>Feature sequence001 488 1327 gene locus_tag LOCUS_00010 488 1327 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_00010 1315 2769 gene locus_tag LOCUS_00020 gene gltA 1315 2769 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_00020 2878 3618 gene locus_tag LOCUS_00030 2878 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4982 3615 gene locus_tag LOCUS_00040 4982 3615 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392890.1 protein_id gnl|my_center|LOCUS_00040 5273 4998 gene locus_tag LOCUS_00050 5273 4998 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_00050 5352 5561 gene locus_tag LOCUS_00060 5352 5561 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_00060 6301 5558 gene locus_tag LOCUS_00070 6301 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6564 6872 gene locus_tag LOCUS_00080 6564 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6872 9058 gene locus_tag LOCUS_00090 6872 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9055 9552 gene locus_tag LOCUS_00100 9055 9552 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_00100 9562 10143 gene locus_tag LOCUS_00110 9562 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10151 11143 gene locus_tag LOCUS_00120 10151 11143 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_00120 11143 11475 gene locus_tag LOCUS_00130 11143 11475 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367214.1 protein_id gnl|my_center|LOCUS_00130 11476 13242 gene locus_tag LOCUS_00140 11476 13242 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_00140 13243 14658 gene locus_tag LOCUS_00150 13243 14658 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_00150 14655 14846 gene locus_tag LOCUS_00160 14655 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14849 15490 gene locus_tag LOCUS_00170 14849 15490 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_00170 15641 15868 gene locus_tag LOCUS_00180 15641 15868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17118 15775 gene locus_tag LOCUS_00190 17118 15775 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_00190 18557 17115 gene locus_tag LOCUS_00200 18557 17115 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_00200 19863 18652 gene locus_tag LOCUS_00210 19863 18652 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767735.1 protein_id gnl|my_center|LOCUS_00210 24175 20009 gene locus_tag LOCUS_00220 24175 20009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25119 24382 gene locus_tag LOCUS_00230 25119 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25335 25411 gene locus_tag LOCUS_t00010 25335 25411 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26442 25501 gene locus_tag LOCUS_00240 26442 25501 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_00240 26717 27538 gene locus_tag LOCUS_00250 26717 27538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27666 28676 gene locus_tag LOCUS_00260 gene ord 27666 28676 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_00260 28732 29085 gene locus_tag LOCUS_00270 28732 29085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29087 30499 gene locus_tag LOCUS_00280 gene ortB 29087 30499 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_00280 30528 31160 gene locus_tag LOCUS_00290 30528 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31288 31824 gene locus_tag LOCUS_00300 31288 31824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32899 31883 gene locus_tag LOCUS_00310 32899 31883 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_00310 33051 33500 gene locus_tag LOCUS_00320 33051 33500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33567 33824 gene locus_tag LOCUS_00330 33567 33824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33769 34128 gene locus_tag LOCUS_00340 33769 34128 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229169.1 protein_id gnl|my_center|LOCUS_00340 34162 34407 gene locus_tag LOCUS_00350 34162 34407 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393126.1 protein_id gnl|my_center|LOCUS_00350 34409 34651 gene locus_tag LOCUS_00360 34409 34651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 34691 34891 gene locus_tag LOCUS_00370 34691 34891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 35066 35428 gene locus_tag LOCUS_00380 35066 35428 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_00380 35425 37683 gene locus_tag LOCUS_00390 gene oraE 35425 37683 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_00390 37921 38688 gene locus_tag LOCUS_00400 37921 38688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 38681 40027 gene locus_tag LOCUS_00410 38681 40027 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_00410 40169 40747 gene locus_tag LOCUS_00420 40169 40747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40744 41871 gene locus_tag LOCUS_00430 40744 41871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 41926 42990 gene locus_tag LOCUS_00440 41926 42990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43100 43636 gene locus_tag LOCUS_00450 43100 43636 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256454.1 protein_id gnl|my_center|LOCUS_00450 43816 44823 gene locus_tag LOCUS_00460 43816 44823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44839 45426 gene locus_tag LOCUS_00470 44839 45426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 45501 46232 gene locus_tag LOCUS_00480 45501 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 46949 46236 gene locus_tag LOCUS_00490 46949 46236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 48009 46990 gene locus_tag LOCUS_00500 48009 46990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48192 48593 gene locus_tag LOCUS_00510 48192 48593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 49265 50746 gene locus_tag LOCUS_00520 49265 50746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 51956 50787 gene locus_tag LOCUS_00530 51956 50787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_00530 52084 52959 gene locus_tag LOCUS_00540 52084 52959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 52956 53651 gene locus_tag LOCUS_00550 52956 53651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 53683 54552 gene locus_tag LOCUS_00560 53683 54552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00560 54633 55271 gene locus_tag LOCUS_00570 54633 55271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 56480 55278 gene locus_tag LOCUS_00580 56480 55278 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_00580 56954 57859 gene locus_tag LOCUS_00590 56954 57859 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_00590 57861 58886 gene locus_tag LOCUS_00600 57861 58886 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209211630.1 protein_id gnl|my_center|LOCUS_00600 58883 60157 gene locus_tag LOCUS_00610 58883 60157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932623.1 protein_id gnl|my_center|LOCUS_00610 60154 60684 gene locus_tag LOCUS_00620 gene cobO 60154 60684 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_00620 61453 60692 gene locus_tag LOCUS_00630 61453 60692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_00630 61617 61979 gene locus_tag LOCUS_00640 61617 61979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 62029 62274 gene locus_tag LOCUS_00650 62029 62274 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938182.1 protein_id gnl|my_center|LOCUS_00650 62271 62948 gene locus_tag LOCUS_00660 62271 62948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 63899 62967 gene locus_tag LOCUS_00670 63899 62967 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_00670 64357 63902 gene locus_tag LOCUS_00680 64357 63902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 65329 64430 gene locus_tag LOCUS_00690 65329 64430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 65476 65736 gene locus_tag LOCUS_00700 65476 65736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 65896 66066 gene locus_tag LOCUS_00710 65896 66066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 66115 66567 gene locus_tag LOCUS_00720 66115 66567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 >Feature sequence002 1206 268 gene locus_tag LOCUS_00730 gene lnrL 1206 268 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_00730 1364 2170 gene locus_tag LOCUS_00740 1364 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2299 2225 gene locus_tag LOCUS_t00020 2299 2225 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2918 11677 gene locus_tag LOCUS_00750 2918 11677 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_00750 12566 11754 gene locus_tag LOCUS_00760 12566 11754 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_00760 12721 13446 gene locus_tag LOCUS_00770 12721 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 13591 13515 gene locus_tag LOCUS_t00030 13591 13515 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 14039 13638 gene locus_tag LOCUS_00780 14039 13638 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937805.1 protein_id gnl|my_center|LOCUS_00780 14145 14633 gene locus_tag LOCUS_00790 14145 14633 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409242.1 protein_id gnl|my_center|LOCUS_00790 15826 14636 gene locus_tag LOCUS_00800 15826 14636 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_00800 16584 15823 gene locus_tag LOCUS_00810 16584 15823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812523.1 protein_id gnl|my_center|LOCUS_00810 18100 16592 gene locus_tag LOCUS_00820 18100 16592 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256886.1 protein_id gnl|my_center|LOCUS_00820 18840 18124 gene locus_tag LOCUS_00830 gene ppaX 18840 18124 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_00830 21435 18874 gene locus_tag LOCUS_00840 gene gyrA 21435 18874 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_00840 21985 21452 gene locus_tag LOCUS_00850 21985 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 23845 22013 gene locus_tag LOCUS_00860 gene gyrB 23845 22013 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_00860 24592 24023 gene locus_tag LOCUS_00870 24592 24023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 25695 24592 gene locus_tag LOCUS_00880 gene recF 25695 24592 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_00880 26337 25711 gene locus_tag LOCUS_00890 26337 25711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 28407 27040 gene locus_tag LOCUS_00900 gene dnaA 28407 27040 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_00900 29235 28423 gene locus_tag LOCUS_00910 29235 28423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 30271 30474 gene locus_tag LOCUS_00920 30271 30474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 30474 30695 gene locus_tag LOCUS_00930 gene yidD 30474 30695 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_00930 30821 31540 gene locus_tag LOCUS_00940 30821 31540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 31537 32289 gene locus_tag LOCUS_00950 31537 32289 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295258.1 protein_id gnl|my_center|LOCUS_00950 32764 33489 gene locus_tag LOCUS_00960 gene rsmG 32764 33489 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836617.1 protein_id gnl|my_center|LOCUS_00960 33558 34361 gene locus_tag LOCUS_00970 33558 34361 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_00970 34354 35235 gene locus_tag LOCUS_00980 34354 35235 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_00980 35228 35527 gene locus_tag LOCUS_00990 35228 35527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 35573 38476 gene locus_tag LOCUS_01000 35573 38476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 38469 41873 gene locus_tag LOCUS_01010 38469 41873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 42888 41842 gene locus_tag LOCUS_01020 gene rlmN 42888 41842 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460524.1 protein_id gnl|my_center|LOCUS_01020 43287 44477 gene locus_tag LOCUS_01030 43287 44477 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_01030 45824 44550 gene locus_tag LOCUS_01040 45824 44550 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_01040 46001 46603 gene locus_tag LOCUS_01050 46001 46603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 46603 47535 gene locus_tag LOCUS_01060 46603 47535 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 protein_id gnl|my_center|LOCUS_01060 49661 47532 gene locus_tag LOCUS_01070 49661 47532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 49861 50169 gene locus_tag LOCUS_01080 49861 50169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 >Feature sequence003 <1 1602 gene locus_tag LOCUS_01090 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976336.1:DNA primase 1599 3128 gene locus_tag LOCUS_01100 1599 3128 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207194702.1 protein_id gnl|my_center|LOCUS_01100 3265 3190 gene locus_tag LOCUS_t00040 3265 3190 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3394 3468 gene locus_tag LOCUS_t00050 3394 3468 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3484 4575 gene locus_tag LOCUS_01110 3484 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 4666 5430 gene locus_tag LOCUS_01120 gene galE 4666 5430 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674228.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01120 5713 5787 gene locus_tag LOCUS_t00060 5713 5787 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5866 7875 gene locus_tag LOCUS_01130 5866 7875 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_01130 8611 8393 gene locus_tag LOCUS_01140 8611 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8587 9789 gene locus_tag LOCUS_01150 8587 9789 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_01150 9786 11093 gene locus_tag LOCUS_01160 9786 11093 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_01160 11090 13735 gene locus_tag LOCUS_01170 11090 13735 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_01170 13748 14416 gene locus_tag LOCUS_01180 13748 14416 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_01180 14509 15513 gene locus_tag LOCUS_01190 gene trpS 14509 15513 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_01190 15517 16260 gene locus_tag LOCUS_01200 15517 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 16257 16910 gene locus_tag LOCUS_01210 gene scpB 16257 16910 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_01210 16891 17676 gene locus_tag LOCUS_01220 16891 17676 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_01220 17677 18246 gene locus_tag LOCUS_01230 gene cobU 17677 18246 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530112.1 protein_id gnl|my_center|LOCUS_01230 18231 19328 gene locus_tag LOCUS_01240 gene cobT 18231 19328 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_01240 19325 20080 gene locus_tag LOCUS_01250 gene cobS 19325 20080 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140155.1 protein_id gnl|my_center|LOCUS_01250 20077 20706 gene locus_tag LOCUS_01260 20077 20706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 20761 21861 gene locus_tag LOCUS_01270 gene hisC 20761 21861 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_01270 21937 22962 gene locus_tag LOCUS_01280 gene aroF 21937 22962 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_01280 22959 24092 gene locus_tag LOCUS_01290 22959 24092 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_01290 24092 25408 gene locus_tag LOCUS_01300 gene aroA 24092 25408 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664630.1 protein_id gnl|my_center|LOCUS_01300 25460 26128 gene locus_tag LOCUS_01310 gene cmk 25460 26128 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_01310 26137 26766 gene locus_tag LOCUS_01320 26137 26766 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_01320 26763 27605 gene locus_tag LOCUS_01330 gene ispH 26763 27605 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_01330 27598 28887 gene locus_tag LOCUS_01340 27598 28887 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_01340 28887 30194 gene locus_tag LOCUS_01350 gene der 28887 30194 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_01350 30196 30867 gene locus_tag LOCUS_01360 gene plsY 30196 30867 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_01360 30871 31893 gene locus_tag LOCUS_01370 30871 31893 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392833.1 protein_id gnl|my_center|LOCUS_01370 31890 32573 gene locus_tag LOCUS_01380 gene rpe 31890 32573 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_01380 32714 33865 gene locus_tag LOCUS_01390 gene ribD 32714 33865 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_01390 33865 34533 gene locus_tag LOCUS_01400 33865 34533 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_01400 34530 35759 gene locus_tag LOCUS_01410 34530 35759 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_01410 35776 36246 gene locus_tag LOCUS_01420 gene ribE 35776 36246 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_01420 36585 37277 gene locus_tag LOCUS_01430 36585 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 37282 38103 gene locus_tag LOCUS_01440 gene hisJ 37282 38103 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_01440 38093 39199 gene locus_tag LOCUS_01450 38093 39199 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460810.1 protein_id gnl|my_center|LOCUS_01450 39186 39908 gene locus_tag LOCUS_01460 39186 39908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 39977 40372 gene locus_tag LOCUS_01470 39977 40372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 40384 40749 gene locus_tag LOCUS_01480 gene queD 40384 40749 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938647.1 protein_id gnl|my_center|LOCUS_01480 41242 41892 gene locus_tag LOCUS_01490 41242 41892 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_01490 42015 42431 gene locus_tag LOCUS_01500 42015 42431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence004 963 475 gene locus_tag LOCUS_01510 963 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 2439 1087 gene locus_tag LOCUS_01520 2439 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 3098 2436 gene locus_tag LOCUS_01530 gene fsa 3098 2436 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_01530 4052 3099 gene locus_tag LOCUS_01540 4052 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 5392 4052 gene locus_tag LOCUS_01550 5392 4052 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060774.1 protein_id gnl|my_center|LOCUS_01550 6186 5395 gene locus_tag LOCUS_01560 6186 5395 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990915.1 protein_id gnl|my_center|LOCUS_01560 7211 6297 gene locus_tag LOCUS_01570 gene thrB 7211 6297 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_01570 8501 7215 gene locus_tag LOCUS_01580 8501 7215 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_01580 9968 8607 gene locus_tag LOCUS_01590 gene lysA 9968 8607 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_01590 11772 10057 gene locus_tag LOCUS_01600 gene argS 11772 10057 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_01600 11916 12149 gene locus_tag LOCUS_01610 11916 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 12556 12146 gene locus_tag LOCUS_01620 12556 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13025 12561 gene locus_tag LOCUS_01630 gene rlmH 13025 12561 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989404.1 protein_id gnl|my_center|LOCUS_01630 14467 13022 gene locus_tag LOCUS_01640 14467 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 14738 14663 gene locus_tag LOCUS_t00070 14738 14663 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15912 14746 gene locus_tag LOCUS_01650 15912 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 17021 15900 gene locus_tag LOCUS_01660 gene holB 17021 15900 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_01660 17667 17026 gene locus_tag LOCUS_01670 gene tmk 17667 17026 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_01670 18230 17664 gene locus_tag LOCUS_01680 