 266 105 gene locus_tag LOCUS_06190 266 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 653 276 gene locus_tag LOCUS_06200 653 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1440 574 gene locus_tag LOCUS_06210 1440 574 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_06210 1739 1440 gene locus_tag LOCUS_06220 1739 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2846 1875 gene locus_tag LOCUS_06230 2846 1875 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640348.1 protein_id gnl|my_center|LOCUS_06230 2930 3838 gene locus_tag LOCUS_06240 2930 3838 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087195.1 protein_id gnl|my_center|LOCUS_06240 3853 4533 gene locus_tag LOCUS_06250 3853 4533 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173266.1 protein_id gnl|my_center|LOCUS_06250 4533 5261 gene locus_tag LOCUS_06260 4533 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 5252 5773 gene locus_tag LOCUS_06270 5252 5773 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_06270 6987 5770 gene locus_tag LOCUS_06280 6987 5770 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_06280 7664 7005 gene locus_tag LOCUS_06290 7664 7005 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391306.1 protein_id gnl|my_center|LOCUS_06290 7627 8088 gene locus_tag LOCUS_06300 7627 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8085 8366 gene locus_tag LOCUS_06310 8085 8366 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964162.1 protein_id gnl|my_center|LOCUS_06310 8376 8570 gene locus_tag LOCUS_06320 8376 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8570 9118 gene locus_tag LOCUS_06330 8570 9118 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_06330 9171 9767 gene locus_tag LOCUS_06340 9171 9767 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 protein_id gnl|my_center|LOCUS_06340 9864 10616 gene locus_tag LOCUS_06350 9864 10616 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 protein_id gnl|my_center|LOCUS_06350 10613 11554 gene locus_tag LOCUS_06360 10613 11554 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_06360 11557 12429 gene locus_tag LOCUS_06370 11557 12429 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_06370 12444 12833 gene locus_tag LOCUS_06380 12444 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 14461 12944 gene locus_tag LOCUS_06390 14461 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 15026 14454 gene locus_tag LOCUS_06400 15026 14454 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383409.1 protein_id gnl|my_center|LOCUS_06400 15052 16479 gene locus_tag LOCUS_06410 gene argH 15052 16479 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_06410 16476 16604 gene locus_tag LOCUS_06420 16476 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 16601 17860 gene locus_tag LOCUS_06430 gene lysA 16601 17860 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066759.1 protein_id gnl|my_center|LOCUS_06430 17921 20533 gene locus_tag LOCUS_06440 17921 20533 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 protein_id gnl|my_center|LOCUS_06440 20614 21774 gene locus_tag LOCUS_06450 20614 21774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 22470 21793 gene locus_tag LOCUS_06460 22470 21793 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 protein_id gnl|my_center|LOCUS_06460 22671 23366 gene locus_tag LOCUS_06470 gene ftsE 22671 23366 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_06470 23359 24237 gene locus_tag LOCUS_06480 23359 24237 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_06480 24282 24881 gene locus_tag LOCUS_06490 24282 24881 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_06490 24878 25588 gene locus_tag LOCUS_06500 24878 25588 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_06500 26835 25591 gene locus_tag LOCUS_06510 26835 25591 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_06510 27633 26869 gene locus_tag LOCUS_06520 27633 26869 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088033.1 protein_id gnl|my_center|LOCUS_06520 27726 28502 gene locus_tag LOCUS_06530 27726 28502 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_06530 28507 29982 gene locus_tag LOCUS_06540 28507 29982 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_06540 31576 29987 gene locus_tag LOCUS_06550 31576 29987 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_06550 33089 31659 gene locus_tag LOCUS_06560 33089 31659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086748.1 protein_id gnl|my_center|LOCUS_06560 34215 33097 gene locus_tag LOCUS_06570 34215 33097 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_06570 35424 34225 gene locus_tag LOCUS_06580 35424 34225 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494077.1 protein_id gnl|my_center|LOCUS_06580 36974 35421 gene locus_tag LOCUS_06590 36974 35421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974513.1 protein_id gnl|my_center|LOCUS_06590 37944 36988 gene locus_tag LOCUS_06600 gene pip 37944 36988 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211090.1 protein_id gnl|my_center|LOCUS_06600 38977 38021 gene locus_tag LOCUS_06610 gene pip 38977 38021 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974918.1 protein_id gnl|my_center|LOCUS_06610 39057 39518 gene locus_tag LOCUS_06620 39057 39518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 39520 40311 gene locus_tag LOCUS_06630 39520 40311 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551585.1 protein_id gnl|my_center|LOCUS_06630 40359 41027 gene locus_tag LOCUS_06640 40359 41027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 42894 40993 gene locus_tag LOCUS_06650 42894 40993 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_06650 43592 42969 gene locus_tag LOCUS_06660 43592 42969 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_06660 44408 43611 gene locus_tag LOCUS_06670 44408 43611 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086325.1 protein_id gnl|my_center|LOCUS_06670 45346 44408 gene locus_tag LOCUS_06680 45346 44408 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_06680 46165 45377 gene locus_tag LOCUS_06690 46165 45377 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266698.1 protein_id gnl|my_center|LOCUS_06690 46337 47332 gene locus_tag LOCUS_06700 46337 47332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 47391 47467 gene locus_tag LOCUS_t00060 47391 47467 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 48971 48513 gene locus_tag LOCUS_06710 48971 48513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 49173 48988 gene locus_tag LOCUS_06720 49173 48988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 51087 49348 gene locus_tag LOCUS_06730 51087 49348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 51505 51170 gene locus_tag LOCUS_06740 51505 51170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 51820 52761 gene locus_tag LOCUS_06750 51820 52761 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_06750 52963 52799 gene locus_tag LOCUS_06760 52963 52799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 52990 53187 gene locus_tag LOCUS_06770 52990 53187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 53355 53612 gene locus_tag LOCUS_06780 53355 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 53614 54189 gene locus_tag LOCUS_06790 53614 54189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence012 <1 902 gene locus_tag LOCUS_06800 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523139.1:aromatic ring-hydroxylating dioxygenase subunit alpha 899 3319 gene locus_tag LOCUS_06810 899 3319 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_06810 5001 3316 gene locus_tag LOCUS_06820 gene ybaL 5001 3316 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 protein_id gnl|my_center|LOCUS_06820 5951 5094 gene locus_tag LOCUS_06830 5951 5094 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_06830 6946 5948 gene locus_tag LOCUS_06840 6946 5948 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 protein_id gnl|my_center|LOCUS_06840 7377 6943 gene locus_tag LOCUS_06850 7377 6943 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 protein_id gnl|my_center|LOCUS_06850 7434 8141 gene locus_tag LOCUS_06860 7434 8141 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531799.1 protein_id gnl|my_center|LOCUS_06860 8138 9049 gene locus_tag LOCUS_06870 8138 9049 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243632.1 protein_id gnl|my_center|LOCUS_06870 9122 10462 gene locus_tag LOCUS_06880 9122 10462 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531800.1 protein_id gnl|my_center|LOCUS_06880 10528 11445 gene locus_tag LOCUS_06890 10528 11445 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 protein_id gnl|my_center|LOCUS_06890 11442 12260 gene locus_tag LOCUS_06900 11442 12260 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174730.1 protein_id gnl|my_center|LOCUS_06900 12524 12264 gene locus_tag LOCUS_06910 12524 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 13159 12629 gene locus_tag LOCUS_06920 13159 12629 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192889.1 protein_id gnl|my_center|LOCUS_06920 14166 13183 gene locus_tag LOCUS_06930 14166 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14297 14809 gene locus_tag LOCUS_06940 14297 14809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17947 14813 gene locus_tag LOCUS_06950 17947 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 18482 18060 gene locus_tag LOCUS_06960 18482 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 18979 18488 gene locus_tag LOCUS_06970 gene greA 18979 18488 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722610.1 protein_id gnl|my_center|LOCUS_06970 22255 19019 gene locus_tag LOCUS_06980 gene carB 22255 19019 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_06980 23489 22308 gene locus_tag LOCUS_06990 gene carA 23489 22308 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090106.1 protein_id gnl|my_center|LOCUS_06990 23741 24196 gene locus_tag LOCUS_07000 23741 24196 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_07000 24212 26074 gene locus_tag LOCUS_07010 gene dnaG 24212 26074 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_07010 26112 28094 gene locus_tag LOCUS_07020 gene rpoD 26112 28094 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532953.1 protein_id gnl|my_center|LOCUS_07020 28168 28243 gene locus_tag LOCUS_t00070 28168 28243 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28306 29139 gene locus_tag LOCUS_07030 28306 29139 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_07030 29191 29754 gene locus_tag LOCUS_07040 29191 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07040 29758 30447 gene locus_tag LOCUS_07050 29758 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07050 30466 31362 gene locus_tag LOCUS_07060 30466 31362 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974047.1 protein_id gnl|my_center|LOCUS_07060 31359 32192 gene locus_tag LOCUS_07070 31359 32192 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312430.1 protein_id gnl|my_center|LOCUS_07070 32196 33260 gene locus_tag LOCUS_07080 gene ugpC 32196 33260 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384839.1 protein_id gnl|my_center|LOCUS_07080 33257 34057 gene locus_tag LOCUS_07090 33257 34057 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966449.1 protein_id gnl|my_center|LOCUS_07090 34764 34054 gene locus_tag LOCUS_07100 34764 34054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 35040 35969 gene locus_tag LOCUS_07110 35040 35969 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 protein_id gnl|my_center|LOCUS_07110 36074 36769 gene locus_tag LOCUS_07120 36074 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 37509 36796 gene locus_tag LOCUS_07130 37509 36796 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090865.1 protein_id gnl|my_center|LOCUS_07130 37985 37506 gene locus_tag LOCUS_07140 37985 37506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 38096 38794 gene locus_tag LOCUS_07150 38096 38794 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_07150 38929 40476 gene locus_tag LOCUS_07160 38929 40476 CDS product stimulus-sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_07160 40473 40919 gene locus_tag LOCUS_07170 40473 40919 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_07170 40930 41844 gene locus_tag LOCUS_07180 gene rapZ 40930 41844 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_07180 41886 42296 gene locus_tag LOCUS_07190 41886 42296 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_07190 42293 42571 gene locus_tag LOCUS_07200 42293 42571 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626594.1 protein_id gnl|my_center|LOCUS_07200 42558 44348 gene locus_tag LOCUS_07210 gene ptsP 42558 44348 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_07210 44764 44345 gene locus_tag LOCUS_07220 44764 44345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 45295 44858 gene locus_tag LOCUS_07230 45295 44858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 45462 47210 gene locus_tag LOCUS_07240 45462 47210 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_07240 47817 47191 gene locus_tag LOCUS_07250 gene phaR 47817 47191 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_07250 47890 48348 gene locus_tag LOCUS_07260 47890 48348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 48371 49375 gene locus_tag LOCUS_07270 48371 49375 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_07270 49375 50319 gene locus_tag LOCUS_07280 49375 50319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 50416 52218 gene locus_tag LOCUS_07290 gene lepA 50416 52218 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175920.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence013 129 371 gene locus_tag LOCUS_07300 129 371 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229190.1 protein_id gnl|my_center|LOCUS_07300 371 781 gene locus_tag LOCUS_07310 371 781 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_07310 2678 786 gene locus_tag LOCUS_07320 gene cobT 2678 786 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_07320 3687 2695 gene locus_tag LOCUS_07330 gene cobS 3687 2695 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_07330 4349 3780 gene locus_tag LOCUS_07340 4349 3780 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_07340 4432 4704 gene locus_tag LOCUS_07350 4432 4704 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_07350 4863 5699 gene locus_tag LOCUS_07360 4863 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 6328 5768 gene locus_tag LOCUS_07370 6328 5768 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_07370 6856 6410 gene locus_tag LOCUS_07380 6856 6410 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_07380 7073 7723 gene locus_tag LOCUS_07390 7073 7723 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_07390 8359 7727 gene locus_tag LOCUS_07400 8359 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 8482 9252 gene locus_tag LOCUS_07410 8482 9252 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533989.1 protein_id gnl|my_center|LOCUS_07410 9265 10371 gene locus_tag LOCUS_07420 9265 10371 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_07420 10921 10382 gene locus_tag LOCUS_07430 10921 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 12134 10911 gene locus_tag LOCUS_07440 12134 10911 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085494.1 protein_id gnl|my_center|LOCUS_07440 13389 12193 gene locus_tag LOCUS_07450 13389 12193 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387974.1 protein_id gnl|my_center|LOCUS_07450 13601 14809 gene locus_tag LOCUS_07460 13601 14809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_07460 15970 14810 gene locus_tag LOCUS_07470 15970 14810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 protein_id gnl|my_center|LOCUS_07470 16689 15967 gene locus_tag LOCUS_07480 16689 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 16964 16686 gene locus_tag LOCUS_07490 16964 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 18877 16973 gene locus_tag LOCUS_07500 18877 16973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061526.1 protein_id gnl|my_center|LOCUS_07500 20769 18877 gene locus_tag LOCUS_07510 20769 18877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972419.1 protein_id gnl|my_center|LOCUS_07510 21271 20780 gene locus_tag LOCUS_07520 21271 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 22008 21268 gene locus_tag LOCUS_07530 22008 21268 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331956.1 protein_id gnl|my_center|LOCUS_07530 22409 22185 gene locus_tag LOCUS_07540 22409 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 22293 22661 gene locus_tag LOCUS_07550 22293 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 22700 22954 gene locus_tag LOCUS_07560 22700 22954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 23798 22962 gene locus_tag LOCUS_07570 23798 22962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 26608 23912 gene locus_tag LOCUS_07580 26608 23912 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_07580 25255 25347 gene locus_tag LOCUS_t00080 25255 25347 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26838 27701 gene locus_tag LOCUS_07590 26838 27701 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_07590 27704 29284 gene locus_tag LOCUS_07600 27704 29284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 29305 30360 gene locus_tag LOCUS_07610 gene tsaD 29305 30360 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_07610 30357 31349 gene locus_tag LOCUS_07620 30357 31349 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 protein_id gnl|my_center|LOCUS_07620 31408 31713 gene locus_tag LOCUS_07630 31408 31713 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917958.1 protein_id gnl|my_center|LOCUS_07630 31728 32141 gene locus_tag LOCUS_07640 31728 32141 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_07640 32138 32467 gene locus_tag LOCUS_07650 32138 32467 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089166.1 protein_id gnl|my_center|LOCUS_07650 33081 32455 gene locus_tag LOCUS_07660 33081 32455 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087129.1 protein_id gnl|my_center|LOCUS_07660 33165 34232 gene locus_tag LOCUS_07670 33165 34232 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312850.1 protein_id gnl|my_center|LOCUS_07670 34261 35238 gene locus_tag LOCUS_07680 34261 35238 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 protein_id gnl|my_center|LOCUS_07680 35249 36004 gene locus_tag LOCUS_07690 35249 36004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082944.1 protein_id gnl|my_center|LOCUS_07690 35997 36779 gene locus_tag LOCUS_07700 35997 36779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 protein_id gnl|my_center|LOCUS_07700 36882 37559 gene locus_tag LOCUS_07710 36882 37559 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085687.1 protein_id gnl|my_center|LOCUS_07710 37552 38121 gene locus_tag LOCUS_07720 37552 38121 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_07720 38130 38609 gene locus_tag LOCUS_07730 38130 38609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 38683 39156 gene locus_tag LOCUS_07740 38683 39156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 39153 39746 gene locus_tag LOCUS_07750 39153 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 40410 39895 gene locus_tag LOCUS_07760 40410 39895 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_07760 41041 40418 gene locus_tag LOCUS_07770 41041 40418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 41130 41834 gene locus_tag LOCUS_07780 41130 41834 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_07780 41906 41992 gene locus_tag LOCUS_t00090 41906 41992 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42001 42615 gene locus_tag LOCUS_07790 42001 42615 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_07790 43670 42612 gene locus_tag LOCUS_07800 43670 42612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 45009 43729 gene locus_tag LOCUS_07810 45009 43729 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103397.1 protein_id gnl|my_center|LOCUS_07810 45520 45029 gene locus_tag LOCUS_07820 45520 45029 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770954.1 protein_id gnl|my_center|LOCUS_07820 46619 45624 gene locus_tag LOCUS_07830 46619 45624 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_07830 46732 47475 gene locus_tag LOCUS_07840 46732 47475 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532444.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence014 204 389 gene locus_tag LOCUS_07850 204 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1250 543 gene locus_tag LOCUS_07860 1250 543 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838222.1 protein_id gnl|my_center|LOCUS_07860 2926 1445 gene locus_tag LOCUS_07870 2926 1445 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389097.1 protein_id gnl|my_center|LOCUS_07870 3624 2926 gene locus_tag LOCUS_07880 3624 2926 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267484.1 protein_id gnl|my_center|LOCUS_07880 5333 3621 gene locus_tag LOCUS_07890 5333 3621 CDS product acetolactate synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930005.1 protein_id gnl|my_center|LOCUS_07890 6556 5330 gene locus_tag LOCUS_07900 6556 5330 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967499.1 protein_id gnl|my_center|LOCUS_07900 6728 7864 gene locus_tag LOCUS_07910 6728 7864 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171909.1 protein_id gnl|my_center|LOCUS_07910 7925 9022 gene locus_tag LOCUS_07920 7925 9022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086326.1 protein_id gnl|my_center|LOCUS_07920 9070 9882 gene locus_tag LOCUS_07930 9070 9882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967496.1 protein_id gnl|my_center|LOCUS_07930 9872 10666 gene locus_tag LOCUS_07940 9872 10666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967495.1 protein_id gnl|my_center|LOCUS_07940 10672 11034 gene locus_tag LOCUS_07950 10672 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07950 11124 11825 gene locus_tag LOCUS_07960 11124 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 11828 12583 gene locus_tag LOCUS_07970 11828 12583 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967501.1 protein_id gnl|my_center|LOCUS_07970 12980 12594 gene locus_tag LOCUS_07980 12980 12594 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067237.1 protein_id gnl|my_center|LOCUS_07980 13181 13543 gene locus_tag LOCUS_07990 13181 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 15377 13794 gene locus_tag LOCUS_08000 15377 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 15653 15408 gene locus_tag LOCUS_08010 15653 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 16116 15664 gene locus_tag LOCUS_08020 16116 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 16194 16469 gene locus_tag LOCUS_08030 16194 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 16746 17699 gene locus_tag LOCUS_08040 16746 17699 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_08040 17692 19419 gene locus_tag LOCUS_08050 17692 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 20918 19416 gene locus_tag LOCUS_08060 20918 19416 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267548.1 protein_id gnl|my_center|LOCUS_08060 21724 20963 gene locus_tag LOCUS_08070 gene soxA 21724 20963 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174733.1 protein_id gnl|my_center|LOCUS_08070 22041 21721 gene locus_tag LOCUS_08080 gene soxZ 22041 21721 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085518.1 protein_id gnl|my_center|LOCUS_08080 22517 22038 gene locus_tag LOCUS_08090 22517 22038 CDS product SoxY-related AACIE arm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085519.1 protein_id gnl|my_center|LOCUS_08090 22965 22522 gene locus_tag LOCUS_08100 gene soxX 22965 22522 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_08100 25179 23014 gene locus_tag LOCUS_08110 25179 23014 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_08110 25643 25194 gene locus_tag LOCUS_08120 25643 25194 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174739.1 protein_id gnl|my_center|LOCUS_08120 26015 25833 gene locus_tag LOCUS_08130 26015 25833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 27085 26012 gene locus_tag LOCUS_08140 27085 26012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 27318 27527 gene locus_tag LOCUS_08150 27318 27527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 27617 27814 gene locus_tag LOCUS_08160 27617 27814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 28543 27821 gene locus_tag LOCUS_08170 gene nocM 28543 27821 CDS product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 protein_id gnl|my_center|LOCUS_08170 29328 28549 gene locus_tag LOCUS_08180 gene nocQ 29328 28549 CDS product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 protein_id gnl|my_center|LOCUS_08180 30365 29520 gene locus_tag LOCUS_08190 gene nocT 30365 29520 CDS product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 protein_id gnl|my_center|LOCUS_08190 31218 30433 gene locus_tag LOCUS_08200 31218 30433 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 protein_id gnl|my_center|LOCUS_08200 31341 31742 gene locus_tag LOCUS_08210 31341 31742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 31898 33334 gene locus_tag LOCUS_08220 31898 33334 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_08220 33334 34653 gene locus_tag LOCUS_08230 33334 34653 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_08230 34653 35420 gene locus_tag LOCUS_08240 34653 35420 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_08240 36414 35410 gene locus_tag LOCUS_08250 36414 35410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 36962 36492 gene locus_tag LOCUS_08260 36962 36492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08260 37118 36972 gene locus_tag LOCUS_08270 37118 36972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 37260 38276 gene locus_tag LOCUS_08280 37260 38276 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387999.1 protein_id gnl|my_center|LOCUS_08280 38273 38938 gene locus_tag LOCUS_08290 38273 38938 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387998.1 protein_id gnl|my_center|LOCUS_08290 38991 40454 gene locus_tag LOCUS_08300 gene guaB 38991 40454 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387997.1 protein_id gnl|my_center|LOCUS_08300 40465 41763 gene locus_tag LOCUS_08310 40465 41763 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_08310 41760 42308 gene locus_tag LOCUS_08320 41760 42308 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_08320 42305 43399 gene locus_tag LOCUS_08330 42305 43399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 43396 44943 gene locus_tag LOCUS_08340 gene guaA 43396 44943 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966922.1 protein_id gnl|my_center|LOCUS_08340 45097 46725 gene locus_tag LOCUS_08350 45097 46725 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918882.1 protein_id gnl|my_center|LOCUS_08350 47214 46813 gene locus_tag LOCUS_08360 47214 46813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence015 <1 627 gene locus_tag LOCUS_08370 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969494.1:MFS transporter 662 1171 gene locus_tag LOCUS_08380 662 1171 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090332.1 protein_id gnl|my_center|LOCUS_08380 1205 2125 gene locus_tag LOCUS_08390 gene metA 1205 2125 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252334.1 protein_id gnl|my_center|LOCUS_08390 2122 3783 gene locus_tag LOCUS_08400 2122 3783 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_08400 5096 3780 gene locus_tag LOCUS_08410 5096 3780 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_08410 5615 5100 gene locus_tag LOCUS_08420 5615 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 6591 5647 gene locus_tag LOCUS_08430 6591 5647 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_08430 7600 6686 gene locus_tag LOCUS_08440 7600 6686 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086752.1 protein_id gnl|my_center|LOCUS_08440 8589 7678 gene locus_tag LOCUS_08450 gene yghX 8589 7678 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_08450 8700 9797 gene locus_tag LOCUS_08460 8700 9797 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 protein_id gnl|my_center|LOCUS_08460 10204 9794 gene locus_tag LOCUS_08470 10204 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 10234 11604 gene locus_tag LOCUS_08480 10234 11604 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_08480 11609 12613 gene locus_tag LOCUS_08490 11609 12613 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393248.1 protein_id gnl|my_center|LOCUS_08490 13238 12582 gene locus_tag LOCUS_08500 13238 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973993.1 protein_id gnl|my_center|LOCUS_08500 14631 13240 gene locus_tag LOCUS_08510 14631 13240 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967518.1 protein_id gnl|my_center|LOCUS_08510 16053 14644 gene locus_tag LOCUS_08520 16053 14644 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_08520 16241 16050 gene locus_tag LOCUS_08530 16241 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 17761 16280 gene locus_tag LOCUS_08540 17761 16280 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_08540 18584 17790 gene locus_tag LOCUS_08550 gene lpxA 18584 17790 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_08550 20585 18678 gene locus_tag LOCUS_08560 20585 18678 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_08560 22654 20591 gene locus_tag LOCUS_08570 22654 20591 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538142.1 protein_id gnl|my_center|LOCUS_08570 22830 24914 gene locus_tag LOCUS_08580 22830 24914 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_08580 24916 26304 gene locus_tag LOCUS_08590 24916 26304 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402899.1 protein_id gnl|my_center|LOCUS_08590 26416 26649 gene locus_tag LOCUS_08600 26416 26649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08600 26951 27487 gene locus_tag LOCUS_08610 26951 27487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 27543 28280 gene locus_tag LOCUS_08620 27543 28280 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815247.1 protein_id gnl|my_center|LOCUS_08620 28329 29075 gene locus_tag LOCUS_08630 28329 29075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 29167 29334 gene locus_tag LOCUS_08640 29167 29334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 30980 29430 gene locus_tag LOCUS_08650 30980 29430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_08650 31130 32341 gene locus_tag LOCUS_08660 31130 32341 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_08660 33810 32338 gene locus_tag LOCUS_08670 33810 32338 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_08670 34437 33832 gene locus_tag LOCUS_08680 34437 33832 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978011.1 protein_id gnl|my_center|LOCUS_08680 34618 35787 gene locus_tag LOCUS_08690 34618 35787 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965179.1 protein_id gnl|my_center|LOCUS_08690 35845 36603 gene locus_tag LOCUS_08700 35845 36603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083708.1 protein_id gnl|my_center|LOCUS_08700 36600 37325 gene locus_tag LOCUS_08710 36600 37325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083707.1 protein_id gnl|my_center|LOCUS_08710 37336 38322 gene locus_tag LOCUS_08720 37336 38322 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083706.1 protein_id gnl|my_center|LOCUS_08720 38322 39389 gene locus_tag LOCUS_08730 38322 39389 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463731.1 protein_id gnl|my_center|LOCUS_08730 39451 40044 gene locus_tag LOCUS_08740 39451 40044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 40064 40639 gene locus_tag LOCUS_08750 40064 40639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 40671 41237 gene locus_tag LOCUS_08760 40671 41237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 42276 41242 gene locus_tag LOCUS_08770 42276 41242 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_08770 42507 42307 gene locus_tag LOCUS_08780 42507 42307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 42422 43621 gene locus_tag LOCUS_08790 42422 43621 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_08790 43724 45316 gene locus_tag LOCUS_08800 43724 45316 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_08800 45444 45226 gene locus_tag LOCUS_08810 45444 45226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 45528 47126 gene locus_tag LOCUS_08820 45528 47126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence016 1654 125 gene locus_tag LOCUS_08830 gene xseA 1654 125 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387920.1 protein_id gnl|my_center|LOCUS_08830 1701 2972 gene locus_tag LOCUS_08840 gene purD 1701 2972 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_08840 3400 2969 gene locus_tag LOCUS_08850 3400 2969 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388408.1 protein_id gnl|my_center|LOCUS_08850 3469 4266 gene locus_tag LOCUS_08860 3469 4266 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388410.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08860 4247 4804 gene locus_tag LOCUS_08870 gene rsmD 4247 4804 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_08870 5226 4915 gene locus_tag LOCUS_08880 5226 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 6994 5240 gene locus_tag LOCUS_08890 gene mutL 6994 5240 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_08890 8332 7007 gene locus_tag LOCUS_08900 8332 7007 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_08900 9674 8343 gene locus_tag LOCUS_08910 9674 8343 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_08910 10426 9719 gene locus_tag LOCUS_08920 10426 9719 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_08920 10937 10434 gene locus_tag LOCUS_08930 gene lspA 10937 10434 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_08930 13774 10934 gene locus_tag LOCUS_08940 gene ileS 13774 10934 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_08940 14730 13792 gene locus_tag LOCUS_08950 14730 13792 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_08950 15241 14813 gene locus_tag LOCUS_08960 15241 14813 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_08960 16300 15323 gene locus_tag LOCUS_08970 16300 15323 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_08970 16771 16361 gene locus_tag LOCUS_08980 16771 16361 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072053.1 protein_id gnl|my_center|LOCUS_08980 16863 17237 gene locus_tag LOCUS_08990 16863 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 17765 17265 gene locus_tag LOCUS_09000 17765 17265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 18247 18933 gene locus_tag LOCUS_09010 gene feuP 18247 18933 CDS product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 protein_id gnl|my_center|LOCUS_09010 18914 20257 gene locus_tag LOCUS_09020 18914 20257 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_09020 20362 20574 gene locus_tag LOCUS_09030 20362 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 21427 20642 gene locus_tag LOCUS_09040 21427 20642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_09040 22457 21516 gene locus_tag LOCUS_09050 22457 21516 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267881.1 protein_id gnl|my_center|LOCUS_09050 23997 22492 gene locus_tag LOCUS_09060 23997 22492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_09060 25145 24084 gene locus_tag LOCUS_09070 25145 24084 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_09070 26125 25145 gene locus_tag LOCUS_09080 26125 25145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_09080 26832 26122 gene locus_tag LOCUS_09090 26832 26122 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_09090 26942 28471 gene locus_tag LOCUS_09100 26942 28471 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064463.1 protein_id gnl|my_center|LOCUS_09100 29073 28468 gene locus_tag LOCUS_09110 29073 28468 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946184.1 protein_id gnl|my_center|LOCUS_09110 29088 29669 gene locus_tag LOCUS_09120 29088 29669 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532299.1 protein_id gnl|my_center|LOCUS_09120 30173 29673 gene locus_tag LOCUS_09130 30173 29673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 30919 30170 gene locus_tag LOCUS_09140 30919 30170 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_09140 31884 30916 gene locus_tag LOCUS_09150 gene pip 31884 30916 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_09150 31963 33405 gene locus_tag LOCUS_09160 31963 33405 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 protein_id gnl|my_center|LOCUS_09160 33402 35222 gene locus_tag LOCUS_09170 33402 35222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 35300 36382 gene locus_tag LOCUS_09180 35300 36382 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083251.1 protein_id gnl|my_center|LOCUS_09180 37161 36367 gene locus_tag LOCUS_09190 37161 36367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 38278 37184 gene locus_tag LOCUS_09200 38278 37184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 38989 38654 gene locus_tag LOCUS_09210 38989 38654 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_09210 39149 40336 gene locus_tag LOCUS_09220 39149 40336 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421599.1 protein_id gnl|my_center|LOCUS_09220 41766 40333 gene locus_tag LOCUS_09230 41766 40333 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_09230 41707 41928 gene locus_tag LOCUS_09240 41707 41928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 42540 42166 gene locus_tag LOCUS_09250 42540 42166 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_09250 45023 42537 gene locus_tag LOCUS_09260 45023 42537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 45133 47019 gene locus_tag LOCUS_09270 gene htpG 45133 47019 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence017 1086 154 gene locus_tag LOCUS_09280 1086 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2108 1083 gene locus_tag LOCUS_09290 2108 1083 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389259.1 protein_id gnl|my_center|LOCUS_09290 2827 2105 gene locus_tag LOCUS_09300 gene pxpB 2827 2105 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087337.1 protein_id gnl|my_center|LOCUS_09300 2873 3649 gene locus_tag LOCUS_09310 2873 3649 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339325.1 protein_id gnl|my_center|LOCUS_09310 4692 3646 gene locus_tag LOCUS_09320 4692 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 4732 5139 gene locus_tag LOCUS_09330 4732 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 6106 5258 gene locus_tag LOCUS_09340 6106 5258 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384365.1 protein_id gnl|my_center|LOCUS_09340 6951 6109 gene locus_tag LOCUS_09350 6951 6109 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085492.1 protein_id gnl|my_center|LOCUS_09350 7036 7995 gene locus_tag LOCUS_09360 7036 7995 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974396.1 protein_id gnl|my_center|LOCUS_09360 7992 8762 gene locus_tag LOCUS_09370 7992 8762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_09370 8788 9765 gene locus_tag LOCUS_09380 gene pip 8788 9765 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_09380 9765 10739 gene locus_tag LOCUS_09390 gene pip 9765 10739 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640184.1 protein_id gnl|my_center|LOCUS_09390 10916 11446 gene locus_tag LOCUS_09400 10916 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 12060 11509 gene locus_tag LOCUS_09410 12060 11509 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_09410 12605 12063 gene locus_tag LOCUS_09420 12605 12063 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772008.1 protein_id gnl|my_center|LOCUS_09420 12711 13655 gene locus_tag LOCUS_09430 12711 13655 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_09430 14051 13842 gene locus_tag LOCUS_09440 14051 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 14148 14573 gene locus_tag LOCUS_09450 14148 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 14723 14932 gene locus_tag LOCUS_09460 14723 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 14941 16785 gene locus_tag LOCUS_09470 14941 16785 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_09470 16770 18605 gene locus_tag LOCUS_09480 16770 18605 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_09480 18602 19657 gene locus_tag LOCUS_09490 18602 19657 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_09490 19959 19654 gene locus_tag LOCUS_09500 19959 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 21994 20126 gene locus_tag LOCUS_09510 21994 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 22434 22174 gene locus_tag LOCUS_09520 22434 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 22699 22436 gene locus_tag LOCUS_09530 22699 22436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 23070 22705 gene locus_tag LOCUS_09540 23070 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 23252 24019 gene locus_tag LOCUS_09550 gene cobF 23252 24019 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031346.1 protein_id gnl|my_center|LOCUS_09550 24775 24050 gene locus_tag LOCUS_09560 24775 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 24893 26266 gene locus_tag LOCUS_09570 gene gndA 24893 26266 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399773.1 protein_id gnl|my_center|LOCUS_09570 26257 26757 gene locus_tag LOCUS_09580 26257 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 26825 28477 gene locus_tag LOCUS_09590 26825 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 28493 29026 gene locus_tag LOCUS_09600 28493 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 29121 29828 gene locus_tag LOCUS_09610 29121 29828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 31651 29837 gene locus_tag LOCUS_09620 31651 29837 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_09620 32032 31736 gene locus_tag LOCUS_09630 32032 31736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 33215 32325 gene locus_tag LOCUS_09640 33215 32325 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_09640 33299 34300 gene locus_tag LOCUS_09650 33299 34300 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 protein_id gnl|my_center|LOCUS_09650 34302 35282 gene locus_tag LOCUS_09660 34302 35282 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088636.1 protein_id gnl|my_center|LOCUS_09660 35317 36168 gene locus_tag LOCUS_09670 35317 36168 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_09670 36214 36284 gene locus_tag LOCUS_t00100 36214 36284 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36439 37230 gene locus_tag LOCUS_09680 36439 37230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 37990 37460 gene locus_tag LOCUS_09690 37990 37460 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083294.1 protein_id gnl|my_center|LOCUS_09690 38868 37987 gene locus_tag LOCUS_09700 38868 37987 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640054.1 protein_id gnl|my_center|LOCUS_09700 39008 39082 gene locus_tag LOCUS_t00110 39008 39082 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 39584 39186 gene locus_tag LOCUS_09710 39584 39186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 39811 41400 gene locus_tag LOCUS_09720 39811 41400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 41393 42010 gene locus_tag LOCUS_09730 gene fixJ 41393 42010 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 protein_id gnl|my_center|LOCUS_09730 43332 42016 gene locus_tag LOCUS_09740 gene flgE 43332 42016 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086481.1 protein_id gnl|my_center|LOCUS_09740 44513 43365 gene locus_tag LOCUS_09750 44513 43365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 44946 44740 gene locus_tag LOCUS_09760 44946 44740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 46207 45278 gene locus_tag LOCUS_09770 46207 45278 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973337.1 protein_id gnl|my_center|LOCUS_09770 46320 46730 gene locus_tag LOCUS_09780 46320 46730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence018 <1 1471 gene locus_tag LOCUS_09790 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398747.1:alpha-L-arabinofuranosidase AbfA 1536 2456 gene locus_tag LOCUS_09800 1536 2456 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_09800 2459 2917 gene locus_tag LOCUS_09810 2459 2917 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967034.1 protein_id gnl|my_center|LOCUS_09810 3102 3884 gene locus_tag LOCUS_09820 3102 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3881 5929 gene locus_tag LOCUS_09830 3881 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5926 6939 gene locus_tag LOCUS_09840 5926 6939 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_09840 6949 7917 gene locus_tag LOCUS_09850 6949 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 7926 10007 gene locus_tag LOCUS_09860 7926 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 10790 10065 gene locus_tag LOCUS_09870 10790 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 11348 13984 gene locus_tag LOCUS_09880 gene tssH 11348 13984 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 protein_id gnl|my_center|LOCUS_09880 14027 14503 gene locus_tag LOCUS_09890 14027 14503 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504561.1 protein_id gnl|my_center|LOCUS_09890 14595 16703 gene locus_tag LOCUS_09900 14595 16703 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_09900 16708 17292 gene locus_tag LOCUS_09910 16708 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 17368 17883 gene locus_tag LOCUS_09920 gene tssB 17368 17883 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973761.1 protein_id gnl|my_center|LOCUS_09920 17884 19377 gene locus_tag LOCUS_09930 gene tssC 17884 19377 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_09930 19398 20855 gene locus_tag LOCUS_09940 gene tssC 19398 20855 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315896.1 protein_id gnl|my_center|LOCUS_09940 20869 21672 gene locus_tag LOCUS_09950 20869 21672 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064512.1 protein_id gnl|my_center|LOCUS_09950 21669 22169 gene locus_tag LOCUS_09960 gene tssE 21669 22169 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315898.1 protein_id gnl|my_center|LOCUS_09960 22166 23971 gene locus_tag LOCUS_09970 gene tssF 22166 23971 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973760.1 protein_id gnl|my_center|LOCUS_09970 23935 24996 gene locus_tag LOCUS_09980 gene tssG 23935 24996 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_09980 24993 26555 gene locus_tag LOCUS_09990 24993 26555 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_09990 26552 28495 gene locus_tag LOCUS_10000 26552 28495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 28540 28923 gene locus_tag LOCUS_10010 28540 28923 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_10010 29013 29996 gene locus_tag LOCUS_10020 29013 29996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 29993 30814 gene locus_tag LOCUS_10030 29993 30814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 30865 32193 gene locus_tag LOCUS_10040 gene tssK 30865 32193 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 protein_id gnl|my_center|LOCUS_10040 32413 33648 gene locus_tag LOCUS_10050 gene tssL 32413 33648 CDS product type VI secretion system protein TssL, long form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086381.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10050 33645 35261 gene locus_tag LOCUS_10060 33645 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10060 35258 38881 gene locus_tag LOCUS_10070 gene tssM 35258 38881 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_10070 38863 39549 gene locus_tag LOCUS_10080 38863 39549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 39554 40270 gene locus_tag LOCUS_10090 gene pppA 39554 40270 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_10090 41385 40267 gene locus_tag LOCUS_10100 gene tssA 41385 40267 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_10100 41855 41403 gene locus_tag LOCUS_10110 41855 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 43269 42103 gene locus_tag LOCUS_10120 43269 42103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 43404 43826 gene locus_tag LOCUS_10130 43404 43826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 43858 44193 gene locus_tag LOCUS_10140 43858 44193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 44214 44996 gene locus_tag LOCUS_10150 44214 44996 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027998753.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence019 1032 112 gene locus_tag LOCUS_10160 1032 112 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_10160 1128 2141 gene locus_tag LOCUS_10170 1128 2141 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_10170 2141 2998 gene locus_tag LOCUS_10180 gene sseA 2141 2998 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_10180 2995 3987 gene locus_tag LOCUS_10190 2995 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5868 3991 gene locus_tag LOCUS_10200 5868 3991 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365310.1 protein_id gnl|my_center|LOCUS_10200 5899 6411 gene locus_tag LOCUS_10210 5899 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 6408 7313 gene locus_tag LOCUS_10220 6408 7313 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_10220 7310 7612 gene locus_tag LOCUS_10230 7310 7612 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_10230 9581 7584 gene locus_tag LOCUS_10240 9581 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10453 9578 gene locus_tag LOCUS_10250 10453 9578 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085064.1 protein_id gnl|my_center|LOCUS_10250 10517 11137 gene locus_tag LOCUS_10260 10517 11137 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337686.1 protein_id gnl|my_center|LOCUS_10260 11145 12050 gene locus_tag LOCUS_10270 11145 12050 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_10270 12050 12865 gene locus_tag LOCUS_10280 12050 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 12865 13839 gene locus_tag LOCUS_10290 12865 13839 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 protein_id gnl|my_center|LOCUS_10290 13847 14386 gene locus_tag LOCUS_10300 13847 14386 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002136.1 protein_id gnl|my_center|LOCUS_10300 15594 14332 gene locus_tag LOCUS_10310 15594 14332 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090484.1 protein_id gnl|my_center|LOCUS_10310 19101 15904 gene locus_tag LOCUS_10320 19101 15904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10320 19253 19329 gene locus_tag LOCUS_t00120 19253 19329 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19367 19672 gene locus_tag LOCUS_10330 19367 19672 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171332.1 protein_id gnl|my_center|LOCUS_10330 19692 19768 gene locus_tag LOCUS_t00130 19692 19768 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19835 20023 gene locus_tag LOCUS_10340 19835 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 21018 20020 gene locus_tag LOCUS_10350 21018 20020 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_10350 21173 22189 gene locus_tag LOCUS_10360 21173 22189 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530437.1 protein_id gnl|my_center|LOCUS_10360 22192 23316 gene locus_tag LOCUS_10370 22192 23316 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929812.1 protein_id gnl|my_center|LOCUS_10370 24084 23317 gene locus_tag LOCUS_10380 24084 23317 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313781.1 protein_id gnl|my_center|LOCUS_10380 24153 25211 gene locus_tag LOCUS_10390 24153 25211 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_10390 25221 26789 gene locus_tag LOCUS_10400 25221 26789 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_10400 27445 26786 gene locus_tag LOCUS_10410 27445 26786 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089232.1 protein_id gnl|my_center|LOCUS_10410 27553 28161 gene locus_tag LOCUS_10420 27553 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966478.1 protein_id gnl|my_center|LOCUS_10420 28271 28933 gene locus_tag LOCUS_10430 28271 28933 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_10430 29346 28930 gene locus_tag LOCUS_10440 29346 28930 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969419.1 protein_id gnl|my_center|LOCUS_10440 30476 29373 gene locus_tag LOCUS_10450 30476 29373 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140150.1 protein_id gnl|my_center|LOCUS_10450 30573 34415 gene locus_tag LOCUS_10460 30573 34415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 36047 34473 gene locus_tag LOCUS_10470 36047 34473 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_10470 36178 37503 gene locus_tag LOCUS_10480 36178 37503 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 protein_id gnl|my_center|LOCUS_10480 38362 37556 gene locus_tag LOCUS_10490 38362 37556 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_10490 38461 38850 gene locus_tag LOCUS_10500 38461 38850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 38892 39479 gene locus_tag LOCUS_10510 gene gmhB 38892 39479 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072769.1 protein_id gnl|my_center|LOCUS_10510 40523 39480 gene locus_tag LOCUS_10520 40523 39480 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_10520 41554 40523 gene locus_tag LOCUS_10530 41554 40523 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390689.1 protein_id gnl|my_center|LOCUS_10530 42513 41554 gene locus_tag LOCUS_10540 42513 41554 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_10540 42599 43489 gene locus_tag LOCUS_10550 42599 43489 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_10550 44262 43492 gene locus_tag LOCUS_10560 44262 43492 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence020 564 1001 gene locus_tag LOCUS_10570 564 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2412 988 gene locus_tag LOCUS_10580 gene aroA 2412 988 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023323.1 protein_id gnl|my_center|LOCUS_10580 2411 3181 gene locus_tag LOCUS_10590 2411 3181 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992233.1 protein_id gnl|my_center|LOCUS_10590 4858 3173 gene locus_tag LOCUS_10600 gene leuA 4858 3173 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_10600 5089 6009 gene locus_tag LOCUS_10610 5089 6009 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390856.1 protein_id gnl|my_center|LOCUS_10610 6009 6746 gene locus_tag LOCUS_10620 6009 6746 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_10620 6756 7133 gene locus_tag LOCUS_10630 6756 7133 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_10630 7241 8098 gene locus_tag LOCUS_10640 7241 8098 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_10640 8228 8650 gene locus_tag LOCUS_10650 8228 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 9168 8671 gene locus_tag LOCUS_10660 9168 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 9522 9169 gene locus_tag LOCUS_10670 9522 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 10050 9724 gene locus_tag LOCUS_10680 10050 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 10419 10988 gene locus_tag LOCUS_10690 10419 10988 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510041.1 protein_id gnl|my_center|LOCUS_10690 11049 12857 gene locus_tag LOCUS_10700 11049 12857 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_10700 12850 14460 gene locus_tag LOCUS_10710 12850 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 14639 14842 gene locus_tag LOCUS_10720 14639 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 14860 15738 gene locus_tag LOCUS_10730 14860 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 15866 17305 gene locus_tag LOCUS_10740 15866 17305 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 protein_id gnl|my_center|LOCUS_10740 17317 18075 gene locus_tag LOCUS_10750 17317 18075 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_10750 18674 18072 gene locus_tag LOCUS_10760 18674 18072 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_10760 19483 18758 gene locus_tag LOCUS_10770 19483 18758 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 protein_id gnl|my_center|LOCUS_10770 20740 19610 gene locus_tag LOCUS_10780 gene rlmN 20740 19610 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_10780 21243 20737 gene locus_tag LOCUS_10790 21243 20737 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_10790 21379 21957 gene locus_tag LOCUS_10800 21379 21957 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_10800 21954 22598 gene locus_tag LOCUS_10810 gene chrR 21954 22598 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_10810 23131 22583 gene locus_tag LOCUS_10820 23131 22583 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_10820 23211 24209 gene locus_tag LOCUS_10830 23211 24209 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_10830 25093 24206 gene locus_tag LOCUS_10840 gene rarD 25093 24206 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_10840 26258 25083 gene locus_tag LOCUS_10850 26258 25083 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391942.1 protein_id gnl|my_center|LOCUS_10850 26571 26269 gene locus_tag LOCUS_10860 26571 26269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 27500 26568 gene locus_tag LOCUS_10870 27500 26568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 29514 27562 gene locus_tag LOCUS_10880 29514 27562 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 protein_id gnl|my_center|LOCUS_10880 29632 30531 gene locus_tag LOCUS_10890 29632 30531 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_10890 31552 30533 gene locus_tag LOCUS_10900 31552 30533 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975825.1 protein_id gnl|my_center|LOCUS_10900 31831 33351 gene locus_tag LOCUS_10910 31831 33351 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064463.1 protein_id gnl|my_center|LOCUS_10910 33348 34568 gene locus_tag LOCUS_10920 33348 34568 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727468.1 protein_id gnl|my_center|LOCUS_10920 34623 35342 gene locus_tag LOCUS_10930 34623 35342 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_10930 35828 35346 gene locus_tag LOCUS_10940 35828 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10940 36925 35861 gene locus_tag LOCUS_10950 36925 35861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 37009 37695 gene locus_tag LOCUS_10960 gene mtgA 37009 37695 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 protein_id gnl|my_center|LOCUS_10960 37828 39225 gene locus_tag LOCUS_10970 37828 39225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 39719 39264 gene locus_tag LOCUS_10980 39719 39264 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_10980 40634 39726 gene locus_tag LOCUS_10990 40634 39726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10990 41360 40671 gene locus_tag LOCUS_11000 41360 40671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11000 41885 41538 gene locus_tag LOCUS_11010 41885 41538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 42010 42378 gene locus_tag LOCUS_11020 42010 42378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 42732 44003 gene locus_tag LOCUS_11030 42732 44003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence021 1411 113 gene locus_tag LOCUS_11040 gene deoA 1411 113 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477813.1 protein_id gnl|my_center|LOCUS_11040 2625 1411 gene locus_tag LOCUS_11050 2625 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3596 2622 gene locus_tag LOCUS_11060 3596 2622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255101.1 protein_id gnl|my_center|LOCUS_11060 4708 3596 gene locus_tag LOCUS_11070 4708 3596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970668.1 protein_id gnl|my_center|LOCUS_11070 6398 4824 gene locus_tag LOCUS_11080 6398 4824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_11080 7390 6395 gene locus_tag LOCUS_11090 7390 6395 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 protein_id gnl|my_center|LOCUS_11090 8356 7466 gene locus_tag LOCUS_11100 8356 7466 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_11100 8575 9261 gene locus_tag LOCUS_11110 8575 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 10675 9269 gene locus_tag LOCUS_11120 10675 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 10934 11320 gene locus_tag LOCUS_11130 10934 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 11747 11325 gene locus_tag LOCUS_11140 11747 11325 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105578.1 protein_id gnl|my_center|LOCUS_11140 11826 12029 gene locus_tag LOCUS_11150 11826 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 12095 12421 gene locus_tag LOCUS_11160 12095 12421 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254519.1 protein_id gnl|my_center|LOCUS_11160 14446 12449 gene locus_tag LOCUS_11170 14446 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 16373 14649 gene locus_tag LOCUS_11180 16373 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 16980 16471 gene locus_tag LOCUS_11190 16980 16471 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 protein_id gnl|my_center|LOCUS_11190 18196 17216 gene locus_tag LOCUS_11200 18196 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 18397 20586 gene locus_tag LOCUS_11210 18397 20586 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_11210 21967 20606 gene locus_tag LOCUS_11220 21967 20606 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 protein_id gnl|my_center|LOCUS_11220 21991 22914 gene locus_tag LOCUS_11230 gene rsmI 21991 22914 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918033.1 protein_id gnl|my_center|LOCUS_11230 22886 23269 gene locus_tag LOCUS_11240 22886 23269 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918032.1 protein_id gnl|my_center|LOCUS_11240 23283 24074 gene locus_tag LOCUS_11250 23283 24074 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532886.1 protein_id gnl|my_center|LOCUS_11250 24645 24250 gene locus_tag LOCUS_11260 24645 24250 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489271.1 protein_id gnl|my_center|LOCUS_11260 25043 24642 gene locus_tag LOCUS_11270 25043 24642 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967514.1 protein_id gnl|my_center|LOCUS_11270 25130 25711 gene locus_tag LOCUS_11280 25130 25711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 25692 26525 gene locus_tag LOCUS_11290 25692 26525 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918031.1 protein_id gnl|my_center|LOCUS_11290 26680 27645 gene locus_tag LOCUS_11300 gene gshB 26680 27645 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_11300 27648 29165 gene locus_tag LOCUS_11310 27648 29165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 30396 29281 gene locus_tag LOCUS_11320 30396 29281 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050979899.1 protein_id gnl|my_center|LOCUS_11320 31696 30404 gene locus_tag LOCUS_11330 31696 30404 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970535.1 protein_id gnl|my_center|LOCUS_11330 32160 31696 gene locus_tag LOCUS_11340 32160 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 33207 32182 gene locus_tag LOCUS_11350 gene dctP 33207 32182 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970533.1 protein_id gnl|my_center|LOCUS_11350 33478 34443 gene locus_tag LOCUS_11360 gene dapA 33478 34443 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_11360 34450 35391 gene locus_tag