18230 17664 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_01680 19677 18223 gene locus_tag LOCUS_01690 19677 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 20518 19679 gene locus_tag LOCUS_01700 20518 19679 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_01700 21454 20519 gene locus_tag LOCUS_01710 gene mdh 21454 20519 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_01710 24070 21593 gene locus_tag LOCUS_01720 24070 21593 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_01720 24743 24189 gene locus_tag LOCUS_01730 24743 24189 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081962.1 protein_id gnl|my_center|LOCUS_01730 25408 24740 gene locus_tag LOCUS_01740 gene hypB 25408 24740 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_01740 25765 25421 gene locus_tag LOCUS_01750 gene hypA 25765 25421 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250958.1 protein_id gnl|my_center|LOCUS_01750 26539 25778 gene locus_tag LOCUS_01760 26539 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01760 27011 26556 gene locus_tag LOCUS_01770 27011 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 27460 27086 gene locus_tag LOCUS_01780 gene bldG 27460 27086 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_01780 27574 27924 gene locus_tag LOCUS_01790 27574 27924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 28574 27999 gene locus_tag LOCUS_01800 28574 27999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 29063 28638 gene locus_tag LOCUS_01810 29063 28638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 29523 29107 gene locus_tag LOCUS_01820 29523 29107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 30897 29548 gene locus_tag LOCUS_01830 30897 29548 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_01830 31729 30998 gene locus_tag LOCUS_01840 gene ubiE 31729 30998 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_01840 33501 31732 gene locus_tag LOCUS_01850 33501 31732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 34131 33619 gene locus_tag LOCUS_01860 34131 33619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 34797 34141 gene locus_tag LOCUS_01870 34797 34141 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173693.1 protein_id gnl|my_center|LOCUS_01870 35371 34931 gene locus_tag LOCUS_01880 35371 34931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 36222 35392 gene locus_tag LOCUS_01890 gene ccsA 36222 35392 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943519.1 protein_id gnl|my_center|LOCUS_01890 37505 36219 gene locus_tag LOCUS_01900 37505 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 39345 37585 gene locus_tag LOCUS_01910 39345 37585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence005 500 584 gene locus_tag LOCUS_t00080 500 584 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 635 1942 gene locus_tag LOCUS_01920 gene tig 635 1942 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_01920 1939 2550 gene locus_tag LOCUS_01930 gene clpP 1939 2550 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_01930 2560 3813 gene locus_tag LOCUS_01940 gene clpX 2560 3813 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896045.1 protein_id gnl|my_center|LOCUS_01940 4099 3881 gene locus_tag LOCUS_01950 4099 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4292 6940 gene locus_tag LOCUS_01960 4292 6940 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_01960 6942 8279 gene locus_tag LOCUS_01970 6942 8279 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_01970 8348 8794 gene locus_tag LOCUS_01980 8348 8794 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_01980 8849 10765 gene locus_tag LOCUS_01990 gene thrS 8849 10765 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_01990 10829 11401 gene locus_tag LOCUS_02000 10829 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11615 12295 gene locus_tag LOCUS_02010 gene infC 11615 12295 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729330.1 protein_id gnl|my_center|LOCUS_02010 12308 12505 gene locus_tag LOCUS_02020 gene rpmI 12308 12505 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_02020 12542 12901 gene locus_tag LOCUS_02030 gene rplT 12542 12901 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_02030 13099 13581 gene locus_tag LOCUS_02040 13099 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 13562 13957 gene locus_tag LOCUS_02050 13562 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 14322 13960 gene locus_tag LOCUS_02060 14322 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 14312 15373 gene locus_tag LOCUS_02070 gene pheS 14312 15373 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_02070 15416 17857 gene locus_tag LOCUS_02080 gene pheT 15416 17857 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_02080 17996 19033 gene locus_tag LOCUS_02090 gene argC 17996 19033 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_02090 19046 20269 gene locus_tag LOCUS_02100 gene argJ 19046 20269 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_02100 20281 21198 gene locus_tag LOCUS_02110 gene argB 20281 21198 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_02110 21201 22403 gene locus_tag LOCUS_02120 21201 22403 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_02120 22403 23317 gene locus_tag LOCUS_02130 gene argF 22403 23317 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808622.1 protein_id gnl|my_center|LOCUS_02130 23340 23771 gene locus_tag LOCUS_02140 gene argR 23340 23771 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633181.1 protein_id gnl|my_center|LOCUS_02140 23803 25029 gene locus_tag LOCUS_02150 23803 25029 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229357.1 protein_id gnl|my_center|LOCUS_02150 25031 25246 gene locus_tag LOCUS_02160 25031 25246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 25239 26663 gene locus_tag LOCUS_02170 gene argH 25239 26663 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_02170 26669 27163 gene locus_tag LOCUS_02180 26669 27163 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838770.1 protein_id gnl|my_center|LOCUS_02180 27219 28961 gene locus_tag LOCUS_02190 gene polX 27219 28961 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_02190 28958 29587 gene locus_tag LOCUS_02200 28958 29587 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_02200 31802 29607 gene locus_tag LOCUS_02210 31802 29607 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_02210 31962 34352 gene locus_tag LOCUS_02220 31962 34352 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393214.1 protein_id gnl|my_center|LOCUS_02220 36740 34356 gene locus_tag LOCUS_02230 36740 34356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 37232 38440 gene locus_tag LOCUS_02240 gene tyrS 37232 38440 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence006 <1 952 gene locus_tag LOCUS_02250 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242483.1:linearmycin resistance permease LnrM 952 2127 gene locus_tag LOCUS_02260 952 2127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963566.1 protein_id gnl|my_center|LOCUS_02260 2284 4299 gene locus_tag LOCUS_02270 2284 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 4308 4859 gene locus_tag LOCUS_02280 4308 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 5744 4902 gene locus_tag LOCUS_02290 5744 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8324 5796 gene locus_tag LOCUS_02300 8324 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9853 8354 gene locus_tag LOCUS_02310 9853 8354 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_02310 11340 9850 gene locus_tag LOCUS_02320 11340 9850 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_02320 12831 11341 gene locus_tag LOCUS_02330 12831 11341 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02330 13186 12833 gene locus_tag LOCUS_02340 13186 12833 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_02340 13902 13183 gene locus_tag LOCUS_02350 13902 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 14144 13902 gene locus_tag LOCUS_02360 14144 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 14467 14141 gene locus_tag LOCUS_02370 gene mnhG 14467 14141 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 protein_id gnl|my_center|LOCUS_02370 14739 14464 gene locus_tag LOCUS_02380 14739 14464 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_02380 15222 14749 gene locus_tag LOCUS_02390 15222 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 16106 15219 gene locus_tag LOCUS_02400 16106 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 16395 17060 gene locus_tag LOCUS_02410 16395 17060 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_02410 17623 17039 gene locus_tag LOCUS_02420 17623 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 17666 17821 gene locus_tag LOCUS_02430 17666 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 18073 18531 gene locus_tag LOCUS_02440 18073 18531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 18551 19900 gene locus_tag LOCUS_02450 18551 19900 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_02450 20116 21156 gene locus_tag LOCUS_02460 20116 21156 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461600.1 protein_id gnl|my_center|LOCUS_02460 21169 21642 gene locus_tag LOCUS_02470 21169 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 21639 22472 gene locus_tag LOCUS_02480 21639 22472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 23134 22469 gene locus_tag LOCUS_02490 23134 22469 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_02490 23210 25366 gene locus_tag LOCUS_02500 23210 25366 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941359.1 protein_id gnl|my_center|LOCUS_02500 25366 26844 gene locus_tag LOCUS_02510 25366 26844 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_02510 26904 29624 gene locus_tag LOCUS_02520 26904 29624 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 protein_id gnl|my_center|LOCUS_02520 29986 30621 gene locus_tag LOCUS_02530 29986 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 30749 31096 gene locus_tag LOCUS_02540 30749 31096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 31093 31281 gene locus_tag LOCUS_02550 31093 31281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 31315 31788 gene locus_tag LOCUS_02560 31315 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 32116 33396 gene locus_tag LOCUS_02570 32116 33396 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_02570 33402 34352 gene locus_tag LOCUS_02580 33402 34352 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_02580 34421 34885 gene locus_tag LOCUS_02590 34421 34885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 34961 35650 gene locus_tag LOCUS_02600 34961 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 35661 36353 gene locus_tag LOCUS_02610 35661 36353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence007 1291 242 gene locus_tag LOCUS_02620 1291 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 3591 1288 gene locus_tag LOCUS_02630 3591 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860624.1 protein_id gnl|my_center|LOCUS_02630 3825 5387 gene locus_tag LOCUS_02640 gene murJ 3825 5387 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_02640 5384 6064 gene locus_tag LOCUS_02650 5384 6064 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_02650 6921 6061 gene locus_tag LOCUS_02660 6921 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 8056 6935 gene locus_tag LOCUS_02670 gene steA 8056 6935 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_02670 9703 8063 gene locus_tag LOCUS_02680 gene recN 9703 8063 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_02680 10553 9705 gene locus_tag LOCUS_02690 10553 9705 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_02690 11349 10555 gene locus_tag LOCUS_02700 11349 10555 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_02700 13246 11315 gene locus_tag LOCUS_02710 gene dxs 13246 11315 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_02710 13779 13366 gene locus_tag LOCUS_02720 13779 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 14235 13786 gene locus_tag LOCUS_02730 gene nusB 14235 13786 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_02730 14654 14307 gene locus_tag LOCUS_02740 14654 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 16056 14647 gene locus_tag LOCUS_02750 gene accC 16056 14647 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_02750 17934 16057 gene locus_tag LOCUS_02760 gene accB 17934 16057 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393034.1 protein_id gnl|my_center|LOCUS_02760 18578 18018 gene locus_tag LOCUS_02770 gene efp 18578 18018 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_02770 19681 18593 gene locus_tag LOCUS_02780 19681 18593 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_02780 20124 19678 gene locus_tag LOCUS_02790 gene aroQ 20124 19678 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_02790 21776 20127 gene locus_tag LOCUS_02800 21776 20127 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363407.1 protein_id gnl|my_center|LOCUS_02800 22918 21770 gene locus_tag LOCUS_02810 gene aroC 22918 21770 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933099.1 protein_id gnl|my_center|LOCUS_02810 24066 23035 gene locus_tag LOCUS_02820 24066 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 24706 24092 gene locus_tag LOCUS_02830 24706 24092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 25373 24789 gene locus_tag LOCUS_02840 25373 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 26491 25370 gene locus_tag LOCUS_02850 gene pilM 26491 25370 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_02850 28239 26686 gene locus_tag LOCUS_02860 28239 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 28833 28267 gene locus_tag LOCUS_02870 28833 28267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 30377 28830 gene locus_tag LOCUS_02880 30377 28830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 31336 30497 gene locus_tag LOCUS_02890 31336 30497 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881038.1 protein_id gnl|my_center|LOCUS_02890 31839 31471 gene locus_tag LOCUS_02900 31839 31471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 33157 31943 gene locus_tag LOCUS_02910 33157 31943 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_02910 34902 33232 gene locus_tag LOCUS_02920 34902 33232 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence008 723 974 gene locus_tag LOCUS_02930 723 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1375 2547 gene locus_tag LOCUS_02940 1375 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2548 2955 gene locus_tag LOCUS_02950 2548 2955 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140937.1 protein_id gnl|my_center|LOCUS_02950 2974 5382 gene locus_tag LOCUS_02960 2974 5382 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_02960 5379 6041 gene locus_tag LOCUS_02970 5379 6041 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_02970 6038 6904 gene locus_tag LOCUS_02980 6038 6904 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_02980 6910 8484 gene locus_tag LOCUS_02990 6910 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8544 8924 gene locus_tag LOCUS_03000 8544 8924 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807790.1 protein_id gnl|my_center|LOCUS_03000 8967 10340 gene locus_tag LOCUS_03010 gene lpdA 8967 10340 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582893.1 protein_id gnl|my_center|LOCUS_03010 10328 11215 gene locus_tag LOCUS_03020 gene lipA 10328 11215 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_03020 12269 11235 gene locus_tag LOCUS_03030 12269 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12331 13062 gene locus_tag LOCUS_03040 12331 13062 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_03040 13139 13432 gene locus_tag LOCUS_03050 13139 13432 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_03050 13439 15541 gene locus_tag LOCUS_03060 gene ligA 13439 15541 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_03060 15534 16649 gene locus_tag LOCUS_03070 15534 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 16799 18481 gene locus_tag LOCUS_03080 16799 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 18585 18887 gene locus_tag LOCUS_03090 gene gatC 18585 18887 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_03090 18884 20392 gene locus_tag LOCUS_03100 gene gatA 18884 20392 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_03100 20394 21962 gene locus_tag LOCUS_03110 gene gatB 20394 21962 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_03110 22934 21981 gene locus_tag LOCUS_03120 22934 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 23765 23427 gene locus_tag LOCUS_03130 23765 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 23911 25122 gene locus_tag LOCUS_03140 23911 25122 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_03140 25134 26600 gene locus_tag LOCUS_03150 25134 26600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 26640 27485 gene locus_tag LOCUS_03160 26640 27485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 27632 28345 gene locus_tag LOCUS_03170 27632 28345 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887270.1 protein_id gnl|my_center|LOCUS_03170 31876 28412 gene locus_tag LOCUS_03180 31876 28412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 31981 32259 gene locus_tag LOCUS_03190 31981 32259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 34940 32301 gene locus_tag LOCUS_03200 34940 32301 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence009 2251 254 gene locus_tag LOCUS_03210 2251 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2853 2509 gene locus_tag LOCUS_03220 2853 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 2837 3346 gene locus_tag LOCUS_03230 2837 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3495 4559 gene locus_tag LOCUS_03240 3495 4559 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390551.1 protein_id gnl|my_center|LOCUS_03240 4645 5943 gene locus_tag LOCUS_03250 4645 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 5998 7074 gene locus_tag LOCUS_03260 gene wecB 5998 7074 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390550.1 protein_id gnl|my_center|LOCUS_03260 7071 7937 gene locus_tag LOCUS_03270 7071 7937 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597457.1 protein_id gnl|my_center|LOCUS_03270 8012 8713 gene locus_tag LOCUS_03280 8012 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 9564 8719 gene locus_tag LOCUS_03290 9564 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10975 9797 gene locus_tag LOCUS_03300 10975 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 11060 12355 gene locus_tag LOCUS_03310 11060 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 12352 13848 gene locus_tag LOCUS_03320 12352 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 14724 13876 gene locus_tag LOCUS_03330 14724 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 15968 14721 gene locus_tag LOCUS_03340 15968 14721 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597462.1 protein_id gnl|my_center|LOCUS_03340 16192 15965 gene locus_tag LOCUS_03350 16192 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16342 17205 gene locus_tag LOCUS_03360 16342 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 17209 18363 gene locus_tag LOCUS_03370 17209 18363 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_03370 18360 19040 gene locus_tag LOCUS_03380 18360 19040 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925266.1 protein_id gnl|my_center|LOCUS_03380 19037 19639 gene locus_tag LOCUS_03390 19037 19639 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_03390 19695 21038 gene locus_tag LOCUS_03400 19695 21038 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_03400 21032 22243 gene locus_tag LOCUS_03410 21032 22243 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061514.1 protein_id gnl|my_center|LOCUS_03410 22240 24084 gene locus_tag LOCUS_03420 22240 24084 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_03420 26196 24103 gene locus_tag LOCUS_03430 26196 24103 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_03430 27111 26197 gene locus_tag LOCUS_03440 27111 26197 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_03440 29269 27215 gene locus_tag LOCUS_03450 29269 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 30387 29266 gene locus_tag LOCUS_03460 gene leuB 30387 29266 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393735.