LOCUS_11370 34450 35391 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_11370 36196 35396 gene locus_tag LOCUS_11380 36196 35396 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399313.1 protein_id gnl|my_center|LOCUS_11380 37050 36196 gene locus_tag LOCUS_11390 37050 36196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973997.1 protein_id gnl|my_center|LOCUS_11390 37208 37047 gene locus_tag LOCUS_11400 37208 37047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 38021 37221 gene locus_tag LOCUS_11410 38021 37221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11410 38858 38046 gene locus_tag LOCUS_11420 38858 38046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973996.1 protein_id gnl|my_center|LOCUS_11420 40267 38855 gene locus_tag LOCUS_11430 40267 38855 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931675.1 protein_id gnl|my_center|LOCUS_11430 41247 40285 gene locus_tag LOCUS_11440 41247 40285 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808077.1 protein_id gnl|my_center|LOCUS_11440 42271 41267 gene locus_tag LOCUS_11450 42271 41267 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123020.1 protein_id gnl|my_center|LOCUS_11450 43182 42328 gene locus_tag LOCUS_11460 43182 42328 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence022 1746 574 gene locus_tag LOCUS_11470 1746 574 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940761.1 protein_id gnl|my_center|LOCUS_11470 2588 1752 gene locus_tag LOCUS_11480 gene legD1 2588 1752 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_11480 4029 2593 gene locus_tag LOCUS_11490 4029 2593 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 protein_id gnl|my_center|LOCUS_11490 5187 4099 gene locus_tag LOCUS_11500 5187 4099 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_11500 5322 6320 gene locus_tag LOCUS_11510 5322 6320 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083666.1 protein_id gnl|my_center|LOCUS_11510 6317 7591 gene locus_tag LOCUS_11520 gene eno 6317 7591 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083669.1 protein_id gnl|my_center|LOCUS_11520 9078 7588 gene locus_tag LOCUS_11530 9078 7588 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940278.1 protein_id gnl|my_center|LOCUS_11530 9412 10947 gene locus_tag LOCUS_11540 9412 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 10967 12115 gene locus_tag LOCUS_11550 10967 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 12239 12682 gene locus_tag LOCUS_11560 12239 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 12773 13486 gene locus_tag LOCUS_11570 12773 13486 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036958.1 protein_id gnl|my_center|LOCUS_11570 13993 13553 gene locus_tag LOCUS_11580 13993 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 14324 13968 gene locus_tag LOCUS_11590 14324 13968 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_11590 15471 14335 gene locus_tag LOCUS_11600 15471 14335 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_11600 15713 16123 gene locus_tag LOCUS_11610 15713 16123 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390475.1 protein_id gnl|my_center|LOCUS_11610 16285 16719 gene locus_tag LOCUS_11620 gene dksA 16285 16719 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_11620 18183 16744 gene locus_tag LOCUS_11630 18183 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 19220 18480 gene locus_tag LOCUS_11640 gene flgH 19220 18480 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_11640 20242 19250 gene locus_tag LOCUS_11650 20242 19250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 21053 20268 gene locus_tag LOCUS_11660 gene flgG 21053 20268 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_11660 21806 21078 gene locus_tag LOCUS_11670 gene flgF 21806 21078 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919924.1 protein_id gnl|my_center|LOCUS_11670 25076 21969 gene locus_tag LOCUS_11680 25076 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 25193 26551 gene locus_tag LOCUS_11690 25193 26551 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_11690 26548 27534 gene locus_tag LOCUS_11700 26548 27534 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_11700 27531 28781 gene locus_tag LOCUS_11710 27531 28781 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_11710 28782 29420 gene locus_tag LOCUS_11720 28782 29420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 29417 30514 gene locus_tag LOCUS_11730 29417 30514 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582222.1 protein_id gnl|my_center|LOCUS_11730 30517 32406 gene locus_tag LOCUS_11740 30517 32406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 32458 33951 gene locus_tag LOCUS_11750 32458 33951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 33967 34317 gene locus_tag LOCUS_11760 33967 34317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 35513 34314 gene locus_tag LOCUS_11770 35513 34314 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967053.1 protein_id gnl|my_center|LOCUS_11770 36391 35513 gene locus_tag LOCUS_11780 36391 35513 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284614.1 protein_id gnl|my_center|LOCUS_11780 36903 36388 gene locus_tag LOCUS_11790 36903 36388 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088181.1 protein_id gnl|my_center|LOCUS_11790 37581 36916 gene locus_tag LOCUS_11800 37581 36916 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088180.1 protein_id gnl|my_center|LOCUS_11800 37991 37581 gene locus_tag LOCUS_11810 37991 37581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088179.1 protein_id gnl|my_center|LOCUS_11810 38794 37988 gene locus_tag LOCUS_11820 38794 37988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088178.1 protein_id gnl|my_center|LOCUS_11820 39906 38791 gene locus_tag LOCUS_11830 39906 38791 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_11830 41020 39917 gene locus_tag LOCUS_11840 41020 39917 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088176.1 protein_id gnl|my_center|LOCUS_11840 41928 41020 gene locus_tag LOCUS_11850 41928 41020 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence023 2824 551 gene locus_tag LOCUS_11860 2824 551 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_11860 3096 3581 gene locus_tag LOCUS_11870 3096 3581 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_11870 3581 4078 gene locus_tag LOCUS_11880 3581 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5894 4071 gene locus_tag LOCUS_11890 5894 4071 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_11890 5988 6872 gene locus_tag LOCUS_11900 5988 6872 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974845.1 protein_id gnl|my_center|LOCUS_11900 8314 6869 gene locus_tag LOCUS_11910 gene ntrC 8314 6869 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_11910 9429 8311 gene locus_tag LOCUS_11920 9429 8311 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389367.1 protein_id gnl|my_center|LOCUS_11920 10415 9426 gene locus_tag LOCUS_11930 gene dusB 10415 9426 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_11930 11295 10447 gene locus_tag LOCUS_11940 gene ccsA 11295 10447 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626222.1 protein_id gnl|my_center|LOCUS_11940 11316 13781 gene locus_tag LOCUS_11950 11316 13781 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061787.1 protein_id gnl|my_center|LOCUS_11950 13784 14716 gene locus_tag LOCUS_11960 13784 14716 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731057.1 protein_id gnl|my_center|LOCUS_11960 15365 14778 gene locus_tag LOCUS_11970 15365 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 16769 15492 gene locus_tag LOCUS_11980 16769 15492 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534205.1 protein_id gnl|my_center|LOCUS_11980 18501 16822 gene locus_tag LOCUS_11990 18501 16822 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_11990 20042 18501 gene locus_tag LOCUS_12000 gene hutH 20042 18501 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527399.1 protein_id gnl|my_center|LOCUS_12000 21303 20179 gene locus_tag LOCUS_12010 gene metC 21303 20179 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_12010 22363 21335 gene locus_tag LOCUS_12020 22363 21335 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_12020 24050 22446 gene locus_tag LOCUS_12030 24050 22446 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931332.1 protein_id gnl|my_center|LOCUS_12030 24817 24107 gene locus_tag LOCUS_12040 24817 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 25845 24832 gene locus_tag LOCUS_12050 25845 24832 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966592.1 protein_id gnl|my_center|LOCUS_12050 26706 25846 gene locus_tag LOCUS_12060 26706 25846 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_12060 26779 27714 gene locus_tag LOCUS_12070 26779 27714 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532815.1 protein_id gnl|my_center|LOCUS_12070 27757 28308 gene locus_tag LOCUS_12080 27757 28308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 28347 29927 gene locus_tag LOCUS_12090 28347 29927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_12090 31423 29924 gene locus_tag LOCUS_12100 gene argH 31423 29924 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257217.1 protein_id gnl|my_center|LOCUS_12100 31515 33932 gene locus_tag LOCUS_12110 31515 33932 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_12110 34048 35652 gene locus_tag LOCUS_12120 34048 35652 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529488.1 protein_id gnl|my_center|LOCUS_12120 35636 36658 gene locus_tag LOCUS_12130 35636 36658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389766.1 protein_id gnl|my_center|LOCUS_12130 36655 37494 gene locus_tag LOCUS_12140 36655 37494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970497.1 protein_id gnl|my_center|LOCUS_12140 37548 37793 gene locus_tag LOCUS_12150 37548 37793 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_12150 37790 38197 gene locus_tag LOCUS_12160 37790 38197 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_12160 38306 41155 gene locus_tag LOCUS_12170 gene uvrA 38306 41155 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence024 568 1323 gene locus_tag LOCUS_12180 568 1323 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_12180 1373 1693 gene locus_tag LOCUS_12190 1373 1693 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879182.1 protein_id gnl|my_center|LOCUS_12190 1767 2117 gene locus_tag LOCUS_12200 1767 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2268 2119 gene locus_tag LOCUS_12210 2268 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2664 2479 gene locus_tag LOCUS_12220 2664 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2603 3766 gene locus_tag LOCUS_12230 2603 3766 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_12230 3780 5273 gene locus_tag LOCUS_12240 3780 5273 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 protein_id gnl|my_center|LOCUS_12240 5297 7615 gene locus_tag LOCUS_12250 5297 7615 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_12250 7612 8844 gene locus_tag LOCUS_12260 7612 8844 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_12260 9002 9862 gene locus_tag LOCUS_12270 gene motA 9002 9862 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_12270 9869 10477 gene locus_tag LOCUS_12280 9869 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10489 11151 gene locus_tag LOCUS_12290 10489 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 11171 11905 gene locus_tag LOCUS_12300 11171 11905 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389598.1 protein_id gnl|my_center|LOCUS_12300 11902 12990 gene locus_tag LOCUS_12310 11902 12990 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_12310 15218 12987 gene locus_tag LOCUS_12320 gene parC 15218 12987 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_12320 15971 15228 gene locus_tag LOCUS_12330 gene recO 15971 15228 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640273.1 protein_id gnl|my_center|LOCUS_12330 16318 15971 gene locus_tag LOCUS_12340 16318 15971 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_12340 16477 18312 gene locus_tag LOCUS_12350 16477 18312 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12350 18412 20754 gene locus_tag LOCUS_12360 18412 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 22853 20751 gene locus_tag LOCUS_12370 22853 20751 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12370 24766 22826 gene locus_tag LOCUS_12380 24766 22826 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12380 26625 24751 gene locus_tag LOCUS_12390 26625 24751 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12390 28362 26626 gene locus_tag LOCUS_12400 28362 26626 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12400 29429 28539 gene locus_tag LOCUS_12410 29429 28539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 31388 29487 gene locus_tag LOCUS_12420 31388 29487 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12420 32584 31385 gene locus_tag LOCUS_12430 32584 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 34646 32595 gene locus_tag LOCUS_12440 34646 32595 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390486.1 protein_id gnl|my_center|LOCUS_12440 34653 34832 gene locus_tag LOCUS_12450 34653 34832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 36709 34769 gene locus_tag LOCUS_12460 36709 34769 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_12460 36793 37767 gene locus_tag LOCUS_12470 36793 37767 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143781.1 protein_id gnl|my_center|LOCUS_12470 37810 38403 gene locus_tag LOCUS_12480 37810 38403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12480 38346 39842 gene locus_tag LOCUS_12490 38346 39842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12490 >Feature sequence025 2202 655 gene locus_tag LOCUS_12500 2202 655 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339153.1 protein_id gnl|my_center|LOCUS_12500 3248 2199 gene locus_tag LOCUS_12510 3248 2199 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339534.1 protein_id gnl|my_center|LOCUS_12510 4657 3248 gene locus_tag LOCUS_12520 4657 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5448 4654 gene locus_tag LOCUS_12530 gene xth 5448 4654 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_12530 6137 5448 gene locus_tag LOCUS_12540 6137 5448 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088674.1 protein_id gnl|my_center|LOCUS_12540 6689 6165 gene locus_tag LOCUS_12550 6689 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 7726 6686 gene locus_tag LOCUS_12560 gene gtdA 7726 6686 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082942.1 protein_id gnl|my_center|LOCUS_12560 8447 7743 gene locus_tag LOCUS_12570 8447 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9374 8457 gene locus_tag LOCUS_12580 9374 8457 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085741.1 protein_id gnl|my_center|LOCUS_12580 10393 9371 gene locus_tag LOCUS_12590 10393 9371 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613682.1 protein_id gnl|my_center|LOCUS_12590 10492 11508 gene locus_tag LOCUS_12600 10492 11508 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_12600 11508 12014 gene locus_tag LOCUS_12610 11508 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 12011 13330 gene locus_tag LOCUS_12620 12011 13330 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_12620 13327 13764 gene locus_tag LOCUS_12630 13327 13764 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202877.1 protein_id gnl|my_center|LOCUS_12630 13994 13761 gene locus_tag LOCUS_12640 13994 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689624.1 protein_id gnl|my_center|LOCUS_12640 14136 14693 gene locus_tag LOCUS_12650 14136 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529206.1 protein_id gnl|my_center|LOCUS_12650 14690 16030 gene locus_tag LOCUS_12660 14690 16030 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_12660 16769 16014 gene locus_tag LOCUS_12670 16769 16014 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896177.1 protein_id gnl|my_center|LOCUS_12670 18099 16780 gene locus_tag LOCUS_12680 18099 16780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 19367 18105 gene locus_tag LOCUS_12690 19367 18105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_12690 24219 19381 gene locus_tag LOCUS_12700 24219 19381 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_12700 24373 25026 gene locus_tag LOCUS_12710 24373 25026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 25038 25823 gene locus_tag LOCUS_12720 25038 25823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 25820 26755 gene locus_tag LOCUS_12730 25820 26755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 26752 27945 gene locus_tag LOCUS_12740 26752 27945 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 protein_id gnl|my_center|LOCUS_12740 27950 29095 gene locus_tag LOCUS_12750 27950 29095 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088731.1 protein_id gnl|my_center|LOCUS_12750 29092 30255 gene locus_tag LOCUS_12760 gene neuC 29092 30255 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_12760 31819 30245 gene locus_tag LOCUS_12770 31819 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 32790 31840 gene locus_tag LOCUS_12780 32790 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 33074 32898 gene locus_tag LOCUS_12790 33074 32898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 33790 33071 gene locus_tag LOCUS_12800 33790 33071 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_12800 33896 36004 gene locus_tag LOCUS_12810 gene flmG 33896 36004 CDS product glycosyltransferase FlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919333.1 protein_id gnl|my_center|LOCUS_12810 36643 35999 gene locus_tag LOCUS_12820 gene hisH 36643 35999 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946487.1 protein_id gnl|my_center|LOCUS_12820 37404 36640 gene locus_tag LOCUS_12830 gene wbuZ 37404 36640 CDS product glycosyl amidation-associated protein WbuZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213307.1 protein_id gnl|my_center|LOCUS_12830 38607 37408 gene locus_tag LOCUS_12840 38607 37408 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841181.1 protein_id gnl|my_center|LOCUS_12840 39800 38745 gene locus_tag LOCUS_12850 39800 38745 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_12850 40259 39912 gene locus_tag LOCUS_12860 40259 39912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 40469 40302 gene locus_tag LOCUS_12870 40469 40302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence026 805 53 gene locus_tag LOCUS_12880 805 53 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_12880 1813 890 gene locus_tag LOCUS_12890 1813 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1873 3171 gene locus_tag LOCUS_12900 1873 3171 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088166.1 protein_id gnl|my_center|LOCUS_12900 3939 3175 gene locus_tag LOCUS_12910 3939 3175 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_12910 4730 3936 gene locus_tag LOCUS_12920 4730 3936 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_12920 6280 4730 gene locus_tag LOCUS_12930 gene metG 6280 4730 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_12930 7411 6293 gene locus_tag LOCUS_12940 7411 6293 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_12940 7950 7408 gene locus_tag LOCUS_12950 gene tmk 7950 7408 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_12950 9197 8055 gene locus_tag LOCUS_12960 9197 8055 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_12960 10243 9215 gene locus_tag LOCUS_12970 10243 9215 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_12970 11267 10296 gene locus_tag LOCUS_12980 11267 10296 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705995.1 protein_id gnl|my_center|LOCUS_12980 11346 12347 gene locus_tag LOCUS_12990 11346 12347 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089289.1 protein_id gnl|my_center|LOCUS_12990 12397 13092 gene locus_tag LOCUS_13000 12397 13092 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704944.1 protein_id gnl|my_center|LOCUS_13000 13082 14065 gene locus_tag LOCUS_13010 13082 14065 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193507.1 protein_id gnl|my_center|LOCUS_13010 14114 15301 gene locus_tag LOCUS_13020 14114 15301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_13020 15306 16073 gene locus_tag LOCUS_13030 gene hpnC 15306 16073 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_13030 16073 16855 gene locus_tag LOCUS_13040 gene hpnD 16073 16855 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085786.1 protein_id gnl|my_center|LOCUS_13040 16852 17937 gene locus_tag LOCUS_13050 gene hpnE 16852 17937 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085787.1 protein_id gnl|my_center|LOCUS_13050 18011 18601 gene locus_tag LOCUS_13060 18011 18601 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_13060 19164 18934 gene locus_tag LOCUS_13070 19164 18934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 20161 19832 gene locus_tag LOCUS_13080 20161 19832 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_13080 20922 20158 gene locus_tag LOCUS_13090 20922 20158 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_13090 21301 20927 gene locus_tag LOCUS_13100 21301 20927 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_13100 22253 21309 gene locus_tag LOCUS_13110 22253 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 23844 22270 gene locus_tag LOCUS_13120 23844 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 24219 23854 gene locus_tag LOCUS_13130 gene yajC 24219 23854 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626242.1 protein_id gnl|my_center|LOCUS_13130 24322 25179 gene locus_tag LOCUS_13140 24322 25179 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_13140 25176 25622 gene locus_tag LOCUS_13150 25176 25622 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028935.1 protein_id gnl|my_center|LOCUS_13150 26969 25701 gene locus_tag LOCUS_13160 26969 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 27482 27054 gene locus_tag LOCUS_13170 27482 27054 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389405.1 protein_id gnl|my_center|LOCUS_13170 27906 27484 gene locus_tag LOCUS_13180 27906 27484 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_13180 28454 27903 gene locus_tag LOCUS_13190 28454 27903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 29002 28466 gene locus_tag LOCUS_13200 29002 28466 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719695.1 protein_id gnl|my_center|LOCUS_13200 29898 29107 gene locus_tag LOCUS_13210 gene surE 29898 29107 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 protein_id gnl|my_center|LOCUS_13210 31168 29891 gene locus_tag LOCUS_13220 gene serS 31168 29891 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 protein_id gnl|my_center|LOCUS_13220 32037 31228 gene locus_tag LOCUS_13230 gene tatC 32037 31228 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_13230 32510 32043 gene locus_tag LOCUS_13240 gene tatB 32510 32043 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389525.1 protein_id gnl|my_center|LOCUS_13240 32814 32560 gene locus_tag LOCUS_13250 32814 32560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 33962 32916 gene locus_tag LOCUS_13260 33962 32916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_13260 35635 33959 gene locus_tag LOCUS_13270 35635 33959 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_13270 36376 35732 gene locus_tag LOCUS_13280 36376 35732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 37264 36380 gene locus_tag LOCUS_13290 37264 36380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 38054 37272 gene locus_tag LOCUS_13300 38054 37272 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_13300 38740 38051 gene locus_tag LOCUS_13310 38740 38051 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086687.1 protein_id gnl|my_center|LOCUS_13310 39778 38753 gene locus_tag LOCUS_13320 gene nagZ 39778 38753 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389530.1 protein_id gnl|my_center|LOCUS_13320 39962 39765 gene locus_tag LOCUS_13330 39962 39765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence027 411 1844 gene locus_tag LOCUS_13340 411 1844 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104140.1 protein_id gnl|my_center|LOCUS_13340 1902 2150 gene locus_tag LOCUS_13350 1902 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2143 2529 gene locus_tag LOCUS_13360 2143 2529 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_13360 3867 2530 gene locus_tag LOCUS_13370 3867 2530 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931176.1 protein_id gnl|my_center|LOCUS_13370 5098 3884 gene locus_tag LOCUS_13380 5098 3884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_13380 5245 6114 gene locus_tag LOCUS_13390 5245 6114 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_13390 6149 6646 gene locus_tag LOCUS_13400 6149 6646 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969470.1 protein_id gnl|my_center|LOCUS_13400 6646 7920 gene locus_tag LOCUS_13410 6646 7920 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 protein_id gnl|my_center|LOCUS_13410 8353 7922 gene locus_tag LOCUS_13420 8353 7922 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183417335.1 protein_id gnl|my_center|LOCUS_13420 9713 8364 gene locus_tag LOCUS_13430 9713 8364 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_13430 10541 9753 gene locus_tag LOCUS_13440 10541 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390709.1 protein_id gnl|my_center|LOCUS_13440 10613 11314 gene locus_tag LOCUS_13450 10613 11314 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_13450 12726 11749 gene locus_tag LOCUS_13460 12726 11749 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975182.1 protein_id gnl|my_center|LOCUS_13460 14105 12783 gene locus_tag LOCUS_13470 14105 12783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_13470 15348 14152 gene locus_tag LOCUS_13480 15348 14152 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 protein_id gnl|my_center|LOCUS_13480 16210 15398 gene locus_tag LOCUS_13490 16210 15398 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_13490 17493 16213 gene locus_tag LOCUS_13500 17493 16213 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_13500 18884 17490 gene locus_tag LOCUS_13510 18884 17490 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_13510 19583 18939 gene locus_tag LOCUS_13520 gene pdeM 19583 18939 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 protein_id gnl|my_center|LOCUS_13520 19672 20958 gene locus_tag LOCUS_13530 19672 20958 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 protein_id gnl|my_center|LOCUS_13530 23390 20955 gene locus_tag LOCUS_13540 23390 20955 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650294.1 protein_id gnl|my_center|LOCUS_13540 23946 23470 gene locus_tag LOCUS_13550 23946 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315053.1 protein_id gnl|my_center|LOCUS_13550 24034 25527 gene locus_tag LOCUS_13560 24034 25527 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_13560 25940 25524 gene locus_tag LOCUS_13570 25940 25524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 27123 25972 gene locus_tag LOCUS_13580 27123 25972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 29002 27212 gene locus_tag LOCUS_13590 gene cysC 29002 27212 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_13590 29928 29068 gene locus_tag LOCUS_13600 29928 29068 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_13600 30070 30519 gene locus_tag LOCUS_13610 30070 30519 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_13610 30561 30776 gene locus_tag LOCUS_13620 30561 30776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 31938 30784 gene locus_tag LOCUS_13630 31938 30784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 32771 31938 gene locus_tag LOCUS_13640 32771 31938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 32957 33334 gene locus_tag LOCUS_13650 gene crcB 32957 33334 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_13650 33331 34581 gene locus_tag LOCUS_13660 33331 34581 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086107.1 protein_id gnl|my_center|LOCUS_13660 34588 35898 gene locus_tag LOCUS_13670 34588 35898 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 protein_id gnl|my_center|LOCUS_13670 36271 35912 gene locus_tag LOCUS_13680 36271 35912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 37214 36288 gene locus_tag LOCUS_13690 37214 36288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 37388 38374 gene locus_tag LOCUS_13700 37388 38374 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence028 1527 406 gene locus_tag LOCUS_13710 gene aroB 1527 406 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391488.1 protein_id gnl|my_center|LOCUS_13710 2147 1524 gene locus_tag LOCUS_13720 2147 1524 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920844.1 protein_id gnl|my_center|LOCUS_13720 2255 2416 gene locus_tag LOCUS_13730 2255 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2397 4214 gene locus_tag LOCUS_13740 2397 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4211 5119 gene locus_tag LOCUS_13750 4211 5119 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529355.1 protein_id gnl|my_center|LOCUS_13750 5172 6128 gene locus_tag LOCUS_13760 5172 6128 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_13760 7460 6162 gene locus_tag LOCUS_13770 7460 6162 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 protein_id gnl|my_center|LOCUS_13770 7885 7649 gene locus_tag LOCUS_13780 7885 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7913 8197 gene locus_tag LOCUS_13790 7913 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8194 8994 gene locus_tag LOCUS_13800 8194 8994 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 protein_id gnl|my_center|LOCUS_13800 9088 10467 gene locus_tag LOCUS_13810 9088 10467 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_13810 10479 11234 gene locus_tag LOCUS_13820 10479 11234 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 protein_id gnl|my_center|LOCUS_13820 11254 11616 gene locus_tag LOCUS_13830 11254 11616 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_13830 11974 11588 gene locus_tag LOCUS_13840 11974 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 12260 12796 gene locus_tag LOCUS_13850 12260 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 13138 12812 gene locus_tag LOCUS_13860 13138 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 13472 13164 gene locus_tag LOCUS_13870 13472 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 15568 13589 gene locus_tag LOCUS_13880 15568 13589 CDS product VC_2705 family sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259231.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13880 15809 15594 gene locus_tag LOCUS_13890 15809 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 16247 17929 gene locus_tag LOCUS_13900 gene ettA 16247 17929 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_13900 17957 19411 gene locus_tag LOCUS_13910 17957 19411 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_13910 20150 19416 gene locus_tag LOCUS_13920 20150 19416 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_13920 20268 21140 gene locus_tag LOCUS_13930 20268 21140 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174686.1 protein_id gnl|my_center|LOCUS_13930 21151 21597 gene locus_tag LOCUS_13940 21151 21597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 21919 21608 gene locus_tag LOCUS_13950 21919 21608 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440932.1 protein_id gnl|my_center|LOCUS_13950 22535 21924 gene locus_tag LOCUS_13960 22535 21924 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040736.1 protein_id gnl|my_center|LOCUS_13960 23232 22537 gene locus_tag LOCUS_13970 23232 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 23132 23365 gene locus_tag LOCUS_13980 23132 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 23528 24526 gene locus_tag LOCUS_13990 23528 24526 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969763.1 protein_id gnl|my_center|LOCUS_13990 24529 25386 gene locus_tag LOCUS_14000 gene metF 24529 25386 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173518.1 protein_id gnl|my_center|LOCUS_14000 25383 28862 gene locus_tag LOCUS_14010 gene metH 25383 28862 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_14010 28932 29561 gene locus_tag LOCUS_14020 28932 29561 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530072.1 protein_id gnl|my_center|LOCUS_14020 29687 30181 gene locus_tag LOCUS_14030 29687 30181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 30516 31523 gene locus_tag LOCUS_14040 gene galE 30516 31523 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920241.1 protein_id gnl|my_center|LOCUS_14040 31546 34116 gene locus_tag LOCUS_14050 31546 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 34136 35914 gene locus_tag LOCUS_14060 34136 35914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_14060 <36621 35911 gene locus_tag LOCUS_14070 <36621 35911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083079845.1:plasmid pRiA4b ORF-3 family protein >Feature sequence029 723 466 gene locus_tag LOCUS_14080 gene grxC 723 466 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273795.1 protein_id gnl|my_center|LOCUS_14080 1491 739 gene locus_tag LOCUS_14090 1491 739 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_14090 1549 2463 gene locus_tag LOCUS_14100 1549 2463 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_14100 3659 2460 gene locus_tag LOCUS_14110 3659 2460 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972739.1 protein_id gnl|my_center|LOCUS_14110 4981 3662 gene locus_tag LOCUS_14120 4981 3662 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_14120 6340 5069 gene locus_tag LOCUS_14130 6340 5069 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070728.1 protein_id gnl|my_center|LOCUS_14130 7311 6349 gene locus_tag LOCUS_14140 7311 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 8521 7292 gene locus_tag LOCUS_14150 gene argJ 8521 7292 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_14150 9404 8565 gene locus_tag LOCUS_14160 9404 8565 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066738.1 protein_id gnl|my_center|LOCUS_14160 10248 9523 gene locus_tag LOCUS_14170 10248 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10495 13179 gene locus_tag LOCUS_14180 gene secA 10495 13179 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_14180 14343 13195 gene locus_tag LOCUS_14190 14343 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 15571 14450 gene locus_tag LOCUS_14200 15571 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 16423 15578 gene locus_tag LOCUS_14210 16423 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 17326 16562 gene locus_tag LOCUS_14220 17326 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195887.1 protein_id gnl|my_center|LOCUS_14220 17856 17365 gene locus_tag LOCUS_14230 17856 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14230 18057 17875 gene locus_tag LOCUS_14240 18057 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14240 18893 18114 gene locus_tag LOCUS_14250 18893 18114 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397463.1 protein_id gnl|my_center|LOCUS_14250 19048 20052 gene locus_tag LOCUS_14260 19048 20052 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640348.1 protein_id gnl|my_center|LOCUS_14260 20782 20075 gene locus_tag LOCUS_14270 gene radC 20782 20075 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_14270 21599 20766 gene locus_tag LOCUS_14280 gene map 21599 20766 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_14280 21793 22548 gene locus_tag LOCUS_14290 21793 22548 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_14290 22587 23135 gene locus_tag LOCUS_14300 22587 23135 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810192.1 protein_id gnl|my_center|LOCUS_14300 23721 23140 gene locus_tag LOCUS_14310 gene alkB 23721 23140 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965755.1 protein_id gnl|my_center|LOCUS_14310 24704 23832 gene locus_tag LOCUS_14320 24704 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 24773 24858 gene locus_tag LOCUS_t00140 24773 24858 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24871 25359 gene locus_tag LOCUS_14330 24871 25359 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930501.1 protein_id gnl|my_center|LOCUS_14330 25881 25408 gene locus_tag LOCUS_14340 25881 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 26248 26027 gene locus_tag LOCUS_14350 26248 26027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 27053 26361 gene locus_tag LOCUS_14360 gene trmB 27053 26361 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_14360 28236 27043 gene locus_tag LOCUS_14370 gene metK 28236 27043 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_14370 28801 28355 gene locus_tag LOCUS_14380 28801 28355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 30390 28867 gene locus_tag LOCUS_14390 gene lnt 30390 28867 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_14390 31301 30411 gene locus_tag LOCUS_14400 31301 30411 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_14400 31774 31298 gene locus_tag LOCUS_14410 gene ybeY 31774 31298 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391519.1 protein_id gnl|my_center|LOCUS_14410 32769 31771 gene locus_tag LOCUS_14420 32769 31771 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 protein_id gnl|my_center|LOCUS_14420 34118 32766 gene locus_tag LOCUS_14430 gene miaB 34118 32766 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_14430 34302 34919 gene locus_tag LOCUS_14440 34302 34919 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108953.1 protein_id gnl|my_center|LOCUS_14440 35162 36118 gene locus_tag LOCUS_14450 gene prfB 35162 36118 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14450 36123 36464 gene locus_tag LOCUS_14460 36123 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence030 708 148 gene locus_tag LOCUS_14470 708 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1500 760 gene locus_tag LOCUS_14480 1500 760 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255254.1 protein_id gnl|my_center|LOCUS_14480 1591 3114 gene locus_tag LOCUS_14490 1591 3114 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_14490 3130 4086 gene locus_tag LOCUS_14500 3130 4086 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329828.1 protein_id gnl|my_center|LOCUS_14500 4837 4109 gene locus_tag LOCUS_14510 4837 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 5317 4856 gene locus_tag LOCUS_14520 5317 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6362 5382 gene locus_tag LOCUS_14530 6362 5382 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194986.1 protein_id gnl|my_center|LOCUS_14530 7874 6363 gene locus_tag LOCUS_14540 7874 6363 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243665.1 protein_id gnl|my_center|LOCUS_14540 7916 9403 gene locus_tag LOCUS_14550 gene glpK 7916 9403 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_14550 9400 9951 gene locus_tag LOCUS_14560 gene greB 9400 9951 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_14560 10127 10336 gene locus_tag LOCUS_14570 10127 10336 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173969.1 protein_id gnl|my_center|LOCUS_14570 10553 11170 gene locus_tag LOCUS_14580 10553 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 11517 11167 gene locus_tag LOCUS_14590 11517 11167 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_14590 11778 12923 gene locus_tag LOCUS_14600 gene gcvT 11778 12923 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650750.1 protein_id gnl|my_center|LOCUS_14600 12930 13298 gene locus_tag LOCUS_14610 gene gcvH 12930 13298 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088496.1 protein_id gnl|my_center|LOCUS_14610 13298 14644 gene locus_tag LOCUS_14620 gene gcvPA 13298 14644 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390797.1 protein_id gnl|my_center|LOCUS_14620 14641 16194 gene locus_tag LOCUS_14630 gene gcvPB 14641 16194 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390796.1 protein_id gnl|my_center|LOCUS_14630 16314 18143 gene locus_tag LOCUS_14640 gene iolD 16314 18143 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196072.1 protein_id gnl|my_center|LOCUS_14640 18152 19036 gene locus_tag LOCUS_14650 gene iolE 18152 19036 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_14650 20424 19033 gene locus_tag LOCUS_14660 20424 19033 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_14660 21653 20439 gene locus_tag LOCUS_14670 21653 20439 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_14670 22303 21713 gene locus_tag LOCUS_14680 22303 21713 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_14680 23219 22365 gene locus_tag LOCUS_14690 23219 22365 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147137887.1 protein_id gnl|my_center|LOCUS_14690 23291 23632 gene locus_tag LOCUS_14700 23291 23632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 23639 25429 gene locus_tag LOCUS_14710 gene hcuC 23639 25429 CDS product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_14710 26559 25426 gene locus_tag LOCUS_14720 26559 25426 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_14720 26709 28394 gene locus_tag LOCUS_14730 26709 28394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625913.1 protein_id gnl|my_center|LOCUS_14730 28469 29305 gene locus_tag LOCUS_14740 28469 29305 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083358.1 protein_id gnl|my_center|LOCUS_14740 30465 29302 gene locus_tag LOCUS_14750 gene mtnA 30465 29302 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_14750 30992 30462 gene locus_tag LOCUS_14760 30992 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 31964 31071 gene locus_tag LOCUS_14770 31964 31071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_14770 32914 31964 gene locus_tag LOCUS_14780 32914 31964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083812.1 protein_id gnl|my_center|LOCUS_14780 34533 32959 gene locus_tag LOCUS_14790 34533 32959 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083813.1 protein_id gnl|my_center|LOCUS_14790 <36298 34545 gene locus_tag LOCUS_14800 <36298 34545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903889.1:ABC transporter ATP-binding protein >Feature sequence031 1690 305 gene locus_tag LOCUS_14810 1690 305 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_14810 3411 1687 gene locus_tag LOCUS_14820 3411 1687 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_14820 3410 4051 gene locus_tag LOCUS_14830 3410 4051 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_14830 4193 4954 gene locus_tag LOCUS_14840 4193 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479984.1 protein_id gnl|my_center|LOCUS_14840 4941 5408 gene locus_tag LOCUS_14850 4941 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 7431 5371 gene locus_tag LOCUS_14860 7431 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 8311 7508 gene locus_tag LOCUS_14870 8311 7508 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_14870 9141 8308 gene locus_tag LOCUS_14880 9141 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 10361 9216 gene locus_tag LOCUS_14890 10361 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 11458 10388 gene locus_tag LOCUS_14900 11458 10388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809599.1 protein_id gnl|my_center|LOCUS_14900 11623 11982 gene locus_tag LOCUS_14910 11623 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 12037 12549 gene locus_tag LOCUS_14920 12037 12549 CDS product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966290.1 protein_id gnl|my_center|LOCUS_14920 12546 14102 gene locus_tag LOCUS_14930 12546 14102 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 protein_id gnl|my_center|LOCUS_14930 14129 15037 gene locus_tag LOCUS_14940 14129 15037 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383153.1 protein_id gnl|my_center|LOCUS_14940 15044 16195 gene locus_tag LOCUS_14950 15044 16195 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538117.1 protein_id gnl|my_center|LOCUS_14950 16596 16198 gene locus_tag LOCUS_14960 16596 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 16689 16946 gene locus_tag LOCUS_14970 16689 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14970 17042 17338 gene locus_tag LOCUS_14980 17042 17338 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976332.1 protein_id gnl|my_center|LOCUS_14980 20805 17356 gene locus_tag LOCUS_14990 gene mfd 20805 17356 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_14990 21065 20805 gene locus_tag LOCUS_15000 21065 20805 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 protein_id gnl|my_center|LOCUS_15000 21150 23243 gene locus_tag LOCUS_15010 gene recG 21150 23243 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_15010 23929 23246 gene locus_tag LOCUS_15020 23929 23246 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_15020 24495 25523 gene locus_tag LOCUS_15030 24495 25523 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_15030 25520 26020 gene locus_tag LOCUS_15040 25520 26020 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338085.1 protein_id gnl|my_center|LOCUS_15040 26031 27167 gene locus_tag LOCUS_15050 26031 27167 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_15050 27176 27577 gene locus_tag LOCUS_15060 27176 27577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 27648 29138 gene locus_tag LOCUS_15070 27648 29138 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_15070 29161 29595 gene locus_tag LOCUS_15080 29161 29595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 30059 29592 gene locus_tag LOCUS_15090 30059 29592 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389850.1 protein_id gnl|my_center|LOCUS_15090 30722 30066 gene locus_tag LOCUS_15100 30722 30066 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977883.1 protein_id gnl|my_center|LOCUS_15100 31668 30736 gene locus_tag LOCUS_15110 31668 30736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 32448 31672 gene locus_tag LOCUS_15120 32448 31672 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_15120 32594 33058 gene locus_tag LOCUS_15130 32594 33058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 33976 33053 gene locus_tag LOCUS_15140 33976 33053 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_15140 34023 34697 gene locus_tag LOCUS_15150 34023 34697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 34700 35872 gene locus_tag LOCUS_15160 34700 35872 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085983.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence032 125 709 gene locus_tag LOCUS_15170 125 709 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_15170 1676 690 gene locus_tag LOCUS_15180 1676 690 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_15180 1830 3005 gene locus_tag LOCUS_15190 1830 3005 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 protein_id gnl|my_center|LOCUS_15190 3015 3926 gene locus_tag LOCUS_15200 gene argF 3015 3926 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 protein_id gnl|my_center|LOCUS_15200 3934 4818 gene locus_tag LOCUS_15210 3934 4818 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 protein_id gnl|my_center|LOCUS_15210 4929 5522 gene locus_tag LOCUS_15220 4929 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 6538 5519 gene locus_tag LOCUS_15230 6538 5519 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_15230 6601 7842 gene locus_tag LOCUS_15240 6601 7842 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_15240 9157 7832 gene locus_tag LOCUS_15250 gene murA 9157 7832 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920208.1 protein_id gnl|my_center|LOCUS_15250 10218 9205 gene locus_tag LOCUS_15260 10218 9205 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 protein_id gnl|my_center|LOCUS_15260 10398 13838 gene locus_tag LOCUS_15270 10398 13838 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_15270 14455 13835 gene locus_tag LOCUS_15280 14455 13835 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811288.1 protein_id gnl|my_center|LOCUS_15280 15348 14452 gene locus_tag LOCUS_15290 15348 14452 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083970.1 protein_id gnl|my_center|LOCUS_15290 15919 15431 gene locus_tag LOCUS_15300 15919 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 16219 15956 gene locus_tag LOCUS_15310 16219 15956 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387921.1 protein_id gnl|my_center|LOCUS_15310 16475 16789 gene locus_tag LOCUS_15320 16475 16789 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088371.1 protein_id gnl|my_center|LOCUS_15320 16805 18451 gene locus_tag LOCUS_15330 gene groL 16805 18451 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387923.1 protein_id gnl|my_center|LOCUS_15330 18543 19481 gene locus_tag LOCUS_15340 18543 19481 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_15340 19536 22169 gene locus_tag LOCUS_15350 gene pepN 19536 22169 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_15350 23177 22182 gene locus_tag LOCUS_15360 23177 22182 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_15360 24415 23186 gene locus_tag LOCUS_15370 24415 23186 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_15370 24820 24536 gene locus_tag LOCUS_15380 24820 24536 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_15380 25501 26250 gene locus_tag LOCUS_15390 25501 26250 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 protein_id gnl|my_center|LOCUS_15390 27005 26247 gene locus_tag LOCUS_15400 gene cobM 27005 26247 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 protein_id gnl|my_center|LOCUS_15400 27382 27002 gene locus_tag LOCUS_15410 27382 27002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 28596 27391 gene locus_tag LOCUS_15420 28596 27391 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531080.1 protein_id gnl|my_center|LOCUS_15420 29276 28593 gene locus_tag LOCUS_15430 29276 28593 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_15430 29330 30343 gene locus_tag LOCUS_15440 gene cbiB 29330 30343 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391129.1 protein_id gnl|my_center|LOCUS_15440 31820 30336 gene locus_tag LOCUS_15450 31820 30336 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391128.1 protein_id gnl|my_center|LOCUS_15450 32463 31807 gene locus_tag LOCUS_15460 32463 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 33084 32479 gene locus_tag LOCUS_15470 gene cobO 33084 32479 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972580.1 protein_id gnl|my_center|LOCUS_15470 <35995 33081 gene locus_tag LOCUS_15480 <35995 33081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391113.1:cobaltochelatase subunit CobN >Feature sequence033 308 123 gene locus_tag LOCUS_15490 308 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 478 1485 gene locus_tag LOCUS_15500 478 1485 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391203.1 protein_id gnl|my_center|LOCUS_15500 1920 1549 gene locus_tag LOCUS_15510 1920 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2656 2042 gene locus_tag LOCUS_15520 2656 2042 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_15520 3202 2657 gene locus_tag LOCUS_15530 3202 2657 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_15530 3974 3207 gene locus_tag LOCUS_15540 gene hisF 3974 3207 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080486.1 protein_id gnl|my_center|LOCUS_15540 4609 3974 gene locus_tag LOCUS_15550 gene hisH 4609 3974 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_15550 5622 4618 gene locus_tag LOCUS_15560 gene pseB 5622 4618 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639918.1 protein_id gnl|my_center|LOCUS_15560 5708 6472 gene locus_tag LOCUS_15570 5708 6472 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_15570 6475 7338 gene locus_tag LOCUS_15580 gene rfbD 6475 7338 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_15580 7378 9069 gene locus_tag LOCUS_15590 7378 9069 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_15590 9080 10504 gene locus_tag LOCUS_15600 9080 10504 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_15600 10486 11532 gene locus_tag LOCUS_15610 gene pseG 10486 11532 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_15610 12590 11529 gene locus_tag LOCUS_15620 gene pseI 12590 11529 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 protein_id gnl|my_center|LOCUS_15620 13768 12587 gene locus_tag LOCUS_15630 13768 12587 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_15630 13855 15147 gene locus_tag LOCUS_15640 13855 15147 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707841.1 protein_id gnl|my_center|LOCUS_15640 15144 16028 gene locus_tag LOCUS_15650 15144 16028 CDS product bifunctional regulator KidO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923314.1 protein_id gnl|my_center|LOCUS_15650 16105 16350 gene locus_tag LOCUS_15660 16105 16350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 16347 17897 gene locus_tag LOCUS_15670 16347 17897 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_15670 17894 18670 gene locus_tag LOCUS_15680 17894 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 18667 19329 gene locus_tag LOCUS_15690 18667 19329 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064970.1 protein_id gnl|my_center|LOCUS_15690 19326 21239 gene locus_tag LOCUS_15700 19326 21239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 22840 21236 gene locus_tag LOCUS_15710 22840 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 23507 23013 gene locus_tag LOCUS_15720 23507 23013 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090485.1 protein_id gnl|my_center|LOCUS_15720 24653 23526 gene locus_tag LOCUS_15730 gene odc2 24653 23526 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329838.1 protein_id gnl|my_center|LOCUS_15730 26090 24678 gene locus_tag LOCUS_15740 26090 24678 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948197.1 protein_id gnl|my_center|LOCUS_15740 28491 26470 gene locus_tag LOCUS_15750 28491 26470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 29714 28584 gene locus_tag LOCUS_15760 29714 28584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920937.1 protein_id gnl|my_center|LOCUS_15760 30167 29724 gene locus_tag LOCUS_15770 30167 29724 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_15770 31252 30167 gene locus_tag LOCUS_15780 31252 30167 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_15780 32022 31312 gene locus_tag LOCUS_15790 32022 31312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 31960 32358 gene locus_tag LOCUS_15800 31960 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 32939 32271 gene locus_tag LOCUS_15810 32939 32271 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216474.1 protein_id gnl|my_center|LOCUS_15810 33667 32939 gene locus_tag LOCUS_15820 33667 32939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 33778 34401 gene locus_tag LOCUS_15830 33778 34401 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_15830 34491 34982 gene locus_tag LOCUS_15840 34491 34982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 <35773 34957 gene locus_tag LOCUS_15850 <35773 34957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067729.1:tRNA epoxyqueuosine(34) reductase QueG >Feature sequence034 368 1915 gene locus_tag LOCUS_15860 368 1915 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_15860 1940 2884 gene locus_tag LOCUS_15870 1940 2884 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_15870 2943 3743 gene locus_tag LOCUS_15880 2943 3743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_15880 4514 3999 gene locus_tag LOCUS_15890 4514 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15890 5652 4708 gene locus_tag LOCUS_15900 5652 4708 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_15900 5762 6802 gene locus_tag LOCUS_15910 5762 6802 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339534.1 protein_id gnl|my_center|LOCUS_15910 6880 8196 gene locus_tag LOCUS_15920 gene hemL 6880 8196 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_15920 8196 9761 gene locus_tag LOCUS_15930 8196 9761 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395758.1 protein_id gnl|my_center|LOCUS_15930 9782 11020 gene locus_tag LOCUS_15940 9782 11020 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_15940 13626 11212 gene locus_tag LOCUS_15950 13626 11212 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528147.1 protein_id gnl|my_center|LOCUS_15950 13719 14678 gene locus_tag LOCUS_15960 13719 14678 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027124.1 protein_id gnl|my_center|LOCUS_15960 14792 15961 gene locus_tag LOCUS_15970 gene lde 14792 15961 CDS product multidrug efflux MFS transporter Lde inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990057.1 protein_id gnl|my_center|LOCUS_15970 16908 15958 gene locus_tag LOCUS_15980 16908 15958 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083809.1 protein_id gnl|my_center|LOCUS_15980 17858 16905 gene locus_tag LOCUS_15990 17858 16905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943261.1 protein_id gnl|my_center|LOCUS_15990 18729 17851 gene locus_tag LOCUS_16000 18729 17851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_16000 19661 18726 gene locus_tag LOCUS_16010 19661 18726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087662.1 protein_id gnl|my_center|LOCUS_16010 21862 19658 gene locus_tag LOCUS_16020 21862 19658 CDS product N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086709.1 protein_id gnl|my_center|LOCUS_16020 21933 23507 gene locus_tag LOCUS_16030 21933 23507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_16030 24485 23547 gene locus_tag LOCUS_16040 24485 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 26669 24651 gene locus_tag LOCUS_16050 26669 24651 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742782.1 protein_id gnl|my_center|LOCUS_16050 26750 28774 gene locus_tag LOCUS_16060 26750 28774 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533008.1 protein_id gnl|my_center|LOCUS_16060 28774 29718 gene locus_tag LOCUS_16070 28774 29718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533004.1 protein_id gnl|my_center|LOCUS_16070 29913 29722 gene locus_tag LOCUS_16080 29913 29722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 29830 30093 gene locus_tag LOCUS_16090 29830 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 30434 30153 gene locus_tag LOCUS_16100 30434 30153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 31654 30479 gene locus_tag LOCUS_16110 31654 30479 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_16110 32120 31728 gene locus_tag LOCUS_16120 32120 31728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 33108 32131 gene locus_tag LOCUS_16130 33108 32131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533007.1 protein_id gnl|my_center|LOCUS_16130 34072 33101 gene locus_tag LOCUS_16140 34072 33101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533006.1 protein_id gnl|my_center|LOCUS_16140 34515 34069 gene locus_tag LOCUS_16150 34515 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence035 610 125 gene locus_tag LOCUS_16160 610 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1363 683 gene locus_tag LOCUS_16170 1363 683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160544.1 protein_id gnl|my_center|LOCUS_16170 2603 1356 gene locus_tag LOCUS_16180 2603 1356 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_16180 3925 2603 gene locus_tag LOCUS_16190 3925 2603 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531107.1 protein_id gnl|my_center|LOCUS_16190 4538 4053 gene locus_tag LOCUS_16200 4538 4053 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008875359.1 protein_id gnl|my_center|LOCUS_16200 5528 4635 gene locus_tag LOCUS_16210 gene mmsB 5528 4635 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_16210 6709 5666 gene locus_tag LOCUS_16220 6709 5666 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_16220 6972 7129 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtccccgctcgtttcggggtggtct 10741 7175 gene locus_tag LOCUS_16230 10741 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 11301 10963 gene locus_tag LOCUS_16240 11301 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 12195 11341 gene locus_tag LOCUS_16250 12195 11341 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216362.1 protein_id gnl|my_center|LOCUS_16250 12264 13499 gene locus_tag LOCUS_16260 12264 13499 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243289.1 protein_id gnl|my_center|LOCUS_16260 13496 13906 gene locus_tag LOCUS_16270 13496 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 13923 14879 gene locus_tag LOCUS_16280 gene speB 13923 14879 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_16280 14967 16520 gene locus_tag LOCUS_16290 14967 16520 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_16290 16630 17886 gene locus_tag LOCUS_16300 16630 17886 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_16300 20012 17883 gene locus_tag LOCUS_16310 20012 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 21880 19991 gene locus_tag LOCUS_16320 21880 19991 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_16320 23832 21862 gene locus_tag LOCUS_16330 23832 21862 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_16330 23856 25703 gene locus_tag LOCUS_16340 23856 25703 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_16340 25781 26746 gene locus_tag LOCUS_16350 gene pdhA 25781 26746 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_16350 26736 27926 gene locus_tag LOCUS_16360 26736 27926 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_16360 27930 29102 gene locus_tag LOCUS_16370 27930 29102 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_16370 29222 30166 gene locus_tag LOCUS_16380 29222 30166 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_16380 30163 31113 gene locus_tag LOCUS_16390 30163 31113 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639972.1 protein_id gnl|my_center|LOCUS_16390 31260 31994 gene locus_tag LOCUS_16400 31260 31994 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_16400 31991 32995 gene locus_tag LOCUS_16410 31991 32995 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_16410 34420 33761 gene locus_tag LOCUS_16420 34420 33761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence036 410 730 gene locus_tag LOCUS_16430 410 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 939 2744 gene locus_tag LOCUS_16440 939 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2787 4508 gene locus_tag LOCUS_16450 2787 4508 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390481.1 protein_id gnl|my_center|LOCUS_16450 4564 5274 gene locus_tag LOCUS_16460 4564 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 5338 5631 gene locus_tag LOCUS_16470 5338 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 7626 5713 gene locus_tag LOCUS_16480 7626 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 9587 7632 gene locus_tag LOCUS_16490 9587 7632 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_16490 9730 10776 gene locus_tag LOCUS_16500 gene neuB 9730 10776 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_16500 12675 10780 gene locus_tag LOCUS_16510 12675 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 12845 14794 gene locus_tag LOCUS_16520 12845 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 16664 14775 gene locus_tag LOCUS_16530 16664 14775 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_16530 17157 16702 gene locus_tag LOCUS_16540 gene secB 17157 16702 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970595.1 protein_id gnl|my_center|LOCUS_16540 17313 17765 gene locus_tag LOCUS_16550 17313 17765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 18781 17762 gene locus_tag LOCUS_16560 18781 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 20003 19305 gene locus_tag LOCUS_16570 20003 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 21823 19967 gene locus_tag LOCUS_16580 21823 19967 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_16580 23743 21833 gene locus_tag LOCUS_16590 23743 21833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 25341 23818 gene locus_tag LOCUS_16600 25341 23818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 25921 25349 gene locus_tag LOCUS_16610 25921 25349 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064114.1 protein_id gnl|my_center|LOCUS_16610 26158 25931 gene locus_tag LOCUS_16620 26158 25931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 26811 26158 gene locus_tag LOCUS_16630 26811 26158 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042062.1 protein_id gnl|my_center|LOCUS_16630 26962 29031 gene locus_tag LOCUS_16640 26962 29031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390481.1 protein_id gnl|my_center|LOCUS_16640 29028 30602 gene locus_tag LOCUS_16650 29028 30602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 30599 32488 gene locus_tag LOCUS_16660 30599 32488 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_16660 34079 33036 gene locus_tag LOCUS_16670 34079 33036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence037 75 587 gene locus_tag LOCUS_16680 75 587 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971624.1 protein_id gnl|my_center|LOCUS_16680 587 1378 gene locus_tag LOCUS_16690 gene hutG 587 1378 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926125.1 protein_id gnl|my_center|LOCUS_16690 2165 1335 gene locus_tag LOCUS_16700 2165 1335 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_16700 2326 3087 gene locus_tag LOCUS_16710 2326 3087 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267567.1 protein_id gnl|my_center|LOCUS_16710 3161 3925 gene locus_tag LOCUS_16720 3161 3925 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_16720 3987 6038 gene locus_tag LOCUS_16730 3987 6038 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_16730 6050 6556 gene locus_tag LOCUS_16740 6050 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 7239 6772 gene locus_tag LOCUS_16750 7239 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 7339 8136 gene locus_tag LOCUS_16760 7339 8136 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_16760 8136 8939 gene locus_tag LOCUS_16770 8136 8939 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310140.1 protein_id gnl|my_center|LOCUS_16770 8944 9180 gene locus_tag LOCUS_16780 8944 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 9800 9177 gene locus_tag LOCUS_16790 9800 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 9925 10821 gene locus_tag LOCUS_16800 9925 10821 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16800 10857 11711 gene locus_tag LOCUS_16810 10857 11711 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16810 11726 12607 gene locus_tag LOCUS_16820 11726 12607 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16820 12604 13482 gene locus_tag LOCUS_16830 12604 13482 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16830 13479 14366 gene locus_tag LOCUS_16840 13479 14366 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16840 14363 15034 gene locus_tag LOCUS_16850 14363 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16850 15059 15262 gene locus_tag LOCUS_16860 15059 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16860 15696 15232 gene locus_tag LOCUS_16870 15696 15232 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_16870 16148 15693 gene locus_tag LOCUS_16880 16148 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 16674 16201 gene locus_tag LOCUS_16890 16674 16201 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027459.1 protein_id gnl|my_center|LOCUS_16890 17473 16682 gene locus_tag LOCUS_16900 17473 16682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389674.1 protein_id gnl|my_center|LOCUS_16900 18306 17476 gene locus_tag LOCUS_16910 18306 17476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208758262.1 protein_id gnl|my_center|LOCUS_16910 19223 18303 gene locus_tag LOCUS_16920 19223 18303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385766.1 protein_id gnl|my_center|LOCUS_16920 20296 19220 gene locus_tag LOCUS_16930 20296 19220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010220797.1 protein_id gnl|my_center|LOCUS_16930 21916 20312 gene locus_tag LOCUS_16940 21916 20312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538185.1 protein_id gnl|my_center|LOCUS_16940 25177 22052 gene locus_tag LOCUS_16950 25177 22052 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_16950 25220 28192 gene locus_tag LOCUS_16960 25220 28192 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16960 28189 28653 gene locus_tag LOCUS_16970 28189 28653 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_16970 28657 29130 gene locus_tag LOCUS_16980 28657 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 29680 29447 gene locus_tag LOCUS_16990 29680 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 29618 30025 gene locus_tag LOCUS_17000 29618 30025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 30132 30809 gene locus_tag LOCUS_17010 30132 30809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 32959 30806 gene locus_tag LOCUS_17020 32959 30806 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815961.1 protein_id gnl|my_center|LOCUS_17020 34026 33052 gene locus_tag LOCUS_17030 34026 33052 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815960.