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence010 263 1411 gene locus_tag LOCUS_03470 263 1411 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_03470 1471 1818 gene locus_tag LOCUS_03480 1471 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1815 2741 gene locus_tag LOCUS_03490 1815 2741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582702.1 protein_id gnl|my_center|LOCUS_03490 2741 3508 gene locus_tag LOCUS_03500 2741 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4070 3534 gene locus_tag LOCUS_03510 4070 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 4617 4105 gene locus_tag LOCUS_03520 4617 4105 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_03520 5805 4714 gene locus_tag LOCUS_03530 5805 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5955 7154 gene locus_tag LOCUS_03540 gene coaBC 5955 7154 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_03540 7160 7729 gene locus_tag LOCUS_03550 7160 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 7777 7853 gene locus_tag LOCUS_t00090 7777 7853 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8113 8562 gene locus_tag LOCUS_03560 8113 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 8612 9088 gene locus_tag LOCUS_03570 8612 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 9379 9561 gene locus_tag LOCUS_03580 9379 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 10047 11084 gene locus_tag LOCUS_03590 gene mltG 10047 11084 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_03590 11135 12082 gene locus_tag LOCUS_03600 gene corA 11135 12082 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_03600 12073 12729 gene locus_tag LOCUS_03610 12073 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 12746 15256 gene locus_tag LOCUS_03620 12746 15256 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_03620 15399 17273 gene locus_tag LOCUS_03630 15399 17273 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256943.1 protein_id gnl|my_center|LOCUS_03630 17317 18618 gene locus_tag LOCUS_03640 17317 18618 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_03640 18622 19056 gene locus_tag LOCUS_03650 18622 19056 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_03650 19892 19038 gene locus_tag LOCUS_03660 19892 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 20318 19926 gene locus_tag LOCUS_03670 20318 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 20341 21582 gene locus_tag LOCUS_03680 20341 21582 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_03680 21595 22701 gene locus_tag LOCUS_03690 gene gcvT 21595 22701 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_03690 22735 23118 gene locus_tag LOCUS_03700 gene gcvH 22735 23118 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_03700 23122 24459 gene locus_tag LOCUS_03710 gene gcvPA 23122 24459 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_03710 24456 25952 gene locus_tag LOCUS_03720 gene gcvPB 24456 25952 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_03720 25970 26713 gene locus_tag LOCUS_03730 25970 26713 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_03730 26862 27173 gene locus_tag LOCUS_03740 26862 27173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 27209 27469 gene locus_tag LOCUS_03750 27209 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 27517 27966 gene locus_tag LOCUS_03760 27517 27966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence011 11 86 gene locus_tag LOCUS_t00100 11 86 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 179 571 gene locus_tag LOCUS_03770 179 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 637 3171 gene locus_tag LOCUS_03780 gene leuS 637 3171 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_03780 3278 3949 gene locus_tag LOCUS_03790 3278 3949 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_03790 4232 3936 gene locus_tag LOCUS_03800 4232 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 4186 6582 gene locus_tag LOCUS_03810 4186 6582 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_03810 6485 7405 gene locus_tag LOCUS_03820 gene holA 6485 7405 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_03820 7772 7506 gene locus_tag LOCUS_03830 gene rpsT 7772 7506 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228460.1 protein_id gnl|my_center|LOCUS_03830 7979 9781 gene locus_tag LOCUS_03840 gene lepA 7979 9781 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_03840 9785 10993 gene locus_tag LOCUS_03850 gene hemW 9785 10993 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_03850 11104 12126 gene locus_tag LOCUS_03860 gene hrcA 11104 12126 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_03860 12142 13254 gene locus_tag LOCUS_03870 gene dnaJ 12142 13254 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_03870 13255 14028 gene locus_tag LOCUS_03880 13255 14028 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_03880 14021 15331 gene locus_tag LOCUS_03890 gene mtaB 14021 15331 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_03890 15443 16423 gene locus_tag LOCUS_03900 15443 16423 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_03900 16416 18539 gene locus_tag LOCUS_03910 16416 18539 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_03910 18505 18948 gene locus_tag LOCUS_03920 gene ybeY 18505 18948 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_03920 18957 19658 gene locus_tag LOCUS_03930 18957 19658 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 protein_id gnl|my_center|LOCUS_03930 19686 20990 gene locus_tag LOCUS_03940 19686 20990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 20965 21396 gene locus_tag LOCUS_03950 20965 21396 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_03950 21398 22312 gene locus_tag LOCUS_03960 gene era 21398 22312 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_03960 22355 23038 gene locus_tag LOCUS_03970 gene deoC 22355 23038 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_03970 23029 23799 gene locus_tag LOCUS_03980 23029 23799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 23882 24763 gene locus_tag LOCUS_03990 gene glyQ 23882 24763 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_03990 24763 26835 gene locus_tag LOCUS_04000 gene glyS 24763 26835 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_04000 26837 27655 gene locus_tag LOCUS_04010 26837 27655 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392143.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence012 479 1381 gene locus_tag LOCUS_04020 gene xerD 479 1381 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792251.1 protein_id gnl|my_center|LOCUS_04020 1347 2186 gene locus_tag LOCUS_04030 gene whiG 1347 2186 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_04030 2231 2830 gene locus_tag LOCUS_04040 2231 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 3039 3914 gene locus_tag LOCUS_04050 gene rpsB 3039 3914 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_04050 3971 4885 gene locus_tag LOCUS_04060 gene tsf 3971 4885 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_04060 4992 5717 gene locus_tag LOCUS_04070 gene pyrH 4992 5717 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_04070 5714 6271 gene locus_tag LOCUS_04080 gene frr 5714 6271 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531503.1 protein_id gnl|my_center|LOCUS_04080 6279 7055 gene locus_tag LOCUS_04090 6279 7055 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_04090 7055 7867 gene locus_tag LOCUS_04100 7055 7867 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_04100 7864 9000 gene locus_tag LOCUS_04110 7864 9000 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_04110 9057 10310 gene locus_tag LOCUS_04120 9057 10310 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027845.1 protein_id gnl|my_center|LOCUS_04120 10323 11375 gene locus_tag LOCUS_04130 gene ispG 10323 11375 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_04130 11479 11871 gene locus_tag LOCUS_04140 11479 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11915 13642 gene locus_tag LOCUS_04150 11915 13642 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_04150 13780 14262 gene locus_tag LOCUS_04160 gene rimP 13780 14262 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_04160 14266 15411 gene locus_tag LOCUS_04170 gene nusA 14266 15411 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_04170 15416 15721 gene locus_tag LOCUS_04180 15416 15721 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583568.1 protein_id gnl|my_center|LOCUS_04180 15727 18156 gene locus_tag LOCUS_04190 15727 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 18160 18525 gene locus_tag LOCUS_04200 18160 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 18532 19503 gene locus_tag LOCUS_04210 18532 19503 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_04210 19500 20417 gene locus_tag LOCUS_04220 19500 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 20414 21340 gene locus_tag LOCUS_04230 20414 21340 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_04230 21438 21779 gene locus_tag LOCUS_04240 gene rpsO 21438 21779 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_04240 21892 24063 gene locus_tag LOCUS_04250 gene pnp 21892 24063 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_04250 24146 25393 gene locus_tag LOCUS_04260 24146 25393 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_04260 25408 26187 gene locus_tag LOCUS_04270 gene dapB 25408 26187 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_04270 26195 27409 gene locus_tag LOCUS_04280 gene dapG 26195 27409 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808827.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence013 2477 1941 gene locus_tag LOCUS_04290 2477 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2938 2477 gene locus_tag LOCUS_04300 2938 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3449 2949 gene locus_tag LOCUS_04310 gene coaD 3449 2949 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_04310 4017 3451 gene locus_tag LOCUS_04320 gene rsmD 4017 3451 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_04320 6113 4014 gene locus_tag LOCUS_04330 gene recG 6113 4014 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_04330 6979 6131 gene locus_tag LOCUS_04340 6979 6131 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_04340 8610 7000 gene locus_tag LOCUS_04350 8610 7000 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_04350 8972 8607 gene locus_tag LOCUS_04360 8972 8607 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830156.1 protein_id gnl|my_center|LOCUS_04360 9181 9369 gene locus_tag LOCUS_04370 gene rpmB 9181 9369 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_04370 11055 9373 gene locus_tag LOCUS_04380 11055 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11701 11177 gene locus_tag LOCUS_04390 11701 11177 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_04390 12417 11854 gene locus_tag LOCUS_04400 12417 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13607 12642 gene locus_tag LOCUS_04410 13607 12642 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_04410 14761 13715 gene locus_tag LOCUS_04420 14761 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 14885 15154 gene locus_tag LOCUS_04430 14885 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 16130 15165 gene locus_tag LOCUS_04440 gene glpX 16130 15165 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_04440 17512 16160 gene locus_tag LOCUS_04450 gene rsmB 17512 16160 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_04450 18420 17500 gene locus_tag LOCUS_04460 gene fmt 18420 17500 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805211.1 protein_id gnl|my_center|LOCUS_04460 18929 18444 gene locus_tag LOCUS_04470 gene def 18929 18444 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583792.1 protein_id gnl|my_center|LOCUS_04470 21270 19000 gene locus_tag LOCUS_04480 gene priA 21270 19000 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_04480 22556 21309 gene locus_tag LOCUS_04490 gene metK 22556 21309 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_04490 22893 23309 gene locus_tag LOCUS_04500 22893 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 23334 24788 gene locus_tag LOCUS_04510 gene gltX 23334 24788 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_04510 24907 24982 gene locus_tag LOCUS_t00110 24907 24982 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 2718 1825 gene locus_tag LOCUS_04520 2718 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3649 2684 gene locus_tag LOCUS_04530 gene hemC 3649 2684 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933094.1 protein_id gnl|my_center|LOCUS_04530 5009 3630 gene locus_tag LOCUS_04540 gene hemA 5009 3630 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_04540 6065 5229 gene locus_tag LOCUS_04550 6065 5229 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327253.1 protein_id gnl|my_center|LOCUS_04550 6920 6075 gene locus_tag LOCUS_04560 gene ccsB 6920 6075 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_04560 7140 6952 gene locus_tag LOCUS_04570 7140 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8075 7149 gene locus_tag LOCUS_04580 8075 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 8822 8118 gene locus_tag LOCUS_04590 8822 8118 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_04590 9558 8827 gene locus_tag LOCUS_04600 9558 8827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_04600 11643 9568 gene locus_tag LOCUS_04610 11643 9568 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693418.1 protein_id gnl|my_center|LOCUS_04610 12363 11680 gene locus_tag LOCUS_04620 12363 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 13360 12590 gene locus_tag LOCUS_04630 13360 12590 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_04630 13481 14182 gene locus_tag LOCUS_04640 13481 14182 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804556.1 protein_id gnl|my_center|LOCUS_04640 14189 15631 gene locus_tag LOCUS_04650 14189 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 18355 15647 gene locus_tag LOCUS_04660 18355 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 19608 18352 gene locus_tag LOCUS_04670 19608 18352 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_04670 20257 19694 gene locus_tag LOCUS_04680 20257 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 21279 20323 gene locus_tag LOCUS_04690 21279 20323 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_04690 21964 21260 gene locus_tag LOCUS_04700 21964 21260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 22872 21964 gene locus_tag LOCUS_04710 gene nadC 22872 21964 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391199.1 protein_id gnl|my_center|LOCUS_04710 24527 22869 gene locus_tag LOCUS_04720 gene nadB 24527 22869 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence015 1755 733 gene locus_tag LOCUS_04730 gene mnmA 1755 733 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_04730 2065 2646 gene locus_tag LOCUS_04740 2065 2646 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_04740 4392 2647 gene locus_tag LOCUS_04750 4392 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4533 5135 gene locus_tag LOCUS_04760 4533 5135 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 protein_id gnl|my_center|LOCUS_04760 5126 7207 gene locus_tag LOCUS_04770 5126 7207 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_04770 7209 9110 gene locus_tag LOCUS_04780 7209 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 9150 10028 gene locus_tag LOCUS_04790 9150 10028 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966558.1 protein_id gnl|my_center|LOCUS_04790 10047 10919 gene locus_tag LOCUS_04800 10047 10919 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_04800 10922 11785 gene locus_tag LOCUS_04810 10922 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 13191 11788 gene locus_tag LOCUS_04820 13191 11788 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_04820 13386 13886 gene locus_tag LOCUS_04830 13386 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 14107 14676 gene locus_tag LOCUS_04840 14107 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 14759 15925 gene locus_tag LOCUS_04850 14759 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 15929 16513 gene locus_tag LOCUS_04860 15929 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 16530 17219 gene locus_tag LOCUS_04870 16530 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 17212 18636 gene locus_tag LOCUS_04880 17212 18636 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_04880 18765 19568 gene locus_tag LOCUS_04890 18765 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 19587 20900 gene locus_tag LOCUS_04900 19587 20900 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222086.1 protein_id gnl|my_center|LOCUS_04900 21081 20887 gene locus_tag LOCUS_04910 21081 20887 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_04910 21684 21115 gene locus_tag LOCUS_04920 21684 21115 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811992.1 protein_id gnl|my_center|LOCUS_04920 21861 23048 gene locus_tag LOCUS_04930 gene nifV 21861 23048 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583977.1 protein_id gnl|my_center|LOCUS_04930 23045 24325 gene locus_tag LOCUS_04940 23045 24325 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence016 3117 1069 gene locus_tag LOCUS_04950 3117 1069 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_04950 4752 3397 gene locus_tag LOCUS_04960 4752 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 6702 4768 gene locus_tag LOCUS_04970 6702 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7870 6689 gene locus_tag LOCUS_04980 7870 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 8529 7867 gene locus_tag LOCUS_04990 8529 7867 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_04990 8670 8584 gene locus_tag LOCUS_t00120 8670 8584 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9625 8693 gene locus_tag LOCUS_05000 9625 8693 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_05000 9996 9622 gene locus_tag LOCUS_05010 9996 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 10442 10107 gene locus_tag LOCUS_05020 10442 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12173 10776 gene locus_tag LOCUS_05030 gene pyk 12173 10776 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_05030 13556 12243 gene locus_tag LOCUS_05040 gene eno 13556 12243 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_05040 14998 13553 gene locus_tag LOCUS_05050 gene mazG 14998 13553 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_05050 15911 15021 gene locus_tag LOCUS_05060 15911 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 19348 15926 gene locus_tag LOCUS_05070 gene mfd 19348 15926 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_05070 20704 19493 gene locus_tag LOCUS_05080 20704 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 21502 20762 gene locus_tag LOCUS_05090 21502 20762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 21701 22357 gene locus_tag LOCUS_05100 gene nth 21701 22357 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_05100 23133 22378 gene locus_tag LOCUS_05110 23133 22378 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941418.1 protein_id gnl|my_center|LOCUS_05110 23593 23135 gene locus_tag LOCUS_05120 23593 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 23696 23842 gene locus_tag LOCUS_05130 23696 23842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05130 >Feature sequence017 255 361 gene locus_tag LOCUS_r00010 255 361 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 511 729 gene locus_tag LOCUS_05140 511 729 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_05140 988 3261 gene locus_tag LOCUS_05150 988 3261 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_05150 3272 3835 gene locus_tag LOCUS_05160 gene dcd 3272 3835 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_05160 3844 4080 gene locus_tag LOCUS_05170 3844 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4086 4904 gene locus_tag LOCUS_05180 4086 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392149.1 protein_id gnl|my_center|LOCUS_05180 6151 4859 gene locus_tag LOCUS_05190 6151 4859 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_05190 6513 6187 gene locus_tag LOCUS_05200 6513 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7172 6510 gene locus_tag LOCUS_05210 7172 6510 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_05210 7290 7676 gene locus_tag LOCUS_05220 7290 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8378 7680 gene locus_tag LOCUS_05230 8378 7680 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_05230 8562 9125 gene locus_tag LOCUS_05240 8562 9125 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_05240 9130 10020 gene locus_tag LOCUS_05250 gene htpX 9130 10020 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_05250 10017 10907 gene locus_tag LOCUS_05260 gene lgt 10017 10907 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_05260 11116 10904 gene locus_tag LOCUS_05270 11116 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 11252 12292 gene locus_tag LOCUS_05280 11252 12292 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_05280 12400 13290 gene locus_tag LOCUS_05290 gene pdxS 12400 13290 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119184.1 protein_id gnl|my_center|LOCUS_05290 13293 13871 gene locus_tag LOCUS_05300 gene pdxT 13293 13871 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_05300 13889 14647 gene locus_tag LOCUS_05310 13889 14647 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 protein_id gnl|my_center|LOCUS_05310 15106 14660 gene locus_tag LOCUS_05320 15106 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 15245 15736 gene locus_tag LOCUS_05330 gene ruvC 15245 15736 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_05330 15733 16314 gene locus_tag LOCUS_05340 gene ruvA 15733 16314 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_05340 16311 17375 gene locus_tag LOCUS_05350 gene ruvB 16311 17375 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_05350 17443 18012 gene locus_tag LOCUS_05360 17443 18012 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_05360 18097 18936 gene locus_tag LOCUS_05370 gene folD 18097 18936 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937630.1 protein_id gnl|my_center|LOCUS_05370 19010 19738 gene locus_tag LOCUS_05380 19010 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 19740 20384 gene locus_tag LOCUS_05390 19740 20384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 20436 20999 gene locus_tag LOCUS_05400 20436 20999 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940315.1 protein_id gnl|my_center|LOCUS_05400 21061 22095 gene locus_tag LOCUS_05410 gene queA 21061 22095 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_05410 23078 22104 gene locus_tag LOCUS_05420 23078 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 23628 23065 gene locus_tag LOCUS_05430 23628 23065 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence018 27 455 gene locus_tag LOCUS_05440 27 455 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_05440 613 1869 gene locus_tag LOCUS_05450 gene murA 613 1869 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_05450 1879 2301 gene locus_tag LOCUS_05460 gene fabZ 1879 2301 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_05460 2354 3649 gene locus_tag LOCUS_05470 2354 3649 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_05470 3836 5101 gene locus_tag LOCUS_05480 3836 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 6321 5098 gene locus_tag LOCUS_05490 6321 5098 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_05490 6449 7582 gene locus_tag LOCUS_05500 6449 7582 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257992.1 protein_id gnl|my_center|LOCUS_05500 7687 9405 gene locus_tag LOCUS_05510 7687 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10958 9420 gene locus_tag LOCUS_05520 10958 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 11082 12377 gene locus_tag LOCUS_05530 11082 12377 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272540.1 protein_id gnl|my_center|LOCUS_05530 12434 13249 gene locus_tag LOCUS_05540 12434 13249 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_05540 13293 14552 gene locus_tag LOCUS_05550 gene ahcY 13293 14552 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_05550 14728 15024 gene locus_tag LOCUS_05560 14728 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 15075 15383 gene locus_tag LOCUS_05570 15075 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 15398 17179 gene locus_tag LOCUS_05580 15398 17179 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_05580 17215 18168 gene locus_tag LOCUS_05590 17215 18168 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_05590 18193 18939 gene locus_tag LOCUS_05600 18193 18939 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_05600 20467 19070 gene locus_tag LOCUS_05610 20467 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 20593 20838 gene locus_tag LOCUS_05620 20593 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 20835 21092 gene locus_tag LOCUS_05630 20835 21092 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_05630 21197 22426 gene locus_tag LOCUS_05640 gene mtnA 21197 22426 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_05640 22436 23347 gene locus_tag LOCUS_05650 22436 23347 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence019 1218 694 gene locus_tag LOCUS_05660 1218 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1922 1245 gene locus_tag LOCUS_05670 1922 1245 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_05670 2599 1928 gene locus_tag LOCUS_05680 gene phoU 2599 1928 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_05680 3514 2690 gene locus_tag LOCUS_05690 gene pstB 3514 2690 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337598.1 protein_id gnl|my_center|LOCUS_05690 4341 3511 gene locus_tag LOCUS_05700 gene pstA 4341 3511 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_05700 5275 4346 gene locus_tag LOCUS_05710 gene pstC 5275 4346 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_05710 6056 5268 gene locus_tag LOCUS_05720 6056 5268 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_05720 6913 6095 gene locus_tag LOCUS_05730 gene pgeF 6913 6095 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460686.1 protein_id gnl|my_center|LOCUS_05730 7047 7580 gene locus_tag LOCUS_05740 7047 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 8846 7758 gene locus_tag LOCUS_05750 gene ftsZ 8846 7758 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_05750 9895 9005 gene locus_tag LOCUS_05760 9895 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 10868 9924 gene locus_tag LOCUS_05770 gene murB 10868 9924 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_05770 12259 10865 gene locus_tag LOCUS_05780 gene murC 12259 10865 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_05780 13371 12256 gene locus_tag LOCUS_05790 gene murG 13371 12256 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_05790 14548 13283 gene locus_tag LOCUS_05800 gene ftsW 14548 13283 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_05800 15935 14538 gene locus_tag LOCUS_05810 gene murD 15935 14538 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_05810 16987 15935 gene locus_tag LOCUS_05820 gene mraY 16987 15935 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_05820 18392 16968 gene locus_tag LOCUS_05830 18392 16968 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_05830 19837 18386 gene locus_tag LOCUS_05840 19837 18386 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_05840 21544 19892 gene locus_tag LOCUS_05850 21544 19892 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_05850 22191 21649 gene locus_tag LOCUS_05860 22191 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 <23208 22251 gene locus_tag LOCUS_05870 <23208 22251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392354.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence020 <1 1181 gene locus_tag LOCUS_05880 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965122.1:ribonuclease Y 1295 2371 gene locus_tag LOCUS_05890 1295 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2535 2810 gene locus_tag LOCUS_05900 gene spoVS 2535 2810 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_05900 2807 3643 gene locus_tag LOCUS_05910 2807 3643 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_05910 3640 4974 gene locus_tag LOCUS_05920 gene miaB 3640 4974 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_05920 5023 6396 gene locus_tag LOCUS_05930 gene amrA 5023 6396 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_05930 6400 7377 gene locus_tag LOCUS_05940 gene miaA 6400 7377 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_05940 7353 8219 gene locus_tag LOCUS_05950 gene dapF 7353 8219 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_05950 8333 9472 gene locus_tag LOCUS_05960 gene dapL 8333 9472 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144094.1 protein_id gnl|my_center|LOCUS_05960 9488 10783 gene locus_tag LOCUS_05970 gene hflX 9488 10783 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413984.1 protein_id gnl|my_center|LOCUS_05970 11436 10780 gene locus_tag LOCUS_05980 gene lexA 11436 10780 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_05980 11616 11987 gene locus_tag LOCUS_05990 11616 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 12108 12554 gene locus_tag LOCUS_06000 gene nrdR 12108 12554 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_06000 12600 12845 gene locus_tag LOCUS_06010 12600 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 12850 13290 gene locus_tag LOCUS_06020 gene dut 12850 13290 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413930.1 protein_id gnl|my_center|LOCUS_06020 13958 13647 gene locus_tag LOCUS_06030 13958 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 14356 13973 gene locus_tag LOCUS_06040 14356 13973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 14911 14369 gene locus_tag LOCUS_06050 14911 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 16248 14944 gene locus_tag LOCUS_06060 16248 14944 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_06060 16987 16259 gene locus_tag LOCUS_06070 16987 16259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_06070 17750 16980 gene locus_tag LOCUS_06080 17750 16980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_06080 18775 17747 gene locus_tag LOCUS_06090 18775 17747 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_06090 19656 18778 gene locus_tag LOCUS_06100 19656 18778 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_06100 20887 19685 gene locus_tag LOCUS_06110 20887 19685 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942380.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence021 10 85 gene locus_tag LOCUS_t00130 10 85 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 177 250 gene locus_tag LOCUS_t00140 177 250 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 525 373 gene locus_tag LOCUS_06120 525 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1361 654 gene locus_tag LOCUS_06130 1361 654 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_06130 1924 1358 gene locus_tag LOCUS_06140 1924 1358 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728289.1 protein_id gnl|my_center|LOCUS_06140 2795 1989 gene locus_tag LOCUS_06150 2795 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 6101 2835 gene locus_tag LOCUS_06160 6101 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6905 6180 gene locus_tag LOCUS_06170 6905 6180 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 protein_id gnl|my_center|LOCUS_06170 7377 7033 gene locus_tag LOCUS_06180 7377 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8807 7458 gene locus_tag LOCUS_06190 8807 7458 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_06190 10333 8804 gene locus_tag LOCUS_06200 10333 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11724 10330 gene locus_tag LOCUS_06210 gene rpoN 11724 10330 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_06210 12786 11773 gene locus_tag LOCUS_06220 12786 11773 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941237.1 protein_id gnl|my_center|LOCUS_06220 13655 12786 gene locus_tag LOCUS_06230 13655 12786 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_06230 13819 14121 gene locus_tag LOCUS_06240 13819 14121 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349636.1 protein_id gnl|my_center|LOCUS_06240 14486 14139 gene locus_tag LOCUS_06250 14486 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 15065 14736 gene locus_tag LOCUS_06260 gene trxA 15065 14736 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598398.1 protein_id gnl|my_center|LOCUS_06260 15187 16410 gene locus_tag LOCUS_06270 15187 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 17146 16424 gene locus_tag LOCUS_06280 17146 16424 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_06280 18435 17275 gene locus_tag LOCUS_06290 18435 17275 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_06290 19714 18437 gene locus_tag LOCUS_06300 19714 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence022 <1 1136 gene locus_tag LOCUS_06310 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391653.1:ATP-dependent zinc metalloprotease FtsH 1270 1686 gene locus_tag LOCUS_06320 1270 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1717 1923 gene locus_tag LOCUS_06330 1717 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1920 2279 gene locus_tag LOCUS_06340 1920 2279 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_06340 2305 2688 gene locus_tag LOCUS_06350 2305 2688 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388948.1 protein_id gnl|my_center|LOCUS_06350 2692 3606 gene locus_tag LOCUS_06360 2692 3606 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_06360 3603 4496 gene locus_tag LOCUS_06370 3603 4496 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_06370 4607 5812 gene locus_tag LOCUS_06380 4607 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 5812 6474 gene locus_tag LOCUS_06390 5812 6474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_06390 6579 6896 gene locus_tag LOCUS_06400 6579 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7002 7427 gene locus_tag LOCUS_06410 7002 7427 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255279.1 protein_id gnl|my_center|LOCUS_06410 7431 9062 gene locus_tag LOCUS_06420 7431 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 9078 9854 gene locus_tag LOCUS_06430 9078 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 9867 11030 gene locus_tag LOCUS_06440 9867 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 11020 12390 gene locus_tag LOCUS_06450 11020 12390 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_06450 12423 14303 gene locus_tag LOCUS_06460 12423 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 14306 15226 gene locus_tag LOCUS_06470 14306 15226 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_06470 15274 15840 gene locus_tag LOCUS_06480 gene folE 15274 15840 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_06480 15872 16732 gene locus_tag LOCUS_06490 gene folP 15872 16732 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227766.1 protein_id gnl|my_center|LOCUS_06490 16729 17556 gene locus_tag LOCUS_06500 16729 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 17687 18571 gene locus_tag LOCUS_06510 gene panB 17687 18571 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_06510 18574 19425 gene locus_tag LOCUS_06520 gene panC 18574 19425 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence023 2668 530 gene locus_tag LOCUS_06530 gene ppk1 2668 530 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_06530 4277 2748 gene locus_tag LOCUS_06540 4277 2748 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_06540 4741 4274 gene locus_tag LOCUS_06550 4741 4274 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243293.1 protein_id gnl|my_center|LOCUS_06550 4851 5255 gene locus_tag LOCUS_06560 4851 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6352 5258 gene locus_tag LOCUS_06570 6352 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7333 6590 gene locus_tag LOCUS_06580 7333 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7475 7696 gene locus_tag LOCUS_06590 7475 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8551 7787 gene locus_tag LOCUS_06600 8551 7787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_06600 9180 8725 gene locus_tag LOCUS_06610 9180 8725 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037432.1 protein_id gnl|my_center|LOCUS_06610 10596 9208 gene locus_tag LOCUS_06620 10596 9208 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_06620 11099 10833 gene locus_tag LOCUS_06630 11099 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11316 11239 gene locus_tag LOCUS_t00150 11316 11239 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12359 11409 gene locus_tag LOCUS_06640 12359 11409 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_06640 12677 12378 gene locus_tag LOCUS_06650 12677 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 13618 12725 gene locus_tag LOCUS_06660 13618 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 13646 14446 gene locus_tag LOCUS_06670 13646 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 15138 14716 gene locus_tag LOCUS_06680 15138 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 15280 16212 gene locus_tag LOCUS_06690 15280 16212 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_06690 16595 16209 gene locus_tag LOCUS_06700 16595 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 17453 16746 gene locus_tag LOCUS_06710 17453 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17708 17634 gene locus_tag LOCUS_t00160 17708 17634 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18196 17774 gene locus_tag LOCUS_06720 18196 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 18438 18193 gene locus_tag LOCUS_06730 18438 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence024 126 542 gene locus_tag LOCUS_06740 126 542 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_06740 623 886 gene locus_tag LOCUS_06750 gene rpsR 623 886 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_06750 915 1877 gene locus_tag LOCUS_06760 915 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1937 2617 gene locus_tag LOCUS_06770 1937 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2680 4038 gene locus_tag LOCUS_06780 gene dnaB 2680 4038 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_06780 4074 5465 gene locus_tag LOCUS_06790 4074 5465 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_06790 5495 5830 gene locus_tag LOCUS_06800 5495 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6017 7306 gene locus_tag LOCUS_06810 6017 7306 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_06810 7421 8701 gene locus_tag LOCUS_06820 gene purD 7421 8701 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_06820 8701 10026 gene locus_tag LOCUS_06830 8701 10026 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_06830 10037 10501 gene locus_tag LOCUS_06840 gene purE 10037 10501 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_06840 10494 10943 gene locus_tag LOCUS_06850 10494 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 11457 10963 gene locus_tag LOCUS_06860 11457 10963 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_06860 