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence038 306 908 gene locus_tag LOCUS_17040 306 908 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337073.1 protein_id gnl|my_center|LOCUS_17040 920 2527 gene locus_tag LOCUS_17050 920 2527 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_17050 2596 3330 gene locus_tag LOCUS_17060 2596 3330 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930516.1 protein_id gnl|my_center|LOCUS_17060 3327 4457 gene locus_tag LOCUS_17070 3327 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4458 6446 gene locus_tag LOCUS_17080 4458 6446 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929810.1 protein_id gnl|my_center|LOCUS_17080 7442 6447 gene locus_tag LOCUS_17090 7442 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7534 8295 gene locus_tag LOCUS_17100 7534 8295 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_17100 8607 8302 gene locus_tag LOCUS_17110 8607 8302 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_17110 8662 9063 gene locus_tag LOCUS_17120 8662 9063 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265965.1 protein_id gnl|my_center|LOCUS_17120 9138 9608 gene locus_tag LOCUS_17130 9138 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10005 9580 gene locus_tag LOCUS_17140 10005 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 10193 10008 gene locus_tag LOCUS_17150 10193 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 12866 10221 gene locus_tag LOCUS_17160 12866 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17160 13946 12873 gene locus_tag LOCUS_17170 13946 12873 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 protein_id gnl|my_center|LOCUS_17170 15226 13943 gene locus_tag LOCUS_17180 15226 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 16209 15223 gene locus_tag LOCUS_17190 16209 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 17840 16251 gene locus_tag LOCUS_17200 gene tar 17840 16251 CDS product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483273.1 protein_id gnl|my_center|LOCUS_17200 18291 17851 gene locus_tag LOCUS_17210 18291 17851 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_17210 19899 18418 gene locus_tag LOCUS_17220 19899 18418 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665838.1 protein_id gnl|my_center|LOCUS_17220 21306 19963 gene locus_tag LOCUS_17230 21306 19963 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225960.1 protein_id gnl|my_center|LOCUS_17230 22322 21303 gene locus_tag LOCUS_17240 22322 21303 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088354.1 protein_id gnl|my_center|LOCUS_17240 22461 23246 gene locus_tag LOCUS_17250 22461 23246 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_17250 23292 24884 gene locus_tag LOCUS_17260 23292 24884 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_17260 25487 24894 gene locus_tag LOCUS_17270 25487 24894 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_17270 26224 25484 gene locus_tag LOCUS_17280 gene cobB 26224 25484 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_17280 26747 26205 gene locus_tag LOCUS_17290 gene thpR 26747 26205 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 protein_id gnl|my_center|LOCUS_17290 26843 34066 gene locus_tag LOCUS_17300 26843 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence039 1373 186 gene locus_tag LOCUS_17310 1373 186 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337698.1 protein_id gnl|my_center|LOCUS_17310 2705 1413 gene locus_tag LOCUS_17320 2705 1413 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827458.1 protein_id gnl|my_center|LOCUS_17320 2688 2897 gene locus_tag LOCUS_17330 2688 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3166 2843 gene locus_tag LOCUS_17340 3166 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3238 4320 gene locus_tag LOCUS_17350 3238 4320 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566323.1 protein_id gnl|my_center|LOCUS_17350 4360 4707 gene locus_tag LOCUS_17360 4360 4707 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_17360 4704 5210 gene locus_tag LOCUS_17370 4704 5210 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_17370 5203 5865 gene locus_tag LOCUS_17380 5203 5865 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 protein_id gnl|my_center|LOCUS_17380 6667 5849 gene locus_tag LOCUS_17390 6667 5849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_17390 7431 6664 gene locus_tag LOCUS_17400 7431 6664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_17400 8472 7480 gene locus_tag LOCUS_17410 8472 7480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 protein_id gnl|my_center|LOCUS_17410 9094 8579 gene locus_tag LOCUS_17420 9094 8579 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 protein_id gnl|my_center|LOCUS_17420 9453 9707 gene locus_tag LOCUS_17430 9453 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 9875 11236 gene locus_tag LOCUS_17440 9875 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 11628 11233 gene locus_tag LOCUS_17450 11628 11233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11892 12845 gene locus_tag LOCUS_17460 11892 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 14019 12871 gene locus_tag LOCUS_17470 gene dauA 14019 12871 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_17470 14046 14462 gene locus_tag LOCUS_17480 14046 14462 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819820.1 protein_id gnl|my_center|LOCUS_17480 14869 14459 gene locus_tag LOCUS_17490 gene cheY 14869 14459 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367338.1 protein_id gnl|my_center|LOCUS_17490 15361 14951 gene locus_tag LOCUS_17500 15361 14951 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161420660.1 protein_id gnl|my_center|LOCUS_17500 18871 15371 gene locus_tag LOCUS_17510 18871 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 20417 18984 gene locus_tag LOCUS_17520 20417 18984 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267548.1 protein_id gnl|my_center|LOCUS_17520 21690 20488 gene locus_tag LOCUS_17530 21690 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17530 22185 21706 gene locus_tag LOCUS_17540 22185 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17540 22319 24112 gene locus_tag LOCUS_17550 22319 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 25113 24109 gene locus_tag LOCUS_17560 25113 24109 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921442.1 protein_id gnl|my_center|LOCUS_17560 25197 26075 gene locus_tag LOCUS_17570 25197 26075 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_17570 26087 27343 gene locus_tag LOCUS_17580 26087 27343 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970230.1 protein_id gnl|my_center|LOCUS_17580 27343 27999 gene locus_tag LOCUS_17590 27343 27999 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844806.1 protein_id gnl|my_center|LOCUS_17590 30133 28346 gene locus_tag LOCUS_17600 30133 28346 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095490734.1 protein_id gnl|my_center|LOCUS_17600 32508 30205 gene locus_tag LOCUS_17610 32508 30205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 32675 33412 gene locus_tag LOCUS_17620 32675 33412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence040 405 731 gene locus_tag LOCUS_17630 405 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 855 1145 gene locus_tag LOCUS_17640 855 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2883 1123 gene locus_tag LOCUS_17650 2883 1123 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_17650 2997 3464 gene locus_tag LOCUS_17660 2997 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3461 4231 gene locus_tag LOCUS_17670 3461 4231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_17670 4219 4926 gene locus_tag LOCUS_17680 4219 4926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_17680 4975 5301 gene locus_tag LOCUS_17690 4975 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17690 5323 6177 gene locus_tag LOCUS_17700 5323 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17700 6201 7061 gene locus_tag LOCUS_17710 6201 7061 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809695.1 protein_id gnl|my_center|LOCUS_17710 7064 8008 gene locus_tag LOCUS_17720 7064 8008 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_17720 8015 8512 gene locus_tag LOCUS_17730 8015 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 9729 8509 gene locus_tag LOCUS_17740 9729 8509 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268578.1 protein_id gnl|my_center|LOCUS_17740 9846 10427 gene locus_tag LOCUS_17750 9846 10427 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966373.1 protein_id gnl|my_center|LOCUS_17750 11592 10381 gene locus_tag LOCUS_17760 11592 10381 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_17760 11656 14547 gene locus_tag LOCUS_17770 11656 14547 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088782.1 protein_id gnl|my_center|LOCUS_17770 15515 14544 gene locus_tag LOCUS_17780 15515 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 15604 16542 gene locus_tag LOCUS_17790 15604 16542 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202064.1 protein_id gnl|my_center|LOCUS_17790 16577 17221 gene locus_tag LOCUS_17800 16577 17221 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141803.1 protein_id gnl|my_center|LOCUS_17800 17928 17218 gene locus_tag LOCUS_17810 17928 17218 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_17810 18056 18202 gene locus_tag LOCUS_17820 18056 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 18410 19366 gene locus_tag LOCUS_17830 18410 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 19363 19920 gene locus_tag LOCUS_17840 gene leuD 19363 19920 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_17840 19944 20960 gene locus_tag LOCUS_17850 19944 20960 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399877.1 protein_id gnl|my_center|LOCUS_17850 21026 23074 gene locus_tag LOCUS_17860 21026 23074 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 protein_id gnl|my_center|LOCUS_17860 23090 24001 gene locus_tag LOCUS_17870 23090 24001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 24141 24845 gene locus_tag LOCUS_17880 24141 24845 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872728.1 protein_id gnl|my_center|LOCUS_17880 26039 24894 gene locus_tag LOCUS_17890 26039 24894 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 protein_id gnl|my_center|LOCUS_17890 26204 27793 gene locus_tag LOCUS_17900 26204 27793 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_17900 27802 28593 gene locus_tag LOCUS_17910 27802 28593 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974684.1 protein_id gnl|my_center|LOCUS_17910 30991 28610 gene locus_tag LOCUS_17920 30991 28610 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_17920 32495 31020 gene locus_tag LOCUS_17930 32495 31020 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965463.1 protein_id gnl|my_center|LOCUS_17930 32617 33027 gene locus_tag LOCUS_17940 32617 33027 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence041 169 1521 gene locus_tag LOCUS_17950 169 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1559 4378 gene locus_tag LOCUS_17960 1559 4378 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_17960 4535 6043 gene locus_tag LOCUS_17970 gene murJ 4535 6043 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_17970 7058 6033 gene locus_tag LOCUS_17980 7058 6033 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_17980 7171 8175 gene locus_tag LOCUS_17990 gene trpS 7171 8175 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_17990 8178 8393 gene locus_tag LOCUS_18000 8178 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 9643 8381 gene locus_tag LOCUS_18010 9643 8381 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088858.1 protein_id gnl|my_center|LOCUS_18010 10452 9661 gene locus_tag LOCUS_18020 10452 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 13115 10461 gene locus_tag LOCUS_18030 gene mutS 13115 10461 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_18030 13307 15088 gene locus_tag LOCUS_18040 13307 15088 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090889.1 protein_id gnl|my_center|LOCUS_18040 15100 15507 gene locus_tag LOCUS_18050 15100 15507 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 protein_id gnl|my_center|LOCUS_18050 15627 17885 gene locus_tag LOCUS_18060 15627 17885 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391289.1 protein_id gnl|my_center|LOCUS_18060 18439 17894 gene locus_tag LOCUS_18070 18439 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 19067 18453 gene locus_tag LOCUS_18080 19067 18453 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_18080 19232 19462 gene locus_tag LOCUS_18090 19232 19462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 19952 19485 gene locus_tag LOCUS_18100 gene ptsN 19952 19485 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_18100 20996 20160 gene locus_tag LOCUS_18110 20996 20160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089920.1 protein_id gnl|my_center|LOCUS_18110 21170 21835 gene locus_tag LOCUS_18120 21170 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 21847 22635 gene locus_tag LOCUS_18130 21847 22635 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_18130 24319 22658 gene locus_tag LOCUS_18140 24319 22658 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395926.1 protein_id gnl|my_center|LOCUS_18140 24945 24574 gene locus_tag LOCUS_18150 24945 24574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 25098 26495 gene locus_tag LOCUS_18160 25098 26495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 26521 28077 gene locus_tag LOCUS_18170 26521 28077 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 protein_id gnl|my_center|LOCUS_18170 29573 28074 gene locus_tag LOCUS_18180 gene rpoN 29573 28074 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_18180 30366 29584 gene locus_tag LOCUS_18190 gene lptB 30366 29584 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_18190 31166 30363 gene locus_tag LOCUS_18200 31166 30363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_18200 31864 31163 gene locus_tag LOCUS_18210 31864 31163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 32844 31870 gene locus_tag LOCUS_18220 32844 31870 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence042 491 255 gene locus_tag LOCUS_18230 491 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2343 535 gene locus_tag LOCUS_18240 2343 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2565 3101 gene locus_tag LOCUS_18250 2565 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 protein_id gnl|my_center|LOCUS_18250 3851 3105 gene locus_tag LOCUS_18260 3851 3105 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_18260 4747 3848 gene locus_tag LOCUS_18270 4747 3848 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_18270 5334 4744 gene locus_tag LOCUS_18280 gene pdxH 5334 4744 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_18280 5461 5925 gene locus_tag LOCUS_18290 5461 5925 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_18290 6017 6988 gene locus_tag LOCUS_18300 6017 6988 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390376.1 protein_id gnl|my_center|LOCUS_18300 7029 7841 gene locus_tag LOCUS_18310 gene fabI 7029 7841 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532803.1 protein_id gnl|my_center|LOCUS_18310 7855 8931 gene locus_tag LOCUS_18320 gene aroC 7855 8931 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_18320 8916 9875 gene locus_tag LOCUS_18330 8916 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 9879 11759 gene locus_tag LOCUS_18340 9879 11759 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_18340 11980 11756 gene locus_tag LOCUS_18350 11980 11756 CDS product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221786.1 protein_id gnl|my_center|LOCUS_18350 12112 13863 gene locus_tag LOCUS_18360 12112 13863 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_18360 14343 13864 gene locus_tag LOCUS_18370 14343 13864 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_18370 15103 14357 gene locus_tag LOCUS_18380 15103 14357 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_18380 17030 15117 gene locus_tag LOCUS_18390 gene dxs 17030 15117 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532789.1 protein_id gnl|my_center|LOCUS_18390 17958 17047 gene locus_tag LOCUS_18400 17958 17047 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_18400 18211 17960 gene locus_tag LOCUS_18410 18211 17960 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626422.1 protein_id gnl|my_center|LOCUS_18410 19161 18226 gene locus_tag LOCUS_18420 19161 18226 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532793.1 protein_id gnl|my_center|LOCUS_18420 20109 19285 gene locus_tag LOCUS_18430 20109 19285 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640244.1 protein_id gnl|my_center|LOCUS_18430 20586 21812 gene locus_tag LOCUS_18440 20586 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 22704 21880 gene locus_tag LOCUS_18450 22704 21880 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640244.1 protein_id gnl|my_center|LOCUS_18450 24882 22912 gene locus_tag LOCUS_18460 24882 22912 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_18460 26798 24879 gene locus_tag LOCUS_18470 26798 24879 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_18470 28840 26795 gene locus_tag LOCUS_18480 28840 26795 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_18480 30444 28813 gene locus_tag LOCUS_18490 30444 28813 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_18490 31342 30521 gene locus_tag LOCUS_18500 31342 30521 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640244.1 protein_id gnl|my_center|LOCUS_18500 31976 31632 gene locus_tag LOCUS_18510 31976 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 32401 31976 gene locus_tag LOCUS_18520 gene flbT 32401 31976 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919334.1 protein_id gnl|my_center|LOCUS_18520 32895 32461 gene locus_tag LOCUS_18530 32895 32461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence043 596 132 gene locus_tag LOCUS_18540 596 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1196 732 gene locus_tag LOCUS_18550 1196 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1939 1193 gene locus_tag LOCUS_18560 1939 1193 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085267.1 protein_id gnl|my_center|LOCUS_18560 3134 2034 gene locus_tag LOCUS_18570 gene ugpC 3134 2034 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087328.1 protein_id gnl|my_center|LOCUS_18570 4065 3151 gene locus_tag LOCUS_18580 4065 3151 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087327.1 protein_id gnl|my_center|LOCUS_18580 5054 4065 gene locus_tag LOCUS_18590 5054 4065 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174000.1 protein_id gnl|my_center|LOCUS_18590 6484 5150 gene locus_tag LOCUS_18600 6484 5150 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087324.1 protein_id gnl|my_center|LOCUS_18600 6691 6966 gene locus_tag LOCUS_18610 6691 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 6963 7205 gene locus_tag LOCUS_18620 6963 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 8987 7209 gene locus_tag LOCUS_18630 gene aspS 8987 7209 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_18630 9868 8996 gene locus_tag LOCUS_18640 gene rfbA 9868 8996 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919025.1 protein_id gnl|my_center|LOCUS_18640 10731 9865 gene locus_tag LOCUS_18650 gene rfbD 10731 9865 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_18650 11780 10728 gene locus_tag LOCUS_18660 gene rffG 11780 10728 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_18660 12343 11777 gene locus_tag LOCUS_18670 gene rfbC 12343 11777 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_18670 12476 12691 gene locus_tag LOCUS_18680 12476 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 13127 12681 gene locus_tag LOCUS_18690 13127 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 13393 13124 gene locus_tag LOCUS_18700 13393 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967281.1 protein_id gnl|my_center|LOCUS_18700 13478 13783 gene locus_tag LOCUS_18710 13478 13783 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647290.1 protein_id gnl|my_center|LOCUS_18710 13810 14154 gene locus_tag LOCUS_18720 13810 14154 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392606.1 protein_id gnl|my_center|LOCUS_18720 14705 14151 gene locus_tag LOCUS_18730 14705 14151 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391188.1 protein_id gnl|my_center|LOCUS_18730 14916 15146 gene locus_tag LOCUS_18740 14916 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 15744 15286 gene locus_tag LOCUS_18750 15744 15286 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921478.1 protein_id gnl|my_center|LOCUS_18750 15870 16367 gene locus_tag LOCUS_18760 15870 16367 CDS product DUF2165 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974551.1 protein_id gnl|my_center|LOCUS_18760 16370 16900 gene locus_tag LOCUS_18770 16370 16900 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 protein_id gnl|my_center|LOCUS_18770 16934 18826 gene locus_tag LOCUS_18780 gene asnB 16934 18826 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_18780 18967 20118 gene locus_tag LOCUS_18790 18967 20118 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_18790 20735 20115 gene locus_tag LOCUS_18800 20735 20115 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072381493.1 protein_id gnl|my_center|LOCUS_18800 21553 20864 gene locus_tag LOCUS_18810 21553 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 22781 21690 gene locus_tag LOCUS_18820 22781 21690 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_18820 23736 22738 gene locus_tag LOCUS_18830 23736 22738 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_18830 24964 23744 gene locus_tag LOCUS_18840 24964 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 25829 25176 gene locus_tag LOCUS_18850 25829 25176 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_18850 25961 26608 gene locus_tag LOCUS_18860 25961 26608 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_18860 26618 27235 gene locus_tag LOCUS_18870 26618 27235 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_18870 27366 28898 gene locus_tag LOCUS_18880 27366 28898 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085914.1 protein_id gnl|my_center|LOCUS_18880 28968 29651 gene locus_tag LOCUS_18890 28968 29651 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_18890 29648 31006 gene locus_tag LOCUS_18900 29648 31006 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_18900 31803 31198 gene locus_tag LOCUS_18910 31803 31198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313611.1 protein_id gnl|my_center|LOCUS_18910 32256 31825 gene locus_tag LOCUS_18920 32256 31825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence044 93 608 gene locus_tag LOCUS_18930 93 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1335 628 gene locus_tag LOCUS_18940 1335 628 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220090.1 protein_id gnl|my_center|LOCUS_18940 2378 1386 gene locus_tag LOCUS_18950 2378 1386 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697738.1 protein_id gnl|my_center|LOCUS_18950 3655 2396 gene locus_tag LOCUS_18960 3655 2396 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_18960 4475 3675 gene locus_tag LOCUS_18970 4475 3675 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399313.1 protein_id gnl|my_center|LOCUS_18970 5410 4475 gene locus_tag LOCUS_18980 5410 4475 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931530.1 protein_id gnl|my_center|LOCUS_18980 6001 5540 gene locus_tag LOCUS_18990 6001 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 6905 6150 gene locus_tag LOCUS_19000 6905 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 7903 6989 gene locus_tag LOCUS_19010 7903 6989 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337748.1 protein_id gnl|my_center|LOCUS_19010 8023 9273 gene locus_tag LOCUS_19020 8023 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 9353 11437 gene locus_tag LOCUS_19030 9353 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 12427 11444 gene locus_tag LOCUS_19040 12427 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 12758 13762 gene locus_tag LOCUS_19050 12758 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 14877 13777 gene locus_tag LOCUS_19060 14877 13777 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 protein_id gnl|my_center|LOCUS_19060 14960 15961 gene locus_tag LOCUS_19070 14960 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 16043 17251 gene locus_tag LOCUS_19080 16043 17251 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_19080 17915 17424 gene locus_tag LOCUS_19090 17915 17424 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974632.1 protein_id gnl|my_center|LOCUS_19090 18393 17905 gene locus_tag LOCUS_19100 18393 17905 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_19100 19685 18390 gene locus_tag LOCUS_19110 19685 18390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 21067 19682 gene locus_tag LOCUS_19120 21067 19682 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_19120 22353 21064 gene locus_tag LOCUS_19130 22353 21064 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_19130 23962 22340 gene locus_tag LOCUS_19140 gene gpmI 23962 22340 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_19140 23946 24746 gene locus_tag LOCUS_19150 23946 24746 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_19150 26053 24827 gene locus_tag LOCUS_19160 26053 24827 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_19160 27207 26050 gene locus_tag LOCUS_19170 27207 26050 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_19170 27650 27216 gene locus_tag LOCUS_19180 27650 27216 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304069.1 protein_id gnl|my_center|LOCUS_19180 28255 27647 gene locus_tag LOCUS_19190 28255 27647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_19190 28632 28228 gene locus_tag LOCUS_19200 28632 28228 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035635.1 protein_id gnl|my_center|LOCUS_19200 29607 28654 gene locus_tag LOCUS_19210 29607 28654 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175852.1 protein_id gnl|my_center|LOCUS_19210 30826 29621 gene locus_tag LOCUS_19220 30826 29621 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089330.1 protein_id gnl|my_center|LOCUS_19220 30942 31316 gene locus_tag LOCUS_19230 30942 31316 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066647.1 protein_id gnl|my_center|LOCUS_19230 31316 31792 gene locus_tag LOCUS_19240 31316 31792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 31800 32129 gene locus_tag LOCUS_19250 gene soxZ 31800 32129 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence045 388 1611 gene locus_tag LOCUS_19260 388 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_19260 1608 3224 gene locus_tag LOCUS_19270 1608 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3239 3535 gene locus_tag LOCUS_19280 3239 3535 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_19280 3599 3844 gene locus_tag LOCUS_19290 3599 3844 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_19290 4203 3841 gene locus_tag LOCUS_19300 4203 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4319 5191 gene locus_tag LOCUS_19310 4319 5191 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470590.1 protein_id gnl|my_center|LOCUS_19310 5234 6205 gene locus_tag LOCUS_19320 5234 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814748.1 protein_id gnl|my_center|LOCUS_19320 6333 7346 gene locus_tag LOCUS_19330 gene nadA 6333 7346 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 protein_id gnl|my_center|LOCUS_19330 7343 8233 gene locus_tag LOCUS_19340 gene nadC 7343 8233 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_19340 8997 8245 gene locus_tag LOCUS_19350 8997 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 9713 8994 gene locus_tag LOCUS_19360 9713 8994 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083922.1 protein_id gnl|my_center|LOCUS_19360 10840 9710 gene locus_tag LOCUS_19370 10840 9710 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 protein_id gnl|my_center|LOCUS_19370 14307 10843 gene locus_tag LOCUS_19380 14307 10843 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 protein_id gnl|my_center|LOCUS_19380 16331 14451 gene locus_tag LOCUS_19390 16331 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 16546 17508 gene locus_tag LOCUS_19400 16546 17508 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088661.1 protein_id gnl|my_center|LOCUS_19400 19301 17505 gene locus_tag LOCUS_19410 19301 17505 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_19410 19379 21154 gene locus_tag LOCUS_19420 19379 21154 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_19420 21151 22494 gene locus_tag LOCUS_19430 21151 22494 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_19430 22859 24169 gene locus_tag LOCUS_19440 22859 24169 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388884.1 protein_id gnl|my_center|LOCUS_19440 24324 25451 gene locus_tag LOCUS_19450 24324 25451 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_19450 25467 25775 gene locus_tag LOCUS_19460 25467 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 25789 27189 gene locus_tag LOCUS_19470 25789 27189 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_19470 27335 27514 gene locus_tag LOCUS_19480 gene napE 27335 27514 CDS product periplasmic nitrate reductase, NapE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089773.1 protein_id gnl|my_center|LOCUS_19480 27519 27854 gene locus_tag LOCUS_19490 27519 27854 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089774.1 protein_id gnl|my_center|LOCUS_19490 27844 30366 gene locus_tag LOCUS_19500 gene napA 27844 30366 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089775.1 protein_id gnl|my_center|LOCUS_19500 30363 30827 gene locus_tag LOCUS_19510 30363 30827 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173083.1 protein_id gnl|my_center|LOCUS_19510 30857 31456 gene locus_tag LOCUS_19520 30857 31456 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089777.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence046 1109 135 gene locus_tag LOCUS_19530 1109 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1819 1121 gene locus_tag LOCUS_19540 1819 1121 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_19540 2523 1825 gene locus_tag LOCUS_19550 2523 1825 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_19550 3298 2531 gene locus_tag LOCUS_19560 3298 2531 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_19560 3447 5498 gene locus_tag LOCUS_19570 3447 5498 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_19570 6469 5495 gene locus_tag LOCUS_19580 6469 5495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538196.1 protein_id gnl|my_center|LOCUS_19580 7458 6454 gene locus_tag LOCUS_19590 7458 6454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538195.1 protein_id gnl|my_center|LOCUS_19590 8345 7461 gene locus_tag LOCUS_19600 8345 7461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_19600 9342 8356 gene locus_tag LOCUS_19610 9342 8356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_19610 9499 11655 gene locus_tag LOCUS_19620 9499 11655 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_19620 11662 13128 gene locus_tag LOCUS_19630 11662 13128 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_19630 13547 13125 gene locus_tag LOCUS_19640 13547 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 15218 13551 gene locus_tag LOCUS_19650 15218 13551 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 protein_id gnl|my_center|LOCUS_19650 17295 15208 gene locus_tag LOCUS_19660 17295 15208 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 protein_id gnl|my_center|LOCUS_19660 17472 18539 gene locus_tag LOCUS_19670 17472 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 18568 20145 gene locus_tag LOCUS_19680 18568 20145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815878.1 protein_id gnl|my_center|LOCUS_19680 20204 21295 gene locus_tag LOCUS_19690 20204 21295 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_19690 21292 22509 gene locus_tag LOCUS_19700 gene kynU 21292 22509 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 protein_id gnl|my_center|LOCUS_19700 22595 23362 gene locus_tag LOCUS_19710 22595 23362 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040191.1 protein_id gnl|my_center|LOCUS_19710 23401 24981 gene locus_tag LOCUS_19720 23401 24981 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_19720 24987 26699 gene locus_tag LOCUS_19730 24987 26699 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_19730 26710 27522 gene locus_tag LOCUS_19740 gene comA 26710 27522 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869753.1 protein_id gnl|my_center|LOCUS_19740 27525 28412 gene locus_tag LOCUS_19750 27525 28412 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 protein_id gnl|my_center|LOCUS_19750 28424 30655 gene locus_tag LOCUS_19760 28424 30655 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_19760 <31355 30652 gene locus_tag LOCUS_19770 <31355 30652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095098.1:heme ABC transporter ATP-binding protein >Feature sequence047 690 271 gene locus_tag LOCUS_19780 gene cueR 690 271 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_19780 1420 761 gene locus_tag LOCUS_19790 1420 761 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_19790 2346 1417 gene locus_tag LOCUS_19800 2346 1417 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 protein_id gnl|my_center|LOCUS_19800 4058 2343 gene locus_tag LOCUS_19810 4058 2343 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_19810 4384 4055 gene locus_tag LOCUS_19820 gene sdhC 4384 4055 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339082.1 protein_id gnl|my_center|LOCUS_19820 4716 4384 gene locus_tag LOCUS_19830 4716 4384 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 protein_id gnl|my_center|LOCUS_19830 5420 4713 gene locus_tag LOCUS_19840 5420 4713 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_19840 5489 7102 gene locus_tag LOCUS_19850 5489 7102 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021953.1 protein_id gnl|my_center|LOCUS_19850 8588 7110 gene locus_tag LOCUS_19860 8588 7110 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039027.1 protein_id gnl|my_center|LOCUS_19860 9275 8910 gene locus_tag LOCUS_19870 9275 8910 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_19870 9625 9272 gene locus_tag LOCUS_19880 9625 9272 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391340.1 protein_id gnl|my_center|LOCUS_19880 10442 9681 gene locus_tag LOCUS_19890 gene hisF 10442 9681 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_19890 11161 10439 gene locus_tag LOCUS_19900 gene hisA 11161 10439 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_19900 11694 11158 gene locus_tag LOCUS_19910 11694 11158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102722.1 protein_id gnl|my_center|LOCUS_19910 12323 11691 gene locus_tag LOCUS_19920 gene hisH 12323 11691 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083479.1 protein_id gnl|my_center|LOCUS_19920 12963 12376 gene locus_tag LOCUS_19930 gene hisB 12963 12376 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_19930 13080 13631 gene locus_tag LOCUS_19940 gene hslV 13080 13631 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 protein_id gnl|my_center|LOCUS_19940 13628 14938 gene locus_tag LOCUS_19950 gene hslU 13628 14938 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 protein_id gnl|my_center|LOCUS_19950 16008 14935 gene locus_tag LOCUS_19960 16008 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 16109 17398 gene locus_tag LOCUS_19970 16109 17398 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970317.1 protein_id gnl|my_center|LOCUS_19970 18327 17377 gene locus_tag LOCUS_19980 gene pspF 18327 17377 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388974.1 protein_id gnl|my_center|LOCUS_19980 18529 19194 gene locus_tag LOCUS_19990 gene pspA 18529 19194 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_19990 19214 19447 gene locus_tag LOCUS_20000 gene pspB 19214 19447 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093876.1 protein_id gnl|my_center|LOCUS_20000 19444 19929 gene locus_tag LOCUS_20010 19444 19929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 19973 20704 gene locus_tag LOCUS_20020 19973 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 20719 22764 gene locus_tag LOCUS_20030 20719 22764 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_20030 24053 22761 gene locus_tag LOCUS_20040 24053 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 25303 24158 gene locus_tag LOCUS_20050 25303 24158 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_20050 26069 25389 gene locus_tag LOCUS_20060 26069 25389 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_20060 26268 27452 gene locus_tag LOCUS_20070 26268 27452 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_20070 28951 27449 gene locus_tag LOCUS_20080 28951 27449 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965463.1 protein_id gnl|my_center|LOCUS_20080 29449 29006 gene locus_tag LOCUS_20090 29449 29006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 30719 29457 gene locus_tag LOCUS_20100 30719 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence048 711 636 gene locus_tag LOCUS_t00150 711 636 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1144 809 gene locus_tag LOCUS_20110 1144 809 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388049.1 protein_id gnl|my_center|LOCUS_20110 1272 1949 gene locus_tag LOCUS_20120 gene cmk 1272 1949 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388047.1 protein_id gnl|my_center|LOCUS_20120 2068 3792 gene locus_tag LOCUS_20130 gene rpsA 2068 3792 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_20130 4007 4318 gene locus_tag LOCUS_20140 gene ihfB 4007 4318 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_20140 4327 4662 gene locus_tag LOCUS_20150 4327 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4667 5596 gene locus_tag LOCUS_20160 4667 5596 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_20160 5613 6191 gene locus_tag LOCUS_20170 5613 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 6586 6188 gene locus_tag LOCUS_20180 6586 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 7071 6586 gene locus_tag LOCUS_20190 7071 6586 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704946.1 protein_id gnl|my_center|LOCUS_20190 7119 7847 gene locus_tag LOCUS_20200 gene pyrF 7119 7847 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_20200 7844 8479 gene locus_tag LOCUS_20210 7844 8479 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_20210 8492 8935 gene locus_tag LOCUS_20220 8492 8935 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_20220 8996 9364 gene locus_tag LOCUS_20230 8996 9364 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 protein_id gnl|my_center|LOCUS_20230 9379 10560 gene locus_tag LOCUS_20240 9379 10560 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_20240 10538 10828 gene locus_tag LOCUS_20250 10538 10828 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_20250 11247 10852 gene locus_tag LOCUS_20260 11247 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 11822 11244 gene locus_tag LOCUS_20270 11822 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 12930 11893 gene locus_tag LOCUS_20280 12930 11893 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089417.1 protein_id gnl|my_center|LOCUS_20280 13144 14364 gene locus_tag LOCUS_20290 gene trpB 13144 14364 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724529.1 protein_id gnl|my_center|LOCUS_20290 14361 15182 gene locus_tag LOCUS_20300 gene trpA 14361 15182 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 protein_id gnl|my_center|LOCUS_20300 15179 16090 gene locus_tag LOCUS_20310 gene accD 15179 16090 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 protein_id gnl|my_center|LOCUS_20310 16105 17403 gene locus_tag LOCUS_20320 16105 17403 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_20320 17415 18014 gene locus_tag LOCUS_20330 17415 18014 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083595.1 protein_id gnl|my_center|LOCUS_20330 18375 18049 gene locus_tag LOCUS_20340 gene trxA 18375 18049 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_20340 19635 18490 gene locus_tag LOCUS_20350 19635 18490 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389734.1 protein_id gnl|my_center|LOCUS_20350 19872 22208 gene locus_tag LOCUS_20360 19872 22208 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_20360 22201 23586 gene locus_tag LOCUS_20370 22201 23586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 23583 24938 gene locus_tag LOCUS_20380 23583 24938 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966223.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20380 24935 25915 gene locus_tag LOCUS_20390 24935 25915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 26793 25912 gene locus_tag LOCUS_20400 26793 25912 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391011.1 protein_id gnl|my_center|LOCUS_20400 27877 26786 gene locus_tag LOCUS_20410 gene hisC 27877 26786 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084214.1 protein_id gnl|my_center|LOCUS_20410 28665 27892 gene locus_tag LOCUS_20420 28665 27892 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_20420 28791 29981 gene locus_tag LOCUS_20430 28791 29981 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence049 246 1217 gene locus_tag LOCUS_20440 246 1217 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529611.1 protein_id gnl|my_center|LOCUS_20440 1285 1758 gene locus_tag LOCUS_20450 1285 1758 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529612.1 protein_id gnl|my_center|LOCUS_20450 1758 3248 gene locus_tag LOCUS_20460 1758 3248 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 protein_id gnl|my_center|LOCUS_20460 3665 3297 gene locus_tag LOCUS_20470 3665 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971762.1 protein_id gnl|my_center|LOCUS_20470 4368 3790 gene locus_tag LOCUS_20480 gene grpE 4368 3790 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613481.1 protein_id gnl|my_center|LOCUS_20480 5428 4397 gene locus_tag LOCUS_20490 gene hrcA 5428 4397 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_20490 5655 5425 gene locus_tag LOCUS_20500 5655 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 5590 6267 gene locus_tag LOCUS_20510 gene rph 5590 6267 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391388.1 protein_id gnl|my_center|LOCUS_20510 6267 7130 gene locus_tag LOCUS_20520 6267 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7136 7738 gene locus_tag LOCUS_20530 gene rdgB 7136 7738 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_20530 7735 8865 gene locus_tag LOCUS_20540 gene hemW 7735 8865 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528629.1 protein_id gnl|my_center|LOCUS_20540 8942 11197 gene locus_tag LOCUS_20550 8942 11197 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_20550 11187 12581 gene locus_tag LOCUS_20560 11187 12581 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_20560 12657 13946 gene locus_tag LOCUS_20570 12657 13946 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_20570 14867 14112 gene locus_tag LOCUS_20580 14867 14112 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384628.1 protein_id gnl|my_center|LOCUS_20580 15658 14870 gene locus_tag LOCUS_20590 15658 14870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384629.1 protein_id gnl|my_center|LOCUS_20590 16497 15655 gene locus_tag LOCUS_20600 16497 15655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384630.1 protein_id gnl|my_center|LOCUS_20600 17547 16558 gene locus_tag LOCUS_20610 17547 16558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384631.1 protein_id gnl|my_center|LOCUS_20610 18973 17702 gene locus_tag LOCUS_20620 gene glcF 18973 17702 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971053.1 protein_id gnl|my_center|LOCUS_20620 20169 18973 gene locus_tag LOCUS_20630 20169 18973 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 protein_id gnl|my_center|LOCUS_20630 21662 20169 gene locus_tag LOCUS_20640 21662 20169 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_20640 21832 22149 gene locus_tag LOCUS_20650 21832 22149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 22362 22237 gene locus_tag LOCUS_20660 gene ykgO 22362 22237 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709334.1 protein_id gnl|my_center|LOCUS_20660 23820 22432 gene locus_tag LOCUS_20670 23820 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 24076 25050 gene locus_tag LOCUS_20680 24076 25050 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407642.1 protein_id gnl|my_center|LOCUS_20680 25306 25845 gene locus_tag LOCUS_20690 25306 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 25971 27293 gene locus_tag LOCUS_20700 25971 27293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 27715 28575 gene locus_tag LOCUS_20710 27715 28575 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389372.1 protein_id gnl|my_center|LOCUS_20710 28787 29038 gene locus_tag LOCUS_20720 gene hfq 28787 29038 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence050 424 167 gene locus_tag LOCUS_20730 424 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 305 1291 gene locus_tag LOCUS_20740 305 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1288 1788 gene locus_tag LOCUS_20750 1288 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1816 2457 gene locus_tag LOCUS_20760 gene pncA 1816 2457 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_20760 2472 2978 gene locus_tag LOCUS_20770 2472 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3628 2963 gene locus_tag LOCUS_20780 3628 2963 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 protein_id gnl|my_center|LOCUS_20780 5937 3637 gene locus_tag LOCUS_20790 5937 3637 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_20790 6960 5950 gene locus_tag LOCUS_20800 6960 5950 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_20800 7141 7908 gene locus_tag LOCUS_20810 7141 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 8713 7913 gene locus_tag LOCUS_20820 8713 7913 CDS product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095882.1 protein_id gnl|my_center|LOCUS_20820 8760 9986 gene locus_tag LOCUS_20830 8760 9986 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087807.1 protein_id gnl|my_center|LOCUS_20830 11157 9991 gene locus_tag LOCUS_20840 11157 9991 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968789.1 protein_id gnl|my_center|LOCUS_20840 11313 11708 gene locus_tag LOCUS_20850 11313 11708 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919888.1 protein_id gnl|my_center|LOCUS_20850 12121 11705 gene locus_tag LOCUS_20860 12121 11705 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_20860 13272 12118 gene locus_tag LOCUS_20870 13272 12118 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930497.1 protein_id gnl|my_center|LOCUS_20870 13604 13272 gene locus_tag LOCUS_20880 13604 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967044.1 protein_id gnl|my_center|LOCUS_20880 13697 14464 gene locus_tag LOCUS_20890 13697 14464 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243756.1 protein_id gnl|my_center|LOCUS_20890 14475 15257 gene locus_tag LOCUS_20900 14475 15257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066342893.1 protein_id gnl|my_center|LOCUS_20900 16101 15265 gene locus_tag LOCUS_20910 16101 15265 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_20910 16361 16110 gene locus_tag LOCUS_20920 16361 16110 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 protein_id gnl|my_center|LOCUS_20920 16452 17891 gene locus_tag LOCUS_20930 16452 17891 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 protein_id gnl|my_center|LOCUS_20930 19267 17888 gene locus_tag LOCUS_20940 19267 17888 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530266.1 protein_id gnl|my_center|LOCUS_20940 20136 19336 gene locus_tag LOCUS_20950 20136 19336 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530267.1 protein_id gnl|my_center|LOCUS_20950 20193 21503 gene locus_tag LOCUS_20960 20193 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 22645 21500 gene locus_tag LOCUS_20970 22645 21500 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 protein_id gnl|my_center|LOCUS_20970 22765 23130 gene locus_tag LOCUS_20980 22765 23130 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142319.1 protein_id gnl|my_center|LOCUS_20980 23155 24240 gene locus_tag LOCUS_20990 23155 24240 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_20990 25730 24237 gene locus_tag LOCUS_21000 25730 24237 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_21000 26866 25793 gene locus_tag LOCUS_21010 26866 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 26941 28365 gene locus_tag LOCUS_21020 26941 28365 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_21020 28366 28788 gene locus_tag LOCUS_21030 28366 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 28976 29683 gene locus_tag LOCUS_21040 gene msrA 28976 29683 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence051 1914 841 gene locus_tag LOCUS_21050 1914 841 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_21050 2040 3269 gene locus_tag LOCUS_21060 2040 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 4864 3266 gene locus_tag LOCUS_21070 gene ggt 4864 3266 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_21070 4981 5469 gene locus_tag LOCUS_21080 4981 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_21080 5486 6508 gene locus_tag LOCUS_21090 5486 6508 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_21090 6505 7371 gene locus_tag LOCUS_21100 6505 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 8732 7368 gene locus_tag LOCUS_21110 8732 7368 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967518.1 protein_id gnl|my_center|LOCUS_21110 10379 8811 gene locus_tag LOCUS_21120 10379 8811 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_21120 11111 10455 gene locus_tag LOCUS_21130 11111 10455 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974959.1 protein_id gnl|my_center|LOCUS_21130 11271 12218 gene locus_tag LOCUS_21140 11271 12218 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112680.1 protein_id gnl|my_center|LOCUS_21140 12347 13222 gene locus_tag LOCUS_21150 gene dctP 12347 13222 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970533.1 protein_id gnl|my_center|LOCUS_21150 13277 13795 gene locus_tag LOCUS_21160 13277 13795 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970534.1 protein_id gnl|my_center|LOCUS_21160 13792 15099 gene locus_tag LOCUS_21170 13792 15099 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970535.1 protein_id gnl|my_center|LOCUS_21170 15096 15539 gene locus_tag LOCUS_21180 15096 15539 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382876.1 protein_id gnl|my_center|LOCUS_21180 15545 17419 gene locus_tag LOCUS_21190 15545 17419 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083873.1 protein_id gnl|my_center|LOCUS_21190 17507 19222 gene locus_tag LOCUS_21200 17507 19222 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_21200 19222 21267 gene locus_tag LOCUS_21210 19222 21267 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_21210 21283 23403 gene locus_tag LOCUS_21220 21283 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 23418 24434 gene locus_tag LOCUS_21230 23418 24434 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_21230 24444 25220 gene locus_tag LOCUS_21240 gene nfsA 24444 25220 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075306.1 protein_id gnl|my_center|LOCUS_21240 26673 25225 gene locus_tag LOCUS_21250 26673 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 27362 26691 gene locus_tag LOCUS_21260 27362 26691 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170303643.1 protein_id gnl|my_center|LOCUS_21260 27602 27369 gene locus_tag LOCUS_21270 27602 27369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 27601 27864 gene locus_tag LOCUS_21280 27601 27864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 27921 28193 gene locus_tag LOCUS_21290 27921 28193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 28233 28481 gene locus_tag LOCUS_21300 28233 28481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 29553 28654 gene locus_tag LOCUS_21310 29553 28654 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence052 177 1103 gene locus_tag LOCUS_21320 177 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1621 1118 gene locus_tag LOCUS_21330 1621 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 3110 1605 gene locus_tag LOCUS_21340 3110 1605 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389621.1 protein_id gnl|my_center|LOCUS_21340 3323 4006 gene locus_tag LOCUS_21350 3323 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5432 4137 gene locus_tag LOCUS_21360 5432 4137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_21360 6151 5429 gene locus_tag LOCUS_21370 6151 5429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_21370 7815 6151 gene locus_tag LOCUS_21380 7815 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 8012 10879 gene locus_tag LOCUS_21390 8012 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 10886 11785 gene locus_tag LOCUS_21400 10886 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 11847 12698 gene locus_tag LOCUS_21410 11847 12698 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_21410 12992 12714 gene locus_tag LOCUS_21420 12992 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 13025 13591 gene locus_tag LOCUS_21430 13025 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 15213 13651 gene locus_tag LOCUS_21440 15213 13651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_21440 15823 15359 gene locus_tag LOCUS_21450 15823 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 16278 15823 gene locus_tag LOCUS_21460 16278 15823 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229621.1 protein_id gnl|my_center|LOCUS_21460 17589 16279 gene locus_tag LOCUS_21470 17589 16279 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_21470 18088 17615 gene locus_tag LOCUS_21480 18088 17615 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172862.1 protein_id gnl|my_center|LOCUS_21480 19212 18166 gene locus_tag LOCUS_21490 gene dctP 19212 18166 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 protein_id gnl|my_center|LOCUS_21490 20307 19327 gene locus_tag LOCUS_21500 20307 19327 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862432.1 protein_id gnl|my_center|LOCUS_21500 21235 20360 gene locus_tag LOCUS_21510 21235 20360 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_21510 21427 22743 gene locus_tag LOCUS_21520 21427 22743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 23559 22753 gene locus_tag LOCUS_21530 23559 22753 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086845.1 protein_id gnl|my_center|LOCUS_21530 23684 23609 gene locus_tag LOCUS_t00160 23684 23609 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24267 23740 gene locus_tag LOCUS_21540 gene coaD 24267 23740 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_21540 27017 24264 gene locus_tag LOCUS_21550 gene gyrA 27017 24264 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389497.1 protein_id gnl|my_center|LOCUS_21550 27533 27135 gene locus_tag LOCUS_21560 27533 27135 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096828425.1 protein_id gnl|my_center|LOCUS_21560 28150 27530 gene locus_tag LOCUS_21570 28150 27530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 28628 28164 gene locus_tag LOCUS_21580 28628 28164 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence053 458 3 gene locus_tag LOCUS_21590 gene queF 458 3 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920506.1 protein_id gnl|my_center|LOCUS_21590 1480 455 gene locus_tag LOCUS_21600 gene tgt 1480 455 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_21600 2592 1570 gene locus_tag LOCUS_21610 gene queA 2592 1570 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_21610 4084 2582 gene locus_tag LOCUS_21620 4084 2582 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_21620 4495 4124 gene locus_tag LOCUS_21630 4495 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4780 4499 gene locus_tag LOCUS_21640 4780 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5192 4854 gene locus_tag LOCUS_21650 5192 4854 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_21650 5680 5189 gene locus_tag LOCUS_21660 5680 5189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_21660 6238 5750 gene locus_tag LOCUS_21670 6238 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 6399 7328 gene locus_tag LOCUS_21680 6399 7328 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196382.1 protein_id gnl|my_center|LOCUS_21680 7337 8749 gene locus_tag LOCUS_21690 7337 8749 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039986.1 protein_id gnl|my_center|LOCUS_21690 10323 8746 gene locus_tag LOCUS_21700 10323 8746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_21700 11105 10359 gene locus_tag LOCUS_21710 11105 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 12280 11102 gene locus_tag LOCUS_21720 12280 11102 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529684.1 protein_id gnl|my_center|LOCUS_21720 13670 12282 gene locus_tag LOCUS_21730 13670 12282 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_21730 15040 13673 gene locus_tag LOCUS_21740 15040 13673 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_21740 15926 15054 gene locus_tag LOCUS_21750 15926 15054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383474.1 protein_id gnl|my_center|LOCUS_21750 16995 15946 gene locus_tag LOCUS_21760 16995 15946 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383473.1 protein_id gnl|my_center|LOCUS_21760 18093 17029 gene locus_tag LOCUS_21770 18093 17029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383472.1 protein_id gnl|my_center|LOCUS_21770 18914 18093 gene locus_tag LOCUS_21780 18914 18093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383471.1 protein_id gnl|my_center|LOCUS_21780 19290 18922 gene locus_tag LOCUS_21790 19290 18922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 19759 19343 gene locus_tag LOCUS_21800 19759 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 19972 19766 gene locus_tag LOCUS_21810 19972 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 19971 20582 gene locus_tag LOCUS_21820 19971 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 21683 20589 gene locus_tag LOCUS_21830 21683 20589 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_21830 22242 21694 gene locus_tag LOCUS_21840 22242 21694 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_21840 22498 23034 gene locus_tag LOCUS_21850 22498 23034 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975850.1 protein_id gnl|my_center|LOCUS_21850 23050 24723 gene locus_tag LOCUS_21860 23050 24723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 25903 24788 gene locus_tag LOCUS_21870 25903 24788 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_21870 27869 26049 gene locus_tag LOCUS_21880 gene typA 27869 26049 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_21880 29208 27985 gene locus_tag LOCUS_21890 29208 27985 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence054 2448 964 gene locus_tag LOCUS_21900 2448 964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_21900 2603 3067 gene locus_tag LOCUS_21910 2603 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4056 3064 gene locus_tag LOCUS_21920 4056 3064 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526837.1 protein_id gnl|my_center|LOCUS_21920 4502 4053 gene locus_tag LOCUS_21930 4502 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 4893 4504 gene locus_tag LOCUS_21940 4893 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5805 4906 gene locus_tag LOCUS_21950 5805 4906 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889450.1 protein_id gnl|my_center|LOCUS_21950 6501 5821 gene locus_tag LOCUS_21960 6501 5821 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385215.1 protein_id gnl|my_center|LOCUS_21960 7322 6498 gene locus_tag LOCUS_21970 7322 6498 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_21970 8236 7322 gene locus_tag LOCUS_21980 8236 7322 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525206.1 protein_id gnl|my_center|LOCUS_21980 9529 8291 gene locus_tag LOCUS_21990 9529 8291 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385218.1 protein_id gnl|my_center|LOCUS_21990 10795 9557 gene locus_tag LOCUS_22000 10795 9557 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_22000 11605 10835 gene locus_tag LOCUS_22010 11605 10835 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_22010 12594 11602 gene locus_tag LOCUS_22020 gene moaA 12594 11602 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669564.1 protein_id gnl|my_center|LOCUS_22020 12684 13559 gene locus_tag LOCUS_22030 gene fdhD 12684 13559 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966588.1 protein_id gnl|my_center|LOCUS_22030 13644 14447 gene locus_tag LOCUS_22040 13644 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 14455 16545 gene locus_tag LOCUS_22050 14455 16545 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085126.1 protein_id gnl|my_center|LOCUS_22050 16555 17481 gene locus_tag LOCUS_22060 16555 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 18177 17500 gene locus_tag LOCUS_22070 18177 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 19159 18278 gene locus_tag LOCUS_22080 19159 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 19764 19342 gene locus_tag LOCUS_22090 19764 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 20798 19848 gene locus_tag LOCUS_22100 20798 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 21009 22175 gene locus_tag LOCUS_22110 21009 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 22210 23676 gene locus_tag LOCUS_22120 22210 23676 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311741.1 protein_id gnl|my_center|LOCUS_22120 24082 23708 gene locus_tag LOCUS_22130 24082 23708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 24951 24085 gene locus_tag LOCUS_22140 24951 24085 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351200.1 protein_id gnl|my_center|LOCUS_22140 25643 25248 gene locus_tag LOCUS_22150 25643 25248 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088362.1 protein_id gnl|my_center|LOCUS_22150 25706 26332 gene locus_tag LOCUS_22160 25706 26332 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 protein_id gnl|my_center|LOCUS_22160 29213 26322 gene locus_tag LOCUS_22170 29213 26322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence055 173 937 gene locus_tag LOCUS_22180 173 937 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_22180 2127 934 gene locus_tag LOCUS_22190 2127 934 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_22190 2059 2835 gene locus_tag LOCUS_22200 2059 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2852 3709 gene locus_tag LOCUS_22210 2852 3709 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920157.1 protein_id gnl|my_center|LOCUS_22210 3706 4656 gene locus_tag LOCUS_22220 3706 4656 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528532.1 protein_id gnl|my_center|LOCUS_22220 4763 6160 gene locus_tag LOCUS_22230 4763 6160 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_22230 6197 6634 gene locus_tag LOCUS_22240 6197 6634 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_22240 6760 7179 gene locus_tag LOCUS_22250 6760 7179 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_22250 7248 8594 gene locus_tag LOCUS_22260 7248 8594 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_22260 8591 9175 gene locus_tag LOCUS_22270 8591 9175 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_22270 9247 10122 gene locus_tag LOCUS_22280 9247 10122 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_22280 11129 10131 gene locus_tag LOCUS_22290 11129 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 11558 11229 gene locus_tag LOCUS_22300 11558 11229 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 protein_id gnl|my_center|LOCUS_22300 11652 12677 gene locus_tag LOCUS_22310 11652 12677 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_22310 14725 12674 gene locus_tag LOCUS_22320 14725 12674 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 protein_id gnl|my_center|LOCUS_22320 15603 14722 gene locus_tag LOCUS_22330 gene murQ 15603 14722 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_22330 15664 16647 gene locus_tag LOCUS_22340 15664 16647 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918332.1 protein_id gnl|my_center|LOCUS_22340 16644 17780 gene locus_tag LOCUS_22350 gene nagA 16644 17780 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038508.1 protein_id gnl|my_center|LOCUS_22350 17770 19170 gene locus_tag LOCUS_22360 17770 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 19853 19125 gene locus_tag LOCUS_22370 19853 19125 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_22370 21538 19850 gene locus_tag LOCUS_22380 21538 19850 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 protein_id gnl|my_center|LOCUS_22380 22541 21543 gene locus_tag LOCUS_22390 22541 21543 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_22390 22602 23840 gene locus_tag LOCUS_22400 22602 23840 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502893.1 protein_id gnl|my_center|LOCUS_22400 23840 24619 gene locus_tag LOCUS_22410 23840 24619 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_22410 26723 24621 gene locus_tag LOCUS_22420 26723 24621 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112541.1 protein_id gnl|my_center|LOCUS_22420 27765 26728 gene locus_tag LOCUS_22430 27765 26728 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853200.1 protein_id gnl|my_center|LOCUS_22430 27867 29417 gene locus_tag LOCUS_22440 27867 29417 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence056 173 514 gene locus_tag LOCUS_22450 173 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 582 1187 gene locus_tag LOCUS_22460 582 1187 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047143.1 protein_id gnl|my_center|LOCUS_22460 1184 1762 gene locus_tag LOCUS_22470 1184 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1871 2263 gene locus_tag LOCUS_22480 1871 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2270 2986 gene locus_tag LOCUS_22490 2270 2986 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 protein_id gnl|my_center|LOCUS_22490 3788 3003 gene locus_tag LOCUS_22500 3788 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4584 3790 gene locus_tag LOCUS_22510 4584 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 5567 4581 gene locus_tag LOCUS_22520 5567 4581 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_22520 6396 5779 gene locus_tag LOCUS_22530 6396 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 6486 6947 gene locus_tag LOCUS_22540 6486 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 6937 7758 gene locus_tag LOCUS_22550 6937 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 7794 8453 gene locus_tag LOCUS_22560 7794 8453 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_22560 8677 8450 gene locus_tag LOCUS_22570 8677 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 9684 8875 gene locus_tag LOCUS_22580 gene pstB 9684 8875 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 protein_id gnl|my_center|LOCUS_22580 11415 9697 gene locus_tag LOCUS_22590 gene pstA 11415 9697 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_22590 14027 11427 gene locus_tag LOCUS_22600 14027 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 15072 14080 gene locus_tag LOCUS_22610 gene pstS 15072 14080 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_22610 17199 15238 gene locus_tag LOCUS_22620 17199 15238 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390754.1 protein_id gnl|my_center|LOCUS_22620 17678 17295 gene locus_tag LOCUS_22630 17678 17295 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844515.1 protein_id gnl|my_center|LOCUS_22630 17887 17675 gene locus_tag LOCUS_22640 17887 17675 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709672.1 protein_id gnl|my_center|LOCUS_22640 18593 17919 gene locus_tag LOCUS_22650 18593 17919 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067253.1 protein_id gnl|my_center|LOCUS_22650 19532 18606 gene locus_tag LOCUS_22660 gene trxA 19532 18606 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_22660 20084 19557 gene locus_tag LOCUS_22670 20084 19557 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_22670 20191 20265 gene locus_tag LOCUS_t00170 20191 20265 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21251 20337 gene locus_tag LOCUS_22680 21251 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 21418 22104 gene locus_tag LOCUS_22690 21418 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_22690 22771 22064 gene locus_tag LOCUS_22700 22771 22064 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087296.1 protein_id gnl|my_center|LOCUS_22700 23376 22771 gene locus_tag LOCUS_22710 23376 22771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088355.1 protein_id gnl|my_center|LOCUS_22710 24181 23384 gene locus_tag LOCUS_22720 24181 23384 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_22720 24453 24178 gene locus_tag LOCUS_22730 24453 24178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 24679 24494 gene locus_tag LOCUS_22740 24679 24494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22740 25661 24768 gene locus_tag LOCUS_22750 25661 24768 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176150.1 protein_id gnl|my_center|LOCUS_22750 25847 26776 gene locus_tag LOCUS_22760 25847 26776 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198035.1 protein_id gnl|my_center|LOCUS_22760 27152 26787 gene locus_tag LOCUS_22770 27152 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 27661 27182 gene locus_tag LOCUS_22780 27661 27182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 28791 27658 gene locus_tag LOCUS_22790 28791 27658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 29239 29012 gene locus_tag LOCUS_22800 29239 29012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 29120 29380 gene locus_tag LOCUS_22810 29120 29380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence057 380 1096 gene locus_tag LOCUS_22820 380 1096 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269433.1 protein_id gnl|my_center|LOCUS_22820 1099 1380 gene locus_tag LOCUS_22830 1099 1380 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_22830 1377 2855 gene locus_tag LOCUS_22840 1377 2855 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_22840 2845 3507 gene locus_tag LOCUS_22850 2845 3507 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_22850 4817 3492 gene locus_tag LOCUS_22860 4817 3492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064566.1 protein_id gnl|my_center|LOCUS_22860 5817 4849 gene locus_tag LOCUS_22870 5817 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 6006 7991 gene locus_tag LOCUS_22880 6006 7991 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_22880 8070 8516 gene locus_tag LOCUS_22890 8070 8516 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265864.1 protein_id gnl|my_center|LOCUS_22890 8629 10224 gene locus_tag LOCUS_22900 8629 10224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_22900 11461 10244 gene locus_tag LOCUS_22910 11461 10244 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_22910 12126 11458 gene locus_tag LOCUS_22920 12126 11458 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_22920 13453 12251 gene locus_tag LOCUS_22930 13453 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 13565 14083 gene locus_tag LOCUS_22940 13565 14083 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613918.1 protein_id gnl|my_center|LOCUS_22940 14080 15246 gene locus_tag LOCUS_22950 14080 15246 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085576.1 protein_id gnl|my_center|LOCUS_22950 17283 15259 gene locus_tag LOCUS_22960 17283 15259 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226130.1 protein_id gnl|my_center|LOCUS_22960 17378 18850 gene locus_tag LOCUS_22970 17378 18850 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_22970 18861 19835 gene locus_tag LOCUS_22980 18861 19835 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921075.1 protein_id gnl|my_center|LOCUS_22980 20588 19839 gene locus_tag LOCUS_22990 20588 19839 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765949.1 protein_id gnl|my_center|LOCUS_22990 22029 20773 gene locus_tag LOCUS_23000 22029 20773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 22469 23500 gene locus_tag LOCUS_23010 22469 23500 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_23010 23491 24291 gene locus_tag LOCUS_23020 23491 24291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812501.1 protein_id gnl|my_center|LOCUS_23020 24288 25301 gene locus_tag LOCUS_23030 24288 25301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461413.1 protein_id gnl|my_center|LOCUS_23030 25305 26246 gene locus_tag LOCUS_23040 gene pip 25305 26246 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_23040 27214 26243 gene locus_tag LOCUS_23050 27214 26243 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_23050 27116 27364 gene locus_tag LOCUS_23060 27116 27364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 27400 27894 gene locus_tag LOCUS_23070 27400 27894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 27969 28460 gene locus_tag LOCUS_23080 27969 28460 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530535.1 protein_id gnl|my_center|LOCUS_23080 <29152 28457 gene locus_tag LOCUS_23090 <29152 28457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261331.1:alternative oxidase >Feature sequence058 1076 237 gene locus_tag LOCUS_23100 gene gluQRS 1076 237 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_23100 1130 1813 gene locus_tag LOCUS_23110 1130 1813 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_23110 1926 2492 gene locus_tag LOCUS_23120 1926 2492 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 protein_id gnl|my_center|LOCUS_23120 3028 2489 gene locus_tag LOCUS_23130 3028 2489 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_23130 3519 3025 gene locus_tag LOCUS_23140 3519 3025 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_23140 4103 3522 gene locus_tag LOCUS_23150 4103 3522 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_23150 4869 4129 gene locus_tag LOCUS_23160 4869 4129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_23160 6176 4869 gene locus_tag LOCUS_23170 6176 4869 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_23170 7630 6179 gene locus_tag LOCUS_23180 7630 6179 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_23180 8039 7620 gene locus_tag LOCUS_23190 8039 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 9331 8036 gene locus_tag LOCUS_23200 9331 8036 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129220445.1 protein_id gnl|my_center|LOCUS_23200 10274 9324 gene locus_tag LOCUS_23210 10274 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 10374 10459 gene locus_tag LOCUS_t00180 10374 10459 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10499 10840 gene locus_tag LOCUS_23220 10499 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 10885 11979 gene locus_tag LOCUS_23230 10885 11979 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_23230 11976 12887 gene locus_tag LOCUS_23240 11976 12887 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027311.1 protein_id gnl|my_center|LOCUS_23240 13486 12884 gene locus_tag LOCUS_23250 13486 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814756.1 protein_id gnl|my_center|LOCUS_23250 13630 14847 gene locus_tag LOCUS_23260 13630 14847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086066.1 protein_id gnl|my_center|LOCUS_23260 15637 14849 gene locus_tag LOCUS_23270 15637 14849 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_23270 16843 15650 gene locus_tag LOCUS_23280 16843 15650 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966992.1 protein_id gnl|my_center|LOCUS_23280 16931 17698 gene locus_tag LOCUS_23290 16931 17698 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070711.1 protein_id gnl|my_center|LOCUS_23290 18582 17707 gene locus_tag LOCUS_23300 18582 17707 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040202.1 protein_id gnl|my_center|LOCUS_23300 18575 19201 gene locus_tag LOCUS_23310 18575 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 19255 20253 gene locus_tag LOCUS_23320 19255 20253 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_23320 20272 20682 gene locus_tag LOCUS_23330 20272 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 20698 21369 gene locus_tag LOCUS_23340 20698 21369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 21366 22439 gene locus_tag LOCUS_23350 21366 22439 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082423.1 protein_id gnl|my_center|LOCUS_23350 22520 22675 gene locus_tag LOCUS_23360 22520 22675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23360 22691 23071 gene locus_tag LOCUS_23370 22691 23071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23370 23264 24679 gene locus_tag LOCUS_23380 23264 24679 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_23380 24686 25627 gene locus_tag LOCUS_23390 24686 25627 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_23390 25632 26447 gene locus_tag LOCUS_23400 25632 26447 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396033.1 protein_id gnl|my_center|LOCUS_23400 26479 27219 gene locus_tag LOCUS_23410 26479 27219 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_23410 27810 28805 gene locus_tag LOCUS_23420 27810 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence059 326 2275 gene locus_tag LOCUS_23430 326 2275 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969356.1 protein_id gnl|my_center|LOCUS_23430 2284 3678 gene locus_tag LOCUS_23440 2284 3678 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267550.1 protein_id gnl|my_center|LOCUS_23440 5741 3696 gene locus_tag LOCUS_23450 5741 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 7292 5838 gene locus_tag LOCUS_23460 7292 5838 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_23460 8311 7292 gene locus_tag LOCUS_23470 8311 7292 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970424.1 protein_id gnl|my_center|LOCUS_23470 9332 8313 gene locus_tag LOCUS_23480 9332 8313 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970424.1 protein_id gnl|my_center|LOCUS_23480 9496 11082 gene locus_tag LOCUS_23490 9496 11082 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376440.1 protein_id gnl|my_center|LOCUS_23490 11151 12158 gene locus_tag LOCUS_23500 11151 12158 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530437.1 protein_id gnl|my_center|LOCUS_23500 12165 13094 gene locus_tag LOCUS_23510 12165 13094 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704270.1 protein_id gnl|my_center|LOCUS_23510 13099 13710 gene locus_tag LOCUS_23520 13099 13710 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_23520 15170 13707 gene locus_tag LOCUS_23530 15170 13707 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_23530 15273 16730 gene locus_tag LOCUS_23540 15273 16730 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_23540 17808 16735 gene locus_tag LOCUS_23550 17808 16735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_23550 18610 17822 gene locus_tag LOCUS_23560 18610 17822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969778.1 protein_id gnl|my_center|LOCUS_23560 19509 18607 gene locus_tag LOCUS_23570 19509 18607 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529194.1 protein_id gnl|my_center|LOCUS_23570 20033 19572 gene locus_tag LOCUS_23580 20033 19572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23580 20659 20030 gene locus_tag LOCUS_23590 20659 20030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23590 22000 20768 gene locus_tag LOCUS_23600 22000 20768 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 protein_id gnl|my_center|LOCUS_23600 23196 22030 gene locus_tag LOCUS_23610 23196 22030 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_23610 23927 23241 gene locus_tag LOCUS_23620 23927 23241 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_23620 25126 23927 gene locus_tag LOCUS_23630 25126 23927 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088780.1 protein_id gnl|my_center|LOCUS_23630 26015 25185 gene locus_tag LOCUS_23640 gene hisN 26015 25185 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_23640 26805 26020 gene locus_tag LOCUS_23650 gene hisN 26805 26020 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_23650 28397 26802 gene locus_tag LOCUS_23660 28397 26802 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538185.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence060 862 125 gene locus_tag LOCUS_23670 862 125 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_23670 962 3646 gene locus_tag LOCUS_23680 962 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23680 3621 3992 gene locus_tag LOCUS_23690 3621 3992 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083216.1 protein_id gnl|my_center|LOCUS_23690 5495 3996 gene locus_tag LOCUS_23700 5495 3996 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406390.1 protein_id gnl|my_center|LOCUS_23700 6670 5555 gene locus_tag LOCUS_23710 6670 5555 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_23710 7867 6746 gene locus_tag LOCUS_23720 7867 6746 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727711.1 protein_id gnl|my_center|LOCUS_23720 7933 10086 gene locus_tag LOCUS_23730 7933 10086 CDS product N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086709.1 protein_id gnl|my_center|LOCUS_23730 10098 11276 gene locus_tag LOCUS_23740 10098 11276 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974552.1 protein_id gnl|my_center|LOCUS_23740 11282 12715 gene locus_tag LOCUS_23750 11282 12715 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974078.1 protein_id gnl|my_center|LOCUS_23750 14115 12712 gene locus_tag LOCUS_23760 14115 12712 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_23760 14306 14112 gene locus_tag LOCUS_23770 14306 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 14782 14369 gene locus_tag LOCUS_23780 14782 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 14910 15986 gene locus_tag LOCUS_23790 14910 15986 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_23790 16157 16927 gene locus_tag LOCUS_23800 16157 16927 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171680.1 protein_id gnl|my_center|LOCUS_23800 16952 17707 gene locus_tag LOCUS_23810 16952 17707 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_23810 17720 18025 gene locus_tag LOCUS_23820 17720 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 18034 18747 gene locus_tag LOCUS_23830 18034 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 19866 18757 gene locus_tag LOCUS_23840 19866 18757 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089182.1 protein_id gnl|my_center|LOCUS_23840 20660 19863 gene locus_tag LOCUS_23850 20660 19863 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_23850 20762 22063 gene locus_tag LOCUS_23860 gene hemL 20762 22063 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_23860 22938 22069 gene locus_tag LOCUS_23870 22938 22069 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_23870 24512 22935 gene locus_tag LOCUS_23880 24512 22935 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_23880 24698 25396 gene locus_tag LOCUS_23890 24698 25396 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240554.1 protein_id gnl|my_center|LOCUS_23890 26151 25393 gene locus_tag LOCUS_23900 26151 25393 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067067.1 protein_id gnl|my_center|LOCUS_23900 27586 26141 gene locus_tag LOCUS_23910 27586 26141 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808711.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence061 257 562 gene locus_tag LOCUS_23920 257 562 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643481.1 protein_id gnl|my_center|LOCUS_23920 564 1205 gene locus_tag LOCUS_23930 564 1205 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_23930 1215 1913 gene locus_tag LOCUS_23940 1215 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3406 1910 gene locus_tag LOCUS_23950 3406 1910 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_23950 3894 3406 gene locus_tag LOCUS_23960 3894 3406 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085834.1 protein_id gnl|my_center|LOCUS_23960 4921 3947 gene locus_tag LOCUS_23970 4921 3947 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_23970 5424 5074 gene locus_tag LOCUS_23980 5424 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 7069 5432 gene locus_tag LOCUS_23990 7069 5432 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626330.1 protein_id gnl|my_center|LOCUS_23990 7579 7097 gene locus_tag LOCUS_24000 7579 7097 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390054.1 protein_id gnl|my_center|LOCUS_24000 7944 8897 gene locus_tag LOCUS_24010 7944 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552141.1 protein_id gnl|my_center|LOCUS_24010 10000 8894 gene locus_tag LOCUS_24020 10000 8894 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729558.1 protein_id gnl|my_center|LOCUS_24020 10090 10437 gene locus_tag LOCUS_24030 10090 10437 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526838.1 protein_id gnl|my_center|LOCUS_24030 11303 10464 gene locus_tag LOCUS_24040 11303 10464 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727359.1 protein_id gnl|my_center|LOCUS_24040 12850 11300 gene locus_tag LOCUS_24050 12850 11300 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966515.1 protein_id gnl|my_center|LOCUS_24050 13417 14730 gene locus_tag LOCUS_24060 gene ablA 13417 14730 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_24060 14746 15729 gene locus_tag LOCUS_24070 14746 15729 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_24070 15726 16736 gene locus_tag LOCUS_24080 15726 16736 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039097.1 protein_id gnl|my_center|LOCUS_24080 16744 17220 gene locus_tag LOCUS_24090 16744 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 17266 17424 gene locus_tag LOCUS_24100 17266 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 17421 18332 gene locus_tag LOCUS_24110 gene nudC 17421 18332 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_24110 18494 19345 gene locus_tag LOCUS_24120 gene pdxY 18494 19345 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_24120 19824 19357 gene locus_tag LOCUS_24130 19824 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 20684 19839 gene locus_tag LOCUS_24140 20684 19839 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_24140 21703 20690 gene locus_tag LOCUS_24150 21703 20690 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537496.1 protein_id gnl|my_center|LOCUS_24150 22797 21700 gene locus_tag LOCUS_24160 22797 21700 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_24160 22955 24439 gene locus_tag LOCUS_24170 22955 24439 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537499.1 protein_id gnl|my_center|LOCUS_24170 24542 25492 gene locus_tag LOCUS_24180 24542 25492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_24180 25492 26310 gene locus_tag LOCUS_24190 25492 26310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384741.1 protein_id gnl|my_center|LOCUS_24190 26307 26756 gene locus_tag LOCUS_24200 26307 26756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 26842 27465 gene locus_tag LOCUS_24210 26842 27465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence062 525 1895 gene locus_tag LOCUS_24220 525 1895 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921555.1 protein_id gnl|my_center|LOCUS_24220 2632 1892 gene locus_tag LOCUS_24230 2632 1892 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968041.1 protein_id gnl|my_center|LOCUS_24230 4535 2655 gene locus_tag LOCUS_24240 gene recQ 4535 2655 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387850.1 protein_id gnl|my_center|LOCUS_24240 4697 5809 gene locus_tag LOCUS_24250 4697 5809 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980451.1 protein_id gnl|my_center|LOCUS_24250 5806 6978 gene locus_tag LOCUS_24260 5806 6978 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_24260 6975 7265 gene locus_tag LOCUS_24270 6975 7265 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_24270 8400 7237 gene locus_tag LOCUS_24280 8400 7237 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337231.1 protein_id gnl|my_center|LOCUS_24280 8477 9700 gene locus_tag LOCUS_24290 8477 9700 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_24290 10235 9681 gene locus_tag LOCUS_24300 10235 9681 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_24300 10984 10238 gene locus_tag LOCUS_24310 10984 10238 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_24310 11065 12090 gene locus_tag LOCUS_24320 11065 12090 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_24320 12098 12721 gene locus_tag LOCUS_24330 12098 12721 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 protein_id gnl|my_center|LOCUS_24330 12718 14043 gene locus_tag LOCUS_24340 12718 14043 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965170.1 protein_id gnl|my_center|LOCUS_24340 14056 16176 gene locus_tag LOCUS_24350 14056 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 17622 16303 gene locus_tag LOCUS_24360 17622 16303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_24360 18328 17642 gene locus_tag LOCUS_24370 18328 17642 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_24370 18455 18910 gene locus_tag LOCUS_24380 18455 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 18973 20241 gene locus_tag LOCUS_24390 18973 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 20832 20248 gene locus_tag LOCUS_24400 20832 20248 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_24400 20843 21736 gene locus_tag LOCUS_24410 20843 21736 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_24410 22154 21720 gene locus_tag LOCUS_24420 22154 21720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171331.1 protein_id gnl|my_center|LOCUS_24420 23740 22283 gene locus_tag LOCUS_24430 gene dnaA 23740 22283 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_24430 24385 24122 gene locus_tag LOCUS_24440 gene rpsT 24385 24122 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533694.1 protein_id gnl|my_center|LOCUS_24440 25253 24477 gene locus_tag LOCUS_24450 25253 24477 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_24450 26119 25289 gene locus_tag LOCUS_24460 gene mutM 26119 25289 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 protein_id gnl|my_center|LOCUS_24460 26165 26902 gene locus_tag LOCUS_24470 gene ubiE 26165 26902 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence063 579 304 gene locus_tag LOCUS_24480 579 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2501 810 gene locus_tag LOCUS_24490 2501 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3095 2523 gene locus_tag LOCUS_24500 3095 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3680 3099 gene locus_tag LOCUS_24510 3680 3099 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_24510 3783 4766 gene locus_tag LOCUS_24520 3783 4766 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 protein_id gnl|my_center|LOCUS_24520 4775 6292 gene locus_tag LOCUS_24530 4775 6292 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_24530 7302 6289 gene locus_tag LOCUS_24540 7302 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 9683 7299 gene locus_tag LOCUS_24550 gene copA1 9683 7299 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_24550 9827 10963 gene locus_tag LOCUS_24560 9827 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 12189 10987 gene locus_tag LOCUS_24570 12189 10987 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174694.1 protein_id gnl|my_center|LOCUS_24570 12334 13482 gene locus_tag LOCUS_24580 12334 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 13551 15767 gene locus_tag LOCUS_24590 gene uvrB 13551 15767 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_24590 17670 15718 gene locus_tag LOCUS_24600 17670 15718 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_24600 18139 17684 gene locus_tag LOCUS_24610 18139 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 19311 18136 gene locus_tag LOCUS_24620 19311 18136 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_24620 19408 19881 gene locus_tag LOCUS_24630 19408 19881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 19887 20657 gene locus_tag LOCUS_24640 19887 20657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_24640 21429 21187 gene locus_tag LOCUS_24650 21429 21187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 21657 23549 gene locus_tag LOCUS_24660 gene uvrC 21657 23549 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_24660 23595 24206 gene locus_tag LOCUS_24670 gene pgsA 23595 24206 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 protein_id gnl|my_center|LOCUS_24670 24209 24706 gene locus_tag LOCUS_24680 gene mobB 24209 24706 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_24680 24708 25958 gene locus_tag LOCUS_24690 24708 25958 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_24690 25960 26211 gene locus_tag LOCUS_24700 gene moaD 25960 26211 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_24700 26216 26698 gene locus_tag LOCUS_24710 gene moaE 26216 26698 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 protein_id gnl|my_center|LOCUS_24710 26740 26815 gene locus_tag LOCUS_t00190 26740 26815 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 256 711 gene locus_tag LOCUS_24720 256 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1650 715 gene locus_tag LOCUS_24730 gene cysK 1650 715 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_24730 1848 2522 gene locus_tag LOCUS_24740 1848 2522 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_24740 2519 2905 gene locus_tag LOCUS_24750 2519 2905 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200901.1 protein_id gnl|my_center|LOCUS_24750 2979 3767 gene locus_tag LOCUS_24760 2979 3767 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_24760 3821 4210 gene locus_tag LOCUS_24770 3821 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895392.1 protein_id gnl|my_center|LOCUS_24770 4304 4828 gene locus_tag LOCUS_24780 4304 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 5095 5619 gene locus_tag LOCUS_24790 5095 5619 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_24790 5616 6206 gene locus_tag LOCUS_24800 5616 6206 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_24800 6609 6217 gene locus_tag LOCUS_24810 6609 6217 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_24810 7046 6627 gene locus_tag LOCUS_24820 7046 6627 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 protein_id gnl|my_center|LOCUS_24820 7899 7054 gene locus_tag LOCUS_24830 7899 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 9018 7942 gene locus_tag LOCUS_24840 9018 7942 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083752.1 protein_id gnl|my_center|LOCUS_24840 9580 9056 gene locus_tag LOCUS_24850 9580 9056 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620296.1 protein_id gnl|my_center|LOCUS_24850 9683 11026 gene locus_tag LOCUS_24860 9683 11026 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 protein_id gnl|my_center|LOCUS_24860 11124 11537 gene locus_tag LOCUS_24870 11124 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 12230 11541 gene locus_tag LOCUS_24880 12230 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 13642 12227 gene locus_tag LOCUS_24890 13642 12227 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_24890 14990 13986 gene locus_tag LOCUS_24900 14990 13986 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329833.1 protein_id gnl|my_center|LOCUS_24900 16081 15101 gene locus_tag LOCUS_24910 16081 15101 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_24910 16996 16109 gene locus_tag LOCUS_24920 16996 16109 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038707.1 protein_id gnl|my_center|LOCUS_24920 17113 18054 gene locus_tag LOCUS_24930 17113 18054 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267733.1 protein_id gnl|my_center|LOCUS_24930 18096 18452 gene locus_tag LOCUS_24940 18096 18452 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_24940 18449 18772 gene locus_tag LOCUS_24950 18449 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 18769 19596 gene locus_tag LOCUS_24960 18769 19596 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388937.1 protein_id gnl|my_center|LOCUS_24960 19737 20387 gene locus_tag LOCUS_24970 19737 20387 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385685.1 protein_id gnl|my_center|LOCUS_24970 20879 20397 gene locus_tag LOCUS_24980 20879 20397 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161534.1 protein_id gnl|my_center|LOCUS_24980 21307 20876 gene locus_tag LOCUS_24990 21307 20876 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970297.1 protein_id gnl|my_center|LOCUS_24990 22804 21485 gene locus_tag LOCUS_25000 gene hemL 22804 21485 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_25000 22919 23356 gene locus_tag LOCUS_25010 22919 23356 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811741.1 protein_id gnl|my_center|LOCUS_25010 23610 24545 gene locus_tag LOCUS_25020 23610 24545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 24542 25483 gene locus_tag LOCUS_25030 24542 25483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 25904 25500 gene locus_tag LOCUS_25040 25904 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103354.1 protein_id gnl|my_center|LOCUS_25040 26626 25901 gene locus_tag LOCUS_25050 26626 25901 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208432.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence065 2018 192 gene locus_tag LOCUS_25060 gene cysC 2018 192 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_25060 2812 2018 gene locus_tag LOCUS_25070 2812 2018 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_25070 3567 2833 gene locus_tag LOCUS_25080 3567 2833 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084297.1 protein_id gnl|my_center|LOCUS_25080 3719 3573 gene locus_tag LOCUS_25090 3719 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 5012 3981 gene locus_tag LOCUS_25100 5012 3981 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 protein_id gnl|my_center|LOCUS_25100 6319 5105 gene locus_tag LOCUS_25110 6319 5105 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385652.1 protein_id gnl|my_center|LOCUS_25110 8616 6394 gene locus_tag LOCUS_25120 gene katG 8616 6394 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965161.1 protein_id gnl|my_center|LOCUS_25120 8923 8666 gene locus_tag LOCUS_25130 8923 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 10483 8957 gene locus_tag LOCUS_25140 10483 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 11817 10492 gene locus_tag LOCUS_25150 11817 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921598.1 protein_id gnl|my_center|LOCUS_25150 11923 13134 gene locus_tag LOCUS_25160 11923 13134 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064658.1 protein_id gnl|my_center|LOCUS_25160 13387 14550 gene locus_tag LOCUS_25170 13387 14550 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_25170 14612 16057 gene locus_tag LOCUS_25180 14612 16057 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_25180 16317 17018 gene locus_tag LOCUS_25190 16317 17018 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809261.1 protein_id gnl|my_center|LOCUS_25190 18638 17034 gene locus_tag LOCUS_25200 18638 17034 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538185.1 protein_id gnl|my_center|LOCUS_25200 18941 20341 gene locus_tag LOCUS_25210 18941 20341 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_25210 21985 20396 gene locus_tag LOCUS_25220 21985 20396 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_25220 22460 22164 gene locus_tag LOCUS_25230 22460 22164 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087690.1 protein_id gnl|my_center|LOCUS_25230 24158 22677 gene locus_tag LOCUS_25240 24158 22677 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 protein_id gnl|my_center|LOCUS_25240 25261 24155 gene locus_tag LOCUS_25250 25261 24155 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088998.1 protein_id gnl|my_center|LOCUS_25250 25715 25251 gene locus_tag LOCUS_25260 25715 25251 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence066 388 828 gene locus_tag LOCUS_25270 gene rpiB 388 828 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_25270 850 2148 gene locus_tag LOCUS_25280 850 2148 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 protein_id gnl|my_center|LOCUS_25280 2173 2631 gene locus_tag LOCUS_25290 gene nrdR 2173 2631 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_25290 2646 3743 gene locus_tag LOCUS_25300 gene ribD 2646 3743 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_25300 3753 4349 gene locus_tag LOCUS_25310 3753 4349 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_25310 4346 5485 gene locus_tag LOCUS_25320 gene ribB 4346 5485 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_25320 5489 5935 gene locus_tag LOCUS_25330 5489 5935 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720942.1 protein_id gnl|my_center|LOCUS_25330 5932 6411 gene locus_tag LOCUS_25340 gene nusB 5932 6411 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919237.1 protein_id gnl|my_center|LOCUS_25340 6417 7373 gene locus_tag LOCUS_25350 gene thiL 6417 7373 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_25350 7379 7822 gene locus_tag LOCUS_25360 7379 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 7819 9018 gene locus_tag LOCUS_25370 7819 9018 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337692.1 protein_id gnl|my_center|LOCUS_25370 9145 11241 gene locus_tag LOCUS_25380 9145 11241 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389571.1 protein_id gnl|my_center|LOCUS_25380 11781 11314 gene locus_tag LOCUS_25390 gene bamE 11781 11314 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389352.1 protein_id gnl|my_center|LOCUS_25390 11899 12429 gene locus_tag LOCUS_25400 11899 12429 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_25400 12439 12945 gene locus_tag LOCUS_25410 12439 12945 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529291.1 protein_id gnl|my_center|LOCUS_25410 13076 13255 gene locus_tag LOCUS_25420 gene rpmF 13076 13255 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_25420 13300 14340 gene locus_tag LOCUS_25430 gene plsX 13300 14340 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_25430 14337 15296 gene locus_tag LOCUS_25440 14337 15296 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_25440 15399 15725 gene locus_tag LOCUS_25450 15399 15725 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_25450 15757 16221 gene locus_tag LOCUS_25460 15757 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 16307 17893 gene locus_tag LOCUS_25470 16307 17893 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538185.1 protein_id gnl|my_center|LOCUS_25470 18862 17912 gene locus_tag LOCUS_25480 18862 17912 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_25480 19745 18867 gene locus_tag LOCUS_25490 19745 18867 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970499.1 protein_id gnl|my_center|LOCUS_25490 20802 19804 gene locus_tag LOCUS_25500 20802 19804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968089.1 protein_id gnl|my_center|LOCUS_25500 21686 20799 gene locus_tag LOCUS_25510 21686 20799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315087.1 protein_id gnl|my_center|LOCUS_25510 22672 21686 gene locus_tag LOCUS_25520 22672 21686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970496.1 protein_id gnl|my_center|LOCUS_25520 24298 22724 gene locus_tag LOCUS_25530 24298 22724 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973044.1 protein_id gnl|my_center|LOCUS_25530 24829 25080 gene locus_tag LOCUS_25540 24829 25080 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084786.1 protein_id gnl|my_center|LOCUS_25540 25080 26378 gene locus_tag LOCUS_25550 25080 26378 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084785.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence067 812 141 gene locus_tag LOCUS_25560 812 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 983 1762 gene locus_tag LOCUS_25570 983 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1765 2676 gene locus_tag LOCUS_25580 1765 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2989 4218 gene locus_tag LOCUS_25590 2989 4218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383282.1 protein_id gnl|my_center|LOCUS_25590 4280 4801 gene locus_tag LOCUS_25600 4280 4801 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 protein_id gnl|my_center|LOCUS_25600 4870 7521 gene locus_tag LOCUS_25610 4870 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 7616 8803 gene locus_tag LOCUS_25620 7616 8803 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_25620 9021 9353 gene locus_tag LOCUS_25630 9021 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 9363 12176 gene locus_tag LOCUS_25640 9363 12176 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967710.1 protein_id gnl|my_center|LOCUS_25640 12206 12838 gene locus_tag LOCUS_25650 12206 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966599.1 protein_id gnl|my_center|LOCUS_25650 12849 14984 gene locus_tag LOCUS_25660 12849 14984 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085126.1 protein_id gnl|my_center|LOCUS_25660 15061 16008 gene locus_tag LOCUS_25670 15061 16008 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 protein_id gnl|my_center|LOCUS_25670 16012 17808 gene locus_tag LOCUS_25680 16012 17808 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538184.1 protein_id gnl|my_center|LOCUS_25680 18612 17815 gene locus_tag LOCUS_25690 18612 17815 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_25690 18783 19670 gene locus_tag LOCUS_25700 18783 19670 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173962.1 protein_id gnl|my_center|LOCUS_25700 20779 19667 gene locus_tag LOCUS_25710 20779 19667 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_25710 21769 20789 gene locus_tag LOCUS_25720 21769 20789 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_25720 22659 21766 gene locus_tag LOCUS_25730 22659 21766 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_25730 23596 22652 gene locus_tag LOCUS_25740 23596 22652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_25740 25228 23678 gene locus_tag LOCUS_25750 25228 23678 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_25750 26290 25298 gene locus_tag LOCUS_25760 26290 25298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence068 180 1145 gene locus_tag LOCUS_25770 180 1145 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_25770 1532 1206 gene locus_tag LOCUS_25780 1532 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1869 1594 gene locus_tag LOCUS_25790 1869 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2193 2648 gene locus_tag LOCUS_25800 gene tsaE 2193 2648 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_25800 2645 5563 gene locus_tag LOCUS_25810 gene addB 2645 5563 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_25810 5676 9080 gene locus_tag LOCUS_25820 gene addA 5676 9080 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_25820 9092 9448 gene locus_tag LOCUS_25830 9092 9448 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_25830 9530 9754 gene locus_tag LOCUS_25840 gene rpmE 9530 9754 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003506183.1 protein_id gnl|my_center|LOCUS_25840 10193 9810 gene locus_tag LOCUS_25850 10193 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 10679 10245 gene locus_tag LOCUS_25860 10679 10245 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_25860 11479 10679 gene locus_tag LOCUS_25870 11479 10679 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_25870 12771 11479 gene locus_tag LOCUS_25880 12771 11479 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_25880 12991 15003 gene locus_tag LOCUS_25890 12991 15003 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_25890 15009 15803 gene locus_tag LOCUS_25900 15009 15803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_25900 15805 16701 gene locus_tag LOCUS_25910 15805 16701 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_25910 16848 17912 gene locus_tag LOCUS_25920 16848 17912 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_25920 18003 19334 gene locus_tag LOCUS_25930 18003 19334 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_25930 19342 20154 gene locus_tag LOCUS_25940 19342 20154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_25940 20162 21394 gene locus_tag LOCUS_25950 20162 21394 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_25950 21428 22282 gene locus_tag LOCUS_25960 21428 22282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 22678 23166 gene locus_tag LOCUS_25970 22678 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25970 24083 23163 gene locus_tag LOCUS_25980 24083 23163 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_25980 24149 25765 gene locus_tag LOCUS_25990 24149 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 25856 26296 gene locus_tag LOCUS_26000 25856 26296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence069 1584 913 gene locus_tag LOCUS_26010 1584 913 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_26010 1674 2234 gene locus_tag LOCUS_26020 1674 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2280 2765 gene locus_tag LOCUS_26030 gene secB 2280 2765 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_26030 3077 2790 gene locus_tag LOCUS_26040 3077 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3830 3159 gene locus_tag LOCUS_26050 gene dnaQ 3830 3159 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_26050 4431 3790 gene locus_tag LOCUS_26060 gene coaE 4431 3790 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528726.1 protein_id gnl|my_center|LOCUS_26060 4584 5024 gene locus_tag LOCUS_26070 4584 5024 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229412.1 protein_id gnl|my_center|LOCUS_26070 5027 5722 gene locus_tag LOCUS_26080 5027 5722 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_26080 6203 5715 gene locus_tag LOCUS_26090 6203 5715 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086924.1 protein_id gnl|my_center|LOCUS_26090 6507 6259 gene locus_tag LOCUS_26100 6507 6259 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909602.1 protein_id gnl|my_center|LOCUS_26100 7103 6510 gene locus_tag LOCUS_26110 7103 6510 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391361.1 protein_id gnl|my_center|LOCUS_26110 7915 7100 gene locus_tag LOCUS_26120 7915 7100 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_26120 8280 9296 gene locus_tag LOCUS_26130 gene hemE 8280 9296 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_26130 9293 10303 gene locus_tag LOCUS_26140 gene hemH 9293 10303 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921589.1 protein_id gnl|my_center|LOCUS_26140 10300 10746 gene locus_tag LOCUS_26150 gene hemJ 10300 10746 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_26150 10978 12375 gene locus_tag LOCUS_26160 gene rho 10978 12375 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_26160 12984 12448 gene locus_tag LOCUS_26170 12984 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 14522 13104 gene locus_tag LOCUS_26180 gene pyk 14522 13104 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_26180 14635 15471 gene locus_tag LOCUS_26190 14635 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 15514 16347 gene locus_tag LOCUS_26200 gene cobA 15514 16347 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 protein_id gnl|my_center|LOCUS_26200 16511 17098 gene locus_tag LOCUS_26210 16511 17098 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_26210 17106 18419 gene locus_tag LOCUS_26220 17106 18419 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_26220 18440 18874 gene locus_tag LOCUS_26230 18440 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 19047 20174 gene locus_tag LOCUS_26240 19047 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 20324 23656 gene locus_tag LOCUS_26250 20324 23656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 24864 23653 gene locus_tag LOCUS_26260 24864 23653 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_26260 25390 25055 gene locus_tag LOCUS_26270 25390 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence070 1577 672 gene locus_tag LOCUS_26280 1577 672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040797.1 protein_id gnl|my_center|LOCUS_26280 2551 1574 gene locus_tag LOCUS_26290 2551 1574 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040798.1 protein_id gnl|my_center|LOCUS_26290 4222 2648 gene locus_tag LOCUS_26300 4222 2648 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816050.1 protein_id gnl|my_center|LOCUS_26300 4325 5539 gene locus_tag LOCUS_26310 4325 5539 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172745.1 protein_id gnl|my_center|LOCUS_26310 5606 6556 gene locus_tag LOCUS_26320 5606 6556 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 protein_id gnl|my_center|LOCUS_26320 6574 7644 gene locus_tag LOCUS_26330 6574 7644 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_26330 7697 9175 gene locus_tag LOCUS_26340 7697 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 9175 9477 gene locus_tag LOCUS_26350 9175 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 9604 9996 gene locus_tag LOCUS_26360 9604 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088530.1 protein_id gnl|my_center|LOCUS_26360 10096 12321 gene locus_tag LOCUS_26370 10096 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921545.1 protein_id gnl|my_center|LOCUS_26370 12435 14378 gene locus_tag LOCUS_26380 12435 14378 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921376.1 protein_id gnl|my_center|LOCUS_26380 15340 14375 gene locus_tag LOCUS_26390 15340 14375 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 protein_id gnl|my_center|LOCUS_26390 15444 16409 gene locus_tag LOCUS_26400 15444 16409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 17206 16406 gene locus_tag LOCUS_26410 17206 16406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973997.1 protein_id gnl|my_center|LOCUS_26410 17940 17206 gene locus_tag LOCUS_26420 17940 17206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973996.1 protein_id gnl|my_center|LOCUS_26420 18583 18059 gene locus_tag LOCUS_26430 18583 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 18622 20304 gene locus_tag LOCUS_26440 18622 20304 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086735.1 protein_id gnl|my_center|LOCUS_26440 21116 20313 gene locus_tag LOCUS_26450 21116 20313 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_26450 22041 21094 gene locus_tag LOCUS_26460 22041 21094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_26460 22835 22038 gene locus_tag LOCUS_26470 22835 22038 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_26470 23692 22832 gene locus_tag LOCUS_26480 23692 22832 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071491.1 protein_id gnl|my_center|LOCUS_26480 24759 23692 gene locus_tag LOCUS_26490 24759 23692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_26490 25848 24760 gene locus_tag LOCUS_26500 25848 24760 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 protein_id gnl|my_center|LOCUS_26500 <26349 25845 gene locus_tag LOCUS_26510 <26349 25845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704256.1:alanine dehydrogenase >Feature sequence071 896 435 gene locus_tag LOCUS_26520 896 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 1124 3739 gene locus_tag LOCUS_26530 1124 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3976 3746 gene locus_tag LOCUS_26540 3976 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 protein_id gnl|my_center|LOCUS_26540 6454 4031 gene locus_tag LOCUS_26550 gene ligD 6454 4031 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528647.1 protein_id gnl|my_center|LOCUS_26550 6580 7446 gene locus_tag LOCUS_26560 6580 7446 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_26560 7504 9519 gene locus_tag LOCUS_26570 7504 9519 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275308.1 protein_id gnl|my_center|LOCUS_26570 11393 9528 gene locus_tag LOCUS_26580 11393 9528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109184.1 protein_id gnl|my_center|LOCUS_26580 11590 13149 gene locus_tag LOCUS_26590 11590 13149 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_26590 14767 13175 gene locus_tag LOCUS_26600 14767 13175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_26600 14977 16473 gene locus_tag LOCUS_26610 14977 16473 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_26610 17639 16470 gene locus_tag LOCUS_26620 17639 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 17772 18518 gene locus_tag LOCUS_26630 17772 18518 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_26630 19384 18515 gene locus_tag LOCUS_26640 19384 18515 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_26640 19747 19418 gene locus_tag LOCUS_26650 19747 19418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 19870 20049 gene locus_tag LOCUS_26660 19870 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 21376 20111 gene locus_tag LOCUS_26670 21376 20111 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_26670 21351 22403 gene locus_tag LOCUS_26680 21351 22403 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_26680 22803 22405 gene locus_tag LOCUS_26690 22803 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 23256 24251 gene locus_tag LOCUS_26700 23256 24251 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 protein_id gnl|my_center|LOCUS_26700 25439 24432 gene locus_tag LOCUS_26710 25439 24432 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808542.1 protein_id gnl|my_center|LOCUS_26710 25875 25462 gene locus_tag LOCUS_26720 25875 25462 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence072 875 255 gene locus_tag LOCUS_26730 875 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2433 889 gene locus_tag LOCUS_26740 2433 889 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_26740 3505 2624 gene locus_tag LOCUS_26750 3505 2624 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_26750 4498 3530 gene locus_tag LOCUS_26760 gene trxB 4498 3530 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_26760 4586 5152 gene locus_tag LOCUS_26770 4586 5152 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530142.1 protein_id gnl|my_center|LOCUS_26770 5873 5145 gene locus_tag LOCUS_26780 5873 5145 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176257.1 protein_id gnl|my_center|LOCUS_26780 7778 5874 gene locus_tag LOCUS_26790 7778 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 8796 7786 gene locus_tag LOCUS_26800 8796 7786 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_26800 8858 9346 gene locus_tag LOCUS_26810 8858 9346 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_26810 9430 11337 gene locus_tag LOCUS_26820 9430 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 11371 13548 gene locus_tag LOCUS_26830 11371 13548 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_26830 14455 13538 gene locus_tag LOCUS_26840 14455 13538 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832944.1 protein_id gnl|my_center|LOCUS_26840 15456 14452 gene locus_tag LOCUS_26850 15456 14452 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198035.1 protein_id gnl|my_center|LOCUS_26850 16706 15492 gene locus_tag LOCUS_26860 16706 15492 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113883.1 protein_id gnl|my_center|LOCUS_26860 17460 16726 gene locus_tag LOCUS_26870 17460 16726 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 protein_id gnl|my_center|LOCUS_26870 18284 17457 gene locus_tag LOCUS_26880 18284 17457 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_26880 18364 19560 gene locus_tag LOCUS_26890 18364 19560 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_26890 20457 19564 gene locus_tag LOCUS_26900 20457 19564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 20813 20421 gene locus_tag LOCUS_26910 20813 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 20694 22298 gene locus_tag LOCUS_26920 20694 22298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 23414 22299 gene locus_tag LOCUS_26930 23414 22299 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940269.1 protein_id gnl|my_center|LOCUS_26930 24517 23417 gene locus_tag LOCUS_26940 gene pseC 24517 23417 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_26940 25233 24514 gene locus_tag LOCUS_26950 25233 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 25220 25480 gene locus_tag LOCUS_26960 25220 25480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 25583 25723 gene locus_tag LOCUS_26970 25583 25723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence073 329 1792 gene locus_tag LOCUS_26980 329 1792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_26980 1972 2883 gene locus_tag LOCUS_26990 1972 2883 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532537.1 protein_id gnl|my_center|LOCUS_26990 2916 3623 gene locus_tag LOCUS_27000 2916 3623 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015930683.1 protein_id gnl|my_center|LOCUS_27000 3653 5479 gene locus_tag LOCUS_27010 gene ggt 3653 5479 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_27010 5503 6687 gene locus_tag LOCUS_27020 5503 6687 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_27020 7755 6733 gene locus_tag LOCUS_27030 7755 6733 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530437.1 protein_id gnl|my_center|LOCUS_27030 8137 7874 gene locus_tag LOCUS_27040 8137 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 8307 9170 gene locus_tag LOCUS_27050 8307 9170 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553463.1 protein_id gnl|my_center|LOCUS_27050 9201 9920 gene locus_tag LOCUS_27060 9201 9920 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524255.1 protein_id gnl|my_center|LOCUS_27060 9966 10904 gene locus_tag LOCUS_27070 9966 10904 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_27070 10961 11698 gene locus_tag LOCUS_27080 10961 11698 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577311.1 protein_id gnl|my_center|LOCUS_27080 11837 13117 gene locus_tag LOCUS_27090 11837 13117 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975207.1 protein_id gnl|my_center|LOCUS_27090 13194 14063 gene locus_tag LOCUS_27100 13194 14063 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083320.1 protein_id gnl|my_center|LOCUS_27100 14056 14886 gene locus_tag LOCUS_27110 14056 14886 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_27110 15047 15565 gene locus_tag LOCUS_27120 15047 15565 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_27120 16202 15501 gene locus_tag LOCUS_27130 16202 15501 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199157.1 protein_id gnl|my_center|LOCUS_27130 16299 17876 gene locus_tag LOCUS_27140 16299 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 17880 18176 gene locus_tag LOCUS_27150 17880 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 18173 18628 gene locus_tag LOCUS_27160 18173 18628 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_27160 18666 19796 gene locus_tag LOCUS_27170 18666 19796 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807744.1 protein_id gnl|my_center|LOCUS_27170 20315 19854 gene locus_tag LOCUS_27180 20315 19854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 21823 20582 gene locus_tag LOCUS_27190 21823 20582 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_27190 21861 23009 gene locus_tag LOCUS_27200 21861 23009 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727468.1 protein_id gnl|my_center|LOCUS_27200 24208 23090 gene locus_tag LOCUS_27210 24208 23090 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_27210 24378 24554 gene locus_tag LOCUS_27220 24378 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 24751 24620 gene locus_tag LOCUS_27230 24751 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 25484 24771 gene locus_tag LOCUS_27240 25484 24771 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence074 1624 761 gene locus_tag LOCUS_27250 1624 761 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 protein_id gnl|my_center|LOCUS_27250 2482 1649 gene locus_tag LOCUS_27260 gene fghA 2482 1649 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815759.1 protein_id gnl|my_center|LOCUS_27260 3591 2482 gene locus_tag LOCUS_27270 3591 2482 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_27270 3732 3890 gene locus_tag LOCUS_27280 3732 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 4087 5934 gene locus_tag LOCUS_27290 4087 5934 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_27290 5957 7186 gene locus_tag LOCUS_27300 5957 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 7203 8288 gene locus_tag LOCUS_27310 7203 8288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975068.1 protein_id gnl|my_center|LOCUS_27310 8896 8285 gene locus_tag LOCUS_27320 8896 8285 CDS product dual specificity protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969598.1 protein_id gnl|my_center|LOCUS_27320 8990 9889 gene locus_tag LOCUS_27330 8990 9889 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536328.1 protein_id gnl|my_center|LOCUS_27330 9886 10584 gene locus_tag LOCUS_27340 9886 10584 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970788.1 protein_id gnl|my_center|LOCUS_27340 10588 11907 gene locus_tag LOCUS_27350 10588 11907 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010914750.1 protein_id gnl|my_center|LOCUS_27350 11928 13226 gene locus_tag LOCUS_27360 gene glnT 11928 13226 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_27360 13226 13870 gene locus_tag LOCUS_27370 13226 13870 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532893.1 protein_id gnl|my_center|LOCUS_27370 14517 13852 gene locus_tag LOCUS_27380 14517 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 14974 14519 gene locus_tag LOCUS_27390 14974 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 14891 15208 gene locus_tag LOCUS_27400 14891 15208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 15223 15504 gene locus_tag LOCUS_27410 15223 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 15654 16394 gene locus_tag LOCUS_27420 15654 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 16387 17157 gene locus_tag LOCUS_27430 16387 17157 CDS product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508790.1 protein_id gnl|my_center|LOCUS_27430 17154 17612 gene locus_tag LOCUS_27440 17154 17612 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508791.1 protein_id gnl|my_center|LOCUS_27440 18141 17668 gene locus_tag LOCUS_27450 18141 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 18131 18334 gene locus_tag LOCUS_27460 18131 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 19377 18337 gene locus_tag LOCUS_27470 19377 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 19639 20856 gene locus_tag LOCUS_27480 19639 20856 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_27480 20856 21875 gene locus_tag LOCUS_27490 20856 21875 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_27490 22684 21872 gene locus_tag LOCUS_27500 22684 21872 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170303643.1 protein_id gnl|my_center|LOCUS_27500 23129 22788 gene locus_tag LOCUS_27510 23129 22788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 23421 23095 gene locus_tag LOCUS_27520 23421 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 23611 24603 gene locus_tag LOCUS_27530 gene galU 23611 24603 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_27530 25115 24600 gene locus_tag LOCUS_27540 25115 24600 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971658.