11587 12807 gene locus_tag LOCUS_06870 11587 12807 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_06870 12942 13262 gene locus_tag LOCUS_06880 12942 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06880 13276 13689 gene locus_tag LOCUS_06890 gene msrB 13276 13689 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 protein_id gnl|my_center|LOCUS_06890 13686 14756 gene locus_tag LOCUS_06900 gene rsgA 13686 14756 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_06900 14855 15727 gene locus_tag LOCUS_06910 gene hisG 14855 15727 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_06910 15737 16315 gene locus_tag LOCUS_06920 15737 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 16848 16417 gene locus_tag LOCUS_06930 16848 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 17739 16978 gene locus_tag LOCUS_06940 17739 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 18292 17726 gene locus_tag LOCUS_06950 18292 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19622 18435 gene locus_tag LOCUS_06960 gene ahbD 19622 18435 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence025 1282 359 gene locus_tag LOCUS_06970 1282 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2217 1282 gene locus_tag LOCUS_06980 gene rapZ 2217 1282 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391802.1 protein_id gnl|my_center|LOCUS_06980 2583 2230 gene locus_tag LOCUS_06990 2583 2230 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_06990 3386 2715 gene locus_tag LOCUS_07000 3386 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4845 3505 gene locus_tag LOCUS_07010 4845 3505 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940646.1 protein_id gnl|my_center|LOCUS_07010 5783 4953 gene locus_tag LOCUS_07020 5783 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_07020 7307 5796 gene locus_tag LOCUS_07030 7307 5796 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083229.1 protein_id gnl|my_center|LOCUS_07030 8539 7310 gene locus_tag LOCUS_07040 8539 7310 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_07040 9870 8545 gene locus_tag LOCUS_07050 9870 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 10631 10062 gene locus_tag LOCUS_07060 10631 10062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_07060 12078 10642 gene locus_tag LOCUS_07070 12078 10642 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_07070 14000 12153 gene locus_tag LOCUS_07080 gene uvrC 14000 12153 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_07080 16860 14008 gene locus_tag LOCUS_07090 gene uvrA 16860 14008 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_07090 17104 18405 gene locus_tag LOCUS_07100 gene amt 17104 18405 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_07100 18432 18770 gene locus_tag LOCUS_07110 18432 18770 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence026 <1 860 gene locus_tag LOCUS_07120 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897970.1:tRNA guanosine(34) transglycosylase Tgt 957 1217 gene locus_tag LOCUS_07130 gene yajC 957 1217 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_07130 1504 1214 gene locus_tag LOCUS_07140 1504 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1407 2756 gene locus_tag LOCUS_07150 1407 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07150 2749 3666 gene locus_tag LOCUS_07160 gene secF 2749 3666 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_07160 3737 7390 gene locus_tag LOCUS_07170 3737 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 7407 9614 gene locus_tag LOCUS_07180 7407 9614 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_07180 9611 10228 gene locus_tag LOCUS_07190 9611 10228 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_07190 10241 11686 gene locus_tag LOCUS_07200 10241 11686 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045667606.1 protein_id gnl|my_center|LOCUS_07200 11683 12066 gene locus_tag LOCUS_07210 11683 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 12157 13473 gene locus_tag LOCUS_07220 12157 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 13480 14298 gene locus_tag LOCUS_07230 gene ccsA 13480 14298 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943519.1 protein_id gnl|my_center|LOCUS_07230 14384 15226 gene locus_tag LOCUS_07240 gene ccsA 14384 15226 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943519.1 protein_id gnl|my_center|LOCUS_07240 15230 16849 gene locus_tag LOCUS_07250 15230 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 16858 18189 gene locus_tag LOCUS_07260 16858 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 18330 19568 gene locus_tag LOCUS_07270 gene hisS 18330 19568 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence027 52 1144 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcgtagcacttcggagtgtggcggggagctaagac 1301 1582 gene locus_tag LOCUS_07280 1301 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1579 2676 gene locus_tag LOCUS_07290 gene hypD 1579 2676 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_07290 2681 3691 gene locus_tag LOCUS_07300 gene hypE 2681 3691 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_07300 3696 4619 gene locus_tag LOCUS_07310 3696 4619 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250743.1 protein_id gnl|my_center|LOCUS_07310 4632 6284 gene locus_tag LOCUS_07320 4632 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 8234 6402 gene locus_tag LOCUS_07330 8234 6402 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222087.1 protein_id gnl|my_center|LOCUS_07330 8614 8231 gene locus_tag LOCUS_07340 8614 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 9153 8659 gene locus_tag LOCUS_07350 9153 8659 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_07350 9695 9381 gene locus_tag LOCUS_07360 9695 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 9594 9803 gene locus_tag LOCUS_07370 9594 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 10555 9839 gene locus_tag LOCUS_07380 10555 9839 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_07380 11853 10552 gene locus_tag LOCUS_07390 11853 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 12685 11855 gene locus_tag LOCUS_07400 12685 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 13464 12685 gene locus_tag LOCUS_07410 13464 12685 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_07410 14539 13469 gene locus_tag LOCUS_07420 14539 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 15844 14831 gene locus_tag LOCUS_07430 gene amrS 15844 14831 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_07430 17670 15856 gene locus_tag LOCUS_07440 17670 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 18252 17683 gene locus_tag LOCUS_07450 18252 17683 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583841.1 protein_id gnl|my_center|LOCUS_07450 19754 18252 gene locus_tag LOCUS_07460 19754 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence028 599 1576 gene locus_tag LOCUS_07470 599 1576 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_07470 1573 2301 gene locus_tag LOCUS_07480 1573 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07480 2320 2679 gene locus_tag LOCUS_07490 2320 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07490 2716 3885 gene locus_tag LOCUS_07500 2716 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3878 4714 gene locus_tag LOCUS_07510 gene rsmI 3878 4714 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815011.1 protein_id gnl|my_center|LOCUS_07510 5085 4843 gene locus_tag LOCUS_07520 5085 4843 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_07520 5198 6757 gene locus_tag LOCUS_07530 gene metG 5198 6757 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_07530 6782 7633 gene locus_tag LOCUS_07540 6782 7633 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_07540 7630 8226 gene locus_tag LOCUS_07550 7630 8226 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_07550 8335 9423 gene locus_tag LOCUS_07560 8335 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9432 10283 gene locus_tag LOCUS_07570 gene rsmA 9432 10283 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_07570 10554 10895 gene locus_tag LOCUS_07580 10554 10895 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392492.1 protein_id gnl|my_center|LOCUS_07580 10883 11491 gene locus_tag LOCUS_07590 10883 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 11488 11949 gene locus_tag LOCUS_07600 11488 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 11946 13115 gene locus_tag LOCUS_07610 gene nuoD 11946 13115 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_07610 13112 14059 gene locus_tag LOCUS_07620 gene nuoH 13112 14059 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_07620 14050 16098 gene locus_tag LOCUS_07630 14050 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 16095 16586 gene locus_tag LOCUS_07640 16095 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 16583 16873 gene locus_tag LOCUS_07650 gene nuoK 16583 16873 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 protein_id gnl|my_center|LOCUS_07650 16873 18696 gene locus_tag LOCUS_07660 16873 18696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence029 1689 1228 gene locus_tag LOCUS_07670 1689 1228 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323316.1 protein_id gnl|my_center|LOCUS_07670 2849 1689 gene locus_tag LOCUS_07680 2849 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3529 3215 gene locus_tag LOCUS_07690 3529 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3706 4569 gene locus_tag LOCUS_07700 3706 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5468 4566 gene locus_tag LOCUS_07710 5468 4566 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943315.1 protein_id gnl|my_center|LOCUS_07710 5555 5926 gene locus_tag LOCUS_07720 5555 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6007 7455 gene locus_tag LOCUS_07730 6007 7455 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943517.1 protein_id gnl|my_center|LOCUS_07730 8604 7501 gene locus_tag LOCUS_07740 8604 7501 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_07740 9921 8716 gene locus_tag LOCUS_07750 9921 8716 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133853294.1 protein_id gnl|my_center|LOCUS_07750 11094 9961 gene locus_tag LOCUS_07760 11094 9961 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_07760 11963 11052 gene locus_tag LOCUS_07770 11963 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 12338 12000 gene locus_tag LOCUS_07780 12338 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 13890 12400 gene locus_tag LOCUS_07790 13890 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 14445 13927 gene locus_tag LOCUS_07800 14445 13927 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_07800 15060 14449 gene locus_tag LOCUS_07810 15060 14449 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_07810 17017 15062 gene locus_tag LOCUS_07820 17017 15062 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870052.1 protein_id gnl|my_center|LOCUS_07820 18077 17025 gene locus_tag LOCUS_07830 18077 17025 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_07830 18462 18088 gene locus_tag LOCUS_07840 gene cheY 18462 18088 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_07840 18946 18455 gene locus_tag LOCUS_07850 18946 18455 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence030 50 304 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcagctgagcccaccgcgcatggcgcattgagac 453 1559 gene locus_tag LOCUS_07860 453 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1556 3481 gene locus_tag LOCUS_07870 1556 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3478 4635 gene locus_tag LOCUS_07880 gene cmr3 3478 4635 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155321014.1 protein_id gnl|my_center|LOCUS_07880 4610 5509 gene locus_tag LOCUS_07890 gene cmr4 4610 5509 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_07890 5502 5909 gene locus_tag LOCUS_07900 5502 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5906 7003 gene locus_tag LOCUS_07910 5906 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7000 7323 gene locus_tag LOCUS_07920 7000 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 7335 8210 gene locus_tag LOCUS_07930 7335 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 10025 8256 gene locus_tag LOCUS_07940 10025 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 10110 10919 gene locus_tag LOCUS_07950 10110 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11102 11539 gene locus_tag LOCUS_07960 11102 11539 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_07960 11614 13734 gene locus_tag LOCUS_07970 11614 13734 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142478.1 protein_id gnl|my_center|LOCUS_07970 13743 14189 gene locus_tag LOCUS_07980 13743 14189 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_07980 14508 15167 gene locus_tag LOCUS_07990 14508 15167 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_07990 15254 15811 gene locus_tag LOCUS_08000 15254 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 15875 17608 gene locus_tag LOCUS_08010 15875 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 17971 17618 gene locus_tag LOCUS_08020 17971 17618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 18891 17983 gene locus_tag LOCUS_08030 18891 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence031 2017 167 gene locus_tag LOCUS_08040 2017 167 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 protein_id gnl|my_center|LOCUS_08040 2497 2027 gene locus_tag LOCUS_08050 gene tadA 2497 2027 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_08050 2539 2628 gene locus_tag LOCUS_t00170 2539 2628 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2643 3794 gene locus_tag LOCUS_08060 2643 3794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722397.1 protein_id gnl|my_center|LOCUS_08060 3805 4485 gene locus_tag LOCUS_08070 3805 4485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_08070 4562 4655 gene locus_tag LOCUS_t00180 4562 4655 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4708 4784 gene locus_tag LOCUS_t00190 4708 4784 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4892 6604 gene locus_tag LOCUS_08080 4892 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6690 7589 gene locus_tag LOCUS_08090 6690 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7631 8821 gene locus_tag LOCUS_08100 7631 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 8821 9306 gene locus_tag LOCUS_08110 8821 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9496 9966 gene locus_tag LOCUS_08120 9496 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10600 9980 gene locus_tag LOCUS_08130 10600 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 11883 10597 gene locus_tag LOCUS_08140 gene serS 11883 10597 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_08140 12680 11988 gene locus_tag LOCUS_08150 12680 11988 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930841.1 protein_id gnl|my_center|LOCUS_08150 14155 12776 gene locus_tag LOCUS_08160 14155 12776 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_08160 14280 15605 gene locus_tag LOCUS_08170 gene dcm 14280 15605 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068549.1 protein_id gnl|my_center|LOCUS_08170 15577 16011 gene locus_tag LOCUS_08180 15577 16011 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_08180 17354 16008 gene locus_tag LOCUS_08190 17354 16008 CDS product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence032 115 1095 gene locus_tag LOCUS_08200 115 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1213 2097 gene locus_tag LOCUS_08210 1213 2097 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_08210 2102 2536 gene locus_tag LOCUS_08220 2102 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2533 2844 gene locus_tag LOCUS_08230 2533 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2860 3102 gene locus_tag LOCUS_08240 gene purS 2860 3102 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722248.1 protein_id gnl|my_center|LOCUS_08240 3106 3801 gene locus_tag LOCUS_08250 gene purQ 3106 3801 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733240.1 protein_id gnl|my_center|LOCUS_08250 3801 6065 gene locus_tag LOCUS_08260 gene purL 3801 6065 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_08260 6159 6719 gene locus_tag LOCUS_08270 6159 6719 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888997.1 protein_id gnl|my_center|LOCUS_08270 6703 6918 gene locus_tag LOCUS_08280 6703 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7019 8479 gene locus_tag LOCUS_08290 gene purF 7019 8479 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_08290 8476 8913 gene locus_tag LOCUS_08300 8476 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8995 10050 gene locus_tag LOCUS_08310 gene purM 8995 10050 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_08310 10043 10726 gene locus_tag LOCUS_08320 gene purN 10043 10726 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_08320 10745 12304 gene locus_tag LOCUS_08330 gene purH 10745 12304 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_08330 12315 13007 gene locus_tag LOCUS_08340 12315 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 13013 14239 gene locus_tag LOCUS_08350 13013 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 14352 14657 gene locus_tag LOCUS_08360 14352 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 14654 15031 gene locus_tag LOCUS_08370 14654 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 15850 15035 gene locus_tag LOCUS_08380 15850 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 15981 17093 gene locus_tag LOCUS_08390 15981 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 17203 17278 gene locus_tag LOCUS_t00200 17203 17278 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17291 17366 gene locus_tag LOCUS_t00210 17291 17366 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 28 627 gene locus_tag LOCUS_08400 28 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 624 1424 gene locus_tag LOCUS_08410 gene trpC 624 1424 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_08410 1417 2757 gene locus_tag LOCUS_08420 1417 2757 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389732.1 protein_id gnl|my_center|LOCUS_08420 2849 3493 gene locus_tag LOCUS_08430 2849 3493 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_08430 3490 4209 gene locus_tag LOCUS_08440 3490 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4224 5462 gene locus_tag LOCUS_08450 gene trpB 4224 5462 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_08450 5452 6243 gene locus_tag LOCUS_08460 gene trpA 5452 6243 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 protein_id gnl|my_center|LOCUS_08460 6899 6240 gene locus_tag LOCUS_08470 6899 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 7516 6899 gene locus_tag LOCUS_08480 7516 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8164 7559 gene locus_tag LOCUS_08490 8164 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 8404 8183 gene locus_tag LOCUS_08500 8404 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 8584 8420 gene locus_tag LOCUS_08510 8584 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 8683 10302 gene locus_tag LOCUS_08520 8683 10302 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_08520 10299 10748 gene locus_tag LOCUS_08530 10299 10748 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461776.1 protein_id gnl|my_center|LOCUS_08530 10856 11815 gene locus_tag LOCUS_08540 10856 11815 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_08540 11917 12810 gene locus_tag LOCUS_08550 gene accD 11917 12810 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_08550 12812 13777 gene locus_tag LOCUS_08560 12812 13777 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405067.1 protein_id gnl|my_center|LOCUS_08560 13821 15062 gene locus_tag LOCUS_08570 13821 15062 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_08570 15068 15622 gene locus_tag LOCUS_08580 15068 15622 CDS product fuculose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173835.1 protein_id gnl|my_center|LOCUS_08580 16665 15643 gene locus_tag LOCUS_08590 16665 15643 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921016.1 protein_id gnl|my_center|LOCUS_08590 16815 16729 gene locus_tag LOCUS_t00220 16815 16729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 4063 2417 gene locus_tag LOCUS_08600 4063 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4441 5154 gene locus_tag LOCUS_08610 4441 5154 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392424.1 protein_id gnl|my_center|LOCUS_08610 5158 5574 gene locus_tag LOCUS_08620 5158 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5571 6674 gene locus_tag LOCUS_08630 5571 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6745 9423 gene locus_tag LOCUS_08640 6745 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 9461 11356 gene locus_tag LOCUS_08650 gene pknB 9461 11356 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_08650 12033 11407 gene locus_tag LOCUS_08660 12033 11407 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_08660 12077 12907 gene locus_tag LOCUS_08670 12077 12907 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948665.1 protein_id gnl|my_center|LOCUS_08670 14159 12924 gene locus_tag LOCUS_08680 14159 12924 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_08680 15977 14304 gene locus_tag LOCUS_08690 15977 14304 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_08690 16540 15989 gene locus_tag LOCUS_08700 16540 15989 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence035 <1 546 gene locus_tag LOCUS_08710 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870120.1:V-type ATP synthase subunit D 1070 726 gene locus_tag LOCUS_08720 1070 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1249 1728 gene locus_tag LOCUS_08730 1249 1728 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 protein_id gnl|my_center|LOCUS_08730 1740 2378 gene locus_tag LOCUS_08740 1740 2378 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_08740 2440 2874 gene locus_tag LOCUS_08750 2440 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2871 3680 gene locus_tag LOCUS_08760 2871 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3716 5161 gene locus_tag LOCUS_08770 3716 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5423 5716 gene locus_tag LOCUS_08780 gene groES 5423 5716 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056050.1 protein_id gnl|my_center|LOCUS_08780 5766 7394 gene locus_tag LOCUS_08790 gene groL 5766 7394 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_08790 8142 7492 gene locus_tag LOCUS_08800 8142 7492 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_08800 8257 9321 gene locus_tag LOCUS_08810 gene ychF 8257 9321 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_08810 9601 10776 gene locus_tag LOCUS_08820 9601 10776 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_08820 10787 12337 gene locus_tag LOCUS_08830 gene guaA 10787 12337 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_08830 12413 12691 gene locus_tag LOCUS_08840 12413 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08840 12691 13485 gene locus_tag LOCUS_08850 12691 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 13632 13835 gene locus_tag LOCUS_08860 13632 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 13886 16126 gene locus_tag LOCUS_08870 gene pcrA 13886 16126 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence036 <1 1030 gene locus_tag LOCUS_08880 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541602.1:ferrous iron transport protein B 1200 1934 gene locus_tag LOCUS_08890 1200 1934 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_08890 2022 2558 gene locus_tag LOCUS_08900 2022 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2707 5619 gene locus_tag LOCUS_08910 2707 5619 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_08910 6565 5624 gene locus_tag LOCUS_08920 6565 5624 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014402.1 protein_id gnl|my_center|LOCUS_08920 7532 6558 gene locus_tag LOCUS_08930 7532 6558 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080096.1 protein_id gnl|my_center|LOCUS_08930 7839 8834 gene locus_tag LOCUS_08940 7839 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 9562 8855 gene locus_tag LOCUS_08950 gene crp 9562 8855 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063269.1 protein_id gnl|my_center|LOCUS_08950 9689 10123 gene locus_tag LOCUS_08960 9689 10123 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 protein_id gnl|my_center|LOCUS_08960 10125 10511 gene locus_tag LOCUS_08970 10125 10511 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393390.1 protein_id gnl|my_center|LOCUS_08970 10469 10795 gene locus_tag LOCUS_08980 10469 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10906 12768 gene locus_tag LOCUS_08990 10906 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 12817 14064 gene locus_tag LOCUS_09000 12817 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 14057 14743 gene locus_tag LOCUS_09010 14057 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 14827 14973 gene locus_tag LOCUS_09020 14827 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 15176 15817 gene locus_tag LOCUS_09030 15176 15817 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_09030 15821 16486 gene locus_tag LOCUS_09040 15821 16486 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence037 <1 1755 gene locus_tag LOCUS_09050 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA 1822 2946 gene locus_tag LOCUS_09060 gene prfB 1822 2946 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_09060 2966 3877 gene locus_tag LOCUS_09070 2966 3877 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_09070 3874 4719 gene locus_tag LOCUS_09080 3874 4719 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_09080 4716 5657 gene locus_tag LOCUS_09090 4716 5657 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_09090 5811 6500 gene locus_tag LOCUS_09100 gene ftsE 5811 6500 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_09100 6490 7407 gene locus_tag LOCUS_09110 gene ftsX 6490 7407 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_09110 7414 8592 gene locus_tag LOCUS_09120 7414 8592 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_09120 8799 11489 gene locus_tag LOCUS_09130 8799 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 11943 11518 gene locus_tag LOCUS_09140 11943 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 12065 14158 gene locus_tag LOCUS_09150 gene rnr 12065 14158 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_09150 14259 15320 gene locus_tag LOCUS_09160 14259 15320 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_09160 15612 15328 gene locus_tag LOCUS_09170 15612 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 15697 16167 gene locus_tag LOCUS_09180 gene smpB 15697 16167 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence038 4619 747 gene locus_tag LOCUS_09190 4619 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7305 4960 gene locus_tag LOCUS_09200 gene lon 7305 4960 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_09200 7428 9395 gene locus_tag LOCUS_09210 7428 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 9406 10545 gene locus_tag LOCUS_09220 9406 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 10545 11486 gene locus_tag LOCUS_09230 gene trxB 10545 11486 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_09230 11514 11837 gene locus_tag LOCUS_09240 gene trxA 11514 11837 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_09240 11856 12281 gene locus_tag LOCUS_09250 11856 12281 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_09250 12286 12477 gene locus_tag LOCUS_09260 12286 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 12517 12762 gene locus_tag LOCUS_09270 12517 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 12855 13799 gene locus_tag LOCUS_09280 12855 13799 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_09280 13803 14678 gene locus_tag LOCUS_09290 13803 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 14688 15440 gene locus_tag LOCUS_09300 14688 15440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259517.1 protein_id gnl|my_center|LOCUS_09300 15465 16115 gene locus_tag LOCUS_09310 15465 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence039 <1 629 gene locus_tag LOCUS_09320 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813418.1:nitronate monooxygenase 638 1858 gene locus_tag LOCUS_09330 gene fabF 638 1858 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_09330 1863 2597 gene locus_tag LOCUS_09340 gene rnc 1863 2597 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971346.1 protein_id gnl|my_center|LOCUS_09340 2686 6222 gene locus_tag LOCUS_09350 gene smc 2686 6222 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899542.1 protein_id gnl|my_center|LOCUS_09350 6219 7133 gene locus_tag LOCUS_09360 6219 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 7206 8558 gene locus_tag LOCUS_09370 gene ffh 7206 8558 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_09370 8637 9152 gene locus_tag LOCUS_09380 8637 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 9156 9407 gene locus_tag LOCUS_09390 9156 9407 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232017.1 protein_id gnl|my_center|LOCUS_09390 9472 9933 gene locus_tag LOCUS_09400 9472 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9930 10661 gene locus_tag LOCUS_09410 gene trmD 9930 10661 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699993.1 protein_id gnl|my_center|LOCUS_09410 10669 11280 gene locus_tag LOCUS_09420 gene lepB 10669 11280 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811571.1 protein_id gnl|my_center|LOCUS_09420 11399 11740 gene locus_tag LOCUS_09430 gene rplS 11399 11740 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_09430 11812 12588 gene locus_tag LOCUS_09440 11812 12588 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_09440 12660 13022 gene locus_tag LOCUS_09450 12660 13022 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_09450 13025 14485 gene locus_tag LOCUS_09460 13025 14485 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_09460 14482 15324 gene locus_tag LOCUS_09470 14482 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence040 854 492 gene locus_tag LOCUS_09480 854 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1742 858 gene locus_tag LOCUS_09490 1742 858 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_09490 2378 1752 gene locus_tag LOCUS_09500 gene rsxA 2378 1752 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_09500 3004 2375 gene locus_tag LOCUS_09510 3004 2375 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_09510 3588 3001 gene locus_tag LOCUS_09520 3588 3001 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_09520 4579 3581 gene locus_tag LOCUS_09530 4579 3581 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_09530 5916 4576 gene locus_tag LOCUS_09540 gene rsxC 5916 4576 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_09540 6498 6031 gene locus_tag LOCUS_09550 6498 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7890 6574 gene locus_tag LOCUS_09560 7890 6574 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_09560 8638 7895 gene locus_tag LOCUS_09570 8638 7895 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_09570 9497 8640 gene locus_tag LOCUS_09580 9497 8640 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_09580 10528 9494 gene locus_tag LOCUS_09590 10528 9494 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_09590 10993 10592 gene locus_tag LOCUS_09600 gene ndk 10993 10592 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391654.1 protein_id gnl|my_center|LOCUS_09600 12362 11097 gene locus_tag LOCUS_09610 12362 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 13057 12377 gene locus_tag LOCUS_09620 13057 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 13338 15401 gene locus_tag LOCUS_09630 gene fusA 13338 15401 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence041 510 418 gene locus_tag LOCUS_t00230 510 418 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 615 2231 gene locus_tag LOCUS_09640 615 2231 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_09640 2995 2246 gene locus_tag LOCUS_09650 2995 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_09650 3933 2992 gene locus_tag LOCUS_09660 gene arcC 3933 2992 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970090.1 protein_id gnl|my_center|LOCUS_09660 4121 5281 gene locus_tag LOCUS_09670 4121 5281 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404932.1 protein_id gnl|my_center|LOCUS_09670 5309 5584 gene locus_tag LOCUS_09680 5309 5584 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_09680 5606 7057 gene locus_tag LOCUS_09690 5606 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7160 7672 gene locus_tag LOCUS_09700 7160 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7683 10823 gene locus_tag LOCUS_09710 7683 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 10837 11796 gene locus_tag LOCUS_09720 10837 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 11978 12940 gene locus_tag LOCUS_09730 11978 12940 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258504.1 protein_id gnl|my_center|LOCUS_09730 13512 12937 gene locus_tag LOCUS_09740 13512 12937 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_09740 14784 13576 gene locus_tag LOCUS_09750 14784 13576 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence042 1401 163 gene locus_tag LOCUS_09760 1401 163 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_09760 2804 1398 gene locus_tag LOCUS_09770 2804 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3983 2865 gene locus_tag LOCUS_09780 3983 2865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_09780 4707 3973 gene locus_tag LOCUS_09790 4707 3973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_09790 5652 4783 gene locus_tag LOCUS_09800 5652 4783 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 protein_id gnl|my_center|LOCUS_09800 6758 5847 gene locus_tag LOCUS_09810 6758 5847 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_09810 6922 7308 gene locus_tag LOCUS_09820 6922 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7308 8120 gene locus_tag LOCUS_09830 7308 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 8120 8920 gene locus_tag LOCUS_09840 8120 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8968 9798 gene locus_tag LOCUS_09850 8968 9798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870600.1 protein_id gnl|my_center|LOCUS_09850 12442 9812 gene locus_tag LOCUS_09860 12442 9812 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_09860 12618 14252 gene locus_tag LOCUS_09870 gene pckA 12618 14252 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_09870 14422 14619 gene locus_tag LOCUS_09880 14422 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence043 <1 830 gene locus_tag LOCUS_09890 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056876.1:polysaccharide deacetylase family protein 1432 779 gene locus_tag LOCUS_09900 1432 779 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924827.1 protein_id gnl|my_center|LOCUS_09900 2674 1454 gene locus_tag LOCUS_09910 2674 1454 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_09910 4606 2708 gene locus_tag LOCUS_09920 4606 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 4882 4637 gene locus_tag LOCUS_09930 4882 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6051 5152 gene locus_tag LOCUS_09940 6051 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6195 6611 gene locus_tag LOCUS_09950 6195 6611 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_09950 6729 7334 gene locus_tag LOCUS_09960 6729 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7722 7348 gene locus_tag LOCUS_09970 7722 7348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_09970 8207 7752 gene locus_tag LOCUS_09980 8207 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 8543 8226 gene locus_tag LOCUS_09990 8543 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 10678 8588 gene locus_tag LOCUS_10000 10678 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 11017 10942 gene locus_tag LOCUS_t00240 11017 10942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11216 11917 gene locus_tag LOCUS_10010 11216 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_10010 11942 12148 gene locus_tag LOCUS_10020 11942 12148 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_10020 12156 13220 gene locus_tag LOCUS_10030 12156 13220 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_10030 13217 14068 gene locus_tag LOCUS_10040 13217 14068 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence044 120 428 gene locus_tag LOCUS_10050 gene rpsJ 120 428 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_10050 540 1160 gene locus_tag LOCUS_10060 gene rplC 540 1160 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_10060 1202 1825 gene locus_tag LOCUS_10070 gene rplD 1202 1825 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262339.1 protein_id gnl|my_center|LOCUS_10070 1825 2109 gene locus_tag LOCUS_10080 gene rplW 1825 2109 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_10080 2252 3082 gene locus_tag LOCUS_10090 gene rplB 2252 3082 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727696.1 protein_id gnl|my_center|LOCUS_10090 3103 3381 gene locus_tag LOCUS_10100 gene rpsS 3103 3381 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_10100 3454 3795 gene locus_tag LOCUS_10110 gene rplV 3454 3795 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 protein_id gnl|my_center|LOCUS_10110 3800 4537 gene locus_tag LOCUS_10120 gene rpsC 3800 4537 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_10120 4538 4963 gene locus_tag LOCUS_10130 gene rplP 4538 4963 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928969.1 protein_id gnl|my_center|LOCUS_10130 4964 5173 gene locus_tag LOCUS_10140 gene rpmC 4964 5173 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 protein_id gnl|my_center|LOCUS_10140 5188 5448 gene locus_tag LOCUS_10150 gene rpsQ 5188 5448 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_10150 5531 5899 gene locus_tag LOCUS_10160 gene rplN 5531 5899 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_10160 5915 6238 gene locus_tag LOCUS_10170 gene rplX 5915 6238 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869918.1 protein_id gnl|my_center|LOCUS_10170 6323 6865 gene locus_tag LOCUS_10180 gene rplE 6323 6865 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_10180 6919 7104 gene locus_tag LOCUS_10190 6919 7104 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_10190 7209 7607 gene locus_tag LOCUS_10200 gene rpsH 7209 7607 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_10200 7635 8171 gene locus_tag LOCUS_10210 gene rplF 7635 8171 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_10210 8225 8593 gene locus_tag LOCUS_10220 gene rplR 8225 8593 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_10220 8610 9122 gene locus_tag LOCUS_10230 gene rpsE 8610 9122 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_10230 9130 9318 gene locus_tag LOCUS_10240 gene rpmD 9130 9318 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_10240 9412 9858 gene locus_tag LOCUS_10250 gene rplO 9412 9858 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_10250 9855 11117 gene locus_tag LOCUS_10260 gene secY 9855 11117 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_10260 11142 11867 gene locus_tag LOCUS_10270 11142 11867 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_10270 11876 12622 gene locus_tag LOCUS_10280 gene map 11876 12622 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_10280 12721 12942 gene locus_tag LOCUS_10290 gene infA 12721 12942 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_10290 13200 13574 gene locus_tag LOCUS_10300 gene rpsM 13200 13574 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence045 