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence075 2037 718 gene locus_tag LOCUS_27550 gene ccmI 2037 718 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387793.1 protein_id gnl|my_center|LOCUS_27550 2495 2034 gene locus_tag LOCUS_27560 2495 2034 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992253.1 protein_id gnl|my_center|LOCUS_27560 3013 2492 gene locus_tag LOCUS_27570 3013 2492 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_27570 5002 3014 gene locus_tag LOCUS_27580 5002 3014 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_27580 5421 4978 gene locus_tag LOCUS_27590 gene ccmE 5421 4978 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_27590 5573 5418 gene locus_tag LOCUS_27600 5573 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 6307 5576 gene locus_tag LOCUS_27610 6307 5576 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_27610 6991 6326 gene locus_tag LOCUS_27620 gene ccmB 6991 6326 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387800.1 protein_id gnl|my_center|LOCUS_27620 7395 6988 gene locus_tag LOCUS_27630 7395 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 7345 7659 gene locus_tag LOCUS_27640 7345 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 9058 7757 gene locus_tag LOCUS_27650 9058 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 10752 9058 gene locus_tag LOCUS_27660 10752 9058 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_27660 10880 11716 gene locus_tag LOCUS_27670 gene dapD 10880 11716 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_27670 11716 12858 gene locus_tag LOCUS_27680 gene dapE 11716 12858 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 protein_id gnl|my_center|LOCUS_27680 12858 13421 gene locus_tag LOCUS_27690 12858 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 14608 13406 gene locus_tag LOCUS_27700 14608 13406 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_27700 15341 14595 gene locus_tag LOCUS_27710 gene truA 15341 14595 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528473.1 protein_id gnl|my_center|LOCUS_27710 16248 15346 gene locus_tag LOCUS_27720 gene fmt 16248 15346 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252646.1 protein_id gnl|my_center|LOCUS_27720 16799 16281 gene locus_tag LOCUS_27730 gene def 16799 16281 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_27730 16883 17968 gene locus_tag LOCUS_27740 16883 17968 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_27740 17992 18948 gene locus_tag LOCUS_27750 17992 18948 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_27750 18945 19502 gene locus_tag LOCUS_27760 18945 19502 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888592.1 protein_id gnl|my_center|LOCUS_27760 19591 20532 gene locus_tag LOCUS_27770 19591 20532 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256048.1 protein_id gnl|my_center|LOCUS_27770 20539 21312 gene locus_tag LOCUS_27780 20539 21312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088987.1 protein_id gnl|my_center|LOCUS_27780 21309 22085 gene locus_tag LOCUS_27790 21309 22085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531158.1 protein_id gnl|my_center|LOCUS_27790 22286 22211 gene locus_tag LOCUS_t00200 22286 22211 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23046 22327 gene locus_tag LOCUS_27800 23046 22327 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105024.1 protein_id gnl|my_center|LOCUS_27800 23175 24083 gene locus_tag LOCUS_27810 23175 24083 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_27810 24080 24502 gene locus_tag LOCUS_27820 24080 24502 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328107.1 protein_id gnl|my_center|LOCUS_27820 24965 24516 gene locus_tag LOCUS_27830 24965 24516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence076 430 1356 gene locus_tag LOCUS_27840 430 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2097 1375 gene locus_tag LOCUS_27850 2097 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2278 3081 gene locus_tag LOCUS_27860 2278 3081 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393449.1 protein_id gnl|my_center|LOCUS_27860 3606 3740 gene locus_tag LOCUS_27870 3606 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 3958 4290 gene locus_tag LOCUS_27880 3958 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27880 5563 4295 gene locus_tag LOCUS_27890 5563 4295 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969160.1 protein_id gnl|my_center|LOCUS_27890 6495 5560 gene locus_tag LOCUS_27900 6495 5560 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_27900 6573 6938 gene locus_tag LOCUS_27910 6573 6938 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531932.1 protein_id gnl|my_center|LOCUS_27910 6949 8406 gene locus_tag LOCUS_27920 6949 8406 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_27920 8566 8399 gene locus_tag LOCUS_27930 gene rpmG 8566 8399 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390953.1 protein_id gnl|my_center|LOCUS_27930 9186 8638 gene locus_tag LOCUS_27940 9186 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 9868 9248 gene locus_tag LOCUS_27950 9868 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 11536 9974 gene locus_tag LOCUS_27960 11536 9974 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_27960 11695 12273 gene locus_tag LOCUS_27970 11695 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 12270 12833 gene locus_tag LOCUS_27980 12270 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 14988 12778 gene locus_tag LOCUS_27990 gene rnr 14988 12778 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 protein_id gnl|my_center|LOCUS_27990 15800 15003 gene locus_tag LOCUS_28000 15800 15003 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_28000 18465 15835 gene locus_tag LOCUS_28010 gene topA 18465 15835 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_28010 19615 18494 gene locus_tag LOCUS_28020 gene dprA 19615 18494 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_28020 20325 19669 gene locus_tag LOCUS_28030 gene plsY 20325 19669 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_28030 21649 20357 gene locus_tag LOCUS_28040 gene pyrC 21649 20357 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_28040 22605 21646 gene locus_tag LOCUS_28050 22605 21646 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_28050 24127 23048 gene locus_tag LOCUS_28060 24127 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence077 1991 204 gene locus_tag LOCUS_28070 1991 204 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_28070 3430 1994 gene locus_tag LOCUS_28080 3430 1994 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968876.1 protein_id gnl|my_center|LOCUS_28080 4656 3427 gene locus_tag LOCUS_28090 4656 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 5594 4653 gene locus_tag LOCUS_28100 5594 4653 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_28100 5664 6305 gene locus_tag LOCUS_28110 gene parA 5664 6305 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_28110 7047 6280 gene locus_tag LOCUS_28120 gene cysQ 7047 6280 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_28120 9385 7049 gene locus_tag LOCUS_28130 9385 7049 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_28130 9889 9455 gene locus_tag LOCUS_28140 9889 9455 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806935.1 protein_id gnl|my_center|LOCUS_28140 9995 10624 gene locus_tag LOCUS_28150 9995 10624 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_28150 11085 10621 gene locus_tag LOCUS_28160 11085 10621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_28160 11846 11082 gene locus_tag LOCUS_28170 11846 11082 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391126.1 protein_id gnl|my_center|LOCUS_28170 11845 12705 gene locus_tag LOCUS_28180 11845 12705 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626584.1 protein_id gnl|my_center|LOCUS_28180 13433 12669 gene locus_tag LOCUS_28190 13433 12669 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_28190 13473 14630 gene locus_tag LOCUS_28200 13473 14630 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_28200 14627 15547 gene locus_tag LOCUS_28210 14627 15547 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_28210 15723 17642 gene locus_tag LOCUS_28220 gene thrS 15723 17642 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_28220 17785 18219 gene locus_tag LOCUS_28230 gene infC 17785 18219 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_28230 18429 18629 gene locus_tag LOCUS_28240 18429 18629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 18719 20830 gene locus_tag LOCUS_28250 18719 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 20880 21353 gene locus_tag LOCUS_28260 20880 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 21441 23660 gene locus_tag LOCUS_28270 21441 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence078 2479 1064 gene locus_tag LOCUS_28280 2479 1064 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522157.1 protein_id gnl|my_center|LOCUS_28280 2478 3344 gene locus_tag LOCUS_28290 2478 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 3856 3341 gene locus_tag LOCUS_28300 3856 3341 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094773.1 protein_id gnl|my_center|LOCUS_28300 4797 3856 gene locus_tag LOCUS_28310 4797 3856 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_28310 4972 5904 gene locus_tag LOCUS_28320 4972 5904 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533012.1 protein_id gnl|my_center|LOCUS_28320 6686 6033 gene locus_tag LOCUS_28330 6686 6033 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085290.1 protein_id gnl|my_center|LOCUS_28330 6790 7191 gene locus_tag LOCUS_28340 6790 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 8315 7392 gene locus_tag LOCUS_28350 gene ilvE 8315 7392 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_28350 9061 8342 gene locus_tag LOCUS_28360 9061 8342 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172389.1 protein_id gnl|my_center|LOCUS_28360 9140 9568 gene locus_tag LOCUS_28370 9140 9568 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_28370 9895 10938 gene locus_tag LOCUS_28380 9895 10938 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_28380 10976 11992 gene locus_tag LOCUS_28390 10976 11992 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551979.1 protein_id gnl|my_center|LOCUS_28390 12733 12014 gene locus_tag LOCUS_28400 12733 12014 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085427.1 protein_id gnl|my_center|LOCUS_28400 13183 12743 gene locus_tag LOCUS_28410 13183 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 14948 13263 gene locus_tag LOCUS_28420 14948 13263 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 protein_id gnl|my_center|LOCUS_28420 15124 16059 gene locus_tag LOCUS_28430 15124 16059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_28430 16073 16804 gene locus_tag LOCUS_28440 16073 16804 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_28440 16808 18778 gene locus_tag LOCUS_28450 16808 18778 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_28450 18790 19905 gene locus_tag LOCUS_28460 18790 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 20067 20948 gene locus_tag LOCUS_28470 gene speB 20067 20948 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_28470 21210 22436 gene locus_tag LOCUS_28480 21210 22436 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_28480 23174 22563 gene locus_tag LOCUS_28490 23174 22563 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975294.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence079 1735 716 gene locus_tag LOCUS_28500 gene ilvC 1735 716 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 protein_id gnl|my_center|LOCUS_28500 2285 1779 gene locus_tag LOCUS_28510 gene ilvN 2285 1779 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_28510 4124 2340 gene locus_tag LOCUS_28520 4124 2340 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_28520 5123 4176 gene locus_tag LOCUS_28530 gene miaA 5123 4176 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 protein_id gnl|my_center|LOCUS_28530 5152 6027 gene locus_tag LOCUS_28540 gene serB 5152 6027 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_28540 7118 6024 gene locus_tag LOCUS_28550 7118 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 8244 7129 gene locus_tag LOCUS_28560 8244 7129 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_28560 10106 8244 gene locus_tag LOCUS_28570 10106 8244 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_28570 11119 10175 gene locus_tag LOCUS_28580 11119 10175 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_28580 11681 11151 gene locus_tag LOCUS_28590 11681 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 12493 11729 gene locus_tag LOCUS_28600 gene hpaI 12493 11729 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999571.1 protein_id gnl|my_center|LOCUS_28600 14235 12493 gene locus_tag LOCUS_28610 gene araD 14235 12493 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064099.1 protein_id gnl|my_center|LOCUS_28610 15229 14351 gene locus_tag LOCUS_28620 15229 14351 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807688.1 protein_id gnl|my_center|LOCUS_28620 15916 15254 gene locus_tag LOCUS_28630 15916 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 16076 16696 gene locus_tag LOCUS_28640 16076 16696 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_28640 16712 17956 gene locus_tag LOCUS_28650 16712 17956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_28650 18026 19093 gene locus_tag LOCUS_28660 18026 19093 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_28660 19121 22288 gene locus_tag LOCUS_28670 19121 22288 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_28670 22310 22654 gene locus_tag LOCUS_28680 22310 22654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence080 864 769 gene locus_tag LOCUS_t00210 864 769 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2796 874 gene locus_tag LOCUS_28690 gene selB 2796 874 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967006.1 protein_id gnl|my_center|LOCUS_28690 4187 2793 gene locus_tag LOCUS_28700 gene selA 4187 2793 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187099.1 protein_id gnl|my_center|LOCUS_28700 5117 4200 gene locus_tag LOCUS_28710 gene fdhE 5117 4200 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551971.1 protein_id gnl|my_center|LOCUS_28710 5754 5107 gene locus_tag LOCUS_28720 5754 5107 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967002.1 protein_id gnl|my_center|LOCUS_28720 6647 5751 gene locus_tag LOCUS_28730 gene fdxH 6647 5751 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 protein_id gnl|my_center|LOCUS_28730 9731 6660 gene locus_tag LOCUS_28740 gene fdnG 9731 6660 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895684.1 transl_except (pos:complement(9141..9143),aa:Sec) note codon on position 197 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_28740 11034 9958 gene locus_tag LOCUS_28750 11034 9958 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_28750 11106 11459 gene locus_tag LOCUS_28760 11106 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 11462 11905 gene locus_tag LOCUS_28770 11462 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 13985 11919 gene locus_tag LOCUS_28780 13985 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 15071 14148 gene locus_tag LOCUS_28790 15071 14148 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086817.1 protein_id gnl|my_center|LOCUS_28790 15952 15068 gene locus_tag LOCUS_28800 15952 15068 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_28800 17215 16007 gene locus_tag LOCUS_28810 17215 16007 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086815.1 protein_id gnl|my_center|LOCUS_28810 17954 17250 gene locus_tag LOCUS_28820 17954 17250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_28820 18702 17947 gene locus_tag LOCUS_28830 18702 17947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086813.1 protein_id gnl|my_center|LOCUS_28830 20815 18794 gene locus_tag LOCUS_28840 20815 18794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_28840 21681 20812 gene locus_tag LOCUS_28850 21681 20812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527924.1 protein_id gnl|my_center|LOCUS_28850 22704 21682 gene locus_tag LOCUS_28860 22704 21682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence081 247 1128 gene locus_tag LOCUS_28870 247 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 783 696 gene locus_tag LOCUS_t00220 783 696 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1290 2438 gene locus_tag LOCUS_28880 1290 2438 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969663.1 protein_id gnl|my_center|LOCUS_28880 2527 3207 gene locus_tag LOCUS_28890 2527 3207 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397179.1 protein_id gnl|my_center|LOCUS_28890 3204 5180 gene locus_tag LOCUS_28900 3204 5180 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976072.1 protein_id gnl|my_center|LOCUS_28900 6365 5184 gene locus_tag LOCUS_28910 6365 5184 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 protein_id gnl|my_center|LOCUS_28910 7223 6372 gene locus_tag LOCUS_28920 7223 6372 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_28920 7353 8111 gene locus_tag LOCUS_28930 7353 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 8246 9406 gene locus_tag LOCUS_28940 8246 9406 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063758.1 protein_id gnl|my_center|LOCUS_28940 9421 10587 gene locus_tag LOCUS_28950 9421 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 10584 11288 gene locus_tag LOCUS_28960 10584 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 12040 11285 gene locus_tag LOCUS_28970 12040 11285 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992233.1 protein_id gnl|my_center|LOCUS_28970 12376 12041 gene locus_tag LOCUS_28980 gene yciA 12376 12041 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299258.1 protein_id gnl|my_center|LOCUS_28980 12478 14457 gene locus_tag LOCUS_28990 gene parE 12478 14457 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_28990 14454 15854 gene locus_tag LOCUS_29000 14454 15854 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_29000 16664 15855 gene locus_tag LOCUS_29010 16664 15855 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265631.1 protein_id gnl|my_center|LOCUS_29010 16992 16657 gene locus_tag LOCUS_29020 16992 16657 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619585.1 protein_id gnl|my_center|LOCUS_29020 18358 16994 gene locus_tag LOCUS_29030 gene der 18358 16994 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_29030 19702 18368 gene locus_tag LOCUS_29040 gene bamB 19702 18368 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356919.1 protein_id gnl|my_center|LOCUS_29040 20357 19716 gene locus_tag LOCUS_29050 20357 19716 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390834.1 protein_id gnl|my_center|LOCUS_29050 20603 20935 gene locus_tag LOCUS_29060 20603 20935 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390836.1 protein_id gnl|my_center|LOCUS_29060 <22577 21185 gene locus_tag LOCUS_29070 <22577 21185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931332.1:ABC transporter substrate-binding protein >Feature sequence082 1586 378 gene locus_tag LOCUS_29080 1586 378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970398.1 protein_id gnl|my_center|LOCUS_29080 1656 2633 gene locus_tag LOCUS_29090 1656 2633 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067686.1 protein_id gnl|my_center|LOCUS_29090 2630 4600 gene locus_tag LOCUS_29100 2630 4600 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_29100 5226 4597 gene locus_tag LOCUS_29110 gene rhtC 5226 4597 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928824.1 protein_id gnl|my_center|LOCUS_29110 5332 5511 gene locus_tag LOCUS_29120 5332 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 7244 5508 gene locus_tag LOCUS_29130 7244 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 7726 7340 gene locus_tag LOCUS_29140 7726 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 7994 7758 gene locus_tag LOCUS_29150 7994 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 9059 8091 gene locus_tag LOCUS_29160 9059 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 9313 9239 gene locus_tag LOCUS_t00230 9313 9239 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9923 9435 gene locus_tag LOCUS_29170 9923 9435 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_29170 11052 9934 gene locus_tag LOCUS_29180 gene mnmA 11052 9934 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_29180 11261 11055 gene locus_tag LOCUS_29190 gene iscX 11261 11055 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_29190 11599 11264 gene locus_tag LOCUS_29200 11599 11264 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_29200 13540 11621 gene locus_tag LOCUS_29210 gene hscA 13540 11621 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926439.1 protein_id gnl|my_center|LOCUS_29210 14160 13537 gene locus_tag LOCUS_29220 gene hscB 14160 13537 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092824.1 protein_id gnl|my_center|LOCUS_29220 14522 14130 gene locus_tag LOCUS_29230 14522 14130 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597725.1 protein_id gnl|my_center|LOCUS_29230 14939 14538 gene locus_tag LOCUS_29240 gene iscU 14939 14538 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_29240 16236 14959 gene locus_tag LOCUS_29250 16236 14959 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_29250 17351 16248 gene locus_tag LOCUS_29260 17351 16248 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_29260 17832 17365 gene locus_tag LOCUS_29270 17832 17365 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_29270 18556 17855 gene locus_tag LOCUS_29280 gene cysE 18556 17855 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_29280 18717 19382 gene locus_tag LOCUS_29290 18717 19382 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_29290 19661 20905 gene locus_tag LOCUS_29300 gene tyrS 19661 20905 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532167.1 protein_id gnl|my_center|LOCUS_29300 21723 20902 gene locus_tag LOCUS_29310 21723 20902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence083 278 640 gene locus_tag LOCUS_29320 278 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 653 853 gene locus_tag LOCUS_29330 gene rpmD 653 853 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_29330 870 1379 gene locus_tag LOCUS_29340 gene rplO 870 1379 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975184.1 protein_id gnl|my_center|LOCUS_29340 1407 2771 gene locus_tag LOCUS_29350 gene secY 1407 2771 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_29350 2768 3412 gene locus_tag LOCUS_29360 2768 3412 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_29360 3607 3975 gene locus_tag LOCUS_29370 gene rpsM 3607 3975 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919149.1 protein_id gnl|my_center|LOCUS_29370 4033 4434 gene locus_tag LOCUS_29380 gene rpsK 4033 4434 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_29380 4520 5536 gene locus_tag LOCUS_29390 4520 5536 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_29390 5569 5997 gene locus_tag LOCUS_29400 gene rplQ 5569 5997 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_29400 6049 7524 gene locus_tag LOCUS_29410 6049 7524 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_29410 7521 8828 gene locus_tag LOCUS_29420 7521 8828 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_29420 8825 9298 gene locus_tag LOCUS_29430 8825 9298 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088787.1 protein_id gnl|my_center|LOCUS_29430 9295 11400 gene locus_tag LOCUS_29440 9295 11400 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088788.1 protein_id gnl|my_center|LOCUS_29440 11401 12249 gene locus_tag LOCUS_29450 11401 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 12259 13233 gene locus_tag LOCUS_29460 12259 13233 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_29460 13239 13889 gene locus_tag LOCUS_29470 13239 13889 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_29470 13904 14587 gene locus_tag LOCUS_29480 13904 14587 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_29480 14629 16161 gene locus_tag LOCUS_29490 14629 16161 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_29490 16131 16352 gene locus_tag LOCUS_29500 16131 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 16345 18351 gene locus_tag LOCUS_29510 16345 18351 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_29510 18539 18327 gene locus_tag LOCUS_29520 18539 18327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 18644 19009 gene locus_tag LOCUS_29530 18644 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328788.1 protein_id gnl|my_center|LOCUS_29530 19682 18990 gene locus_tag LOCUS_29540 gene lipB 19682 18990 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 protein_id gnl|my_center|LOCUS_29540 19761 19847 gene locus_tag LOCUS_t00240 19761 19847 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 417 214 gene locus_tag LOCUS_29550 417 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 767 1819 gene locus_tag LOCUS_29560 767 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2419 1982 gene locus_tag LOCUS_29570 2419 1982 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_29570 3162 2416 gene locus_tag LOCUS_29580 3162 2416 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_29580 3797 3159 gene locus_tag LOCUS_29590 3797 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 4750 3830 gene locus_tag LOCUS_29600 gene znuA 4750 3830 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_29600 4853 5359 gene locus_tag LOCUS_29610 gene zur 4853 5359 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_29610 5375 6502 gene locus_tag LOCUS_29620 5375 6502 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_29620 6509 8383 gene locus_tag LOCUS_29630 6509 8383 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_29630 9441 8380 gene locus_tag LOCUS_29640 9441 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 10950 9508 gene locus_tag LOCUS_29650 10950 9508 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_29650 11694 10984 gene locus_tag LOCUS_29660 11694 10984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086141.1 protein_id gnl|my_center|LOCUS_29660 12419 11691 gene locus_tag LOCUS_29670 12419 11691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_29670 13380 12412 gene locus_tag LOCUS_29680 13380 12412 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_29680 14240 13377 gene locus_tag LOCUS_29690 14240 13377 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_29690 15615 14374 gene locus_tag LOCUS_29700 15615 14374 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_29700 15720 17525 gene locus_tag LOCUS_29710 15720 17525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_29710 17522 18214 gene locus_tag LOCUS_29720 17522 18214 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_29720 18214 19482 gene locus_tag LOCUS_29730 18214 19482 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_29730 19479 20432 gene locus_tag LOCUS_29740 gene lpxK 19479 20432 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_29740 20425 21303 gene locus_tag LOCUS_29750 20425 21303 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_29750 21363 21704 gene locus_tag LOCUS_29760 21363 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence085 187 927 gene locus_tag LOCUS_29770 187 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1138 2607 gene locus_tag LOCUS_29780 1138 2607 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_29780 2615 3847 gene locus_tag LOCUS_29790 2615 3847 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494242.1 protein_id gnl|my_center|LOCUS_29790 3888 4472 gene locus_tag LOCUS_29800 3888 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 5638 4469 gene locus_tag LOCUS_29810 5638 4469 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_29810 6027 5638 gene locus_tag LOCUS_29820 6027 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 6832 6008 gene locus_tag LOCUS_29830 6832 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 6949 7272 gene locus_tag LOCUS_29840 6949 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 8117 7269 gene locus_tag LOCUS_29850 8117 7269 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105361.1 protein_id gnl|my_center|LOCUS_29850 8440 8105 gene locus_tag LOCUS_29860 8440 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 8512 10170 gene locus_tag LOCUS_29870 8512 10170 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081318989.1 protein_id gnl|my_center|LOCUS_29870 10178 10354 gene locus_tag LOCUS_29880 10178 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 10351 11544 gene locus_tag LOCUS_29890 10351 11544 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918524.1 protein_id gnl|my_center|LOCUS_29890 11999 11541 gene locus_tag LOCUS_29900 11999 11541 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_29900 12128 12334 gene locus_tag LOCUS_29910 12128 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 12681 12340 gene locus_tag LOCUS_29920 12681 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 13328 12774 gene locus_tag LOCUS_29930 13328 12774 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872728.1 protein_id gnl|my_center|LOCUS_29930 14425 13436 gene locus_tag LOCUS_29940 14425 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 15663 14467 gene locus_tag LOCUS_29950 15663 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 15684 16718 gene locus_tag LOCUS_29960 15684 16718 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971599.1 protein_id gnl|my_center|LOCUS_29960 17539 16715 gene locus_tag LOCUS_29970 17539 16715 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_29970 18653 17607 gene locus_tag LOCUS_29980 18653 17607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390949.1 protein_id gnl|my_center|LOCUS_29980 20350 18641 gene locus_tag LOCUS_29990 20350 18641 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529320.1 protein_id gnl|my_center|LOCUS_29990 21328 20351 gene locus_tag LOCUS_30000 21328 20351 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976081.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence086 348 1229 gene locus_tag LOCUS_30010 348 1229 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_30010 1226 2116 gene locus_tag LOCUS_30020 1226 2116 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_30020 2163 3839 gene locus_tag LOCUS_30030 2163 3839 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_30030 3844 4671 gene locus_tag LOCUS_30040 3844 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 5027 4680 gene locus_tag LOCUS_30050 5027 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 5229 5014 gene locus_tag LOCUS_30060 5229 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 5339 6634 gene locus_tag LOCUS_30070 5339 6634 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_30070 6658 7617 gene locus_tag LOCUS_30080 6658 7617 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974587.1 protein_id gnl|my_center|LOCUS_30080 9896 7614 gene locus_tag LOCUS_30090 9896 7614 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 protein_id gnl|my_center|LOCUS_30090 11222 9909 gene locus_tag LOCUS_30100 11222 9909 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086758.1 protein_id gnl|my_center|LOCUS_30100 11311 12801 gene locus_tag LOCUS_30110 11311 12801 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_30110 12786 14012 gene locus_tag LOCUS_30120 12786 14012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040801.1 protein_id gnl|my_center|LOCUS_30120 14065 15306 gene locus_tag LOCUS_30130 14065 15306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_30130 16036 15311 gene locus_tag LOCUS_30140 16036 15311 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_30140 16740 16033 gene locus_tag LOCUS_30150 16740 16033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_30150 17090 16752 gene locus_tag LOCUS_30160 17090 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 17741 17106 gene locus_tag LOCUS_30170 17741 17106 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_30170 17879 18169 gene locus_tag LOCUS_30180 17879 18169 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_30180 18170 18481 gene locus_tag LOCUS_30190 18170 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 18478 19344 gene locus_tag LOCUS_30200 gene folD 18478 19344 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_30200 19431 19991 gene locus_tag LOCUS_30210 19431 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 21207 19999 gene locus_tag LOCUS_30220 21207 19999 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626653.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence087 322 642 gene locus_tag LOCUS_30230 322 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2753 639 gene locus_tag LOCUS_30240 2753 639 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_30240 3085 4473 gene locus_tag LOCUS_30250 gene gltX 3085 4473 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_30250 4560 5864 gene locus_tag LOCUS_30260 gene gltA 4560 5864 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_30260 5861 6067 gene locus_tag LOCUS_30270 5861 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 6064 6558 gene locus_tag LOCUS_30280 6064 6558 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_30280 7150 6710 gene locus_tag LOCUS_30290 gene gloA 7150 6710 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124389.1 protein_id gnl|my_center|LOCUS_30290 8356 7166 gene locus_tag LOCUS_30300 gene lpxB 8356 7166 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_30300 9210 8353 gene locus_tag LOCUS_30310 gene lpxI 9210 8353 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_30310 9958 9161 gene locus_tag LOCUS_30320 gene lpxA 9958 9161 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_30320 10443 9958 gene locus_tag LOCUS_30330 gene fabZ 10443 9958 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_30330 11467 10448 gene locus_tag LOCUS_30340 gene lpxD 11467 10448 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969259.1 protein_id gnl|my_center|LOCUS_30340 12128 11472 gene locus_tag LOCUS_30350 12128 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 14404 12131 gene locus_tag LOCUS_30360 gene bamA 14404 12131 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_30360 15549 14422 gene locus_tag LOCUS_30370 gene rseP 15549 14422 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389468.1 protein_id gnl|my_center|LOCUS_30370 16726 15569 gene locus_tag LOCUS_30380 16726 15569 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_30380 17547 16717 gene locus_tag LOCUS_30390 17547 16717 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_30390 18238 17531 gene locus_tag LOCUS_30400 18238 17531 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_30400 18816 18259 gene locus_tag LOCUS_30410 gene frr 18816 18259 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312543.1 protein_id gnl|my_center|LOCUS_30410 19550 18813 gene locus_tag LOCUS_30420 gene pyrH 19550 18813 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_30420 20481 19558 gene locus_tag LOCUS_30430 gene tsf 20481 19558 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_30430 <21339 20573 gene locus_tag LOCUS_30440 <21339 20573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389461.1:30S ribosomal protein S2 >Feature sequence088 1871 249 gene locus_tag LOCUS_30450 gene ggt 1871 249 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065022.1 protein_id gnl|my_center|LOCUS_30450 2363 1884 gene locus_tag LOCUS_30460 gene gpt 2363 1884 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_30460 3309 2371 gene locus_tag LOCUS_30470 3309 2371 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_30470 4039 3311 gene locus_tag LOCUS_30480 4039 3311 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_30480 6879 4036 gene locus_tag LOCUS_30490 6879 4036 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_30490 7370 6876 gene locus_tag LOCUS_30500 7370 6876 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390254.1 protein_id gnl|my_center|LOCUS_30500 8114 7377 gene locus_tag LOCUS_30510 8114 7377 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_30510 9031 8111 gene locus_tag LOCUS_30520 9031 8111 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_30520 9424 9101 gene locus_tag LOCUS_30530 9424 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 10128 9421 gene locus_tag LOCUS_30540 10128 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 11379 10144 gene locus_tag LOCUS_30550 gene hutI 11379 10144 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_30550 11430 12803 gene locus_tag LOCUS_30560 11430 12803 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_30560 12872 13090 gene locus_tag LOCUS_30570 12872 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 13535 13053 gene locus_tag LOCUS_30580 13535 13053 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704613.1 protein_id gnl|my_center|LOCUS_30580 15538 13598 gene locus_tag LOCUS_30590 gene acs 15538 13598 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_30590 15694 17886 gene locus_tag LOCUS_30600 15694 17886 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390820.1 protein_id gnl|my_center|LOCUS_30600 19338 17947 gene locus_tag LOCUS_30610 19338 17947 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_30610 19922 19350 gene locus_tag LOCUS_30620 19922 19350 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_30620 21218 20079 gene locus_tag LOCUS_30630 21218 20079 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970762.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence089 84 914 gene locus_tag LOCUS_30640 84 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1247 921 gene locus_tag LOCUS_30650 1247 921 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626266.1 protein_id gnl|my_center|LOCUS_30650 1418 2803 gene locus_tag LOCUS_30660 1418 2803 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222025.1 protein_id gnl|my_center|LOCUS_30660 3253 2804 gene locus_tag LOCUS_30670 3253 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 4547 3267 gene locus_tag LOCUS_30680 gene eno 4547 3267 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_30680 4640 5536 gene locus_tag LOCUS_30690 4640 5536 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972370.1 protein_id gnl|my_center|LOCUS_30690 5550 6893 gene locus_tag LOCUS_30700 gene trmFO 5550 6893 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087495.1 protein_id gnl|my_center|LOCUS_30700 7564 6890 gene locus_tag LOCUS_30710 7564 6890 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_30710 7877 7608 gene locus_tag LOCUS_30720 7877 7608 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087489.1 protein_id gnl|my_center|LOCUS_30720 8759 7926 gene locus_tag LOCUS_30730 8759 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 9983 8766 gene locus_tag LOCUS_30740 9983 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 10118 10043 gene locus_tag LOCUS_t00250 10118 10043 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10462 11436 gene locus_tag LOCUS_30750 10462 11436 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084169.1 protein_id gnl|my_center|LOCUS_30750 11755 11453 gene locus_tag LOCUS_30760 11755 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 12089 12529 gene locus_tag LOCUS_30770 12089 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 12463 13221 gene locus_tag LOCUS_30780 12463 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 13218 14615 gene locus_tag LOCUS_30790 13218 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 14705 15949 gene locus_tag LOCUS_30800 14705 15949 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_30800 16215 15946 gene locus_tag LOCUS_30810 16215 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 16287 17276 gene locus_tag LOCUS_30820 16287 17276 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_30820 18091 17273 gene locus_tag LOCUS_30830 18091 17273 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545817.1 protein_id gnl|my_center|LOCUS_30830 18716 18102 gene locus_tag LOCUS_30840 18716 18102 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695341.1 protein_id gnl|my_center|LOCUS_30840 19549 18713 gene locus_tag LOCUS_30850 gene kdsA 19549 18713 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_30850 <21052 19546 gene locus_tag LOCUS_30860 <21052 19546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389640.1:CTP synthase >Feature sequence090 1102 185 gene locus_tag LOCUS_30870 1102 185 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965421.1 protein_id gnl|my_center|LOCUS_30870 2731 1325 gene locus_tag LOCUS_30880 gene pvdN 2731 1325 CDS product pyoverdine-tailoring periplasmic protein PvdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114503.1 protein_id gnl|my_center|LOCUS_30880 2904 4487 gene locus_tag LOCUS_30890 2904 4487 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_30890 4556 5656 gene locus_tag LOCUS_30900 4556 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 5725 6738 gene locus_tag LOCUS_30910 5725 6738 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_30910 8977 6878 gene locus_tag LOCUS_30920 8977 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 9209 9493 gene locus_tag LOCUS_30930 9209 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 9490 9879 gene locus_tag LOCUS_30940 9490 9879 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_30940 12139 9884 gene locus_tag LOCUS_30950 12139 9884 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_30950 13456 12146 gene locus_tag LOCUS_30960 gene ahcY 13456 12146 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_30960 14578 13592 gene locus_tag LOCUS_30970 14578 13592 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_30970 15065 14613 gene locus_tag LOCUS_30980 gene rlmH 15065 14613 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388990.1 protein_id gnl|my_center|LOCUS_30980 15473 15072 gene locus_tag LOCUS_30990 15473 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 16131 15517 gene locus_tag LOCUS_31000 16131 15517 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_31000 17373 16135 gene locus_tag LOCUS_31010 17373 16135 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_31010 18536 17412 gene locus_tag LOCUS_31020 gene proB 18536 17412 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972562.1 protein_id gnl|my_center|LOCUS_31020 19576 18533 gene locus_tag LOCUS_31030 gene obgE 19576 18533 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388995.1 protein_id gnl|my_center|LOCUS_31030 19916 19656 gene locus_tag LOCUS_31040 gene rpmA 19916 19656 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_31040 20249 19935 gene locus_tag LOCUS_31050 gene rplU 20249 19935 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516451.1 protein_id gnl|my_center|LOCUS_31050 20482 20571 gene locus_tag LOCUS_t00260 20482 20571 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 638 195 gene locus_tag LOCUS_31060 gene tolR 638 195 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_31060 1321 638 gene locus_tag LOCUS_31070 1321 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1718 1326 gene locus_tag LOCUS_31080 1718 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2061 3302 gene locus_tag LOCUS_31090 2061 3302 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_31090 3299 6430 gene locus_tag LOCUS_31100 3299 6430 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_31100 6427 9618 gene locus_tag LOCUS_31110 6427 9618 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815032.1 protein_id gnl|my_center|LOCUS_31110 9615 11024 gene locus_tag LOCUS_31120 9615 11024 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_31120 11060 12199 gene locus_tag LOCUS_31130 gene macA 11060 12199 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 protein_id gnl|my_center|LOCUS_31130 12196 14187 gene locus_tag LOCUS_31140 12196 14187 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397097.1 protein_id gnl|my_center|LOCUS_31140 15232 14204 gene locus_tag LOCUS_31150 15232 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 16745 15237 gene locus_tag LOCUS_31160 16745 15237 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_31160 17520 16765 gene locus_tag LOCUS_31170 17520 16765 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_31170 18449 17490 gene locus_tag LOCUS_31180 18449 17490 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731241.1 protein_id gnl|my_center|LOCUS_31180 19231 18527 gene locus_tag LOCUS_31190 19231 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence092 1799 60 gene locus_tag LOCUS_31200 gene ilvD 1799 60 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 protein_id gnl|my_center|LOCUS_31200 1896 2588 gene locus_tag LOCUS_31210 1896 2588 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_31210 3100 2585 gene locus_tag LOCUS_31220 3100 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 5744 3102 gene locus_tag LOCUS_31230 5744 3102 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_31230 6369 5776 gene locus_tag LOCUS_31240 6369 5776 CDS product DUF2497 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389550.1 protein_id gnl|my_center|LOCUS_31240 7883 6474 gene locus_tag LOCUS_31250 7883 6474 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_31250 8575 7922 gene locus_tag LOCUS_31260 8575 7922 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_31260 8732 8805 gene locus_tag LOCUS_t00270 8732 8805 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8886 8960 gene locus_tag LOCUS_t00280 8886 8960 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10590 9052 gene locus_tag LOCUS_31270 10590 9052 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_31270 12013 10517 gene locus_tag LOCUS_31280 12013 10517 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680807.1 protein_id gnl|my_center|LOCUS_31280 12749 12417 gene locus_tag LOCUS_31290 12749 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 15475 12749 gene locus_tag LOCUS_31300 15475 12749 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_31300 15650 16618 gene locus_tag LOCUS_31310 15650 16618 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809024.1 protein_id gnl|my_center|LOCUS_31310 16615 17025 gene locus_tag LOCUS_31320 16615 17025 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809022.1 protein_id gnl|my_center|LOCUS_31320 17879 17022 gene locus_tag LOCUS_31330 17879 17022 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971613.1 protein_id gnl|my_center|LOCUS_31330 20290 18161 gene locus_tag LOCUS_31340 20290 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence093 1229 228 gene locus_tag LOCUS_31350 1229 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31350 2504 1242 gene locus_tag LOCUS_31360 gene fabF 2504 1242 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388177.1 protein_id gnl|my_center|LOCUS_31360 2784 2548 gene locus_tag LOCUS_31370 2784 2548 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_31370 3633 2893 gene locus_tag LOCUS_31380 gene fabG 3633 2893 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_31380 4584 3643 gene locus_tag LOCUS_31390 gene fabD 4584 3643 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_31390 5080 4613 gene locus_tag LOCUS_31400 5080 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 4974 7454 gene locus_tag LOCUS_31410 4974 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 8385 7444 gene locus_tag LOCUS_31420 8385 7444 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_31420 8767 8393 gene locus_tag LOCUS_31430 8767 8393 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_31430 9018 8764 gene locus_tag LOCUS_31440 9018 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 9447 9064 gene locus_tag LOCUS_31450 9447 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 9600 10052 gene locus_tag LOCUS_31460 9600 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 10049 10351 gene locus_tag LOCUS_31470 10049 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 10377 11312 gene locus_tag LOCUS_31480 10377 11312 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_31480 11323 11835 gene locus_tag LOCUS_31490 gene rplI 11323 11835 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625933.1 protein_id gnl|my_center|LOCUS_31490 11998 13509 gene locus_tag LOCUS_31500 11998 13509 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_31500 13496 14596 gene locus_tag LOCUS_31510 gene alr 13496 14596 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 protein_id gnl|my_center|LOCUS_31510 14593 15369 gene locus_tag LOCUS_31520 14593 15369 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_31520 15366 16151 gene locus_tag LOCUS_31530 15366 16151 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_31530 16156 17544 gene locus_tag LOCUS_31540 gene radA 16156 17544 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_31540 17541 18218 gene locus_tag LOCUS_31550 17541 18218 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388164.1 protein_id gnl|my_center|LOCUS_31550 18241 19698 gene locus_tag LOCUS_31560 gene purF 18241 19698 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_31560 19747 20451 gene locus_tag LOCUS_31570 19747 20451 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence094 1233 466 gene locus_tag LOCUS_31580 1233 466 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_31580 1421 1233 gene locus_tag LOCUS_31590 1421 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2228 1449 gene locus_tag LOCUS_31600 2228 1449 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388960.1 protein_id gnl|my_center|LOCUS_31600 4033 2240 gene locus_tag LOCUS_31610 gene sdhA 4033 2240 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_31610 4417 4037 gene locus_tag LOCUS_31620 gene sdhD 4417 4037 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_31620 4824 4435 gene locus_tag LOCUS_31630 gene sdhC 4824 4435 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_31630 6314 4908 gene locus_tag LOCUS_31640 6314 4908 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969313.1 protein_id gnl|my_center|LOCUS_31640 7244 6384 gene locus_tag LOCUS_31650 7244 6384 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_31650 8011 7262 gene locus_tag LOCUS_31660 8011 7262 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_31660 8179 8715 gene locus_tag LOCUS_31670 8179 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 8734 9507 gene locus_tag LOCUS_31680 gene hisN 8734 9507 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_31680 9569 11395 gene locus_tag LOCUS_31690 9569 11395 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_31690 11525 13390 gene locus_tag LOCUS_31700 11525 13390 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_31700 13404 14486 gene locus_tag LOCUS_31710 13404 14486 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537534.1 protein_id gnl|my_center|LOCUS_31710 14483 15547 gene locus_tag LOCUS_31720 14483 15547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_31720 15544 17169 gene locus_tag LOCUS_31730 15544 17169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_31730 17183 18796 gene locus_tag LOCUS_31740 gene cimA 17183 18796 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_31740 18802 19563 gene locus_tag LOCUS_31750 18802 19563 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence095 1423 509 gene locus_tag LOCUS_31760 1423 509 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_31760 1899 1420 gene locus_tag LOCUS_31770 gene ruvX 1899 1420 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_31770 2009 2296 gene locus_tag LOCUS_31780 gene gatC 2009 2296 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_31780 2296 3768 gene locus_tag LOCUS_31790 gene gatA 2296 3768 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240741.1 protein_id gnl|my_center|LOCUS_31790 3765 5219 gene locus_tag LOCUS_31800 gene gatB 3765 5219 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_31800 5221 6372 gene locus_tag LOCUS_31810 5221 6372 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_31810 6323 6802 gene locus_tag LOCUS_31820 6323 6802 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936133.1 protein_id gnl|my_center|LOCUS_31820 7381 6809 gene locus_tag LOCUS_31830 7381 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 8432 7416 gene locus_tag LOCUS_31840 8432 7416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 protein_id gnl|my_center|LOCUS_31840 9239 8445 gene locus_tag LOCUS_31850 9239 8445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089227.1 protein_id gnl|my_center|LOCUS_31850 10063 9236 gene locus_tag LOCUS_31860 10063 9236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089228.1 protein_id gnl|my_center|LOCUS_31860 10304 10089 gene locus_tag LOCUS_31870 10304 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 10436 11461 gene locus_tag LOCUS_31880 10436 11461 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198035.1 protein_id gnl|my_center|LOCUS_31880 11458 12570 gene locus_tag LOCUS_31890 11458 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 12585 13241 gene locus_tag LOCUS_31900 12585 13241 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_31900 13329 14297 gene locus_tag LOCUS_31910 13329 14297 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056629.1 protein_id gnl|my_center|LOCUS_31910 14363 16297 gene locus_tag LOCUS_31920 14363 16297 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_31920 16400 16493 gene locus_tag LOCUS_t00290 16400 16493 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17117 17887 gene locus_tag LOCUS_31930 17117 17887 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_31930 17887 18498 gene locus_tag LOCUS_31940 17887 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 18744 19514 gene locus_tag LOCUS_31950 18744 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 19860 19480 gene locus_tag LOCUS_31960 19860 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence096 2590 173 gene locus_tag LOCUS_31970 2590 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3528 2587 gene locus_tag LOCUS_31980 3528 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 4443 3571 gene locus_tag LOCUS_31990 4443 3571 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410031.1 protein_id gnl|my_center|LOCUS_31990 5177 4440 gene locus_tag LOCUS_32000 gene aztA 5177 4440 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104120.1 protein_id gnl|my_center|LOCUS_32000 5403 6581 gene locus_tag LOCUS_32010 5403 6581 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003620.1 protein_id gnl|my_center|LOCUS_32010 6578 7360 gene locus_tag LOCUS_32020 6578 7360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_32020 7373 8347 gene locus_tag LOCUS_32030 7373 8347 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937913.1 protein_id gnl|my_center|LOCUS_32030 8344 8955 gene locus_tag LOCUS_32040 8344 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 9970 8957 gene locus_tag LOCUS_32050 9970 8957 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528049.1 protein_id gnl|my_center|LOCUS_32050 10042 12114 gene locus_tag LOCUS_32060 10042 12114 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 protein_id gnl|my_center|LOCUS_32060 12111 13736 gene locus_tag LOCUS_32070 12111 13736 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 protein_id gnl|my_center|LOCUS_32070 14863 13748 gene locus_tag LOCUS_32080 gene leuB 14863 13748 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_32080 15610 14957 gene locus_tag LOCUS_32090 15610 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 16307 15702 gene locus_tag LOCUS_32100 gene leuD 16307 15702 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_32100 16445 16762 gene locus_tag LOCUS_32110 16445 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 17208 16759 gene locus_tag LOCUS_32120 17208 16759 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242940.1 protein_id gnl|my_center|LOCUS_32120 18621 17212 gene locus_tag LOCUS_32130 gene leuC 18621 17212 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_32130 19068 18667 gene locus_tag LOCUS_32140 19068 18667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 <19715 19101 gene locus_tag LOCUS_32150 <19715 19101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388942.1:tRNA (guanosine(37)-N1)-methyltransferase TrmD >Feature sequence097 174 1103 gene locus_tag LOCUS_32160 174 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 1650 1126 gene locus_tag LOCUS_32170 1650 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3675 1660 gene locus_tag LOCUS_32180 3675 1660 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_32180 5069 3780 gene locus_tag LOCUS_32190 5069 3780 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_32190 6235 5066 gene locus_tag LOCUS_32200 6235 5066 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_32200 6430 7584 gene locus_tag LOCUS_32210 6430 7584 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_32210 7602 9179 gene locus_tag LOCUS_32220 gene serA 7602 9179 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_32220 9569 9231 gene locus_tag LOCUS_32230 9569 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 10341 9712 gene locus_tag LOCUS_32240 10341 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 11253 10351 gene locus_tag LOCUS_32250 11253 10351 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973825.1 protein_id gnl|my_center|LOCUS_32250 11351 12490 gene locus_tag LOCUS_32260 gene phnW 11351 12490 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112368.1 protein_id gnl|my_center|LOCUS_32260 12495 13724 gene locus_tag LOCUS_32270 gene phnA 12495 13724 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 protein_id gnl|my_center|LOCUS_32270 13735 15186 gene locus_tag LOCUS_32280 gene phnY 13735 15186 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975823.1 protein_id gnl|my_center|LOCUS_32280 15260 16288 gene locus_tag LOCUS_32290 15260 16288 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975825.1 protein_id gnl|my_center|LOCUS_32290 16364 17446 gene locus_tag LOCUS_32300 16364 17446 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527142.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence098 1018 167 gene locus_tag LOCUS_32310 gene bmt 1018 167 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_32310 1285 1935 gene locus_tag LOCUS_32320 1285 1935 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_32320 3859 1937 gene locus_tag LOCUS_32330 3859 1937 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_32330 4856 3894 gene locus_tag LOCUS_32340 4856 3894 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_32340 5467 4853 gene locus_tag LOCUS_32350 5467 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 6029 5544 gene locus_tag LOCUS_32360 6029 5544 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390991.1 protein_id gnl|my_center|LOCUS_32360 6520 6029 gene locus_tag LOCUS_32370 6520 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 6774 6550 gene locus_tag LOCUS_32380 6774 6550 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390993.1 protein_id gnl|my_center|LOCUS_32380 7541 6807 gene locus_tag LOCUS_32390 7541 6807 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_32390 7884 7534 gene locus_tag LOCUS_32400 7884 7534 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968854.1 protein_id gnl|my_center|LOCUS_32400 9531 8023 gene locus_tag LOCUS_32410 9531 8023 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_32410 9953 9531 gene locus_tag LOCUS_32420 9953 9531 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_32420 12311 9966 gene locus_tag LOCUS_32430 12311 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 12656 12330 gene locus_tag LOCUS_32440 12656 12330 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084371.1 protein_id gnl|my_center|LOCUS_32440 12937 12740 gene locus_tag LOCUS_32450 12937 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 13044 13967 gene locus_tag LOCUS_32460 gene htpX 13044 13967 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 protein_id gnl|my_center|LOCUS_32460 13997 15259 gene locus_tag LOCUS_32470 13997 15259 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_32470 15310 16713 gene locus_tag LOCUS_32480 15310 16713 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083078.1 protein_id gnl|my_center|LOCUS_32480 16813 17466 gene locus_tag LOCUS_32490 gene rpe 16813 17466 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088426.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence099 420 1199 gene locus_tag LOCUS_32500 420 1199 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 protein_id gnl|my_center|LOCUS_32500 2127 1207 gene locus_tag LOCUS_32510 2127 1207 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064549.1 protein_id gnl|my_center|LOCUS_32510 2969 2130 gene locus_tag LOCUS_32520 2969 2130 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089838.1 protein_id gnl|my_center|LOCUS_32520 3889 2966 gene locus_tag LOCUS_32530 3889 2966 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089837.1 protein_id gnl|my_center|LOCUS_32530 4703 3909 gene locus_tag LOCUS_32540 4703 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 5243 4713 gene locus_tag LOCUS_32550 5243 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32550 6012 5326 gene locus_tag LOCUS_32560 6012 5326 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087416.1 protein_id gnl|my_center|LOCUS_32560 6760 6071 gene locus_tag LOCUS_32570 6760 6071 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087416.1 protein_id gnl|my_center|LOCUS_32570 7070 7834 gene locus_tag LOCUS_32580 7070 7834 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_32580 7834 8715 gene locus_tag LOCUS_32590 7834 8715 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175095.1 protein_id gnl|my_center|LOCUS_32590 8752 9549 gene locus_tag LOCUS_32600 8752 9549 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_32600 10286 9546 gene locus_tag LOCUS_32610 10286 9546 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970863.1 protein_id gnl|my_center|LOCUS_32610 10420 11088 gene locus_tag LOCUS_32620 10420 11088 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970686.1 protein_id gnl|my_center|LOCUS_32620 11085 12278 gene locus_tag LOCUS_32630 11085 12278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081491.1 protein_id gnl|my_center|LOCUS_32630 12301 13182 gene locus_tag LOCUS_32640 12301 13182 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114464.1 protein_id gnl|my_center|LOCUS_32640 14180 13179 gene locus_tag LOCUS_32650 14180 13179 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 protein_id gnl|my_center|LOCUS_32650 15847 14255 gene locus_tag LOCUS_32660 15847 14255 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388734.1 protein_id gnl|my_center|LOCUS_32660 15958 17928 gene locus_tag LOCUS_32670 15958 17928 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_32670 18161 17943 gene locus_tag LOCUS_32680 18161 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence100 182 1771 gene locus_tag LOCUS_32690 182 1771 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_32690 1870 2907 gene locus_tag LOCUS_32700 1870 2907 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551979.1 protein_id gnl|my_center|LOCUS_32700 4438 2912 gene locus_tag LOCUS_32710 4438 2912 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_32710 4867 4502 gene locus_tag LOCUS_32720 4867 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 4988 6607 gene locus_tag LOCUS_32730 4988 6607 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_32730 6674 11596 gene locus_tag LOCUS_32740 6674 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 13556 11601 gene locus_tag LOCUS_32750 13556 11601 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_32750 14285 13569 gene locus_tag LOCUS_32760 14285 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 14991 14245 gene locus_tag LOCUS_32770 14991 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 15419 14988 gene locus_tag LOCUS_32780 15419 14988 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814256.1 protein_id gnl|my_center|LOCUS_32780 15669 17039 gene locus_tag LOCUS_32790 15669 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 17073 17315 gene locus_tag LOCUS_32800 17073 17315 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 protein_id gnl|my_center|LOCUS_32800 17934 17317 gene locus_tag LOCUS_32810 17934 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence101 2 535 gene locus_tag LOCUS_32820 2 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 657 1700 gene locus_tag LOCUS_32830 657 1700 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339274.1 protein_id gnl|my_center|LOCUS_32830 1705 2772 gene locus_tag LOCUS_32840 1705 2772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339273.1 protein_id gnl|my_center|LOCUS_32840 2762 3619 gene locus_tag LOCUS_32850 2762 3619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339272.1 protein_id gnl|my_center|LOCUS_32850 3616 4398 gene locus_tag LOCUS_32860 3616 4398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724163.1 protein_id gnl|my_center|LOCUS_32860 4420 5112 gene locus_tag LOCUS_32870 4420 5112 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 protein_id gnl|my_center|LOCUS_32870 5156 5440 gene locus_tag LOCUS_32880 5156 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 6101 5451 gene locus_tag LOCUS_32890 6101 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 6580 6119 gene locus_tag LOCUS_32900 6580 6119 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_32900 7978 6581 gene locus_tag LOCUS_32910 7978 6581 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_32910 9318 7987 gene locus_tag LOCUS_32920 9318 7987 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_32920 10219 9350 gene locus_tag LOCUS_32930 gene galU 10219 9350 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_32930 11085 10378 gene locus_tag LOCUS_32940 11085 10378 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_32940 11783 11085 gene locus_tag LOCUS_32950 11783 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_32950 12637 11804 gene locus_tag LOCUS_32960 12637 11804 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_32960 14724 12634 gene locus_tag LOCUS_32970 14724 12634 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 protein_id gnl|my_center|LOCUS_32970 14826 15935 gene locus_tag LOCUS_32980 14826 15935 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089845.1 protein_id gnl|my_center|LOCUS_32980 15929 17551 gene locus_tag LOCUS_32990 15929 17551 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_32990 17853 17548 gene locus_tag LOCUS_33000 17853 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence102 307 594 gene locus_tag LOCUS_33010 307 594 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_33010 600 941 gene locus_tag LOCUS_33020 600 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 1005 1667 gene locus_tag LOCUS_33030 1005 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 2882 1710 gene locus_tag LOCUS_33040 2882 1710 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_33040 2979 4451 gene locus_tag LOCUS_33050 2979 4451 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530716.1 protein_id gnl|my_center|LOCUS_33050 5656 4571 gene locus_tag LOCUS_33060 5656 4571 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_33060 6855 5668 gene locus_tag LOCUS_33070 6855 5668 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494242.1 protein_id gnl|my_center|LOCUS_33070 6946 7668 gene locus_tag LOCUS_33080 6946 7668 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087336.1 protein_id gnl|my_center|LOCUS_33080 7676 8803 gene locus_tag LOCUS_33090 7676 8803 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_33090 10572 8800 gene locus_tag LOCUS_33100 10572 8800 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_33100 12286 10580 gene locus_tag LOCUS_33110 gene ggt 12286 10580 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_33110 12406 13356 gene locus_tag LOCUS_33120 12406 13356 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_33120 13373 14833 gene locus_tag LOCUS_33130 13373 14833 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_33130 16225 14840 gene locus_tag LOCUS_33140 16225 14840 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532287.1 protein_id gnl|my_center|LOCUS_33140 17731 16250 gene locus_tag LOCUS_33150 17731 16250 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063719.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence103 156 82 gene locus_tag LOCUS_t00300 156 82 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 297 464 gene locus_tag LOCUS_33160 297 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1460 501 gene locus_tag LOCUS_33170 1460 501 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_33170 1550 2023 gene locus_tag LOCUS_33180 1550 2023 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037392.1 protein_id gnl|my_center|LOCUS_33180 2166 2384 gene locus_tag LOCUS_33190 2166 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2381 2818 gene locus_tag LOCUS_33200 2381 2818 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086688.1 protein_id gnl|my_center|LOCUS_33200 2815 3420 gene locus_tag LOCUS_33210 2815 3420 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_33210 3433 4176 gene locus_tag LOCUS_33220 3433 4176 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268299.1 protein_id gnl|my_center|LOCUS_33220 4180 4569 gene locus_tag LOCUS_33230 4180 4569 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522206.1 protein_id gnl|my_center|LOCUS_33230 4592 5236 gene locus_tag LOCUS_33240 4592 5236 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_33240 5820 5233 gene locus_tag LOCUS_33250 5820 5233 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_33250 5887 6312 gene locus_tag LOCUS_33260 5887 6312 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_33260 8067 6442 gene locus_tag LOCUS_33270 8067 6442 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_33270 8285 10186 gene locus_tag LOCUS_33280 8285 10186 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_33280 10183 10857 gene locus_tag LOCUS_33290 10183 10857 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929297.1 protein_id gnl|my_center|LOCUS_33290 11556 10897 gene locus_tag LOCUS_33300 11556 10897 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_33300 11747 13339 gene locus_tag LOCUS_33310 11747 13339 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_33310 13342 13770 gene locus_tag LOCUS_33320 13342 13770 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173494.1 protein_id gnl|my_center|LOCUS_33320 13790 14227 gene locus_tag LOCUS_33330 13790 14227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 14239 14670 gene locus_tag LOCUS_33340 14239 14670 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173494.1 protein_id gnl|my_center|LOCUS_33340 15322 14696 gene locus_tag LOCUS_33350 15322 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 16175 15345 gene locus_tag LOCUS_33360 16175 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 17465 16302 gene locus_tag LOCUS_33370 17465 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 >Feature sequence104 <1 796 gene locus_tag LOCUS_33380 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086709.1:N,N-dimethylformamidase 799 1722 gene locus_tag LOCUS_33390 799 1722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087662.1 protein_id gnl|my_center|LOCUS_33390 1719 2597 gene locus_tag LOCUS_33400 1719 2597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_33400 2590 3543 gene locus_tag LOCUS_33410 2590 3543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943261.1 protein_id gnl|my_center|LOCUS_33410 3543 4493 gene locus_tag LOCUS_33420 3543 4493 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083809.1 protein_id gnl|my_center|LOCUS_33420 5725 4490 gene locus_tag LOCUS_33430 5725 4490 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103770.1 protein_id gnl|my_center|LOCUS_33430 6675 5722 gene locus_tag LOCUS_33440 gene uxuA 6675 5722 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906067.1 protein_id gnl|my_center|LOCUS_33440 6768 9182 gene locus_tag LOCUS_33450 6768 9182 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528147.1 protein_id gnl|my_center|LOCUS_33450 10720 9179 gene locus_tag LOCUS_33460 10720 9179 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395758.1 protein_id gnl|my_center|LOCUS_33460 12040 10724 gene locus_tag LOCUS_33470 gene hemL 12040 10724 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_33470 13159 12119 gene locus_tag LOCUS_33480 13159 12119 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339534.1 protein_id gnl|my_center|LOCUS_33480 13270 14214 gene locus_tag LOCUS_33490 13270 14214 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_33490 15031 14231 gene locus_tag LOCUS_33500 15031 14231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_33500 16034 15090 gene locus_tag LOCUS_33510 16034 15090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_33510 17610 16063 gene locus_tag LOCUS_33520 17610 16063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence105 1002 280 gene locus_tag LOCUS_33530 1002 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1260 2201 gene locus_tag LOCUS_33540 1260 2201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391000.1 protein_id gnl|my_center|LOCUS_33540 2213 3679 gene locus_tag LOCUS_33550 gene rfaE1 2213 3679 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_33550 4243 3692 gene locus_tag LOCUS_33560 4243 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33560 4637 4260 gene locus_tag LOCUS_33570 4637 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33570 5216 4728 gene locus_tag LOCUS_33580 5216 4728 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616613.1 protein_id gnl|my_center|LOCUS_33580 5593 6207 gene locus_tag LOCUS_33590 5593 6207 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812253.1 protein_id gnl|my_center|LOCUS_33590 6211 8316 gene locus_tag LOCUS_33600 6211 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 8430 9368 gene locus_tag LOCUS_33610 8430 9368 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390819.1 protein_id gnl|my_center|LOCUS_33610 9392 10258 gene locus_tag LOCUS_33620 9392 10258 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_33620 10255 10941 gene locus_tag LOCUS_33630 10255 10941 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967273.1 protein_id gnl|my_center|LOCUS_33630 10962 11156 gene locus_tag LOCUS_33640 10962 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 11153 12562 gene locus_tag LOCUS_33650 11153 12562 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_33650 12588 12995 gene locus_tag LOCUS_33660 12588 12995 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_33660 13354 12992 gene locus_tag LOCUS_33670 13354 12992 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530010.1 protein_id gnl|my_center|LOCUS_33670 13854 13417 gene locus_tag LOCUS_33680 13854 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 14529 13915 gene locus_tag LOCUS_33690 14529 13915 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_33690 14856 14614 gene locus_tag LOCUS_33700 14856 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 16207 15083 gene locus_tag LOCUS_33710 16207 15083 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390958.1 protein_id gnl|my_center|LOCUS_33710 16885 16262 gene locus_tag LOCUS_33720 16885 16262 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_33720 17046 17330 gene locus_tag LOCUS_33730 17046 17330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence106 447 1022 gene locus_tag LOCUS_33740 447 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1156 2307 gene locus_tag LOCUS_33750 gene argE 1156 2307 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106035.1 protein_id gnl|my_center|LOCUS_33750 2315 3283 gene locus_tag LOCUS_33760 2315 3283 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 protein_id gnl|my_center|LOCUS_33760 3467 5419 gene locus_tag LOCUS_33770 gene dnaK 3467 5419 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502156.1 protein_id gnl|my_center|LOCUS_33770 5516 6652 gene locus_tag LOCUS_33780 gene dnaJ 5516 6652 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_33780 6727 6981 gene locus_tag LOCUS_33790 6727 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218169.1 protein_id gnl|my_center|LOCUS_33790 6975 7295 gene locus_tag LOCUS_33800 6975 7295 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214977.1 protein_id gnl|my_center|LOCUS_33800 7439 8608 gene locus_tag LOCUS_33810 7439 8608 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081446.1 protein_id gnl|my_center|LOCUS_33810 8605 9639 gene locus_tag LOCUS_33820 8605 9639 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368575.1 protein_id gnl|my_center|LOCUS_33820 9636 10640 gene locus_tag LOCUS_33830 9636 10640 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 protein_id gnl|my_center|LOCUS_33830 11170 10637 gene locus_tag LOCUS_33840 11170 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 11811 11167 gene locus_tag LOCUS_33850 11811 11167 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_33850 12104 11808 gene locus_tag LOCUS_33860 12104 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 12728 12135 gene locus_tag LOCUS_33870 12728 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_33870 13284 12721 gene locus_tag LOCUS_33880 13284 12721 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065210.1 protein_id gnl|my_center|LOCUS_33880 13872 13288 gene locus_tag LOCUS_33890 13872 13288 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909036.1 protein_id gnl|my_center|LOCUS_33890 14199 15011 gene locus_tag LOCUS_33900 gene dapB 14199 15011 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_33900 15043 15594 gene locus_tag LOCUS_33910 15043 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 16039 15566 gene locus_tag LOCUS_33920 16039 15566 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_33920 16704 16099 gene locus_tag LOCUS_33930 16704 16099 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073335.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence107 708 100 gene locus_tag LOCUS_33940 708 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967070.1 protein_id gnl|my_center|LOCUS_33940 1096 761 gene locus_tag LOCUS_33950 1096 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 1911 1744 gene locus_tag LOCUS_33960 1911 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 1853 4216 gene locus_tag LOCUS_33970 gene katE 1853 4216 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 protein_id gnl|my_center|LOCUS_33970 4245 4862 gene locus_tag LOCUS_33980 4245 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188758.1 protein_id gnl|my_center|LOCUS_33980 6618 4903 gene locus_tag LOCUS_33990 6618 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 6695 7528 gene locus_tag LOCUS_34000 6695 7528 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_34000 7653 8342 gene locus_tag LOCUS_34010 7653 8342 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528898.1 protein_id gnl|my_center|LOCUS_34010 8362 9213 gene locus_tag LOCUS_34020 8362 9213 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_34020 9333 9260 gene locus_tag LOCUS_t00310 9333 9260 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9487 9870 gene locus_tag LOCUS_34030 9487 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 9897 12095 gene locus_tag LOCUS_34040 9897 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 12973 12092 gene locus_tag LOCUS_34050 12973 12092 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 protein_id gnl|my_center|LOCUS_34050 14685 12970 gene locus_tag LOCUS_34060 14685 12970 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_34060 16328 14703 gene locus_tag LOCUS_34070 16328 14703 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence108 518 75 gene locus_tag LOCUS_34080 gene fliJ 518 75 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388285.1 protein_id gnl|my_center|LOCUS_34080 1857 520 gene locus_tag LOCUS_34090 gene fliI 1857 520 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_34090 2001 2699 gene locus_tag LOCUS_34100 2001 2699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_34100 3363 2719 gene locus_tag LOCUS_34110 gene chpT 3363 2719 CDS product histidine phosphotransferase ChpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923288.1 protein_id gnl|my_center|LOCUS_34110 3497 3673 gene locus_tag LOCUS_34120 3497 3673 CDS product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388277.1 protein_id gnl|my_center|LOCUS_34120 3726 4139 gene locus_tag LOCUS_34130 3726 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 4752 4144 gene locus_tag LOCUS_34140 gene mobA 4752 4144 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_34140 7412 4758 gene locus_tag LOCUS_34150 gene alaS 7412 4758 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532150.1 protein_id gnl|my_center|LOCUS_34150 8557 7505 gene locus_tag LOCUS_34160 8557 7505 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_34160 8685 10235 gene locus_tag LOCUS_34170 8685 10235 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_34170 10306 12495 gene locus_tag LOCUS_34180 10306 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 13620 12589 gene locus_tag LOCUS_34190 gene recA 13620 12589 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314063.1 protein_id gnl|my_center|LOCUS_34190 13802 14875 gene locus_tag LOCUS_34200 13802 14875 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_34200 15012 16004 gene locus_tag LOCUS_34210 15012 16004 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence109 470 249 gene locus_tag LOCUS_34220 470 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 668 1993 gene locus_tag LOCUS_34230 gene mdrR2 668 1993 CDS product transcriptional regulator MdrR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106149.1 protein_id gnl|my_center|LOCUS_34230 4012 1997 gene locus_tag LOCUS_34240 4012 1997 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742782.1 protein_id gnl|my_center|LOCUS_34240 4094 4477 gene locus_tag LOCUS_34250 4094 4477 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640138.1 protein_id gnl|my_center|LOCUS_34250 4541 4975 gene locus_tag LOCUS_34260 4541 4975 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766833.1 protein_id gnl|my_center|LOCUS_34260 5027 5764 gene locus_tag LOCUS_34270 5027 5764 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530159.1 protein_id gnl|my_center|LOCUS_34270 5761 6063 gene locus_tag LOCUS_34280 5761 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 7773 6082 gene locus_tag LOCUS_34290 7773 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 8029 8601 gene locus_tag LOCUS_34300 8029 8601 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918545.1 protein_id gnl|my_center|LOCUS_34300 10247 8655 gene locus_tag LOCUS_34310 10247 8655 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_34310 10416 11285 gene locus_tag LOCUS_34320 10416 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34320 11182 11967 gene locus_tag LOCUS_34330 11182 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34330 12255 14003 gene locus_tag LOCUS_34340 12255 14003 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085850.1 protein_id gnl|my_center|LOCUS_34340 14014 15009 gene locus_tag LOCUS_34350 14014 15009 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_34350 15009 16115 gene locus_tag LOCUS_34360 15009 16115 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388688.1 protein_id gnl|my_center|LOCUS_34360 >Feature sequence110 125 922 gene locus_tag LOCUS_34370 125 922 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_34370 928 1617 gene locus_tag LOCUS_34380 928 1617 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_34380 1617 2675 gene locus_tag LOCUS_34390 1617 2675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812767.1 protein_id gnl|my_center|LOCUS_34390 2733 3779 gene locus_tag LOCUS_34400 2733 3779 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926370.1 protein_id gnl|my_center|LOCUS_34400 3945 5675 gene locus_tag LOCUS_34410 3945 5675 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930994.1 protein_id gnl|my_center|LOCUS_34410 5702 6658 gene locus_tag LOCUS_34420 5702 6658 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_34420 6655 7128 gene locus_tag LOCUS_34430 6655 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 7132 8622 gene locus_tag LOCUS_34440 7132 8622 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969453.1 protein_id gnl|my_center|LOCUS_34440 8622 9980 gene locus_tag LOCUS_34450 8622 9980 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_34450 9983 10729 gene locus_tag LOCUS_34460 9983 10729 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_34460 10740 11516 gene locus_tag LOCUS_34470 10740 11516 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105427165.1 protein_id gnl|my_center|LOCUS_34470 11597 13402 gene locus_tag LOCUS_34480 11597 13402 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_34480 13399 15483 gene locus_tag LOCUS_34490 13399 15483 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_34490 15754 15485 gene locus_tag LOCUS_34500 15754 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence111 3068 477 gene locus_tag LOCUS_34510 gene clpB 3068 477 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_34510 3209 3997 gene locus_tag LOCUS_34520 3209 3997 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_34520 4444 4031 gene locus_tag LOCUS_34530 4444 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 5537 4692 gene locus_tag LOCUS_34540 gene prmC 5537 4692 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_34540 6604 5534 gene locus_tag LOCUS_34550 gene prfA 6604 5534 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597801.1 protein_id gnl|my_center|LOCUS_34550 7830 6601 gene locus_tag LOCUS_34560 gene hemA 7830 6601 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626014.1 protein_id gnl|my_center|LOCUS_34560 8967 7840 gene locus_tag LOCUS_34570 gene ispG 8967 7840 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388505.1 protein_id gnl|my_center|LOCUS_34570 10081 9035 gene locus_tag LOCUS_34580 10081 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 12499 10241 gene locus_tag LOCUS_34590 gene ptsP 12499 10241 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_34590 13566 12499 gene locus_tag LOCUS_34600 13566 12499 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_34600 14767 13547 gene locus_tag LOCUS_34610 14767 13547 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_34610 14931 15617 gene locus_tag LOCUS_34620 gene ubiG 14931 15617 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence112 2598 133 gene locus_tag LOCUS_34630 2598 133 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890485.1 protein_id gnl|my_center|LOCUS_34630 3468 2722 gene locus_tag LOCUS_34640 3468 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 3546 5120 gene locus_tag LOCUS_34650 3546 5120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376440.1 protein_id gnl|my_center|LOCUS_34650 5122 6630 gene locus_tag LOCUS_34660 5122 6630 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064463.1 protein_id gnl|my_center|LOCUS_34660 6940 6635 gene locus_tag LOCUS_34670 6940 6635 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_34670 7261 6965 gene locus_tag LOCUS_34680 7261 6965 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969011.1 protein_id gnl|my_center|LOCUS_34680 7488 9455 gene locus_tag LOCUS_34690 gene tkt 7488 9455 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388353.1 protein_id gnl|my_center|LOCUS_34690 9458 9991 gene locus_tag LOCUS_34700 9458 9991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_34700 10022 11029 gene locus_tag LOCUS_34710 gene gap 10022 11029 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387975.1 protein_id gnl|my_center|LOCUS_34710 11120 11449 gene locus_tag LOCUS_34720 11120 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 11481 11843 gene locus_tag LOCUS_34730 11481 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 11916 12845 gene locus_tag LOCUS_34740 11916 12845 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_34740 12908 13468 gene locus_tag LOCUS_34750 gene thiE 12908 13468 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_34750 13501 14235 gene locus_tag LOCUS_34760 13501 14235 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 protein_id gnl|my_center|LOCUS_34760 14426 14232 gene locus_tag LOCUS_34770 14426 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 15007 14351 gene locus_tag LOCUS_34780 15007 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 15422 15015 gene locus_tag LOCUS_34790 15422 15015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 >Feature sequence113 1174 629 gene locus_tag LOCUS_34800 1174 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 2302 1268 gene locus_tag LOCUS_34810 2302 1268 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_34810 2402 3700 gene locus_tag LOCUS_34820 2402 3700 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 protein_id gnl|my_center|LOCUS_34820 3722 4915 gene locus_tag LOCUS_34830 3722 4915 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 protein_id gnl|my_center|LOCUS_34830 5827 4955 gene locus_tag LOCUS_34840 5827 4955 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930228.1 protein_id gnl|my_center|LOCUS_34840 6222 5833 gene locus_tag LOCUS_34850 6222 5833 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808835.1 protein_id gnl|my_center|LOCUS_34850 7261 6263 gene locus_tag LOCUS_34860 7261 6263 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 protein_id gnl|my_center|LOCUS_34860 8223 7258 gene locus_tag LOCUS_34870 8223 7258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_34870 9101 8220 gene locus_tag LOCUS_34880 9101 8220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816047.1 protein_id gnl|my_center|LOCUS_34880 10072 9101 gene locus_tag LOCUS_34890 10072 9101 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816048.1 protein_id gnl|my_center|LOCUS_34890 10799 10098 gene locus_tag LOCUS_34900 10799 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 10887 11429 gene locus_tag LOCUS_34910 10887 11429 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211412893.1 protein_id gnl|my_center|LOCUS_34910 11435 13024 gene locus_tag LOCUS_34920 11435 13024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816050.1 protein_id gnl|my_center|LOCUS_34920 13081 14037 gene locus_tag LOCUS_34930 13081 14037 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311984.1 protein_id gnl|my_center|LOCUS_34930 14034 15068 gene locus_tag LOCUS_34940 14034 15068 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731241.1 protein_id gnl|my_center|LOCUS_34940 15253 15065 gene locus_tag LOCUS_34950 15253 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 >Feature sequence114 1384 233 gene locus_tag LOCUS_34960 1384 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 2735 1518 gene locus_tag LOCUS_34970 2735 1518 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132624759.1 protein_id gnl|my_center|LOCUS_34970 2815 3288 gene locus_tag LOCUS_34980 2815 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 3320 4747 gene locus_tag LOCUS_34990 3320 4747 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193636.1 protein_id gnl|my_center|LOCUS_34990 4767 5513 gene locus_tag LOCUS_35000 4767 5513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522426.1 protein_id gnl|my_center|LOCUS_35000 6636 5515 gene locus_tag LOCUS_35010 gene nhaA 6636 5515 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166980.1 protein_id gnl|my_center|LOCUS_35010 8777 6768 gene locus_tag LOCUS_35020 8777 6768 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 protein_id gnl|my_center|LOCUS_35020 9824 8862 gene locus_tag LOCUS_35030 9824 8862 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_35030 9951 10601 gene locus_tag LOCUS_35040 9951 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 10598 12193 gene locus_tag LOCUS_35050 10598 12193 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917973.1 protein_id gnl|my_center|LOCUS_35050 13039 12203 gene locus_tag LOCUS_35060 13039 12203 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312205.1 protein_id gnl|my_center|LOCUS_35060 13296 13096 gene locus_tag LOCUS_35070 13296 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 14570 13299 gene locus_tag LOCUS_35080 gene rng 14570 13299 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650682.1 protein_id gnl|my_center|LOCUS_35080 15154 14567 gene locus_tag LOCUS_35090 15154 14567 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence115 1579 437 gene locus_tag LOCUS_35100 1579 437 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037469338.1 protein_id gnl|my_center|LOCUS_35100 2142 1576 gene locus_tag LOCUS_35110 2142 1576 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974715.1 protein_id gnl|my_center|LOCUS_35110 3203 2139 gene locus_tag LOCUS_35120 3203 2139 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625896.1 protein_id gnl|my_center|LOCUS_35120 3671 3207 gene locus_tag LOCUS_35130 3671 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4521 3679 gene locus_tag LOCUS_35140 4521 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 5751 4531 gene locus_tag LOCUS_35150 5751 4531 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_35150 7015 5759 gene locus_tag LOCUS_35160 7015 5759 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_35160 7183 9831 gene locus_tag LOCUS_35170 7183 9831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 protein_id gnl|my_center|LOCUS_35170 9844 10308 gene locus_tag LOCUS_35180 9844 10308 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310720.1 protein_id gnl|my_center|LOCUS_35180 10457 10945 gene locus_tag LOCUS_35190 10457 10945 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 protein_id gnl|my_center|LOCUS_35190 11546 10989 gene locus_tag LOCUS_35200 11546 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 11790 11575 gene locus_tag LOCUS_35210 11790 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 12936 11794 gene locus_tag LOCUS_35220 12936 11794 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_35220 12972 13754 gene locus_tag LOCUS_35230 12972 13754 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088574.1 protein_id gnl|my_center|LOCUS_35230 13765 14412 gene locus_tag LOCUS_35240 13765 14412 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171713470.1 protein_id gnl|my_center|LOCUS_35240 14969 14406 gene locus_tag LOCUS_35250 14969 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence116 1510 104 gene locus_tag LOCUS_35260 1510 104 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_35260 2265 1546 gene locus_tag LOCUS_35270 2265 1546 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015930683.1 protein_id gnl|my_center|LOCUS_35270 3642 2269 gene locus_tag LOCUS_35280 3642 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 5458 3653 gene locus_tag LOCUS_35290 5458 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 6345 5455 gene locus_tag LOCUS_35300 gene hemC 6345 5455 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_35300 6455 7234 gene locus_tag LOCUS_35310 6455 7234 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186890.1 protein_id gnl|my_center|LOCUS_35310 7293 8441 gene locus_tag LOCUS_35320 7293 8441 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_35320 8922 8434 gene locus_tag LOCUS_35330 8922 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 9006 9434 gene locus_tag LOCUS_35340 gene flgC 9006 9434 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870081.1 protein_id gnl|my_center|LOCUS_35340 9522 9848 gene locus_tag LOCUS_35350 9522 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086330.1 protein_id gnl|my_center|LOCUS_35350 10128 12332 gene locus_tag LOCUS_35360 10128 12332 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063786.1 protein_id gnl|my_center|LOCUS_35360 12329 13117 gene locus_tag LOCUS_35370 gene fabG 12329 13117 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 protein_id gnl|my_center|LOCUS_35370 13114 13878 gene locus_tag LOCUS_35380 gene fabG 13114 13878 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225822.1 protein_id gnl|my_center|LOCUS_35380 14351 13938 gene locus_tag LOCUS_35390 gene ros 14351 13938 CDS product MucR family transcriptional regulator Ros inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509257.1 protein_id gnl|my_center|LOCUS_35390 14881 14348 gene locus_tag LOCUS_35400 14881 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence117 2737 254 gene locus_tag LOCUS_35410 gene hrpB 2737 254 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_35410 3787 2765 gene locus_tag LOCUS_35420 3787 2765 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085506.1 protein_id gnl|my_center|LOCUS_35420 3963 5891 gene locus_tag LOCUS_35430 3963 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 6254 5895 gene locus_tag LOCUS_35440 6254 5895 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397337.1 protein_id gnl|my_center|LOCUS_35440 6813 6271 gene locus_tag LOCUS_35450 6813 6271 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919514.1 protein_id gnl|my_center|LOCUS_35450 6706 6936 gene locus_tag LOCUS_35460 6706 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 7001 7513 gene locus_tag LOCUS_35470 7001 7513 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 protein_id gnl|my_center|LOCUS_35470 7515 7925 gene locus_tag LOCUS_35480 7515 7925 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_35480 7954 8307 gene locus_tag LOCUS_35490 7954 8307 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967099.1 protein_id gnl|my_center|LOCUS_35490 8304 8798 gene locus_tag LOCUS_35500 8304 8798 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_35500 9496 8795 gene locus_tag LOCUS_35510 9496 8795 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967553.1 protein_id gnl|my_center|LOCUS_35510 10972 9551 gene locus_tag LOCUS_35520 10972 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 11071 12297 gene locus_tag LOCUS_35530 11071 12297 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_35530 12298 14010 gene locus_tag LOCUS_35540 12298 14010 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_35540 14984 14064 gene locus_tag LOCUS_35550 14984 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence118 2379 1096 gene locus_tag LOCUS_35560 2379 1096 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_35560 2916 2383 gene locus_tag LOCUS_35570 2916 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3929 2943 gene locus_tag LOCUS_35580 3929 2943 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384578.1 protein_id gnl|my_center|LOCUS_35580 4112 5011 gene locus_tag LOCUS_35590 4112 5011 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 protein_id gnl|my_center|LOCUS_35590 5111 6709 gene locus_tag LOCUS_35600 5111 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 6720 8360 gene locus_tag LOCUS_35610 6720 8360 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 protein_id gnl|my_center|LOCUS_35610 8377 9372 gene locus_tag LOCUS_35620 8377 9372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_35620 9359 10264 gene locus_tag LOCUS_35630 9359 10264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969954.1 protein_id gnl|my_center|LOCUS_35630 10261 11232 gene locus_tag LOCUS_35640 10261 11232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_35640 11225 12208 gene locus_tag LOCUS_35650 11225 12208 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_35650 12283 13521 gene locus_tag LOCUS_35660 12283 13521 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_35660 13521 14771 gene locus_tag LOCUS_35670 13521 14771 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence119 701 327 gene locus_tag LOCUS_35680 701 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 907 722 gene locus_tag LOCUS_35690 907 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1582 917 gene locus_tag LOCUS_35700 1582 917 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605277.1 protein_id gnl|my_center|LOCUS_35700 2351 1605 gene locus_tag LOCUS_35710 2351 1605 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_35710 3094 2363 gene locus_tag LOCUS_35720 3094 2363 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968041.1 protein_id gnl|my_center|LOCUS_35720 4679 3177 gene locus_tag LOCUS_35730 4679 3177 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_35730 5791 4676 gene locus_tag LOCUS_35740 5791 4676 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_35740 5925 6869 gene locus_tag LOCUS_35750 5925 6869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_35750 6862 7755 gene locus_tag LOCUS_35760 6862 7755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_35760 7752 8723 gene locus_tag LOCUS_35770 7752 8723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_35770 8720 9706 gene locus_tag LOCUS_35780 8720 9706 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_35780 9716 10651 gene locus_tag LOCUS_35790 9716 10651 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530436.1 protein_id gnl|my_center|LOCUS_35790 11357 10659 gene locus_tag LOCUS_35800 11357 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 11616 11392 gene locus_tag LOCUS_35810 11616 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 11688 12134 gene locus_tag LOCUS_35820 11688 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 12812 12117 gene locus_tag LOCUS_35830 12812 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 13589 12975 gene locus_tag LOCUS_35840 gene rpsD 13589 12975 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088452.1 protein_id gnl|my_center|LOCUS_35840 13820 14995 gene locus_tag LOCUS_35850 13820 14995 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969374.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence120 238 429 gene locus_tag LOCUS_35860 238 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 426 1553 gene locus_tag LOCUS_35870 426 1553 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331975.1 protein_id gnl|my_center|LOCUS_35870 1875 2120 gene locus_tag LOCUS_35880 1875 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 6275 2217 gene locus_tag LOCUS_35890 6275 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221109609.1 protein_id gnl|my_center|LOCUS_35890 6365 6979 gene locus_tag LOCUS_35900 6365 6979 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_35900 6976 7899 gene locus_tag LOCUS_35910 6976 7899 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_35910 8271 8196 gene locus_tag LOCUS_t00320 8271 8196 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8304 9275 gene locus_tag LOCUS_35920 8304 9275 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 protein_id gnl|my_center|LOCUS_35920 9900 9277 gene locus_tag LOCUS_35930 gene def 9900 9277 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_35930 11680 9917 gene locus_tag LOCUS_35940 gene recJ 11680 9917 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_35940 12680 11685 gene locus_tag LOCUS_35950 gene glpX 12680 11685 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022558.1 protein_id gnl|my_center|LOCUS_35950 13995 12703 gene locus_tag LOCUS_35960 13995 12703 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_35960 14465 14103 gene locus_tag LOCUS_35970 14465 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 14529 14828 gene locus_tag LOCUS_35980 14529 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence121 3 335 gene locus_tag LOCUS_35990 3 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 336 1001 gene locus_tag LOCUS_36000 336 1001 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_36000 998 2434 gene locus_tag LOCUS_36010 998 2434 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089082.1 protein_id gnl|my_center|LOCUS_36010 2431 3885 gene locus_tag LOCUS_36020 2431 3885 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_36020 3882 4421 gene locus_tag LOCUS_36030 3882 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 4990 4418 gene locus_tag LOCUS_36040 4990 4418 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556057.1 protein_id gnl|my_center|LOCUS_36040 5130 5933 gene locus_tag LOCUS_36050 5130 5933 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_36050 6594 5866 gene locus_tag LOCUS_36060 6594 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36060 6834 7406 gene locus_tag LOCUS_36070 6834 7406 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389806.1 protein_id gnl|my_center|LOCUS_36070 7403 7858 gene locus_tag LOCUS_36080 7403 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 7949 9988 gene locus_tag LOCUS_36090 7949 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 9998 10864 gene locus_tag LOCUS_36100 9998 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 12559 10994 gene locus_tag LOCUS_36110 12559 10994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 protein_id gnl|my_center|LOCUS_36110 13593 12556 gene locus_tag LOCUS_36120 13593 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 14218 13790 gene locus_tag LOCUS_36130 14218 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 14690 14307 gene locus_tag LOCUS_36140 14690 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 >Feature sequence122 342 1925 gene locus_tag LOCUS_36150 342 1925 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_36150 1991 2230 gene locus_tag LOCUS_36160 1991 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 3795 2227 gene locus_tag LOCUS_36170 3795 2227 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809014.1 protein_id gnl|my_center|LOCUS_36170 5285 3807 gene locus_tag LOCUS_36180 5285 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 6103 5282 gene locus_tag LOCUS_36190 6103 5282 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_36190 7183 6104 gene locus_tag LOCUS_36200 7183 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 8153 7191 gene locus_tag LOCUS_36210 8153 7191 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086129.1 protein_id gnl|my_center|LOCUS_36210 9127 8150 gene locus_tag LOCUS_36220 9127 8150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868769.1 protein_id gnl|my_center|LOCUS_36220 9993 9124 gene locus_tag LOCUS_36230 9993 9124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_36230 10922 9990 gene locus_tag LOCUS_36240 10922 9990 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_36240 12533 10983 gene locus_tag LOCUS_36250 12533 10983 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_36250 14115 12661 gene locus_tag LOCUS_36260 14115 12661 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_36260 >Feature sequence123 <1 1021 gene locus_tag LOCUS_36270 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104537.1:phage terminase large subunit family protein 1028 1237 gene locus_tag LOCUS_36280 1028 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 1240 2742 gene locus_tag LOCUS_36290 1240 2742 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_36290 2787 4028 gene locus_tag LOCUS_36300 2787 4028 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339479.1 protein_id gnl|my_center|LOCUS_36300 4075 4464 gene locus_tag LOCUS_36310 4075 4464 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339610.1 protein_id gnl|my_center|LOCUS_36310 4588 5610 gene locus_tag LOCUS_36320 4588 5610 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 protein_id gnl|my_center|LOCUS_36320 5646 5960 gene locus_tag LOCUS_36330 5646 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 5957 6616 gene locus_tag LOCUS_36340 5957 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 6613 7044 gene locus_tag LOCUS_36350 6613 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 7090 8031 gene locus_tag LOCUS_36360 7090 8031 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939436.1 protein_id gnl|my_center|LOCUS_36360 8028 8387 gene locus_tag LOCUS_36370 8028 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 8387 8710 gene locus_tag LOCUS_36380 8387 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 8729 11266 gene locus_tag LOCUS_36390 8729 11266 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931433.1 protein_id gnl|my_center|LOCUS_36390 11693 11331 gene locus_tag LOCUS_36400 11693 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 11974 12453 gene locus_tag LOCUS_36410 11974 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 12489 13553 gene locus_tag LOCUS_36420 12489 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 13570 14433 gene locus_tag LOCUS_36430 13570 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 >Feature sequence124 291 1088 gene locus_tag LOCUS_36440 291 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 1188 1412 gene locus_tag LOCUS_36450 1188 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 1418 1729 gene locus_tag LOCUS_36460 1418 1729 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921080.1 protein_id gnl|my_center|LOCUS_36460 1876 2481 gene locus_tag LOCUS_36470 1876 2481 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388839.1 protein_id gnl|my_center|LOCUS_36470 2478 3290 gene locus_tag LOCUS_36480 2478 3290 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_36480 3775 3287 gene locus_tag LOCUS_36490 3775 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 4385 3801 gene locus_tag LOCUS_36500 4385 3801 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_36500 4631 5380 gene locus_tag LOCUS_36510 4631 5380 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_36510 5391 5888 gene locus_tag LOCUS_36520 gene ruvC 5391 5888 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_36520 5885 6511 gene locus_tag LOCUS_36530 gene ruvA 5885 6511 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_36530 6508 7554 gene locus_tag LOCUS_36540 gene ruvB 6508 7554 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_36540 7547 7975 gene locus_tag LOCUS_36550 gene ybgC 7547 7975 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_36550 7976 8707 gene locus_tag LOCUS_36560 7976 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 8715 9197 gene locus_tag LOCUS_36570 gene tolR 8715 9197 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_36570 9202 10203 gene locus_tag LOCUS_36580 9202 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 10203 11567 gene locus_tag LOCUS_36590 gene tolB 10203 11567 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_36590 11749 12249 gene locus_tag LOCUS_36600 gene pal 11749 12249 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089884.1 protein_id gnl|my_center|LOCUS_36600 12360 13370 gene locus_tag LOCUS_36610 gene ybgF 12360 13370 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_36610 13381 14658 gene locus_tag LOCUS_36620 13381 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence125 521 69 gene locus_tag LOCUS_36630 521 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 652 1761 gene locus_tag LOCUS_36640 652 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2684 1758 gene locus_tag LOCUS_36650 2684 1758 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_36650 3229 2681 gene locus_tag LOCUS_36660 3229 2681 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258952.1 protein_id gnl|my_center|LOCUS_36660 3346 4557 gene locus_tag LOCUS_36670 3346 4557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_36670 5060 4554 gene locus_tag LOCUS_36680 5060 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 6585 5167 gene locus_tag LOCUS_36690 6585 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 7383 6589 gene locus_tag LOCUS_36700 7383 6589 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258152.1 protein_id gnl|my_center|LOCUS_36700 7476 8087 gene locus_tag LOCUS_36710 7476 8087 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_36710 8937 8008 gene locus_tag LOCUS_36720 8937 8008 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967364.1 protein_id gnl|my_center|LOCUS_36720 9689 8934 gene locus_tag LOCUS_36730 gene ppk2 9689 8934 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921245.1 protein_id gnl|my_center|LOCUS_36730 10618 9713 gene locus_tag LOCUS_36740 10618 9713 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_36740 12232 10622 gene locus_tag LOCUS_36750 12232 10622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965309.1 protein_id gnl|my_center|LOCUS_36750 13065 12229 gene locus_tag LOCUS_36760 13065 12229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_36760 14036 13062 gene locus_tag LOCUS_36770 14036 13062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039518.1 protein_id gnl|my_center|LOCUS_36770 14246 14512 gene locus_tag LOCUS_36780 14246 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 >Feature sequence126 955 527 gene locus_tag LOCUS_36790 955 527 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 protein_id gnl|my_center|LOCUS_36790 1453 1034 gene locus_tag LOCUS_36800 1453 1034 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921478.1 protein_id gnl|my_center|LOCUS_36800 2106 1567 gene locus_tag LOCUS_36810 gene kdpF 2106 1567 CDS product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_36810 2574 2134 gene locus_tag LOCUS_36820 2574 2134 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509099.1 protein_id gnl|my_center|LOCUS_36820 3022 2669 gene locus_tag LOCUS_36830 3022 2669 CDS product DUF1428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966868.1 protein_id gnl|my_center|LOCUS_36830 3164 4132 gene locus_tag LOCUS_36840 3164 4132 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_36840 4207 5775 gene locus_tag LOCUS_36850 4207 5775 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930581.1 protein_id gnl|my_center|LOCUS_36850 6634 5786 gene locus_tag LOCUS_36860 6634 5786 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_36860 6859 7068 gene locus_tag LOCUS_36870 6859 7068 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173969.1 protein_id gnl|my_center|LOCUS_36870 7217 8185 gene locus_tag LOCUS_36880 7217 8185 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_36880 8387 8581 gene locus_tag LOCUS_36890 8387 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 8597 9772 gene locus_tag LOCUS_36900 8597 9772 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389823.1 protein_id gnl|my_center|LOCUS_36900 10345 9884 gene locus_tag LOCUS_36910 10345 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 11313 10342 gene locus_tag LOCUS_36920 11313 10342 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339517.1 protein_id gnl|my_center|LOCUS_36920 12281 11406 gene locus_tag LOCUS_36930 12281 11406 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_36930 13251 12301 gene locus_tag LOCUS_36940 13251 12301 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_36940 14309 13359 gene locus_tag LOCUS_36950 14309 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36950 >Feature sequence127 <1 500 gene locus_tag LOCUS_36960 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531218.1:ABC transporter substrate-binding protein 577 1521 gene locus_tag LOCUS_36970 577 1521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 protein_id gnl|my_center|LOCUS_36970 1518 2360 gene locus_tag LOCUS_36980 1518 2360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 protein_id gnl|my_center|LOCUS_36980 2360 3328 gene locus_tag LOCUS_36990 2360 3328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966043.1 protein_id gnl|my_center|LOCUS_36990 3325 4305 gene locus_tag LOCUS_37000 3325 4305 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 protein_id gnl|my_center|LOCUS_37000 4372 6081 gene locus_tag LOCUS_37010 4372 6081 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_37010 7132 6083 gene locus_tag LOCUS_37020 7132 6083 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087060.1 protein_id gnl|my_center|LOCUS_37020 9207 7129 gene locus_tag LOCUS_37030 9207 7129 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 protein_id gnl|my_center|LOCUS_37030 10183 9209 gene locus_tag LOCUS_37040 10183 9209 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_37040 10587 10186 gene locus_tag LOCUS_37050 10587 10186 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883997.1 protein_id gnl|my_center|LOCUS_37050 10957 10571 gene locus_tag LOCUS_37060 10957 10571 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_37060 11276 10950 gene locus_tag LOCUS_37070 11276 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37070 11831 11280 gene locus_tag LOCUS_37080 11831 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37080 12402 12091 gene locus_tag LOCUS_37090 12402 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 13664 12456 gene locus_tag LOCUS_37100 13664 12456 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 protein_id gnl|my_center|LOCUS_37100 13380 13281 gene locus_tag LOCUS_t00330 13380 13281 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13749 14051 gene locus_tag LOCUS_37110 13749 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence128 37 113 gene locus_tag LOCUS_t00340 37 113 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1515 136 gene locus_tag LOCUS_37120 gene pelG 1515 136 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_37120 3050 1515 gene locus_tag LOCUS_37130 gene pelF 3050 1515 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_37130 4165 3050 gene locus_tag LOCUS_37140 4165 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 5516 4152 gene locus_tag LOCUS_37150 5516 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 6085 5513 gene locus_tag LOCUS_37160 6085 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 7818 6073 gene locus_tag LOCUS_37170 7818 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 11198 7911 gene locus_tag LOCUS_37180 11198 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 13375 11198 gene locus_tag LOCUS_37190 13375 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 14214 13450 gene locus_tag LOCUS_37200 14214 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence129 1459 146 gene locus_tag LOCUS_37210 1459 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 1489 1782 gene locus_tag LOCUS_37220 1489 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4166 1788 gene locus_tag LOCUS_37230 4166 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 7902 4168 gene locus_tag LOCUS_37240 7902 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 9640 7904 gene locus_tag LOCUS_37250 9640 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 11545 9641 gene locus_tag LOCUS_37260 11545 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 13185 11542 gene locus_tag LOCUS_37270 13185 11542 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148065091.1 protein_id gnl|my_center|LOCUS_37270 14030 13197 gene locus_tag LOCUS_37280 14030 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence130 2 970 gene locus_tag LOCUS_37290 2 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1048 2001 gene locus_tag LOCUS_37300 1048 2001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_37300 1985 2899 gene locus_tag LOCUS_37310 1985 2899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_37310 2903 3919 gene locus_tag LOCUS_37320 2903 3919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_37320 3916 4923 gene locus_tag LOCUS_37330 3916 4923 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_37330 4923 6119 gene locus_tag LOCUS_37340 4923 6119 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 protein_id gnl|my_center|LOCUS_37340 6204 7787 gene locus_tag LOCUS_37350 6204 7787 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_37350 8952 7843 gene locus_tag LOCUS_37360 8952 7843 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382304.1 protein_id gnl|my_center|LOCUS_37360 10464 8962 gene locus_tag LOCUS_37370 10464 8962 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_37370 10593 11456 gene locus_tag LOCUS_37380 10593 11456 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212063.1 protein_id gnl|my_center|LOCUS_37380 11467 12621 gene locus_tag LOCUS_37390 11467 12621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_37390 12854 12618 gene locus_tag LOCUS_37400 12854 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 13947 12976 gene locus_tag LOCUS_37410 13947 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence131 1217 180 gene locus_tag LOCUS_37420 1217 180 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_37420 2256 1210 gene locus_tag LOCUS_37430 2256 1210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_37430 3163 2276 gene locus_tag LOCUS_37440 3163 2276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 protein_id gnl|my_center|LOCUS_37440 4139 3192 gene locus_tag LOCUS_37450 4139 3192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_37450 5227 4445 gene locus_tag LOCUS_37460 5227 4445 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 protein_id gnl|my_center|LOCUS_37460 5315 5776 gene locus_tag LOCUS_37470 5315 5776 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_37470 5779 6243 gene locus_tag LOCUS_37480 5779 6243 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_37480 7057 6284 gene locus_tag LOCUS_37490 7057 6284 