70 1044 gene locus_tag LOCUS_10310 gene hemH 70 1044 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_10310 1102 2607 gene locus_tag LOCUS_10320 gene hemG 1102 2607 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_10320 2635 4143 gene locus_tag LOCUS_10330 gene hemG 2635 4143 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_10330 4949 4140 gene locus_tag LOCUS_10340 4949 4140 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_10340 5542 4946 gene locus_tag LOCUS_10350 5542 4946 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221940.1 protein_id gnl|my_center|LOCUS_10350 6277 5645 gene locus_tag LOCUS_10360 gene cybH 6277 5645 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811610.1 protein_id gnl|my_center|LOCUS_10360 7942 6359 gene locus_tag LOCUS_10370 7942 6359 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_10370 9159 7942 gene locus_tag LOCUS_10380 9159 7942 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 protein_id gnl|my_center|LOCUS_10380 9686 9946 gene locus_tag LOCUS_10390 9686 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 10006 10707 gene locus_tag LOCUS_10400 10006 10707 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327132.1 protein_id gnl|my_center|LOCUS_10400 10800 11027 gene locus_tag LOCUS_10410 10800 11027 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023631.1 protein_id gnl|my_center|LOCUS_10410 12328 11024 gene locus_tag LOCUS_10420 gene rlmD 12328 11024 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence046 <1 1548 gene locus_tag LOCUS_10430 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit 2642 1545 gene locus_tag LOCUS_10440 2642 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3109 2639 gene locus_tag LOCUS_10450 3109 2639 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990736.1 protein_id gnl|my_center|LOCUS_10450 3233 3754 gene locus_tag LOCUS_10460 3233 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4435 3863 gene locus_tag LOCUS_10470 4435 3863 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_10470 5535 4582 gene locus_tag LOCUS_10480 5535 4582 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_10480 5629 6048 gene locus_tag LOCUS_10490 5629 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8735 6045 gene locus_tag LOCUS_10500 8735 6045 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_10500 9007 9936 gene locus_tag LOCUS_10510 9007 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9949 10962 gene locus_tag LOCUS_10520 9949 10962 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417689.1 protein_id gnl|my_center|LOCUS_10520 10959 11831 gene locus_tag LOCUS_10530 10959 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 11828 12172 gene locus_tag LOCUS_10540 11828 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence047 1410 847 gene locus_tag LOCUS_10550 1410 847 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918322.1 protein_id gnl|my_center|LOCUS_10550 1994 1407 gene locus_tag LOCUS_10560 1994 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3832 2006 gene locus_tag LOCUS_10570 3832 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 4221 3841 gene locus_tag LOCUS_10580 4221 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5789 4296 gene locus_tag LOCUS_10590 5789 4296 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257542.1 protein_id gnl|my_center|LOCUS_10590 6558 5812 gene locus_tag LOCUS_10600 6558 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6794 7153 gene locus_tag LOCUS_10610 6794 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7198 7680 gene locus_tag LOCUS_10620 7198 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7774 8016 gene locus_tag LOCUS_10630 7774 8016 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_10630 8034 8765 gene locus_tag LOCUS_10640 gene dsrM 8034 8765 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938586.1 protein_id gnl|my_center|LOCUS_10640 8768 10066 gene locus_tag LOCUS_10650 8768 10066 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393135.1 protein_id gnl|my_center|LOCUS_10650 10971 10141 gene locus_tag LOCUS_10660 10971 10141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 11439 10975 gene locus_tag LOCUS_10670 11439 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 11817 11443 gene locus_tag LOCUS_10680 11817 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 11859 12224 gene locus_tag LOCUS_10690 11859 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence048 2084 1194 gene locus_tag LOCUS_10700 gene atpG 2084 1194 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_10700 3657 2092 gene locus_tag LOCUS_10710 gene atpA 3657 2092 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_10710 4215 3658 gene locus_tag LOCUS_10720 4215 3658 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_10720 4705 4205 gene locus_tag LOCUS_10730 gene atpF 4705 4205 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558554.1 protein_id gnl|my_center|LOCUS_10730 4950 4738 gene locus_tag LOCUS_10740 gene atpE 4950 4738 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 protein_id gnl|my_center|LOCUS_10740 5851 5042 gene locus_tag LOCUS_10750 5851 5042 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_10750 6205 5867 gene locus_tag LOCUS_10760 6205 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7483 6398 gene locus_tag LOCUS_10770 7483 6398 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_10770 7938 7480 gene locus_tag LOCUS_10780 7938 7480 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_10780 9199 7955 gene locus_tag LOCUS_10790 9199 7955 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_10790 9661 9215 gene locus_tag LOCUS_10800 gene rpiB 9661 9215 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_10800 10387 9743 gene locus_tag LOCUS_10810 10387 9743 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730205.1 protein_id gnl|my_center|LOCUS_10810 11265 10399 gene locus_tag LOCUS_10820 gene prmC 11265 10399 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_10820 <12243 11266 gene locus_tag LOCUS_10830 <12243 11266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421389.1:peptide chain release factor 1 >Feature sequence049 1159 125 gene locus_tag LOCUS_10840 1159 125 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_10840 2174 1161 gene locus_tag LOCUS_10850 2174 1161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_10850 3162 2176 gene locus_tag LOCUS_10860 3162 2176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_10860 4130 3159 gene locus_tag LOCUS_10870 4130 3159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_10870 5882 4239 gene locus_tag LOCUS_10880 5882 4239 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_10880 6409 6164 gene locus_tag LOCUS_10890 gene secG 6409 6164 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224669.1 protein_id gnl|my_center|LOCUS_10890 8059 6512 gene locus_tag LOCUS_10900 gene gpmI 8059 6512 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_10900 8827 8060 gene locus_tag LOCUS_10910 gene tpiA 8827 8060 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_10910 10028 8838 gene locus_tag LOCUS_10920 10028 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10920 11114 10113 gene locus_tag LOCUS_10930 gene gap 11114 10113 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_10930 <11740 11231 gene locus_tag LOCUS_10940 <11740 11231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357358.1:DNA-binding protein WhiA >Feature sequence050 <1 1268 gene locus_tag LOCUS_10950 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942911.1:lysine--tRNA ligase 1395 3950 gene locus_tag LOCUS_10960 1395 3950 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_10960 4064 5302 gene locus_tag LOCUS_10970 gene radA 4064 5302 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643928.1 protein_id gnl|my_center|LOCUS_10970 5377 6432 gene locus_tag LOCUS_10980 gene disA 5377 6432 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_10980 6572 7624 gene locus_tag LOCUS_10990 6572 7624 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143079.1 protein_id gnl|my_center|LOCUS_10990 7621 8334 gene locus_tag LOCUS_11000 gene ispD 7621 8334 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_11000 8327 8815 gene locus_tag LOCUS_11010 gene ispF 8327 8815 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_11010 9032 9748 gene locus_tag LOCUS_11020 gene cysE 9032 9748 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_11020 9729 11234 gene locus_tag LOCUS_11030 gene cysS 9729 11234 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence051 2181 1534 gene locus_tag LOCUS_11040 2181 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3994 2324 gene locus_tag LOCUS_11050 3994 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4890 3991 gene locus_tag LOCUS_11060 gene aroE 4890 3991 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_11060 5374 4916 gene locus_tag LOCUS_11070 5374 4916 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_11070 6103 5417 gene locus_tag LOCUS_11080 6103 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6844 6104 gene locus_tag LOCUS_11090 6844 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7791 6841 gene locus_tag LOCUS_11100 7791 6841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_11100 8908 7796 gene locus_tag LOCUS_11110 gene mltG 8908 7796 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_11110 9336 8905 gene locus_tag LOCUS_11120 gene ruvX 9336 8905 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_11120 <11401 9341 gene locus_tag LOCUS_11130 <11401 9341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393146.1:alanine--tRNA ligase >Feature sequence052 1573 104 gene locus_tag LOCUS_11140 1573 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2666 1608 gene locus_tag LOCUS_11150 2666 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3897 2758 gene locus_tag LOCUS_11160 3897 2758 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_11160 4583 3903 gene locus_tag LOCUS_11170 4583 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5285 4653 gene locus_tag LOCUS_11180 5285 4653 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_11180 7696 5303 gene locus_tag LOCUS_11190 7696 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 9068 7707 gene locus_tag LOCUS_11200 9068 7707 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392197.1 protein_id gnl|my_center|LOCUS_11200 10235 9069 gene locus_tag LOCUS_11210 10235 9069 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_11210 <11113 10258 gene locus_tag LOCUS_11220 <11113 10258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943934.1:phosphoglucomutase/phosphomannomutase family protein >Feature sequence053 <1 515 gene locus_tag LOCUS_11230 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064991.1:phosphate ABC transporter substrate-binding protein 522 1448 gene locus_tag LOCUS_11240 gene pstC 522 1448 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_11240 1499 2311 gene locus_tag LOCUS_11250 gene pstA 1499 2311 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_11250 2305 3189 gene locus_tag LOCUS_11260 gene pstB 2305 3189 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_11260 4743 3397 gene locus_tag LOCUS_11270 4743 3397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_11270 6235 4874 gene locus_tag LOCUS_11280 gene gdhA 6235 4874 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_11280 6351 7679 gene locus_tag LOCUS_11290 gene glnA 6351 7679 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_11290 8031 7750 gene locus_tag LOCUS_11300 8031 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 9028 8033 gene locus_tag LOCUS_11310 9028 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391744.1 protein_id gnl|my_center|LOCUS_11310 10668 9127 gene locus_tag LOCUS_11320 gene thrC 10668 9127 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547727.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence054 1371 625 gene locus_tag LOCUS_11330 1371 625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020896.1 protein_id gnl|my_center|LOCUS_11330 2194 1379 gene locus_tag LOCUS_11340 2194 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3032 2286 gene locus_tag LOCUS_11350 3032 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3830 3042 gene locus_tag LOCUS_11360 3830 3042 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228359.1 protein_id gnl|my_center|LOCUS_11360 4807 3827 gene locus_tag LOCUS_11370 4807 3827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986750.1 protein_id gnl|my_center|LOCUS_11370 5308 4898 gene locus_tag LOCUS_11380 5308 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11380 5809 5414 gene locus_tag LOCUS_11390 5809 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11390 6521 5811 gene locus_tag LOCUS_11400 6521 5811 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929879.1 protein_id gnl|my_center|LOCUS_11400 9246 6538 gene locus_tag LOCUS_11410 gene polA 9246 6538 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 protein_id gnl|my_center|LOCUS_11410 9329 9868 gene locus_tag LOCUS_11420 9329 9868 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_11420 10106 10678 gene locus_tag LOCUS_11430 10106 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10726 10812 gene locus_tag LOCUS_t00250 10726 10812 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 1009 80 gene locus_tag LOCUS_11440 1009 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1081 2214 gene locus_tag LOCUS_11450 1081 2214 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986024.1 protein_id gnl|my_center|LOCUS_11450 3678 2215 gene locus_tag LOCUS_11460 3678 2215 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_11460 4492 3863 gene locus_tag LOCUS_11470 4492 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4654 5121 gene locus_tag LOCUS_11480 4654 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5118 5981 gene locus_tag LOCUS_11490 5118 5981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258883.1 protein_id gnl|my_center|LOCUS_11490 5978 7225 gene locus_tag LOCUS_11500 5978 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 7222 8286 gene locus_tag LOCUS_11510 7222 8286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258885.1 protein_id gnl|my_center|LOCUS_11510 8312 8449 gene locus_tag LOCUS_11520 8312 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 9232 8459 gene locus_tag LOCUS_11530 9232 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 9597 9229 gene locus_tag LOCUS_11540 9597 9229 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence056 2058 847 gene locus_tag LOCUS_11550 2058 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2517 2065 gene locus_tag LOCUS_11560 2517 2065 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869573.1 protein_id gnl|my_center|LOCUS_11560 3436 2510 gene locus_tag LOCUS_11570 3436 2510 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869572.1 protein_id gnl|my_center|LOCUS_11570 3723 5075 gene locus_tag LOCUS_11580 3723 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5209 5790 gene locus_tag LOCUS_11590 gene sodB 5209 5790 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 protein_id gnl|my_center|LOCUS_11590 5939 6586 gene locus_tag LOCUS_11600 5939 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 7536 6616 gene locus_tag LOCUS_11610 7536 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 7664 9310 gene locus_tag LOCUS_11620 7664 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9677 9333 gene locus_tag LOCUS_11630 9677 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence057 45 1829 gene locus_tag LOCUS_11640 45 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1900 3468 gene locus_tag LOCUS_11650 gene cimA 1900 3468 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_11650 3473 4702 gene locus_tag LOCUS_11660 3473 4702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690873.1 protein_id gnl|my_center|LOCUS_11660 4786 5535 gene locus_tag LOCUS_11670 4786 5535 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938174.1 protein_id gnl|my_center|LOCUS_11670 5708 6022 gene locus_tag LOCUS_11680 5708 6022 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_11680 6027 9497 gene locus_tag LOCUS_11690 6027 9497 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence058 <1 646 gene locus_tag LOCUS_11700 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817208.1:FAD:protein FMN transferase 1027 650 gene locus_tag LOCUS_11710 1027 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1175 2407 gene locus_tag LOCUS_11720 1175 2407 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_11720 2986 2420 gene locus_tag LOCUS_11730 gene pth 2986 2420 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_11730 3653 2997 gene locus_tag LOCUS_11740 3653 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4672 3707 gene locus_tag LOCUS_11750 4672 3707 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_11750 6074 4689 gene locus_tag LOCUS_11760 gene glmU 6074 4689 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_11760 6194 6120 gene locus_tag LOCUS_t00260 6194 6120 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6658 6317 gene locus_tag LOCUS_11770 gene spoVG 6658 6317 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454041.1 protein_id gnl|my_center|LOCUS_11770 7574 6690 gene locus_tag LOCUS_11780 gene ispE 7574 6690 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_11780 7932 7651 gene locus_tag LOCUS_11790 7932 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9471 8032 gene locus_tag LOCUS_11800 gene nuoN 9471 8032 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531102.1 protein_id gnl|my_center|LOCUS_11800 9938 9471 gene locus_tag LOCUS_11810 9938 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence059 214 1005 gene locus_tag LOCUS_11820 214 1005 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_11820 1141 1665 gene locus_tag LOCUS_11830 1141 1665 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_11830 1789 2151 gene locus_tag LOCUS_11840 1789 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2603 2226 gene locus_tag LOCUS_11850 2603 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2911 3189 gene locus_tag LOCUS_11860 2911 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3338 3742 gene locus_tag LOCUS_11870 3338 3742 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_11870 3840 4721 gene locus_tag LOCUS_11880 3840 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4830 5483 gene locus_tag LOCUS_11890 4830 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5615 6088 gene locus_tag LOCUS_11900 5615 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6088 6411 gene locus_tag LOCUS_11910 6088 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6547 7134 gene locus_tag LOCUS_11920 6547 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7270 7656 gene locus_tag LOCUS_11930 7270 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7742 8494 gene locus_tag LOCUS_11940 7742 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 8487 8969 gene locus_tag LOCUS_11950 8487 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 8984 9304 gene locus_tag LOCUS_11960 8984 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11960 >Feature sequence060 2790 694 gene locus_tag LOCUS_11970 gene fusA 2790 694 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_11970 3308 2838 gene locus_tag LOCUS_11980 gene rpsG 3308 2838 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_11980 3756 3385 gene locus_tag LOCUS_11990 gene rpsL 3756 3385 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_11990 8203 3956 gene locus_tag LOCUS_12000 8203 3956 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_12000 <9096 8268 gene locus_tag LOCUS_12010 <9096 8268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029792.1:DNA-directed RNA polymerase subunit beta >Feature sequence061 272 793 gene locus_tag LOCUS_12020 272 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 913 2247 gene locus_tag