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970254.1 protein_id gnl|my_center|LOCUS_37490 7161 8324 gene locus_tag LOCUS_37500 7161 8324 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_37500 8327 9805 gene locus_tag LOCUS_37510 8327 9805 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064557.1 protein_id gnl|my_center|LOCUS_37510 9802 11271 gene locus_tag LOCUS_37520 9802 11271 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814774.1 protein_id gnl|my_center|LOCUS_37520 11275 12675 gene locus_tag LOCUS_37530 11275 12675 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_37530 12678 13481 gene locus_tag LOCUS_37540 12678 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 13562 13918 gene locus_tag LOCUS_37550 13562 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence132 711 82 gene locus_tag LOCUS_37560 711 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 1018 713 gene locus_tag LOCUS_37570 1018 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1339 1028 gene locus_tag LOCUS_37580 1339 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 1626 1336 gene locus_tag LOCUS_37590 1626 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 1833 2237 gene locus_tag LOCUS_37600 gene flgB 1833 2237 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640104.1 protein_id gnl|my_center|LOCUS_37600 2262 2672 gene locus_tag LOCUS_37610 gene flgC 2262 2672 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 protein_id gnl|my_center|LOCUS_37610 2693 3016 gene locus_tag LOCUS_37620 2693 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 3632 3054 gene locus_tag LOCUS_37630 3632 3054 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_37630 4930 3629 gene locus_tag LOCUS_37640 4930 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37640 5456 4932 gene locus_tag LOCUS_37650 5456 4932 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_37650 6247 5444 gene locus_tag LOCUS_37660 6247 5444 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_37660 6322 6642 gene locus_tag LOCUS_37670 gene sugE 6322 6642 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 protein_id gnl|my_center|LOCUS_37670 6647 7081 gene locus_tag LOCUS_37680 6647 7081 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_37680 7078 8142 gene locus_tag LOCUS_37690 7078 8142 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_37690 8253 9254 gene locus_tag LOCUS_37700 8253 9254 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_37700 9395 9865 gene locus_tag LOCUS_37710 gene rplM 9395 9865 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529229.1 protein_id gnl|my_center|LOCUS_37710 9868 10338 gene locus_tag LOCUS_37720 gene rpsI 9868 10338 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_37720 10416 10958 gene locus_tag LOCUS_37730 10416 10958 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_37730 11022 11246 gene locus_tag LOCUS_37740 11022 11246 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_37740 11243 11629 gene locus_tag LOCUS_37750 11243 11629 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_37750 13441 11633 gene locus_tag LOCUS_37760 gene phaC 13441 11633 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence133 956 396 gene locus_tag LOCUS_37770 956 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 1645 956 gene locus_tag LOCUS_37780 1645 956 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_37780 1702 2511 gene locus_tag LOCUS_37790 1702 2511 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_37790 4077 2536 gene locus_tag LOCUS_37800 4077 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4538 4230 gene locus_tag LOCUS_37810 4538 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 6099 4654 gene locus_tag LOCUS_37820 6099 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 6594 6106 gene locus_tag LOCUS_37830 6594 6106 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141970.1 protein_id gnl|my_center|LOCUS_37830 7220 6591 gene locus_tag LOCUS_37840 7220 6591 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 protein_id gnl|my_center|LOCUS_37840 7886 7251 gene locus_tag LOCUS_37850 7886 7251 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_37850 8238 7936 gene locus_tag LOCUS_37860 8238 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 8551 8249 gene locus_tag LOCUS_37870 8551 8249 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_37870 9448 8621 gene locus_tag LOCUS_37880 9448 8621 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388729.1 protein_id gnl|my_center|LOCUS_37880 9846 9445 gene locus_tag LOCUS_37890 9846 9445 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388728.1 protein_id gnl|my_center|LOCUS_37890 9984 10793 gene locus_tag LOCUS_37900 9984 10793 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551585.1 protein_id gnl|my_center|LOCUS_37900 10864 11760 gene locus_tag LOCUS_37910 10864 11760 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_37910 11769 12536 gene locus_tag LOCUS_37920 11769 12536 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 protein_id gnl|my_center|LOCUS_37920 12541 13353 gene locus_tag LOCUS_37930 gene kynA 12541 13353 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530854.1 protein_id gnl|my_center|LOCUS_37930 >Feature sequence134 1043 126 gene locus_tag LOCUS_37940 1043 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 1477 1127 gene locus_tag LOCUS_37950 1477 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 3877 1532 gene locus_tag LOCUS_37960 3877 1532 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 protein_id gnl|my_center|LOCUS_37960 5487 3901 gene locus_tag LOCUS_37970 gene ggt 5487 3901 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_37970 5958 6269 gene locus_tag LOCUS_37980 5958 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 6329 6640 gene locus_tag LOCUS_37990 6329 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 6793 8262 gene locus_tag LOCUS_38000 6793 8262 CDS product IS1182-like element ISCc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918162.1 protein_id gnl|my_center|LOCUS_38000 9048 8566 gene locus_tag LOCUS_38010 9048 8566 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148772447.1 protein_id gnl|my_center|LOCUS_38010 11387 9858 gene locus_tag LOCUS_38020 11387 9858 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804536.1 protein_id gnl|my_center|LOCUS_38020 12176 11451 gene locus_tag LOCUS_38030 12176 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 13022 12264 gene locus_tag LOCUS_38040 13022 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38040 12969 13289 gene locus_tag LOCUS_38050 12969 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 <13862 13208 gene locus_tag LOCUS_38060 <13862 13208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971003.1:glucose-6-phosphate dehydrogenase >Feature sequence135 2228 633 gene locus_tag LOCUS_38070 2228 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3227 2328 gene locus_tag LOCUS_38080 3227 2328 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811054.1 protein_id gnl|my_center|LOCUS_38080 3410 4396 gene locus_tag LOCUS_38090 3410 4396 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735580.1 protein_id gnl|my_center|LOCUS_38090 4422 4943 gene locus_tag LOCUS_38100 4422 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 4947 6230 gene locus_tag LOCUS_38110 4947 6230 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_38110 6321 8408 gene locus_tag LOCUS_38120 6321 8408 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_38120 8405 10135 gene locus_tag LOCUS_38130 8405 10135 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_38130 10135 11727 gene locus_tag LOCUS_38140 10135 11727 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_38140 >Feature sequence136 189 575 gene locus_tag LOCUS_38150 189 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 611 940 gene locus_tag LOCUS_38160 611 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 1111 1449 gene locus_tag LOCUS_38170 1111 1449 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_38170 1536 2945 gene locus_tag LOCUS_38180 gene glnA 1536 2945 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_38180 3067 3840 gene locus_tag LOCUS_38190 3067 3840 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815979.1 protein_id gnl|my_center|LOCUS_38190 4616 3837 gene locus_tag LOCUS_38200 4616 3837 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_38200 4670 6028 gene locus_tag LOCUS_38210 4670 6028 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_38210 6097 7389 gene locus_tag LOCUS_38220 6097 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 7438 9303 gene locus_tag LOCUS_38230 7438 9303 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_38230 10624 9287 gene locus_tag LOCUS_38240 10624 9287 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_38240 11469 10627 gene locus_tag LOCUS_38250 11469 10627 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_38250 12486 11530 gene locus_tag LOCUS_38260 12486 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 12673 13641 gene locus_tag LOCUS_38270 gene hemB 12673 13641 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence137 713 1015 gene locus_tag LOCUS_38280 713 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 1031 1774 gene locus_tag LOCUS_38290 1031 1774 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533303.1 protein_id gnl|my_center|LOCUS_38290 2143 2067 gene locus_tag LOCUS_t00350 2143 2067 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3126 2143 gene locus_tag LOCUS_38300 3126 2143 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_38300 4124 3174 gene locus_tag LOCUS_38310 4124 3174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_38310 4205 4384 gene locus_tag LOCUS_38320 4205 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 4825 4391 gene locus_tag LOCUS_38330 4825 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 4955 7729 gene locus_tag LOCUS_38340 gene polA 4955 7729 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265962.1 protein_id gnl|my_center|LOCUS_38340 7805 8809 gene locus_tag LOCUS_38350 7805 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 11524 8810 gene locus_tag LOCUS_38360 11524 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 11727 12686 gene locus_tag LOCUS_38370 gene ppk2 11727 12686 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965809.1 protein_id gnl|my_center|LOCUS_38370 13740 12664 gene locus_tag LOCUS_38380 13740 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence138 990 226 gene locus_tag LOCUS_38390 990 226 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085178.1 protein_id gnl|my_center|LOCUS_38390 1977 1093 gene locus_tag LOCUS_38400 1977 1093 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_38400 2036 2830 gene locus_tag LOCUS_38410 2036 2830 CDS product fumarylacetoacetate (FAA) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532642.1 protein_id gnl|my_center|LOCUS_38410 3151 4461 gene locus_tag LOCUS_38420 3151 4461 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_38420 4541 6298 gene locus_tag LOCUS_38430 4541 6298 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_38430 6358 7395 gene locus_tag LOCUS_38440 6358 7395 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_38440 7409 8887 gene locus_tag LOCUS_38450 7409 8887 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_38450 8894 10336 gene locus_tag LOCUS_38460 8894 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 10380 11342 gene locus_tag LOCUS_38470 10380 11342 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_38470 11346 11849 gene locus_tag LOCUS_38480 11346 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 11846 13321 gene locus_tag LOCUS_38490 11846 13321 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence139 226 666 gene locus_tag LOCUS_38500 226 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 2874 670 gene locus_tag LOCUS_38510 2874 670 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_38510 3185 3931 gene locus_tag LOCUS_38520 3185 3931 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967118.1 protein_id gnl|my_center|LOCUS_38520 4828 3935 gene locus_tag LOCUS_38530 4828 3935 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086254.1 protein_id gnl|my_center|LOCUS_38530 4895 5851 gene locus_tag LOCUS_38540 4895 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 6601 5855 gene locus_tag LOCUS_38550 6601 5855 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086254.1 protein_id gnl|my_center|LOCUS_38550 6838 8346 gene locus_tag LOCUS_38560 6838 8346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_38560 8353 9270 gene locus_tag LOCUS_38570 8353 9270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348343.1 protein_id gnl|my_center|LOCUS_38570 9267 10151 gene locus_tag LOCUS_38580 9267 10151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383487.1 protein_id gnl|my_center|LOCUS_38580 11341 10274 gene locus_tag LOCUS_38590 11341 10274 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_38590 11416 13251 gene locus_tag LOCUS_38600 gene ilvD 11416 13251 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528037.1 protein_id gnl|my_center|LOCUS_38600 >Feature sequence140 128 1507 gene locus_tag LOCUS_38610 128 1507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_38610 1563 2015 gene locus_tag LOCUS_38620 1563 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 2018 2470 gene locus_tag LOCUS_38630 2018 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 4085 2508 gene locus_tag LOCUS_38640 4085 2508 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_38640 4896 4174 gene locus_tag LOCUS_38650 4896 4174 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 protein_id gnl|my_center|LOCUS_38650 4937 6979 gene locus_tag LOCUS_38660 4937 6979 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_38660 6976 8652 gene locus_tag LOCUS_38670 6976 8652 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_38670 8649 9809 gene locus_tag LOCUS_38680 8649 9809 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_38680 10084 9812 gene locus_tag LOCUS_38690 10084 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 10638 10964 gene locus_tag LOCUS_38700 10638 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 11049 13247 gene locus_tag LOCUS_38710 11049 13247 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813982.1 protein_id gnl|my_center|LOCUS_38710 >Feature sequence141 595 128 gene locus_tag LOCUS_38720 gene smpB 595 128 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_38720 1484 606 gene locus_tag LOCUS_38730 gene dapA 1484 606 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_38730 1629 3857 gene locus_tag LOCUS_38740 1629 3857 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_38740 3857 4546 gene locus_tag LOCUS_38750 3857 4546 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241077.1 protein_id gnl|my_center|LOCUS_38750 4575 5558 gene locus_tag LOCUS_38760 4575 5558 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_38760 5825 5607 gene locus_tag LOCUS_38770 5825 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 5709 6458 gene locus_tag LOCUS_38780 5709 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 6554 7159 gene locus_tag LOCUS_38790 6554 7159 CDS product YkoF family thiamine/hydroxymethylpyrimidine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173727.1 protein_id gnl|my_center|LOCUS_38790 7164 7733 gene locus_tag LOCUS_38800 7164 7733 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776332.1 protein_id gnl|my_center|LOCUS_38800 7723 9297 gene locus_tag LOCUS_38810 7723 9297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 protein_id gnl|my_center|LOCUS_38810 9294 9998 gene locus_tag LOCUS_38820 9294 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 10894 9995 gene locus_tag LOCUS_38830 10894 9995 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_38830 11689 10949 gene locus_tag LOCUS_38840 11689 10949 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532140.1 protein_id gnl|my_center|LOCUS_38840 12039 11752 gene locus_tag LOCUS_38850 gene groES 12039 11752 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975851.1 protein_id gnl|my_center|LOCUS_38850 12883 12344 gene locus_tag LOCUS_38860 12883 12344 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 protein_id gnl|my_center|LOCUS_38860 13302 12916 gene locus_tag LOCUS_38870 13302 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence142 306 857 gene locus_tag LOCUS_38880 306 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 925 1665 gene locus_tag LOCUS_38890 925 1665 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967723.1 protein_id gnl|my_center|LOCUS_38890 1776 3500 gene locus_tag LOCUS_38900 gene araD 1776 3500 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_38900 3503 4552 gene locus_tag LOCUS_38910 3503 4552 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_38910 4601 5668 gene locus_tag LOCUS_38920 gene ugpC 4601 5668 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086694.1 protein_id gnl|my_center|LOCUS_38920 5699 7012 gene locus_tag LOCUS_38930 5699 7012 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244134.1 protein_id gnl|my_center|LOCUS_38930 7077 8024 gene locus_tag LOCUS_38940 7077 8024 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061268.1 protein_id gnl|my_center|LOCUS_38940 8017 8910 gene locus_tag LOCUS_38950 8017 8910 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244136.1 protein_id gnl|my_center|LOCUS_38950 8907 10019 gene locus_tag LOCUS_38960 8907 10019 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086669.1 protein_id gnl|my_center|LOCUS_38960 10109 10510 gene locus_tag LOCUS_38970 10109 10510 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918475.1 protein_id gnl|my_center|LOCUS_38970 10837 11958 gene locus_tag LOCUS_38980 10837 11958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211377.1 protein_id gnl|my_center|LOCUS_38980 11955 13004 gene locus_tag LOCUS_38990 11955 13004 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 protein_id gnl|my_center|LOCUS_38990 >Feature sequence143 547 419 gene locus_tag LOCUS_39000 547 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 954 1847 gene locus_tag LOCUS_39010 954 1847 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_39010 2394 1852 gene locus_tag LOCUS_39020 2394 1852 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967322.1 protein_id gnl|my_center|LOCUS_39020 2475 3983 gene locus_tag LOCUS_39030 2475 3983 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387893.1 protein_id gnl|my_center|LOCUS_39030 4029 4328 gene locus_tag LOCUS_39040 4029 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086330.1 protein_id gnl|my_center|LOCUS_39040 4360 6588 gene locus_tag LOCUS_39050 4360 6588 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_39050 6775 8442 gene locus_tag LOCUS_39060 gene pgi 6775 8442 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_39060 9323 8439 gene locus_tag LOCUS_39070 9323 8439 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_39070 9421 9852 gene locus_tag LOCUS_39080 9421 9852 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820995.1 protein_id gnl|my_center|LOCUS_39080 9945 11549 gene locus_tag LOCUS_39090 gene ggt 9945 11549 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_39090 11831 13042 gene locus_tag LOCUS_39100 11831 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 >Feature sequence144 <1 639 gene locus_tag LOCUS_39110 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172977944.1:IS630-like element ISRm10-1 family transposase 873 652 gene locus_tag LOCUS_39120 873 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 872 1840 gene locus_tag LOCUS_39130 872 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 2955 1837 gene locus_tag LOCUS_39140 gene modC 2955 1837 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_39140 3653 2952 gene locus_tag LOCUS_39150 gene modB 3653 2952 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531024.1 protein_id gnl|my_center|LOCUS_39150 4428 3655 gene locus_tag LOCUS_39160 gene modA 4428 3655 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 protein_id gnl|my_center|LOCUS_39160 5959 4481 gene locus_tag LOCUS_39170 5959 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 7185 5962 gene locus_tag LOCUS_39180 7185 5962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_39180 7916 7173 gene locus_tag LOCUS_39190 7916 7173 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_39190 8746 7913 gene locus_tag LOCUS_39200 8746 7913 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_39200 8854 10179 gene locus_tag LOCUS_39210 8854 10179 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968144.1 protein_id gnl|my_center|LOCUS_39210 11204 10185 gene locus_tag LOCUS_39220 11204 10185 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967441.1 protein_id gnl|my_center|LOCUS_39220 11331 12740 gene locus_tag LOCUS_39230 11331 12740 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence145 91 915 gene locus_tag LOCUS_39240 gene phhA 91 915 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_39240 971 1252 gene locus_tag LOCUS_39250 971 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 2380 1247 gene locus_tag LOCUS_39260 2380 1247 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_39260 3054 2374 gene locus_tag LOCUS_39270 3054 2374 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_39270 3455 3105 gene locus_tag LOCUS_39280 3455 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 3979 3452 gene locus_tag LOCUS_39290 3979 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 5151 3979 gene locus_tag LOCUS_39300 5151 3979 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_39300 5251 6459 gene locus_tag LOCUS_39310 5251 6459 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_39310 6456 6584 gene locus_tag LOCUS_39320 6456 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 8172 6601 gene locus_tag LOCUS_39330 8172 6601 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973887.1 protein_id gnl|my_center|LOCUS_39330 9284 8190 gene locus_tag LOCUS_39340 9284 8190 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_39340 9413 10045 gene locus_tag LOCUS_39350 9413 10045 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966858.1 protein_id gnl|my_center|LOCUS_39350 10817 10011 gene locus_tag LOCUS_39360 10817 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 11178 10846 gene locus_tag LOCUS_39370 11178 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 11318 11187 gene locus_tag LOCUS_39380 11318 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39380 12226 11318 gene locus_tag LOCUS_39390 12226 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39390 <12842 12211 gene locus_tag LOCUS_39400 <12842 12211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389748.1:magnesium transporter >Feature sequence146 316 831 gene locus_tag LOCUS_39410 316 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 836 2638 gene locus_tag LOCUS_39420 836 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 2675 2748 gene locus_tag LOCUS_t00360 2675 2748 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2807 4084 gene locus_tag LOCUS_39430 2807 4084 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_39430 4166 4504 gene locus_tag LOCUS_39440 4166 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 5569 4676 gene locus_tag LOCUS_39450 5569 4676 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_39450 6306 5569 gene locus_tag LOCUS_39460 6306 5569 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392579.1 protein_id gnl|my_center|LOCUS_39460 6455 6709 gene locus_tag LOCUS_39470 6455 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 6751 7413 gene locus_tag LOCUS_39480 6751 7413 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_39480 7624 12399 gene locus_tag LOCUS_39490 7624 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 12396 12632 gene locus_tag LOCUS_39500 12396 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence147 81 917 gene locus_tag LOCUS_39510 81 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 1013 1687 gene locus_tag LOCUS_39520 1013 1687 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_39520 1684 2490 gene locus_tag LOCUS_39530 gene pssA 1684 2490 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_39530 2492 3094 gene locus_tag LOCUS_39540 2492 3094 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705440.1 protein_id gnl|my_center|LOCUS_39540 6275 3099 gene locus_tag LOCUS_39550 6275 3099 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_39550 7351 6272 gene locus_tag LOCUS_39560 gene vmeJ 7351 6272 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_39560 7925 7362 gene locus_tag LOCUS_39570 7925 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 9000 8005 gene locus_tag LOCUS_39580 9000 8005 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104158.1 protein_id gnl|my_center|LOCUS_39580 9868 9011 gene locus_tag LOCUS_39590 9868 9011 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190287.1 protein_id gnl|my_center|LOCUS_39590 9909 10937 gene locus_tag LOCUS_39600 9909 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 10934 12553 gene locus_tag LOCUS_39610 10934 12553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_39610 >Feature sequence148 26 1195 gene locus_tag LOCUS_39620 26 1195 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_39620 1295 2215 gene locus_tag LOCUS_39630 1295 2215 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_39630 2215 3162 gene locus_tag LOCUS_39640 2215 3162 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_39640 3155 3904 gene locus_tag LOCUS_39650 3155 3904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_39650 3905 4600 gene locus_tag LOCUS_39660 3905 4600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_39660 4603 5025 gene locus_tag LOCUS_39670 4603 5025 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_39670 5025 5450 gene locus_tag LOCUS_39680 5025 5450 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_39680 5525 5914 gene locus_tag LOCUS_39690 5525 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 5966 7090 gene locus_tag LOCUS_39700 5966 7090 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_39700 7090 9435 gene locus_tag LOCUS_39710 7090 9435 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_39710 9438 11222 gene locus_tag LOCUS_39720 9438 11222 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_39720 11291 11367 gene locus_tag LOCUS_t00370 11291 11367 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence149 84 524 gene locus_tag LOCUS_39730 84 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 539 1765 gene locus_tag LOCUS_39740 539 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 1800 3602 gene locus_tag LOCUS_39750 1800 3602 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_39750 3800 5398 gene locus_tag LOCUS_39760 gene ggt 3800 5398 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_39760 5807 5454 gene locus_tag LOCUS_39770 5807 5454 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_39770 6779 5874 gene locus_tag LOCUS_39780 6779 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 8351 6786 gene locus_tag LOCUS_39790 8351 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 8481 9935 gene locus_tag LOCUS_39800 8481 9935 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_39800 9946 10770 gene locus_tag LOCUS_39810 9946 10770 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204467.1 protein_id gnl|my_center|LOCUS_39810 11318 10827 gene locus_tag LOCUS_39820 11318 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 >Feature sequence150 1049 159 gene locus_tag LOCUS_39830 1049 159 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_39830 1755 1057 gene locus_tag LOCUS_39840 1755 1057 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_39840 2233 1904 gene locus_tag LOCUS_39850 2233 1904 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 protein_id gnl|my_center|LOCUS_39850 2472 2230 gene locus_tag LOCUS_39860 2472 2230 CDS product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729843.1 protein_id gnl|my_center|LOCUS_39860 3224 2514 gene locus_tag LOCUS_39870 3224 2514 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_39870 3965 3228 gene locus_tag LOCUS_39880 gene thiD 3965 3228 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392386.1 protein_id gnl|my_center|LOCUS_39880 5317 3962 gene locus_tag LOCUS_39890 gene glmM 5317 3962 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918006.1 protein_id gnl|my_center|LOCUS_39890 5708 5941 gene locus_tag LOCUS_39900 5708 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 6062 6562 gene locus_tag LOCUS_39910 6062 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 6534 6926 gene locus_tag LOCUS_39920 6534 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 7155 7343 gene locus_tag LOCUS_39930 7155 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 7388 8437 gene locus_tag LOCUS_39940 7388 8437 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_39940 9059 8334 gene locus_tag LOCUS_39950 9059 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 9313 10101 gene locus_tag LOCUS_39960 9313 10101 CDS product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640700.1 protein_id gnl|my_center|LOCUS_39960 10022 11563 gene locus_tag LOCUS_39970 10022 11563 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_39970 11585 11992 gene locus_tag LOCUS_39980 11585 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 >Feature sequence151 <1 791 gene locus_tag LOCUS_39990 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014329495.1:trehalose-phosphatase 788 2584 gene locus_tag LOCUS_40000 788 2584 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_40000 2569 3969 gene locus_tag LOCUS_40010 2569 3969 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_40010 4027 4659 gene locus_tag LOCUS_40020 4027 4659 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_40020 4656 5597 gene locus_tag LOCUS_40030 4656 5597 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_40030 5594 6523 gene locus_tag LOCUS_40040 5594 6523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390878.1 protein_id gnl|my_center|LOCUS_40040 6523 7638 gene locus_tag LOCUS_40050 6523 7638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_40050 8116 7607 gene locus_tag LOCUS_40060 8116 7607 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139251418.1 protein_id gnl|my_center|LOCUS_40060 9039 8137 gene locus_tag LOCUS_40070 9039 8137 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327102.1 protein_id gnl|my_center|LOCUS_40070 11143 9143 gene locus_tag LOCUS_40080 11143 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 11948 11154 gene locus_tag LOCUS_40090 11948 11154 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529072.1 protein_id gnl|my_center|LOCUS_40090 >Feature sequence152 3486 808 gene locus_tag LOCUS_40100 gene ppdK 3486 808 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_40100 5533 3488 gene locus_tag LOCUS_40110 gene glyS 5533 3488 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390705.1 protein_id gnl|my_center|LOCUS_40110 6458 5574 gene locus_tag LOCUS_40120 6458 5574 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_40120 6607 7038 gene locus_tag LOCUS_40130 6607 7038 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_40130 7113 8966 gene locus_tag LOCUS_40140 7113 8966 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188100697.1 protein_id gnl|my_center|LOCUS_40140 9221 8979 gene locus_tag LOCUS_40150 9221 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 11267 9228 gene locus_tag LOCUS_40160 11267 9228 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_40160 11495 11869 gene locus_tag LOCUS_40170 11495 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence153 1233 361 gene locus_tag LOCUS_40180 1233 361 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_40180 3027 1270 gene locus_tag LOCUS_40190 3027 1270 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 protein_id gnl|my_center|LOCUS_40190 3988 3080 gene locus_tag LOCUS_40200 3988 3080 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_40200 4769 4011 gene locus_tag LOCUS_40210 4769 4011 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_40210 6060 4792 gene locus_tag LOCUS_40220 gene dctM 6060 4792 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_40220 6563 6060 gene locus_tag LOCUS_40230 6563 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 7517 6582 gene locus_tag LOCUS_40240 7517 6582 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 protein_id gnl|my_center|LOCUS_40240 8664 7651 gene locus_tag LOCUS_40250 8664 7651 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064872.1 protein_id gnl|my_center|LOCUS_40250 9647 8661 gene locus_tag LOCUS_40260 9647 8661 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_40260 10428 9652 gene locus_tag LOCUS_40270 10428 9652 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104058.1 protein_id gnl|my_center|LOCUS_40270 11483 10665 gene locus_tag LOCUS_40280 11483 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159350744.1 protein_id gnl|my_center|LOCUS_40280 >Feature sequence154 128 1876 gene locus_tag LOCUS_40290 128 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 2423 1887 gene locus_tag LOCUS_40300 2423 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 3268 2438 gene locus_tag LOCUS_40310 3268 2438 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_40310 4326 3268 gene locus_tag LOCUS_40320 4326 3268 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339184.1 protein_id gnl|my_center|LOCUS_40320 5179 4331 gene locus_tag LOCUS_40330 gene ugpE 5179 4331 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_40330 6062 5181 gene locus_tag LOCUS_40340 gene ugpA 6062 5181 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 protein_id gnl|my_center|LOCUS_40340 7498 6182 gene locus_tag LOCUS_40350 gene ugpB 7498 6182 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083853.1 protein_id gnl|my_center|LOCUS_40350 7655 9685 gene locus_tag LOCUS_40360 7655 9685 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256956.1 protein_id gnl|my_center|LOCUS_40360 9754 10806 gene locus_tag LOCUS_40370 gene ada 9754 10806 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_40370 11667 10810 gene locus_tag LOCUS_40380 11667 10810 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_40380 >Feature sequence155 2555 1386 gene locus_tag LOCUS_40390 2555 1386 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_40390 2714 3103 gene locus_tag LOCUS_40400 2714 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 3156 5309 gene locus_tag LOCUS_40410 3156 5309 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_40410 5350 6105 gene locus_tag LOCUS_40420 5350 6105 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_40420 6102 6509 gene locus_tag LOCUS_40430 gene acpS 6102 6509 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 protein_id gnl|my_center|LOCUS_40430 6560 7762 gene locus_tag LOCUS_40440 6560 7762 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_40440 7822 8571 gene locus_tag LOCUS_40450 gene lepB 7822 8571 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_40450 8523 8984 gene locus_tag LOCUS_40460 8523 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40460 9252 10133 gene locus_tag LOCUS_40470 gene era 9252 10133 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844236.1 protein_id gnl|my_center|LOCUS_40470 10657 10142 gene locus_tag LOCUS_40480 10657 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 10742 10969 gene locus_tag LOCUS_40490 10742 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 11033 11575 gene locus_tag LOCUS_40500 11033 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence156 544 251 gene locus_tag LOCUS_40510 544 251 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_40510 666 2051 gene locus_tag LOCUS_40520 666 2051 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039816.1 protein_id gnl|my_center|LOCUS_40520 2089 3489 gene locus_tag LOCUS_40530 gene sthA 2089 3489 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_40530 3489 4016 gene locus_tag LOCUS_40540 3489 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 4092 5192 gene locus_tag LOCUS_40550 4092 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 5261 6370 gene locus_tag LOCUS_40560 5261 6370 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967205.1 protein_id gnl|my_center|LOCUS_40560 6370 7617 gene locus_tag LOCUS_40570 6370 7617 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531949.1 protein_id gnl|my_center|LOCUS_40570 7614 8396 gene locus_tag LOCUS_40580 7614 8396 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_40580 8463 9827 gene locus_tag LOCUS_40590 8463 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 11005 9824 gene locus_tag LOCUS_40600 11005 9824 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577461.1 protein_id gnl|my_center|LOCUS_40600 11514 11008 gene locus_tag LOCUS_40610 11514 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 >Feature sequence157 2892 211 gene locus_tag LOCUS_40620 gene acnA 2892 211 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_40620 3206 3568 gene locus_tag LOCUS_40630 3206 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4908 3616 gene locus_tag LOCUS_40640 gene purB 4908 3616 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920345.1 protein_id gnl|my_center|LOCUS_40640 6333 4936 gene locus_tag LOCUS_40650 6333 4936 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_40650 6490 6624 gene locus_tag LOCUS_40660 gene rpmH 6490 6624 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391083.1 protein_id gnl|my_center|LOCUS_40660 6640 6990 gene locus_tag LOCUS_40670 gene rnpA 6640 6990 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721421.1 protein_id gnl|my_center|LOCUS_40670 6987 7229 gene locus_tag LOCUS_40680 6987 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 7249 8997 gene locus_tag LOCUS_40690 gene yidC 7249 8997 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_40690 8994 9653 gene locus_tag LOCUS_40700 gene yihA 8994 9653 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_40700 9693 10586 gene locus_tag LOCUS_40710 gene argB 9693 10586 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 protein_id gnl|my_center|LOCUS_40710 <11634 10734 gene locus_tag LOCUS_40720 <11634 10734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337152.1:aspartate aminotransferase family protein >Feature sequence158 59 352 gene locus_tag LOCUS_40730 59 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 1290 415 gene locus_tag LOCUS_40740 1290 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 1473 1988 gene locus_tag LOCUS_40750 1473 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 2155 3855 gene locus_tag LOCUS_40760 2155 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390048.1 protein_id gnl|my_center|LOCUS_40760 3865 4767 gene locus_tag LOCUS_40770 3865 4767 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_40770 5957 4764 gene locus_tag LOCUS_40780 5957 4764 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_40780 6047 6346 gene locus_tag LOCUS_40790 6047 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 6385 7173 gene locus_tag LOCUS_40800 6385 7173 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_40800 7174 7302 gene locus_tag LOCUS_40810 7174 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 7562 7299 gene locus_tag LOCUS_40820 7562 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 7783 7571 gene locus_tag LOCUS_40830 7783 7571 CDS product DUF6496 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085379.1 protein_id gnl|my_center|LOCUS_40830 8692 7901 gene locus_tag LOCUS_40840 8692 7901 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531267.1 protein_id gnl|my_center|LOCUS_40840 11077 8708 gene locus_tag LOCUS_40850 11077 8708 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_40850 >Feature sequence159 319 651 gene locus_tag LOCUS_40860 319 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 1153 704 gene locus_tag LOCUS_40870 1153 704 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_40870 1569 1255 gene locus_tag LOCUS_40880 1569 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 1726 2514 gene locus_tag LOCUS_40890 1726 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 2597 3487 gene locus_tag LOCUS_40900 2597 3487 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384819.1 protein_id gnl|my_center|LOCUS_40900 4828 3488 gene locus_tag LOCUS_40910 4828 3488 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088393.1 protein_id gnl|my_center|LOCUS_40910 6215 4875 gene locus_tag LOCUS_40920 6215 4875 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_40920 6401 7033 gene locus_tag LOCUS_40930 6401 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 7087 7521 gene locus_tag LOCUS_40940 7087 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967553.1 protein_id gnl|my_center|LOCUS_40940 7641 8393 gene locus_tag LOCUS_40950 7641 8393 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088364.1 protein_id gnl|my_center|LOCUS_40950 9127 8390 gene locus_tag LOCUS_40960 9127 8390 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 protein_id gnl|my_center|LOCUS_40960 10732 9278 gene locus_tag LOCUS_40970 10732 9278 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921435.1 protein_id gnl|my_center|LOCUS_40970 11270 10800 gene locus_tag LOCUS_40980 11270 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 >Feature sequence160 522 127 gene locus_tag LOCUS_40990 522 127 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531210.1 protein_id gnl|my_center|LOCUS_40990 1422 568 gene locus_tag LOCUS_41000 1422 568 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080689.1 protein_id gnl|my_center|LOCUS_41000 1488 1889 gene locus_tag LOCUS_41010 1488 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 3188 1893 gene locus_tag LOCUS_41020 3188 1893 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400619.1 protein_id gnl|my_center|LOCUS_41020 4436 3228 gene locus_tag LOCUS_41030 4436 3228 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_41030 4515 4706 gene locus_tag LOCUS_41040 4515 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 4891 5805 gene locus_tag LOCUS_41050 4891 5805 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_41050 5805 7226 gene locus_tag LOCUS_41060 gene livM 5805 7226 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389503.1 protein_id gnl|my_center|LOCUS_41060 7223 8074 gene locus_tag LOCUS_41070 7223 8074 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389502.1 protein_id gnl|my_center|LOCUS_41070 8074 8784 gene locus_tag LOCUS_41080 8074 8784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_41080 8795 9151 gene locus_tag LOCUS_41090 8795 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389500.1 protein_id gnl|my_center|LOCUS_41090 9284 10399 gene locus_tag LOCUS_41100 9284 10399 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_41100 10837 10457 gene locus_tag LOCUS_41110 10837 10457 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265704.1 protein_id gnl|my_center|LOCUS_41110 >Feature sequence161 413 1048 gene locus_tag LOCUS_41120 413 1048 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816758.1 protein_id gnl|my_center|LOCUS_41120 2697 1117 gene locus_tag LOCUS_41130 2697 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 3356 2694 gene locus_tag LOCUS_41140 3356 2694 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651303.1 protein_id gnl|my_center|LOCUS_41140 4258 3419 gene locus_tag LOCUS_41150 4258 3419 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389217.1 protein_id gnl|my_center|LOCUS_41150 5421 4336 gene locus_tag LOCUS_41160 5421 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 5812 6219 gene locus_tag LOCUS_41170 5812 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 6306 8882 gene locus_tag LOCUS_41180 gene leuS 6306 8882 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_41180 8887 9384 gene locus_tag LOCUS_41190 8887 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 9385 10407 gene locus_tag LOCUS_41200 gene holA 9385 10407 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_41200 >Feature sequence162 1333 323 gene locus_tag LOCUS_41210 gene fliM 1333 323 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390467.1 protein_id gnl|my_center|LOCUS_41210 1928 1389 gene locus_tag LOCUS_41220 1928 1389 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626461.1 protein_id gnl|my_center|LOCUS_41220 3168 2161 gene locus_tag LOCUS_41230 3168 2161 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_41230 3848 3255 gene locus_tag LOCUS_41240 3848 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088172.1 protein_id gnl|my_center|LOCUS_41240 4843 3845 gene locus_tag LOCUS_41250 4843 3845 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_41250 5421 4840 gene locus_tag LOCUS_41260 5421 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 7001 5427 gene locus_tag LOCUS_41270 7001 5427 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_41270 8196 7120 gene locus_tag LOCUS_41280 8196 7120 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582222.1 protein_id gnl|my_center|LOCUS_41280 8365 9090 gene locus_tag LOCUS_41290 8365 9090 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007746.1 protein_id gnl|my_center|LOCUS_41290 9097 10083 gene locus_tag LOCUS_41300 9097 10083 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967057.1 protein_id gnl|my_center|LOCUS_41300 >Feature sequence163 555 166 gene locus_tag LOCUS_41310 555 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 442 2451 gene locus_tag LOCUS_41320 442 2451 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_41320 2580 3059 gene locus_tag LOCUS_41330 2580 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 3250 4629 gene locus_tag LOCUS_41340 3250 4629 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939113.1 protein_id gnl|my_center|LOCUS_41340 5159 4797 gene locus_tag LOCUS_41350 5159 4797 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_41350 5409 5227 gene locus_tag LOCUS_41360 5409 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 5479 6498 gene locus_tag LOCUS_41370 5479 6498 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_41370 6495 8102 gene locus_tag LOCUS_41380 6495 8102 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_41380 8486 8103 gene locus_tag LOCUS_41390 8486 8103 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_41390 8788 8483 gene locus_tag LOCUS_41400 8788 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 8906 10432 gene locus_tag LOCUS_41410 8906 10432 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_41410 >Feature sequence164 157 1095 gene locus_tag LOCUS_41420 157 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 2221 1103 gene locus_tag LOCUS_41430 2221 1103 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_41430 2296 2610 gene locus_tag LOCUS_41440 2296 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 3169 2756 gene locus_tag LOCUS_41450 3169 2756 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532092.1 protein_id gnl|my_center|LOCUS_41450 3255 3494 gene locus_tag LOCUS_41460 3255 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 3515 3793 gene locus_tag LOCUS_41470 3515 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 4742 3801 gene locus_tag LOCUS_41480 4742 3801 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_41480 4981 5214 gene locus_tag LOCUS_41490 4981 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 5396 6634 gene locus_tag LOCUS_41500 5396 6634 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_41500 6764 8515 gene locus_tag LOCUS_41510 6764 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 8562 10049 gene locus_tag LOCUS_41520 8562 10049 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389097.1 protein_id gnl|my_center|LOCUS_41520 10075 10350 gene locus_tag LOCUS_41530 10075 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 >Feature sequence165 243 857 gene locus_tag LOCUS_41540 243 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 1962 1249 gene locus_tag LOCUS_41550 1962 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 2239 2676 gene locus_tag LOCUS_41560 2239 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 2676 4865 gene locus_tag LOCUS_41570 2676 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 4874 5668 gene locus_tag LOCUS_41580 4874 5668 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_41580 5731 6417 gene locus_tag LOCUS_41590 5731 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 8420 6414 gene locus_tag LOCUS_41600 8420 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 9493 8417 gene locus_tag LOCUS_41610 gene flhB 9493 8417 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_41610 10264 9497 gene locus_tag LOCUS_41620 gene fliR 10264 9497 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462790.1 protein_id gnl|my_center|LOCUS_41620 >Feature sequence166 <1 1209 gene locus_tag LOCUS_41630 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389631.1:dihydrolipoyl dehydrogenase 1213 2148 gene locus_tag LOCUS_41640 gene lipA 1213 2148 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971620.1 protein_id gnl|my_center|LOCUS_41640 2153 2605 gene locus_tag LOCUS_41650 2153 2605 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_41650 3072 2578 gene locus_tag LOCUS_41660 3072 2578 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389623.1 protein_id gnl|my_center|LOCUS_41660 3518 3069 gene locus_tag LOCUS_41670 3518 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 4657 3515 gene locus_tag LOCUS_41680 4657 3515 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_41680 6624 4654 gene locus_tag LOCUS_41690 6624 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 6696 7958 gene locus_tag LOCUS_41700 6696 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391236.1 protein_id gnl|my_center|LOCUS_41700 8099 10276 gene locus_tag LOCUS_41710 8099 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence167 568 161 gene locus_tag LOCUS_41720 568 161 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058819.1 protein_id gnl|my_center|LOCUS_41720 1767 565 gene locus_tag LOCUS_41730 1767 565 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919726.1 protein_id gnl|my_center|LOCUS_41730 3547 1898 gene locus_tag LOCUS_41740 3547 1898 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 protein_id gnl|my_center|LOCUS_41740 4242 3544 gene locus_tag LOCUS_41750 4242 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41750 4580 4239 gene locus_tag LOCUS_41760 4580 4239 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388719.1 protein_id gnl|my_center|LOCUS_41760 5815 4577 gene locus_tag LOCUS_41770 5815 4577 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388724.1 protein_id gnl|my_center|LOCUS_41770 6888 5968 gene locus_tag LOCUS_41780 6888 5968 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_41780 7058 7372 gene locus_tag LOCUS_41790 7058 7372 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514578.1 protein_id gnl|my_center|LOCUS_41790 7517 7825 gene locus_tag LOCUS_41800 7517 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 7834 8847 gene locus_tag LOCUS_41810 7834 8847 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818991.1 protein_id gnl|my_center|LOCUS_41810 9005 10198 gene locus_tag LOCUS_41820 9005 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence168 1159 200 gene locus_tag LOCUS_41830 1159 200 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_41830 1877 1170 gene locus_tag LOCUS_41840 1877 1170 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_41840 3456 2026 gene locus_tag LOCUS_41850 3456 2026 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982234.1 protein_id gnl|my_center|LOCUS_41850 4295 3453 gene locus_tag LOCUS_41860 4295 3453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435787.1 protein_id gnl|my_center|LOCUS_41860 5245 4292 gene locus_tag LOCUS_41870 5245 4292 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037471335.1 protein_id gnl|my_center|LOCUS_41870 6171 5242 gene locus_tag LOCUS_41880 6171 5242 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 protein_id gnl|my_center|LOCUS_41880 6529 6191 gene locus_tag LOCUS_41890 6529 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 8099 6603 gene locus_tag LOCUS_41900 8099 6603 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 protein_id gnl|my_center|LOCUS_41900 8637 8194 gene locus_tag LOCUS_41910 8637 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 9872 8634 gene locus_tag LOCUS_41920 9872 8634 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538090.1 protein_id gnl|my_center|LOCUS_41920 >Feature sequence169 259 936 gene locus_tag LOCUS_41930 259 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 942 1706 gene locus_tag LOCUS_41940 942 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 1850 2410 gene locus_tag LOCUS_41950 1850 2410 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_41950 2481 3239 gene locus_tag LOCUS_41960 gene proC 2481 3239 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_41960 3304 3990 gene locus_tag LOCUS_41970 3304 3990 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392117.1 protein_id gnl|my_center|LOCUS_41970 4019 4516 gene locus_tag LOCUS_41980 4019 4516 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_41980 4584 5462 gene locus_tag LOCUS_41990 4584 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41990 5475 6533 gene locus_tag LOCUS_42000 5475 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42000 6785 7294 gene locus_tag LOCUS_42010 6785 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 7307 8860 gene locus_tag LOCUS_42020 gene nusA 7307 8860 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_42020 8832 9431 gene locus_tag LOCUS_42030 8832 9431 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence170 1268 291 gene locus_tag LOCUS_42040 1268 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 1439 2443 gene locus_tag LOCUS_42050 1439 2443 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784004.1 protein_id gnl|my_center|LOCUS_42050 2509 3018 gene locus_tag LOCUS_42060 2509 3018 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930891.1 protein_id gnl|my_center|LOCUS_42060 3015 4289 gene locus_tag LOCUS_42070 3015 4289 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811706.1 protein_id gnl|my_center|LOCUS_42070 5388 4291 gene locus_tag LOCUS_42080 5388 4291 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538111.1 protein_id gnl|my_center|LOCUS_42080 6511 5399 gene locus_tag LOCUS_42090 6511 5399 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_42090 7413 6508 gene locus_tag LOCUS_42100 7413 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 7487 8278 gene locus_tag LOCUS_42110 7487 8278 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_42110 8369 8746 gene locus_tag LOCUS_42120 8369 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42120 8763 9314 gene locus_tag LOCUS_42130 8763 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42130 9800 9333 gene locus_tag LOCUS_42140 gene mscL 9800 9333 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338438.1 protein_id gnl|my_center|LOCUS_42140 >Feature sequence171 111 575 gene locus_tag LOCUS_42150 111 575 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 protein_id gnl|my_center|LOCUS_42150 815 582 gene locus_tag LOCUS_42160 815 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 1083 826 gene locus_tag LOCUS_42170 1083 826 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532091.1 protein_id gnl|my_center|LOCUS_42170 1527 1084 gene locus_tag LOCUS_42180 1527 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 1856 1524 gene locus_tag LOCUS_42190 1856 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 2824 1853 gene locus_tag LOCUS_42200 2824 1853 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_42200 3527 2817 gene locus_tag LOCUS_42210 3527 2817 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206409.1 protein_id gnl|my_center|LOCUS_42210 3696 3532 gene locus_tag LOCUS_42220 3696 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 4493 3708 gene locus_tag LOCUS_42230 4493 3708 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 protein_id gnl|my_center|LOCUS_42230 4625 5581 gene locus_tag LOCUS_42240 4625 5581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_42240 5681 6145 gene locus_tag LOCUS_42250 5681 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 6239 6700 gene locus_tag LOCUS_42260 6239 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 6697 7512 gene locus_tag LOCUS_42270 6697 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 9560 7509 gene locus_tag LOCUS_42280 9560 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 >Feature sequence172 996 2153 gene locus_tag LOCUS_42290 gene hflK 996 2153 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_42290 2150 3037 gene locus_tag LOCUS_42300 gene hflC 2150 3037 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_42300 3038 3223 gene locus_tag LOCUS_42310 3038 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 3420 4946 gene locus_tag LOCUS_42320 3420 4946 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_42320 5066 6925 gene locus_tag LOCUS_42330 5066 6925 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_42330 6922 7383 gene locus_tag LOCUS_42340 6922 7383 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_42340 7456 8412 gene locus_tag LOCUS_42350 gene msrP 7456 8412 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_42350 9689 8832 gene locus_tag LOCUS_42360 9689 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence173 1236 2081 gene locus_tag LOCUS_42370 1236 2081 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_42370 2100 4010 gene locus_tag LOCUS_42380 2100 4010 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_42380 4057 4974 gene locus_tag LOCUS_42390 4057 4974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383488.1 protein_id gnl|my_center|LOCUS_42390 4971 5816 gene locus_tag LOCUS_42400 4971 5816 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 protein_id gnl|my_center|LOCUS_42400 5813 6784 gene locus_tag LOCUS_42410 5813 6784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267552.1 protein_id gnl|my_center|LOCUS_42410 6781 7740 gene locus_tag LOCUS_42420 6781 7740 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267551.1 protein_id gnl|my_center|LOCUS_42420 9495 7975 gene locus_tag LOCUS_42430 9495 7975 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_42430 >Feature sequence174 329 132 gene locus_tag LOCUS_42440 329 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 2835 493 gene locus_tag LOCUS_42450 2835 493 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_42450 3296 2832 gene locus_tag LOCUS_42460 3296 2832 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391072.1 protein_id gnl|my_center|LOCUS_42460 4723 3293 gene locus_tag LOCUS_42470 gene ccoG 4723 3293 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_42470 5603 4734 gene locus_tag LOCUS_42480 gene ccoP 5603 4734 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_42480 5768 5607 gene locus_tag LOCUS_42490 5768 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 6503 5778 gene locus_tag LOCUS_42500 gene ccoO 6503 5778 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967643.1 protein_id gnl|my_center|LOCUS_42500 7946 6522 gene locus_tag LOCUS_42510 gene ccoN 7946 6522 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391079.1 protein_id gnl|my_center|LOCUS_42510 8083 8856 gene locus_tag LOCUS_42520 8083 8856 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_42520 <9540 8867 gene locus_tag LOCUS_42530 <9540 8867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391108.1:sulfite exporter TauE/SafE family protein >Feature sequence175 <1 721 gene locus_tag LOCUS_42540 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926703.1:TRAP transporter large permease subunit 763 1794 gene locus_tag LOCUS_42550 763 1794 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625873.1 protein_id gnl|my_center|LOCUS_42550 1853 3436 gene locus_tag LOCUS_42560 gene purH 1853 3436 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_42560 4488 3433 gene locus_tag LOCUS_42570 gene mutY 4488 3433 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_42570 4509 4997 gene locus_tag LOCUS_42580 4509 4997 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_42580 5170 5688 gene locus_tag LOCUS_42590 5170 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 5722 9180 gene locus_tag LOCUS_42600 gene smc 5722 9180 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390996.1 protein_id gnl|my_center|LOCUS_42600 >Feature sequence176 2081 516 gene locus_tag LOCUS_42610 2081 516 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533003.1 protein_id gnl|my_center|LOCUS_42610 2885 2244 gene locus_tag LOCUS_42620 2885 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_42620 2980 3168 gene locus_tag LOCUS_42630 2980 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 3200 3781 gene locus_tag LOCUS_42640 3200 3781 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921569.1 protein_id gnl|my_center|LOCUS_42640 3841 4272 gene locus_tag LOCUS_42650 3841 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 4269 4475 gene locus_tag LOCUS_42660 4269 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 5247 4525 gene locus_tag LOCUS_42670 5247 4525 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_42670 5775 5257 gene locus_tag LOCUS_42680 5775 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 6810 5935 gene locus_tag LOCUS_42690 6810 5935 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_42690 6903 7433 gene locus_tag LOCUS_42700 6903 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42700 7473 8462 gene locus_tag LOCUS_42710 7473 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42710 8498 9424 gene locus_tag LOCUS_42720 8498 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 >Feature sequence177 1567 47 gene locus_tag LOCUS_42730 1567 47 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_42730 3199 1592 gene locus_tag LOCUS_42740 3199 1592 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814996.1 protein_id gnl|my_center|LOCUS_42740 4358 3204 gene locus_tag LOCUS_42750 4358 3204 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_42750 5173 4361 gene locus_tag LOCUS_42760 5173 4361 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_42760 5919 5170 gene locus_tag LOCUS_42770 5919 5170 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_42770 8207 5919 gene locus_tag LOCUS_42780 8207 5919 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence178 338 733 gene locus_tag LOCUS_42790 338 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 779 1537 gene locus_tag LOCUS_42800 779 1537 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930761.1 protein_id gnl|my_center|LOCUS_42800 1534 1956 gene locus_tag LOCUS_42810 1534 1956 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_42810 1971 3614 gene locus_tag LOCUS_42820 gene boxC 1971 3614 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_42820 3619 5046 gene locus_tag LOCUS_42830 gene boxB 3619 5046 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_42830 5208 5870 gene locus_tag LOCUS_42840 5208 5870 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_42840 5984 8359 gene locus_tag LOCUS_42850 5984 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 8775 8413 gene locus_tag LOCUS_42860 8775 8413 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531477.1 protein_id gnl|my_center|LOCUS_42860 >Feature sequence179 130 1011 gene locus_tag LOCUS_42870 130 1011 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528171.1 protein_id gnl|my_center|LOCUS_42870 2162 1008 gene locus_tag LOCUS_42880 2162 1008 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083014.1 protein_id gnl|my_center|LOCUS_42880 2246 3331 gene locus_tag LOCUS_42890 2246 3331 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921469.1 protein_id gnl|my_center|LOCUS_42890 3373 3792 gene locus_tag LOCUS_42900 3373 3792 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_42900 4415 3789 gene locus_tag LOCUS_42910 4415 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 5801 4482 gene locus_tag LOCUS_42920 5801 4482 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040264.1 protein_id gnl|my_center|LOCUS_42920 5891 6271 gene locus_tag LOCUS_42930 5891 6271 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_42930 6273 7166 gene locus_tag LOCUS_42940 6273 7166 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867773.1 protein_id gnl|my_center|LOCUS_42940 7163 7381 gene locus_tag LOCUS_42950 7163 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 7372 8538 gene locus_tag LOCUS_42960 7372 8538 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456185.1 protein_id gnl|my_center|LOCUS_42960 8930 8541 gene locus_tag LOCUS_42970 8930 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 >Feature sequence180 <1 2122 gene locus_tag LOCUS_42980 <1 2122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626661.1:translation initiation factor IF-2 2174 2515 gene locus_tag LOCUS_42990 gene rbfA 2174 2515 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_42990 2517 3440 gene locus_tag LOCUS_43000 gene truB 2517 3440 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_43000 3455 3724 gene locus_tag LOCUS_43010 gene rpsO 3455 3724 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917925.1 protein_id gnl|my_center|LOCUS_43010 4841 3792 gene locus_tag LOCUS_43020 gene rsgA 4841 3792 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121027127.1 protein_id gnl|my_center|LOCUS_43020 5533 5138 gene locus_tag LOCUS_43030 5533 5138 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403187.1 protein_id gnl|my_center|LOCUS_43030 5784 5530 gene locus_tag LOCUS_43040 5784 5530 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389024.1 protein_id gnl|my_center|LOCUS_43040 6107 8239 gene locus_tag LOCUS_43050 gene pnp 6107 8239 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_43050 8280 9038 gene locus_tag LOCUS_43060 gene ugpQ 8280 9038 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568486.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence181 1068 553 gene locus_tag LOCUS_43070 1068 553 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 protein_id gnl|my_center|LOCUS_43070 2064 1096 gene locus_tag LOCUS_43080 2064 1096 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_43080 2274 3479 gene locus_tag LOCUS_43090 2274 3479 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256085.1 protein_id gnl|my_center|LOCUS_43090 4387 3476 gene locus_tag LOCUS_43100 4387 3476 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973511.1 protein_id gnl|my_center|LOCUS_43100 4466 5446 gene locus_tag LOCUS_43110 4466 5446 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971592.1 protein_id gnl|my_center|LOCUS_43110 5577 6977 gene locus_tag LOCUS_43120 5577 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 7157 8398 gene locus_tag LOCUS_43130 7157 8398 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_43130 >Feature sequence182 1059 565 gene locus_tag LOCUS_43140 1059 565 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969470.1 protein_id gnl|my_center|LOCUS_43140 2143 1124 gene locus_tag LOCUS_43150 2143 1124 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_43150 3121 2204 gene locus_tag LOCUS_43160 3121 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 4140 3118 gene locus_tag LOCUS_43170 4140 3118 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_43170 6603 4174 gene locus_tag LOCUS_43180 6603 4174 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_43180 7400 6615 gene locus_tag LOCUS_43190 gene fabG 7400 6615 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_43190 8324 7530 gene locus_tag LOCUS_43200 8324 7530 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206682.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence183 297 88 gene locus_tag LOCUS_43210 297 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 1575 403 gene locus_tag LOCUS_43220 1575 403 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_43220 3416 1728 gene locus_tag LOCUS_43230 3416 1728 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085777.1 protein_id gnl|my_center|LOCUS_43230 4538 3519 gene locus_tag LOCUS_43240 4538 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 4929 4549 gene locus_tag LOCUS_43250 4929 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 4966 5520 gene locus_tag LOCUS_43260 4966 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 6627 5569 gene locus_tag LOCUS_43270 6627 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 7811 6627 gene locus_tag LOCUS_43280 7811 6627 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_43280 <8537 7808 gene locus_tag LOCUS_43290 <8537 7808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037395804.1:TRAP transporter large permease subunit >Feature sequence184 711 265 gene locus_tag LOCUS_43300 711 265 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_43300 1192 713 gene locus_tag LOCUS_43310 1192 713 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390580.1 protein_id gnl|my_center|LOCUS_43310 2494 1199 gene locus_tag LOCUS_43320 gene hisD 2494 1199 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_43320 3146 2478 gene locus_tag LOCUS_43330 gene hisG 3146 2478 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_43330 3574 3149 gene locus_tag LOCUS_43340 3574 3149 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 protein_id gnl|my_center|LOCUS_43340 4883 3585 gene locus_tag LOCUS_43350 gene murA 4883 3585 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_43350 5953 4976 gene locus_tag LOCUS_43360 5953 4976 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_43360 7281 5962 gene locus_tag LOCUS_43370 7281 5962 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226140.1 protein_id gnl|my_center|LOCUS_43370 7434 7565 gene locus_tag LOCUS_43380 7434 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 7672 7746 gene locus_tag LOCUS_t00380 7672 7746 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8246 7773 gene locus_tag LOCUS_43390 8246 7773 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_43390 >Feature sequence185 <1 1035 gene locus_tag LOCUS_43400 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085700.1:tartrate dehydrogenase 1032 1658 gene locus_tag LOCUS_43410 1032 1658 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_43410 1655 2104 gene locus_tag LOCUS_43420 1655 2104 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_43420 2118 3725 gene locus_tag LOCUS_43430 2118 3725 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814809.1 protein_id gnl|my_center|LOCUS_43430 3943 3722 gene locus_tag LOCUS_43440 3943 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4083 5681 gene locus_tag LOCUS_43450 4083 5681 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_43450 6857 5745 gene locus_tag LOCUS_43460 6857 5745 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930497.1 protein_id gnl|my_center|LOCUS_43460 8378 6996 gene locus_tag LOCUS_43470 8378 6996 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_43470 >Feature sequence186 1006 287 gene locus_tag LOCUS_43480 1006 287 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_43480 1707 1021 gene locus_tag LOCUS_43490 1707 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 1807 2652 gene locus_tag LOCUS_43500 1807 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 3537 2656 gene locus_tag LOCUS_43510 3537 2656 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_43510 3657 4448 gene locus_tag LOCUS_43520 3657 4448 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_43520 4512 5684 gene locus_tag LOCUS_43530 gene dgoD 4512 5684 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_43530 6122 5691 gene locus_tag LOCUS_43540 6122 5691 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_43540 6952 6149 gene locus_tag LOCUS_43550 6952 6149 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029480.1 protein_id gnl|my_center|LOCUS_43550 7106 7498 gene locus_tag LOCUS_43560 7106 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 7905 7645 gene locus_tag LOCUS_43570 7905 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 >Feature sequence187 216 836 gene locus_tag LOCUS_43580 216 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 1401 1030 gene locus_tag LOCUS_43590 1401 1030 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083086.1 protein_id gnl|my_center|LOCUS_43590 1874 1404 gene locus_tag LOCUS_43600 1874 1404 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083953.1 protein_id gnl|my_center|LOCUS_43600 1982 4126 gene locus_tag LOCUS_43610 1982 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 4198 4644 gene locus_tag LOCUS_43620 4198 4644 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 protein_id gnl|my_center|LOCUS_43620 4644 5228 gene locus_tag LOCUS_43630 4644 5228 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_43630 5319 7544 gene locus_tag LOCUS_43640 5319 7544 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_43640 7642 7923 gene locus_tag LOCUS_43650 7642 7923 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_43650 >Feature sequence188 272 1612 gene locus_tag LOCUS_43660 272 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 1622 3298 gene locus_tag LOCUS_43670 1622 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 3295 5433 gene locus_tag LOCUS_43680 3295 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 5599 5405 gene locus_tag LOCUS_43690 5599 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 5836 6228 gene locus_tag LOCUS_43700 5836 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 6225 6461 gene locus_tag LOCUS_43710 6225 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 6464 6877 gene locus_tag LOCUS_43720 6464 6877 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957963.1 protein_id gnl|my_center|LOCUS_43720 6920 7090 gene locus_tag LOCUS_43730 6920 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 7087 7308 gene locus_tag LOCUS_43740 7087 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 7217 7447 gene locus_tag LOCUS_43750 7217 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 7943 8311 gene locus_tag LOCUS_43760 7943 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 >Feature sequence189 120 2276 gene locus_tag LOCUS_43770 120 2276 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_43770 2282 3748 gene locus_tag LOCUS_43780 2282 3748 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_43780 4167 3745 gene locus_tag LOCUS_43790 4167 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 5840 4173 gene locus_tag LOCUS_43800 5840 4173 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 protein_id gnl|my_center|LOCUS_43800 7920 5830 gene locus_tag LOCUS_43810 7920 5830 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 protein_id gnl|my_center|LOCUS_43810 >Feature sequence190 3 695 gene locus_tag LOCUS_43820 3 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 722 1522 gene locus_tag LOCUS_43830 gene hisN 722 1522 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_43830 1553 2245 gene locus_tag LOCUS_43840 1553 2245 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605277.1 protein_id gnl|my_center|LOCUS_43840 2724 2305 gene locus_tag LOCUS_43850 2724 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 2663 2851 gene locus_tag LOCUS_43860 2663 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 4486 2906 gene locus_tag LOCUS_43870 4486 2906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931332.1 protein_id gnl|my_center|LOCUS_43870 7021 4562 gene locus_tag LOCUS_43880 gene hrpB 7021 4562 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440436.1 protein_id gnl|my_center|LOCUS_43880 7572 7216 gene locus_tag LOCUS_43890 7572 7216 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967551.1 protein_id gnl|my_center|LOCUS_43890 7796 7557 gene locus_tag LOCUS_43900 7796 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 >Feature sequence191 143 682 gene locus_tag LOCUS_43910 143 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 1761 2033 gene locus_tag LOCUS_43920 1761 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 2505 3392 gene locus_tag LOCUS_43930 2505 3392 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172619.1 protein_id gnl|my_center|LOCUS_43930 3735 3412 gene locus_tag LOCUS_43940 3735 3412 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_43940 4009 3722 gene locus_tag LOCUS_43950 4009 3722 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_43950 4119 5003 gene locus_tag LOCUS_43960 4119 5003 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172619.1 protein_id gnl|my_center|LOCUS_43960 5325 5044 gene locus_tag LOCUS_43970 5325 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 5556 6005 gene locus_tag LOCUS_43980 5556 6005 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_43980 <7963 6102 gene locus_tag LOCUS_43990 <7963 6102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950374.1:PD40 domain-containing protein >Feature sequence192 2097 697 gene locus_tag LOCUS_44000 2097 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 3169 2171 gene locus_tag LOCUS_44010 3169 2171 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_44010 4194 3166 gene locus_tag LOCUS_44020 4194 3166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_44020 5092 4196 gene locus_tag LOCUS_44030 5092 4196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_44030 6029 5076 gene locus_tag LOCUS_44040 6029 5076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_44040 7731 6160 gene locus_tag LOCUS_44050 7731 6160 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330176.1 protein_id gnl|my_center|LOCUS_44050 >Feature sequence193 699 22 gene locus_tag LOCUS_44060 699 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 829 2223 gene locus_tag LOCUS_44070 gene thrC 829 2223 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_44070 2233 3495 gene locus_tag LOCUS_44080 2233 3495 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_44080 3512 4102 gene locus_tag LOCUS_44090 3512 4102 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_44090 6150 4099 gene locus_tag LOCUS_44100 6150 4099 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_44100 6224 6922 gene locus_tag LOCUS_44110 6224 6922 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_44110 <7837 6975 gene locus_tag LOCUS_44120 <7837 6975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087456.1:aspartate-semialdehyde dehydrogenase >Feature sequence194 256 897 gene locus_tag LOCUS_44130 256 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 1063 2181 gene locus_tag LOCUS_44140 gene dnaN 1063 2181 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_44140 2216 3346 gene locus_tag LOCUS_44150 gene recF 2216 3346 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387764.1 protein_id gnl|my_center|LOCUS_44150 3352 5817 gene locus_tag LOCUS_44160 gene gyrB 3352 5817 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_44160 5798 6382 gene locus_tag LOCUS_44170 5798 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 7226 6606 gene locus_tag LOCUS_44180 7226 6606 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_44180 >Feature sequence195 2287 605 gene locus_tag LOCUS_44190 2287 605 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973978.1 protein_id gnl|my_center|LOCUS_44190 3393 2284 gene locus_tag LOCUS_44200 3393 2284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761838.1 protein_id gnl|my_center|LOCUS_44200 4403 3411 gene locus_tag LOCUS_44210 4403 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973979.1 protein_id gnl|my_center|LOCUS_44210 5371 4400 gene locus_tag LOCUS_44220 5371 4400 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 protein_id gnl|my_center|LOCUS_44220 5606 6265 gene locus_tag LOCUS_44230 5606 6265 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_44230 6268 7128 gene locus_tag LOCUS_44240 6268 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 7125 7514 gene locus_tag LOCUS_44250 7125 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 >Feature sequence196 561 944 gene locus_tag LOCUS_44260 561 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 947 1738 gene locus_tag LOCUS_44270 947 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 1735 2151 gene locus_tag LOCUS_44280 1735 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 2148 2399 gene locus_tag LOCUS_44290 2148 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 2815 3714 gene locus_tag LOCUS_44300 2815 3714 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975032.1 protein_id gnl|my_center|LOCUS_44300 3856 4743 gene locus_tag LOCUS_44310 3856 4743 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 protein_id gnl|my_center|LOCUS_44310 5122 6369 gene locus_tag LOCUS_44320 5122 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 6502 6771 gene locus_tag LOCUS_44330 6502 6771 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045874275.1 protein_id gnl|my_center|LOCUS_44330 6753 7262 gene locus_tag LOCUS_44340 6753 7262 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705365.1 protein_id gnl|my_center|LOCUS_44340 >Feature sequence197 <1 1857 gene locus_tag LOCUS_44350 <1 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226130.1:CocE/NonD family hydrolase 1854 2687 gene locus_tag LOCUS_44360 1854 2687 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 protein_id gnl|my_center|LOCUS_44360 2689 3165 gene locus_tag LOCUS_44370 gene yeaK 2689 3165 CDS product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138043.1 protein_id gnl|my_center|LOCUS_44370 3284 3868 gene locus_tag LOCUS_44380 gene betI 3284 3868 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096684.1 protein_id gnl|my_center|LOCUS_44380 3865 5541 gene locus_tag LOCUS_44390 gene betA 3865 5541 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214391123.1 protein_id gnl|my_center|LOCUS_44390 6327 5524 gene locus_tag LOCUS_44400 6327 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 6433 7515 gene locus_tag LOCUS_44410 6433 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 >Feature sequence198 44 1261 gene locus_tag LOCUS_44420 44 1261 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_44420 1541 2275 gene locus_tag LOCUS_44430 1541 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 2288 2689 gene locus_tag LOCUS_44440 2288 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 2692 3597 gene locus_tag LOCUS_44450 2692 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 4406 3594 gene locus_tag LOCUS_44460 4406 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 5442 4414 gene locus_tag LOCUS_44470 5442 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 5684 5956 gene locus_tag LOCUS_44480 5684 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 6205 6783 gene locus_tag LOCUS_44490 6205 6783 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920504.1 protein_id gnl|my_center|LOCUS_44490 6780 7460 gene locus_tag LOCUS_44500 6780 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 >Feature sequence199 1594 125 gene locus_tag LOCUS_44510 1594 125 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190957.1 protein_id gnl|my_center|LOCUS_44510 1662 2612 gene locus_tag LOCUS_44520 1662 2612 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_44520 2617 3066 gene locus_tag LOCUS_44530 2617 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105039.1 protein_id gnl|my_center|LOCUS_44530 3283 3071 gene locus_tag LOCUS_44540 3283 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 4221 3295 gene locus_tag LOCUS_44550 4221 3295 CDS product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531028.1 protein_id gnl|my_center|LOCUS_44550 4412 5320 gene locus_tag LOCUS_44560 4412 5320 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396234.1 protein_id gnl|my_center|LOCUS_44560 5397 6065 gene locus_tag LOCUS_44570 5397 6065 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410344.1 protein_id gnl|my_center|LOCUS_44570 6062 6712 gene locus_tag LOCUS_44580 6062 6712 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434088.1 protein_id gnl|my_center|LOCUS_44580 >Feature sequence200 2764 1484 gene locus_tag LOCUS_44590 gene nuoF 2764 1484 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_44590 3381 2764 gene locus_tag LOCUS_44600 3381 2764 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_44600 4556 3378 gene locus_tag LOCUS_44610 4556 3378 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389433.1 protein_id gnl|my_center|LOCUS_44610 5208 4606 gene locus_tag LOCUS_44620 5208 4606 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389432.1 protein_id gnl|my_center|LOCUS_44620 5762 5223 gene locus_tag LOCUS_44630 5762 5223 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_44630 6118 5753 gene locus_tag LOCUS_44640 6118 5753 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_44640 6322 6246 gene locus_tag LOCUS_t00390 6322 6246 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6460 7143 gene locus_tag LOCUS_44650 6460 7143 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705446.1 protein_id gnl|my_center|LOCUS_44650 >Feature sequence201 118 468 gene locus_tag LOCUS_44660 118 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 1391 465 gene locus_tag LOCUS_44670 1391 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 2629 1388 gene locus_tag LOCUS_44680 gene mtaB 2629 1388 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 protein_id gnl|my_center|LOCUS_44680 3467 2637 gene locus_tag LOCUS_44690 gene dapF 3467 2637 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_44690 3897 3544 gene locus_tag LOCUS_44700 3897 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 4433 4233 gene locus_tag LOCUS_44710 4433 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 4691 6037 gene locus_tag LOCUS_44720 gene ffh 4691 6037 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_44720 6218 6589 gene locus_tag LOCUS_44730 gene rpsP 6218 6589 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 protein_id gnl|my_center|LOCUS_44730 6602 7153 gene locus_tag LOCUS_44740 gene rimM 6602 7153 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_44740 >Feature sequence202 868 125 gene locus_tag LOCUS_44750 868 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 2639 1914 gene locus_tag LOCUS_44760 2639 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 3486 2656 gene locus_tag LOCUS_44770 3486 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 3757 4572 gene locus_tag LOCUS_44780 3757 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 4653 4988 gene locus_tag LOCUS_44790 4653 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 4988 6319 gene locus_tag LOCUS_44800 4988 6319 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389727.1 protein_id gnl|my_center|LOCUS_44800 6487 6338 gene locus_tag LOCUS_44810 6487 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 6621 6875 gene locus_tag LOCUS_44820 6621 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence203 22 1947 gene locus_tag LOCUS_44830 gene ftsH 22 1947 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_44830 2003 3082 gene locus_tag LOCUS_44840 2003 3082 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_44840 6361 3086 gene locus_tag LOCUS_44850 6361 3086 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967470.1 protein_id gnl|my_center|LOCUS_44850 6672 6412 gene locus_tag LOCUS_44860 6672 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 >Feature sequence204 595 209 gene locus_tag LOCUS_44870 595 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 958 698 gene locus_tag LOCUS_44880 958 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 1367 963 gene locus_tag LOCUS_44890 gene mce 1367 963 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_44890 3054 1393 gene locus_tag LOCUS_44900 3054 1393 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_44900 3795 3073 gene locus_tag LOCUS_44910 3795 3073 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_44910 5240 3792 gene locus_tag LOCUS_44920 gene nuoN 5240 3792 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_44920 6770 5250 gene locus_tag LOCUS_44930 6770 5250 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_44930 >Feature sequence205 2258 216 gene locus_tag LOCUS_44940 2258 216 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538142.1 protein_id gnl|my_center|LOCUS_44940 3869 2277 gene locus_tag LOCUS_44950 3869 2277 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_44950 5599 3869 gene locus_tag LOCUS_44960 5599 3869 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_44960 <6772 5596 gene locus_tag LOCUS_44970 <6772 5596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870478.1:hydantoinase/oxoprolinase family protein >Feature sequence206 171 452 gene locus_tag LOCUS_44980 171 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 969 454 gene locus_tag LOCUS_44990 969 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 1249 1046 gene locus_tag LOCUS_45000 gene rpsU 1249 1046 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388798.1 protein_id gnl|my_center|LOCUS_45000 1399 1950 gene locus_tag LOCUS_45010 gene def 1399 1950 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_45010 1954 2601 gene locus_tag LOCUS_45020 1954 2601 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_45020 3992 2598 gene locus_tag LOCUS_45030 3992 2598 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814704.1 protein_id gnl|my_center|LOCUS_45030 4588 3992 gene locus_tag LOCUS_45040 4588 3992 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_45040 5746 4679 gene locus_tag LOCUS_45050 5746 4679 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_45050 6231 5743 gene locus_tag LOCUS_45060 gene purE 6231 5743 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388805.1 protein_id gnl|my_center|LOCUS_45060 >Feature sequence207 114 1313 gene locus_tag LOCUS_45070 114 1313 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_45070 1394 1963 gene locus_tag LOCUS_45080 1394 1963 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969610.1 protein_id gnl|my_center|LOCUS_45080 4320 1966 gene locus_tag LOCUS_45090 4320 1966 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_45090 6015 4384 gene locus_tag LOCUS_45100 6015 4384 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538185.1 protein_id gnl|my_center|LOCUS_45100 6465 6016 gene locus_tag LOCUS_45110 6465 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 >Feature sequence208 260 84 gene locus_tag LOCUS_45120 260 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 377 934 gene locus_tag LOCUS_45130 377 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_45130 1134 2420 gene locus_tag LOCUS_45140 1134 2420 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_45140 3482 2514 gene locus_tag LOCUS_45150 3482 2514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258330.1 protein_id gnl|my_center|LOCUS_45150 4416 3463 gene locus_tag LOCUS_45160 4416 3463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_45160 5579 4416 gene locus_tag LOCUS_45170 5579 4416 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173509.1 protein_id gnl|my_center|LOCUS_45170 6403 6104 gene locus_tag LOCUS_45180 6403 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 >Feature sequence209 1175 408 gene locus_tag LOCUS_45190 1175 408 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_45190 1234 2004 gene locus_tag LOCUS_45200 gene gloB 1234 2004 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_45200 2024 2638 gene locus_tag LOCUS_45210 2024 2638 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_45210 2635 3039 gene locus_tag LOCUS_45220 2635 3039 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310369.1 protein_id gnl|my_center|LOCUS_45220 3914 3018 gene locus_tag LOCUS_45230 3914 3018 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_45230 4377 3934 gene locus_tag LOCUS_45240 4377 3934 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_45240 5103 4381 gene locus_tag LOCUS_45250 gene phbB 5103 4381 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_45250 6319 5144 gene locus_tag LOCUS_45260 6319 5144 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 protein_id gnl|my_center|LOCUS_45260 >Feature sequence210 1839 160 gene locus_tag LOCUS_45270 1839 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 2011 3036 gene locus_tag LOCUS_45280 2011 3036 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_45280 4010 3039 gene locus_tag LOCUS_45290 4010 3039 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45290 4984 4007 gene locus_tag LOCUS_45300 4984 4007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143950639.1 protein_id gnl|my_center|LOCUS_45300 5864 4989 gene locus_tag LOCUS_45310 5864 4989 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_45310 6320 5868 gene locus_tag LOCUS_45320 6320 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 >Feature sequence211 478 843 gene locus_tag LOCUS_45330 478 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 931 1737 gene locus_tag LOCUS_45340 931 1737 CDS product sulfurtransferase/chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969286.1 protein_id gnl|my_center|LOCUS_45340 1748 3148 gene locus_tag LOCUS_45350 gene chrA 1748 3148 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087813.1 protein_id gnl|my_center|LOCUS_45350 3190 4158 gene locus_tag LOCUS_45360 3190 4158 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090796.1 protein_id gnl|my_center|LOCUS_45360 4170 5210 gene locus_tag LOCUS_45370 gene ala 4170 5210 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_45370 5242 5436 gene locus_tag LOCUS_45380 5242 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 <6398 5338 gene locus_tag LOCUS_45390 <6398 5338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196366.1:Ni(II)/Co(II) efflux transporter permease subunit NcrC >Feature sequence212 99 1637 gene locus_tag LOCUS_45400 gene ubiB 99 1637 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 protein_id gnl|my_center|LOCUS_45400 1634 2098 gene locus_tag LOCUS_45410 gene dut 1634 2098 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552523.1 protein_id gnl|my_center|LOCUS_45410 2095 2547 gene locus_tag LOCUS_45420 2095 2547 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_45420 2626 3603 gene locus_tag LOCUS_45430 gene cysK 2626 3603 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626663.1 protein_id gnl|my_center|LOCUS_45430 3622 4383 gene locus_tag LOCUS_45440 gene moeB 3622 4383 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_45440 5347 4376 gene locus_tag LOCUS_45450 5347 4376 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087329.1 protein_id gnl|my_center|LOCUS_45450 6167 5358 gene locus_tag LOCUS_45460 6167 5358 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_45460 >Feature sequence213 199 636 gene locus_tag LOCUS_45470 199 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 1551 652 gene locus_tag LOCUS_45480 1551 652 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176150.1 protein_id gnl|my_center|LOCUS_45480 2227 1631 gene locus_tag LOCUS_45490 gene nudF 2227 1631 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174101.1 protein_id gnl|my_center|LOCUS_45490 2715 2224 gene locus_tag LOCUS_45500 2715 2224 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071115951.1 protein_id gnl|my_center|LOCUS_45500 2797 3315 gene locus_tag LOCUS_45510 2797 3315 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_45510 3593 4936 gene locus_tag LOCUS_45520 3593 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 5738 4941 gene locus_tag LOCUS_45530 5738 4941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_45530 5810 6082 gene locus_tag LOCUS_45540 gene fliQ 5810 6082 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626457.1 protein_id gnl|my_center|LOCUS_45540 >Feature sequence214 229 1251 gene locus_tag LOCUS_45550 229 1251 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_45550 1248 2051 gene locus_tag LOCUS_45560 1248 2051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_45560 2058 2699 gene locus_tag LOCUS_45570 2058 2699 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967700.1 protein_id gnl|my_center|LOCUS_45570 2880 3482 gene locus_tag LOCUS_45580 2880 3482 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_45580 4386 3490 gene locus_tag LOCUS_45590 4386 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 5597 4521 gene locus_tag LOCUS_45600 5597 4521 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090193.1 protein_id gnl|my_center|LOCUS_45600 6031 5774 gene locus_tag LOCUS_45610 6031 5774 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537648.1 protein_id gnl|my_center|LOCUS_45610 >Feature sequence215 1184 204 gene locus_tag LOCUS_45620 1184 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 1285 4725 gene locus_tag LOCUS_45630 gene dnaE 1285 4725 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_45630 5472 4729 gene locus_tag LOCUS_45640 5472 4729 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920945.1 protein_id gnl|my_center|LOCUS_45640 5748 5473 gene locus_tag LOCUS_45650 5748 5473 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061577.1 protein_id gnl|my_center|LOCUS_45650 >Feature sequence216 127 522 gene locus_tag LOCUS_45660 127 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 883 509 gene locus_tag LOCUS_45670 883 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 2063 978 gene locus_tag LOCUS_45680 2063 978 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974655.1 protein_id gnl|my_center|LOCUS_45680 3238 2663 gene locus_tag LOCUS_45690 gene moaB 3238 2663 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_45690 5179 3413 gene locus_tag LOCUS_45700 5179 3413 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_45700 <6067 5387 gene locus_tag LOCUS_45710 <6067 5387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063171746.1:uracil-DNA glycosylase >Feature sequence217 2592 1741 gene locus_tag LOCUS_45720 2592 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 4591 2690 gene locus_tag LOCUS_45730 4591 2690 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_45730 5787 4588 gene locus_tag LOCUS_45740 5787 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 >Feature sequence218 318 980 gene locus_tag LOCUS_45750 318 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 2057 1077 gene locus_tag LOCUS_45760 2057 1077 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974497.1 protein_id gnl|my_center|LOCUS_45760 3045 2059 gene locus_tag LOCUS_45770 3045 2059 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809738.1 protein_id gnl|my_center|LOCUS_45770 4046 3051 gene locus_tag LOCUS_45780 4046 3051 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_45780 4915 4064 gene locus_tag LOCUS_45790 4915 4064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384119.1 protein_id gnl|my_center|LOCUS_45790 5762 4908 gene locus_tag LOCUS_45800 5762 4908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_45800 >Feature sequence219 967 218 gene locus_tag LOCUS_45810 967 218 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941295.1 protein_id gnl|my_center|LOCUS_45810 1566 964 gene locus_tag LOCUS_45820 1566 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 2913 1570 gene locus_tag LOCUS_45830 2913 1570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038796350.1 protein_id gnl|my_center|LOCUS_45830 3825 2977 gene locus_tag LOCUS_45840 3825 2977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_45840 <5992 3827 gene locus_tag LOCUS_45850 <5992 3827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103411.1:glycosyltransferase >Feature sequence220 <1 1187 gene locus_tag LOCUS_45860 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337403.1:2-isopropylmalate synthase 1229 2269 gene locus_tag LOCUS_45870 1229 2269 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_45870 2293 3168 gene locus_tag LOCUS_45880 gene mreC 2293 3168 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_45880 3165 3674 gene locus_tag LOCUS_45890 3165 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 3674 5521 gene locus_tag LOCUS_45900 gene mrdA 3674 5521 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_45900 >Feature sequence221 1065 94 gene locus_tag LOCUS_45910 1065 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 1122 2054 gene locus_tag LOCUS_45920 1122 2054 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114502.1 protein_id gnl|my_center|LOCUS_45920 2097 3290 gene locus_tag LOCUS_45930 2097 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 3347 3892 gene locus_tag LOCUS_45940 3347 3892 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_45940 4346 4771 gene locus_tag LOCUS_45950 4346 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 4801 5199 gene locus_tag LOCUS_45960 4801 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 5853 5404 gene locus_tag LOCUS_45970 5853 5404 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 protein_id gnl|my_center|LOCUS_45970 >Feature sequence222 1337 96 gene locus_tag LOCUS_45980 1337 96 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_45980 1693 1346 gene locus_tag LOCUS_45990 1693 1346 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_45990 2265 1786 gene locus_tag LOCUS_46000 2265 1786 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974137.1 protein_id gnl|my_center|LOCUS_46000 2359 3351 gene locus_tag LOCUS_46010 2359 3351 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_46010 4445 3483 gene locus_tag LOCUS_46020 gene pip 4445 3483 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204007.1 protein_id gnl|my_center|LOCUS_46020 4499 5818 gene locus_tag LOCUS_46030 4499 5818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_46030 >Feature sequence223 1569 91 gene locus_tag LOCUS_46040 1569 91 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_46040 2959 1673 gene locus_tag LOCUS_46050 2959 1673 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087102.1 protein_id gnl|my_center|LOCUS_46050 3224 4009 gene locus_tag LOCUS_46060 3224 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 5360 3981 gene locus_tag LOCUS_46070 5360 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 5480 5692 gene locus_tag LOCUS_46080 5480 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 >Feature sequence224 <1 513 gene locus_tag LOCUS_46090 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815066.1:amino acid ABC transporter permease 778 1257 gene locus_tag LOCUS_46100 778 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 3653 1332 gene locus_tag LOCUS_46110 gene clpA 3653 1332 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_46110 4009 3671 gene locus_tag LOCUS_46120 gene clpS 4009 3671 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_46120 4748 4227 gene locus_tag LOCUS_46130 4748 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 >Feature sequence225 1715 816 gene locus_tag LOCUS_46140 1715 816 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_46140 1851 2513 gene locus_tag LOCUS_46150 1851 2513 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_46150 2500 3129 gene locus_tag LOCUS_46160 2500 3129 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_46160 4590 3442 gene locus_tag LOCUS_46170 4590 3442 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731603.1 protein_id gnl|my_center|LOCUS_46170 4702 5625 gene locus_tag LOCUS_46180 4702 5625 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533429.1 protein_id gnl|my_center|LOCUS_46180 >Feature sequence226 <1 509 gene locus_tag LOCUS_46190 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014630030.1:IclR family transcriptional regulator 897 652 gene locus_tag LOCUS_46200 897 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 1307 3373 gene locus_tag LOCUS_46210 1307 3373 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173640842.1 protein_id gnl|my_center|LOCUS_46210 3871 4473 gene locus_tag LOCUS_46220 3871 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 5169 4813 gene locus_tag LOCUS_46230 gene tnpB 5169 4813 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057900817.1 protein_id gnl|my_center|LOCUS_46230 5561 5166 gene locus_tag LOCUS_46240 5561 5166 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163163084.1 protein_id gnl|my_center|LOCUS_46240 >Feature sequence227 2139 397 gene locus_tag LOCUS_46250 gene argS 2139 397 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389532.1 protein_id gnl|my_center|LOCUS_46250 3292 2114 gene locus_tag LOCUS_46260 3292 2114 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531289.1 protein_id gnl|my_center|LOCUS_46260 3398 3754 gene locus_tag LOCUS_46270 gene erpA 3398 3754 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_46270 3847 4614 gene locus_tag LOCUS_46280 3847 4614 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529940.1 protein_id gnl|my_center|LOCUS_46280 4619 5386 gene locus_tag LOCUS_46290 4619 5386 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_46290 >Feature sequence228 563 1108 gene locus_tag LOCUS_46300 563 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 1214 2092 gene locus_tag LOCUS_46310 1214 2092 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971222.1 protein_id gnl|my_center|LOCUS_46310 2366 2950 gene locus_tag LOCUS_46320 2366 2950 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_46320 3854 2925 gene locus_tag LOCUS_46330 gene gcvA 3854 2925 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 protein_id gnl|my_center|LOCUS_46330 3952 4194 gene locus_tag LOCUS_46340 3952 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 4274 5488 gene locus_tag LOCUS_46350 4274 5488 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_46350 >Feature sequence229 1638 133 gene locus_tag LOCUS_46360 1638 133 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_46360 3151 1640 gene locus_tag LOCUS_46370 3151 1640 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_46370 4659 3157 gene locus_tag LOCUS_46380 4659 3157 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_46380 5437 4742 gene locus_tag LOCUS_46390 5437 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 >Feature sequence230 1930 905 gene locus_tag LOCUS_46400 gene cobW 1930 905 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_46400 2493 1927 gene locus_tag LOCUS_46410 gene cobU 2493 1927 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 protein_id gnl|my_center|LOCUS_46410 3360 2719 gene locus_tag LOCUS_46420 3360 2719 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_46420 4114 3371 gene locus_tag LOCUS_46430 gene cobS 4114 3371 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086039.1 protein_id gnl|my_center|LOCUS_46430 4184 5200 gene locus_tag LOCUS_46440 gene cobT 4184 5200 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975751.1 protein_id gnl|my_center|LOCUS_46440 5419 5204 gene locus_tag LOCUS_46450 5419 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence231 282 2342 gene locus_tag LOCUS_46460 282 2342 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_46460 2352 3398 gene locus_tag LOCUS_46470 2352 3398 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 protein_id gnl|my_center|LOCUS_46470 3395 4303 gene locus_tag LOCUS_46480 3395 4303 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_46480 4288 5349 gene locus_tag LOCUS_46490 4288 5349 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_46490 >Feature sequence232 484 654 gene locus_tag LOCUS_46500 484 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 3051 658 gene locus_tag LOCUS_46510 gene pheT 3051 658 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_46510 4127 3048 gene locus_tag LOCUS_46520 gene pheS 4127 3048 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_46520 4561 4202 gene locus_tag LOCUS_46530 gene rplT 4561 4202 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391269.1 protein_id gnl|my_center|LOCUS_46530 4774 4574 gene locus_tag LOCUS_46540 gene rpmI 4774 4574 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722593.1 protein_id gnl|my_center|LOCUS_46540 4998 5399 gene locus_tag LOCUS_46550 4998 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 >Feature sequence233 233 1198 gene locus_tag LOCUS_46560 233 1198 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_46560 1208 1762 gene locus_tag LOCUS_46570 1208 1762 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329321.1 protein_id gnl|my_center|LOCUS_46570 1765 2175 gene locus_tag LOCUS_46580 1765 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 2873 2172 gene locus_tag LOCUS_46590 2873 2172 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312614.1 protein_id gnl|my_center|LOCUS_46590 4645 2933 gene locus_tag LOCUS_46600 4645 2933 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927251.1 protein_id gnl|my_center|LOCUS_46600 5244 4738 gene locus_tag LOCUS_46610 5244 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 >Feature sequence234 226 83 gene locus_tag LOCUS_46620 226 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 568 1362 gene locus_tag LOCUS_46630 568 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 2250 1432 gene locus_tag LOCUS_46640 2250 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331406.1 protein_id gnl|my_center|LOCUS_46640 2629 2258 gene locus_tag LOCUS_46650 2629 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 2808 3182 gene locus_tag LOCUS_46660 2808 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 3179 4699 gene locus_tag LOCUS_46670 3179 4699 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920579.1 protein_id gnl|my_center|LOCUS_46670 5140 4718 gene locus_tag LOCUS_46680 5140 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence235 169 2187 gene locus_tag LOCUS_46690 169 2187 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742782.1 protein_id gnl|my_center|LOCUS_46690 3822 2230 gene locus_tag LOCUS_46700 3822 2230 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_46700 >Feature sequence236 1059 2753 gene locus_tag LOCUS_46710 1059 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 2757 3680 gene locus_tag LOCUS_46720 2757 3680 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811592.1 protein_id gnl|my_center|LOCUS_46720 3713 4333 gene locus_tag LOCUS_46730 3713 4333 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792222.1 protein_id gnl|my_center|LOCUS_46730 4333 4830 gene locus_tag LOCUS_46740 4333 4830 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887910.1 protein_id gnl|my_center|LOCUS_46740 >Feature sequence237 522 199 gene locus_tag LOCUS_46750 522 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 1328 591 gene locus_tag LOCUS_46760 gene tpiA 1328 591 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_46760 2707 1565 gene locus_tag LOCUS_46770 2707 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 4719 3502 gene locus_tag LOCUS_46780 4719 3502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 protein_id gnl|my_center|LOCUS_46780 >Feature sequence238 3 665 gene locus_tag LOCUS_46790 3 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 1046 1417 gene locus_tag LOCUS_46800 gene rpsL 1046 1417 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_46800 1427 1897 gene locus_tag LOCUS_46810 gene rpsG 1427 1897 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390502.1 protein_id gnl|my_center|LOCUS_46810 1904 3979 gene locus_tag LOCUS_46820 gene fusA 1904 3979 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390501.1 protein_id gnl|my_center|LOCUS_46820 4011 5201 gene locus_tag LOCUS_46830 gene tuf 4011 5201 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088152.1 protein_id gnl|my_center|LOCUS_46830 >Feature sequence239 307 1092 gene locus_tag LOCUS_46840 307 1092 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_46840 1085 2116 gene locus_tag LOCUS_46850 1085 2116 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_46850 2126 3340 gene locus_tag LOCUS_46860 2126 3340 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338545.1 protein_id gnl|my_center|LOCUS_46860 3345 3977 gene locus_tag LOCUS_46870 3345 3977 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338546.1 protein_id gnl|my_center|LOCUS_46870 4396 3974 gene locus_tag LOCUS_46880 4396 3974 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512998.1 protein_id gnl|my_center|LOCUS_46880 >Feature sequence240 <1 962 gene locus_tag LOCUS_46890 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 2331 1096 gene locus_tag LOCUS_46900 2331 1096 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_46900 3860 2328 gene locus_tag LOCUS_46910 3860 2328 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_46910 4737 3874 gene locus_tag LOCUS_46920 4737 3874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966017.1 protein_id gnl|my_center|LOCUS_46920 5086 4760 gene locus_tag LOCUS_46930 5086 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence241 <1 587 gene locus_tag LOCUS_46940 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533006.1:ABC transporter ATP-binding protein 584 1561 gene locus_tag LOCUS_46950 584 1561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533007.1 protein_id gnl|my_center|LOCUS_46950 1606 1821 gene locus_tag LOCUS_46960 1606 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46960 1834 2781 gene locus_tag LOCUS_46970 1834 2781 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46970 3736 2792 gene locus_tag LOCUS_46980 3736 2792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533004.1 protein_id gnl|my_center|LOCUS_46980 <5104 3736 gene locus_tag LOCUS_46990 <5104 3736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189742782.1:CocE/NonD family hydrolase >Feature sequence242 638 1639 gene locus_tag LOCUS_47000 638 1639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728151.1 protein_id gnl|my_center|LOCUS_47000 1707 2480 gene locus_tag LOCUS_47010 1707 2480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931034.1 protein_id gnl|my_center|LOCUS_47010 2500 3339 gene locus_tag LOCUS_47020 2500 3339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931033.1 protein_id gnl|my_center|LOCUS_47020 3365 4639 gene locus_tag LOCUS_47030 3365 4639 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039310.1 protein_id gnl|my_center|LOCUS_47030 >Feature sequence243 2129 1818 gene locus_tag LOCUS_47040 gene nuoK 2129 1818 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_47040 2737 2129 gene locus_tag LOCUS_47050 2737 2129 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311651.1 protein_id gnl|my_center|LOCUS_47050 3236 2748 gene locus_tag LOCUS_47060 gene nuoI 3236 2748 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_47060 4256 3249 gene locus_tag LOCUS_47070 gene nuoH 4256 3249 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_47070 <4955 4249 gene locus_tag LOCUS_47080 <4955 4249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389436.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence244 746 1819 gene locus_tag LOCUS_47090 746 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 3480 2131 gene locus_tag LOCUS_47100 3480 2131 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267880.1 protein_id gnl|my_center|LOCUS_47100 3636 4913 gene locus_tag LOCUS_47110 3636 4913 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920120.1 protein_id gnl|my_center|LOCUS_47110 >Feature sequence245 913 2364 gene locus_tag LOCUS_47120 913 2364 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_47120 2369 3820 gene locus_tag LOCUS_47130 2369 3820 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_47130 4221 3886 gene locus_tag LOCUS_47140 4221 3886 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_47140 4568 4768 gene locus_tag LOCUS_47150 4568 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 >Feature sequence246 1482 1006 gene locus_tag LOCUS_47160 gene moaC 1482 1006 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390440.1 protein_id gnl|my_center|LOCUS_47160 2297 1482 gene locus_tag LOCUS_47170 gene trpC 2297 1482 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383898.1 protein_id gnl|my_center|LOCUS_47170 3328 2294 gene locus_tag LOCUS_47180 gene trpD 3328 2294 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_47180 3557 4723 gene locus_tag LOCUS_47190 3557 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 >Feature sequence247 2459 861 gene locus_tag LOCUS_47200 2459 861 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_47200 4165 2927 gene locus_tag LOCUS_47210 4165 2927 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_47210 >Feature sequence248 1539 448 gene locus_tag LOCUS_47220 1539 448 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_47220 3173 1596 gene locus_tag LOCUS_47230 3173 1596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815878.1 protein_id gnl|my_center|LOCUS_47230 4266 3202 gene locus_tag LOCUS_47240 4266 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 >Feature sequence249 406 83 gene locus_tag LOCUS_47250 406 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 568 1263 gene locus_tag LOCUS_47260 568 1263 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725050.1 protein_id gnl|my_center|LOCUS_47260 2446 1274 gene locus_tag LOCUS_47270 2446 1274 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_47270 4085 2514 gene locus_tag LOCUS_47280 4085 2514 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931332.1 protein_id gnl|my_center|LOCUS_47280 >Feature sequence250 312 112 gene locus_tag LOCUS_47290 312 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 655 323 gene locus_tag LOCUS_47300 655 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 2126 822 gene locus_tag LOCUS_47310 2126 822 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003587.1 protein_id gnl|my_center|LOCUS_47310 2447 2196 gene locus_tag LOCUS_47320 2447 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 3027 2500 gene locus_tag LOCUS_47330 3027 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 3266 3024 gene locus_tag LOCUS_47340 3266 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 3406 4083 gene locus_tag LOCUS_47350 3406 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence251 653 877 gene locus_tag LOCUS_47360 653 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 940 1170 gene locus_tag LOCUS_47370 940 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 1526 3121 gene locus_tag LOCUS_47380 1526 3121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 protein_id gnl|my_center|LOCUS_47380 >Feature sequence252 429 923 gene locus_tag LOCUS_47390 429 923 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_47390 920 3763 gene locus_tag LOCUS_47400 920 3763 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_47400 >Feature sequence253 <1 1185 gene locus_tag LOCUS_47410 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085117.1:FAD-dependent oxidoreductase 1182 3542 gene locus_tag LOCUS_47420 1182 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 3551 3742 gene locus_tag LOCUS_47430 3551 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 >Feature sequence254 636 109 gene locus_tag LOCUS_47440 636 109 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_47440 1136 654 gene locus_tag LOCUS_47450 1136 654 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_47450 1320 3326 gene locus_tag LOCUS_47460 gene hyfB 1320 3326 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_47460 >Feature sequence255 128 943 gene locus_tag LOCUS_47470 128 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 1003 1335 gene locus_tag LOCUS_47480 1003 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 1349 2596 gene locus_tag LOCUS_47490 1349 2596 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971108.1 protein_id gnl|my_center|LOCUS_47490 >Feature sequence256 398 817 gene locus_tag LOCUS_47500 gene arfB 398 817 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_47500 1861 884 gene locus_tag LOCUS_47510 1861 884 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109658674.1 protein_id gnl|my_center|LOCUS_47510 2018 2179 gene locus_tag LOCUS_47520 2018 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 2176 3021 gene locus_tag LOCUS_47530 2176 3021 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 protein_id gnl|my_center|LOCUS_47530 <3892 3041 gene locus_tag LOCUS_47540 <3892 3041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803678.1:phytanoyl-CoA dioxygenase family protein >Feature sequence257 408 112 gene locus_tag LOCUS_47550 408 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 556 1134 gene locus_tag LOCUS_47560 556 1134 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_47560 1145 2302 gene locus_tag LOCUS_47570 gene rnd 1145 2302 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_47570 3210 2299 gene locus_tag LOCUS_47580 3210 2299 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_47580 3308 3640 gene locus_tag LOCUS_47590 3308 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 >Feature sequence258 <1 1769 gene locus_tag LOCUS_47600 <1 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202495.1:sarcosine oxidase subunit alpha family protein 1750 2334 gene locus_tag LOCUS_47610 gene soxG 1750 2334 CDS product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 protein_id gnl|my_center|LOCUS_47610 3110 2331 gene locus_tag LOCUS_47620 3110 2331 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967658.1 protein_id gnl|my_center|LOCUS_47620 <3695 3113 gene locus_tag LOCUS_47630 <3695 3113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000351233.1:homoserine/homoserine lactone efflux protein >Feature sequence259 810 277 gene locus_tag LOCUS_47640 gene prrA 810 277 CDS product global response regulator transcription factor PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722225.1 protein_id gnl|my_center|LOCUS_47640 2146 824 gene locus_tag LOCUS_47650 2146 824 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_47650 2061 2930 gene locus_tag LOCUS_47660 2061 2930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_47660 2927 3538 gene locus_tag LOCUS_47670 2927 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 >Feature sequence260 84 701 gene locus_tag LOCUS_47680 84 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 862 1719 gene locus_tag LOCUS_47690 862 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 3097 1691 gene locus_tag LOCUS_47700 3097 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence261 967 62 gene locus_tag LOCUS_47710 967 62 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_47710 1082 1417 gene locus_tag LOCUS_47720 1082 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 2138 1395 gene locus_tag LOCUS_47730 2138 1395 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_47730 2349 2131 gene locus_tag LOCUS_47740 2349 2131 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313100.1 protein_id gnl|my_center|LOCUS_47740 2415 3431 gene locus_tag LOCUS_47750 2415 3431 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_47750 >Feature sequence262 1705 1034 gene locus_tag LOCUS_47760 1705 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 2754 1702 gene locus_tag LOCUS_47770 2754 1702 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878074.1 protein_id gnl|my_center|LOCUS_47770 >Feature sequence263 290 2698 gene locus_tag LOCUS_47780 290 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 >Feature sequence264 929 75 gene locus_tag LOCUS_47790 929 75 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_47790 1771 926 gene locus_tag LOCUS_47800 1771 926 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820328.1 protein_id gnl|my_center|LOCUS_47800 2767 1775 gene locus_tag LOCUS_47810 2767 1775 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 protein_id gnl|my_center|LOCUS_47810 >Feature sequence265 814 125 gene locus_tag LOCUS_47820 814 125 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537692.1 protein_id gnl|my_center|LOCUS_47820 935 1381 gene locus_tag LOCUS_47830 935 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 2214 1390 gene locus_tag LOCUS_47840 2214 1390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_47840 2293 2856 gene locus_tag LOCUS_47850 2293 2856 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_47850 >Feature sequence266 176 397 gene locus_tag LOCUS_47860 176 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 846 1190 gene locus_tag LOCUS_47870 846 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47870 1277 1504 gene locus_tag LOCUS_47880 1277 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47880 2408 1515 gene locus_tag LOCUS_47890 2408 1515 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_47890 2575 2405 gene locus_tag LOCUS_47900 2575 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence267 1550 483 gene locus_tag LOCUS_47910 1550 483 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003378.1 protein_id gnl|my_center|LOCUS_47910 2302 1550 gene locus_tag LOCUS_47920 2302 1550 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_47920 >Feature sequence268 1028 204 gene locus_tag LOCUS_47930 gene mazG 1028 204 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_47930 2401 1514 gene locus_tag LOCUS_47940 2401 1514 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390392.1 protein_id gnl|my_center|LOCUS_47940 >Feature sequence269 227 475 gene locus_tag LOCUS_47950 227 475 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389863.1 protein_id gnl|my_center|LOCUS_47950 2347 452 gene locus_tag LOCUS_47960 2347 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 >Feature sequence270 <2420 1476 gene locus_tag LOCUS_47970 <2420 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398990.1:inositol 2-dehydrogenase >Feature sequence271 356 1003 gene locus_tag LOCUS_47980 356 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 1132 1485 gene locus_tag LOCUS_47990 1132 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47990 1482 1919 gene locus_tag LOCUS_48000 1482 1919 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384079.1 protein_id gnl|my_center|LOCUS_48000 >Feature sequence272 820 317 gene locus_tag LOCUS_48010 820 317 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 protein_id gnl|my_center|LOCUS_48010 864 1181 gene locus_tag LOCUS_48020 864 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 1196 1549 gene locus_tag LOCUS_48030 1196 1549 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_48030 <2330 1554 gene locus_tag LOCUS_48040 <2330 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530028.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence273 881 150 gene locus_tag LOCUS_48050 881 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 1138 1797 gene locus_tag LOCUS_48060 1138 1797 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966768.1 protein_id gnl|my_center|LOCUS_48060 1800 2249 gene locus_tag LOCUS_48070 1800 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 >Feature sequence274 665 507 gene locus_tag LOCUS_48080 665 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 734 2086 gene locus_tag LOCUS_48090 734 2086 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939288.1 protein_id gnl|my_center|LOCUS_48090 >Feature sequence275 622 158 gene locus_tag LOCUS_48100 622 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 1296 619 gene locus_tag LOCUS_48110 gene tsaB 1296 619 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_48110 >Feature sequence276 33 1388 gene locus_tag LOCUS_48120 33 1388 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence277 1276 134 gene locus_tag LOCUS_48130 1276 134 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967605.1 protein_id gnl|my_center|LOCUS_48130 >Feature sequence278 114 662 gene locus_tag LOCUS_48140 114 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48140 851 1174 gene locus_tag LOCUS_48150 851 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48150