LOCUS_12030 913 2247 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_12030 2309 2521 gene locus_tag LOCUS_12040 2309 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3825 2557 gene locus_tag LOCUS_12050 3825 2557 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545826.1 protein_id gnl|my_center|LOCUS_12050 4580 3810 gene locus_tag LOCUS_12060 gene sufC 4580 3810 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_12060 5856 4648 gene locus_tag LOCUS_12070 gene larC 5856 4648 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_12070 6614 5853 gene locus_tag LOCUS_12080 gene larB 6614 5853 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_12080 6712 8283 gene locus_tag LOCUS_12090 6712 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence062 3 77 gene locus_tag LOCUS_t00270 3 77 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1081 137 gene locus_tag LOCUS_12100 1081 137 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_12100 1174 2343 gene locus_tag LOCUS_12110 gene rnd 1174 2343 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_12110 2330 3667 gene locus_tag LOCUS_12120 gene xseA 2330 3667 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_12120 3668 3922 gene locus_tag LOCUS_12130 3668 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3922 4278 gene locus_tag LOCUS_12140 3922 4278 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_12140 4283 5134 gene locus_tag LOCUS_12150 4283 5134 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836657.1 protein_id gnl|my_center|LOCUS_12150 5272 5481 gene locus_tag LOCUS_12160 5272 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5605 7596 gene locus_tag LOCUS_12170 gene acs 5605 7596 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence063 875 15 gene locus_tag LOCUS_12180 875 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2238 1051 gene locus_tag LOCUS_12190 2238 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2965 2255 gene locus_tag LOCUS_12200 2965 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4160 3030 gene locus_tag LOCUS_12210 gene cap8G 4160 3030 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_12210 5324 4188 gene locus_tag LOCUS_12220 5324 4188 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_12220 6364 5306 gene locus_tag LOCUS_12230 gene cap8E 6364 5306 CDS product type 8 capsular polysaccharide synthesis protein Cap8E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459062.1 protein_id gnl|my_center|LOCUS_12230 7594 6500 gene locus_tag LOCUS_12240 7594 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7934 7779 gene locus_tag LOCUS_12250 7934 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 8398 8324 gene locus_tag LOCUS_t00280 8398 8324 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 1530 412 gene locus_tag LOCUS_12260 1530 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2393 1545 gene locus_tag LOCUS_12270 2393 1545 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_12270 2893 2390 gene locus_tag LOCUS_12280 2893 2390 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143891478.1 protein_id gnl|my_center|LOCUS_12280 6451 3029 gene locus_tag LOCUS_12290 6451 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 7394 6711 gene locus_tag LOCUS_12300 7394 6711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_12300 8243 7611 gene locus_tag LOCUS_12310 8243 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8593 8240 gene locus_tag LOCUS_12320 8593 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence065 531 992 gene locus_tag LOCUS_12330 531 992 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_12330 996 2117 gene locus_tag LOCUS_12340 gene alr 996 2117 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_12340 2329 2718 gene locus_tag LOCUS_12350 2329 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2771 4732 gene locus_tag LOCUS_12360 2771 4732 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_12360 4729 5055 gene locus_tag LOCUS_12370 4729 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 5106 5684 gene locus_tag LOCUS_12380 5106 5684 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868883.1 protein_id gnl|my_center|LOCUS_12380 5681 6778 gene locus_tag LOCUS_12390 5681 6778 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869715.1 protein_id gnl|my_center|LOCUS_12390 6771 7103 gene locus_tag LOCUS_12400 6771 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence066 907 458 gene locus_tag LOCUS_12410 907 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1743 910 gene locus_tag LOCUS_12420 1743 910 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_12420 1992 2789 gene locus_tag LOCUS_12430 1992 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3855 2920 gene locus_tag LOCUS_12440 3855 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5893 3905 gene locus_tag LOCUS_12450 5893 3905 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_12450 6993 6154 gene locus_tag LOCUS_12460 6993 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 7180 8040 gene locus_tag LOCUS_12470 7180 8040 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence067 241 546 gene locus_tag LOCUS_12480 241 546 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 protein_id gnl|my_center|LOCUS_12480 2738 543 gene locus_tag LOCUS_12490 gene rlmKL 2738 543 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_12490 3465 2788 gene locus_tag LOCUS_12500 gene thiF 3465 2788 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939369.1 protein_id gnl|my_center|LOCUS_12500 3706 3467 gene locus_tag LOCUS_12510 3706 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5574 3787 gene locus_tag LOCUS_12520 5574 3787 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_12520 5996 5676 gene locus_tag LOCUS_12530 5996 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6195 7409 gene locus_tag LOCUS_12540 gene rhlE 6195 7409 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097479.1 protein_id gnl|my_center|LOCUS_12540 8269 7406 gene locus_tag LOCUS_12550 8269 7406 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence068 1136 684 gene locus_tag LOCUS_12560 1136 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2352 1117 gene locus_tag LOCUS_12570 gene dinB 2352 1117 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_12570 2413 3273 gene locus_tag LOCUS_12580 2413 3273 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_12580 4912 3236 gene locus_tag LOCUS_12590 4912 3236 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_12590 5058 5975 gene locus_tag LOCUS_12600 5058 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6050 8008 gene locus_tag LOCUS_12610 6050 8008 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256027.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence069 <1 2404 gene locus_tag LOCUS_12620 <1 2404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225635.1:carbamoyltransferase HypF 2768 2409 gene locus_tag LOCUS_12630 2768 2409 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_12630 3333 2761 gene locus_tag LOCUS_12640 3333 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3543 3349 gene locus_tag LOCUS_12650 3543 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 3659 6853 gene locus_tag LOCUS_12660 gene cas9 3659 6853 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_12660 6822 7721 gene locus_tag LOCUS_12670 gene cas1 6822 7721 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_12670 7726 8043 gene locus_tag LOCUS_12680 gene cas2 7726 8043 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence070 374 682 gene locus_tag LOCUS_12690 374 682 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_12690 777 1031 gene locus_tag LOCUS_12700 777 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1217 1408 gene locus_tag LOCUS_12710 1217 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12710 1533 1333 gene locus_tag LOCUS_12720 1533 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1540 2190 gene locus_tag LOCUS_12730 1540 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 2384 3070 gene locus_tag LOCUS_12740 2384 3070 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_12740 3210 3491 gene locus_tag LOCUS_12750 3210 3491 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_12750 3506 3811 gene locus_tag LOCUS_12760 3506 3811 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_12760 3928 4203 gene locus_tag LOCUS_12770 3928 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4200 4502 gene locus_tag LOCUS_12780 4200 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4636 4878 gene locus_tag LOCUS_12790 4636 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4875 5297 gene locus_tag LOCUS_12800 4875 5297 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_12800 5395 6150 gene locus_tag LOCUS_12810 5395 6150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354251.1 protein_id gnl|my_center|LOCUS_12810 6404 6706 gene locus_tag LOCUS_12820 6404 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6709 7092 gene locus_tag LOCUS_12830 6709 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7089 7445 gene locus_tag LOCUS_12840 7089 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence071 505 29 gene locus_tag LOCUS_12850 505 29 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_12850 1168 599 gene locus_tag LOCUS_12860 1168 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1655 1254 gene locus_tag LOCUS_12870 1655 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2233 1688 gene locus_tag LOCUS_12880 2233 1688 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666760.1 protein_id gnl|my_center|LOCUS_12880 2871 2230 gene locus_tag LOCUS_12890 2871 2230 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_12890 3623 2868 gene locus_tag LOCUS_12900 3623 2868 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095760.1 protein_id gnl|my_center|LOCUS_12900 4017 3586 gene locus_tag LOCUS_12910 4017 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4852 4007 gene locus_tag LOCUS_12920 4852 4007 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 protein_id gnl|my_center|LOCUS_12920 5169 5780 gene locus_tag LOCUS_12930 5169 5780 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227754.1 protein_id gnl|my_center|LOCUS_12930 5770 6264 gene locus_tag LOCUS_12940 5770 6264 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_12940 7725 6355 gene locus_tag LOCUS_12950 7725 6355 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence072 <1 912 gene locus_tag LOCUS_12960 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812122.1:DNA translocase FtsK 945 1706 gene locus_tag LOCUS_12970 945 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1734 2231 gene locus_tag LOCUS_12980 1734 2231 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257723.1 protein_id gnl|my_center|LOCUS_12980 2238 3530 gene locus_tag LOCUS_12990 gene rimO 2238 3530 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_12990 3527 4174 gene locus_tag LOCUS_13000 gene pgsA 3527 4174 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_13000 4158 5390 gene locus_tag LOCUS_13010 4158 5390 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081038.1 protein_id gnl|my_center|LOCUS_13010 5391 5975 gene locus_tag LOCUS_13020 gene thpR 5391 5975 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_13020 6054 7145 gene locus_tag LOCUS_13030 gene recA 6054 7145 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence073 1176 646 gene locus_tag LOCUS_13040 gene lspA 1176 646 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_13040 1541 1176 gene locus_tag LOCUS_13050 1541 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4505 1674 gene locus_tag LOCUS_13060 gene ileS 4505 1674 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_13060 5401 4619 gene locus_tag LOCUS_13070 5401 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5686 5411 gene locus_tag LOCUS_13080 5686 5411 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992358.1 protein_id gnl|my_center|LOCUS_13080 6511 5696 gene locus_tag LOCUS_13090 6511 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 6813 6556 gene locus_tag LOCUS_13100 6813 6556 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450918.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence074 140 21 gene locus_tag LOCUS_13110 140 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 550 137 gene locus_tag LOCUS_13120 550 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1676 567 gene locus_tag LOCUS_13130 gene dnaJ 1676 567 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 protein_id gnl|my_center|LOCUS_13130 2321 1680 gene locus_tag LOCUS_13140 2321 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4210 2324 gene locus_tag LOCUS_13150 gene dnaK 4210 2324 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_13150 4489 4677 gene locus_tag LOCUS_13160 4489 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 5245 4691 gene locus_tag LOCUS_13170 5245 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 6183 5242 gene locus_tag LOCUS_13180 6183 5242 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_13180 6833 6192 gene locus_tag LOCUS_13190 6833 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence075 255 404 gene locus_tag LOCUS_13200 gene rpmG 255 404 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_13200 433 508 gene locus_tag LOCUS_t00290 433 508 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 584 817 gene locus_tag LOCUS_13210 584 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 826 1356 gene locus_tag LOCUS_13220 gene nusG 826 1356 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_13220 1480 1905 gene locus_tag LOCUS_13230 gene rplK 1480 1905 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_13230 1978 2685 gene locus_tag LOCUS_13240 gene rplA 1978 2685 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_13240 2987 3508 gene locus_tag LOCUS_13250 gene rplJ 2987 3508 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_13250 3582 3971 gene locus_tag LOCUS_13260 gene rplL 3582 3971 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence076 625 912 gene locus_tag LOCUS_13270 625 912 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094744.1 protein_id gnl|my_center|LOCUS_13270 2915 915 gene locus_tag LOCUS_13280 2915 915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_13280 4639 2912 gene locus_tag LOCUS_13290 4639 2912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_13290 5160 4636 gene locus_tag LOCUS_13300 5160 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 5306 5749 gene locus_tag LOCUS_13310 5306 5749 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_13310 5837 6421 gene locus_tag LOCUS_13320 gene prxU 5837 6421 CDS product selenocysteine-containing peroxiredoxin PrxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L3Q5 transl_except (pos:5978..5980,aa:Sec) note codon on position 48 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_13320 >Feature sequence077 695 2122 gene locus_tag LOCUS_13330 695 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2129 2299 gene locus_tag LOCUS_13340 2129 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2758 2342 gene locus_tag LOCUS_13350 2758 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2949 4811 gene locus_tag LOCUS_13360 2949 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 4811 5485 gene locus_tag LOCUS_13370 4811 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6084 5410 gene locus_tag LOCUS_13380 6084 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6808 6095 gene locus_tag LOCUS_13390 6808 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence078 174 1277 gene locus_tag LOCUS_13400 gene proB 174 1277 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_13400 1274 2554 gene locus_tag LOCUS_13410 1274 2554 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_13410 2551 3162 gene locus_tag LOCUS_13420 gene nadD 2551 3162 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_13420 3164 3742 gene locus_tag LOCUS_13430 gene yqeK 3164 3742 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_13430 3973 4923 gene locus_tag LOCUS_13440 3973 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4963 5334 gene locus_tag LOCUS_13450 gene rsfS 4963 5334 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_13450 5331 6263 gene locus_tag LOCUS_13460 5331 6263 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944018.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence079 970 245 gene locus_tag LOCUS_13470 gene hisA 970 245 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_13470 1590 967 gene locus_tag LOCUS_13480 gene hisH 1590 967 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_13480 2203 1607 gene locus_tag LOCUS_13490 gene hisB 2203 1607 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_13490 3332 2196 gene locus_tag LOCUS_13500 gene hisC 3332 2196 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545615.1 protein_id gnl|my_center|LOCUS_13500 4640 3333 gene locus_tag LOCUS_13510 gene hisD 4640 3333 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_13510 5323 4637 gene locus_tag LOCUS_13520 gene hisG 5323 4637 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393532.1 protein_id gnl|my_center|LOCUS_13520 <6317 5320 gene locus_tag LOCUS_13530 <6317 5320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393533.1:ATP phosphoribosyltransferase regulatory subunit >Feature sequence080 4291 1817 gene locus_tag LOCUS_13540 4291 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence081 636 118 gene locus_tag LOCUS_13550 636 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1044 1739 gene locus_tag LOCUS_13560 1044 1739 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_13560 1765 2799 gene locus_tag LOCUS_13570 1765 2799 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_13570 2796 4706 gene locus_tag LOCUS_13580 2796 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence082 21 599 gene locus_tag LOCUS_13590 21 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 630 1553 gene locus_tag LOCUS_13600 gene racE 630 1553 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 protein_id gnl|my_center|LOCUS_13600 1544 2293 gene locus_tag LOCUS_13610 1544 2293 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222750.1 protein_id gnl|my_center|LOCUS_13610 2305 3054 gene locus_tag LOCUS_13620 gene rph 2305 3054 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_13620 3041 3652 gene locus_tag LOCUS_13630 3041 3652 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_13630 3747 3823 gene locus_tag LOCUS_t00300 3747 3823 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3830 3905 gene locus_tag LOCUS_t00310 3830 3905 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3999 4075 gene locus_tag LOCUS_t00320 3999 4075 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4087 4163 gene locus_tag LOCUS_t00330 4087 4163 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4274 5968 gene locus_tag LOCUS_13640 4274 5968 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence083 378 785 gene locus_tag LOCUS_13650 378 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 923 1126 gene locus_tag LOCUS_13660 923 1126 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643615.1 protein_id gnl|my_center|LOCUS_13660 1273 2001 gene locus_tag LOCUS_13670 1273 2001 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_13670 2055 2130 gene locus_tag LOCUS_t00340 2055 2130 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2329 2736 gene locus_tag LOCUS_13680 2329 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2792 3043 gene locus_tag LOCUS_13690 2792 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3346 3807 gene locus_tag LOCUS_13700 3346 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3878 4021 gene locus_tag LOCUS_13710 3878 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4094 4501 gene locus_tag LOCUS_13720 4094 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4574 5746 gene locus_tag LOCUS_13730 4574 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence084 726 2534 gene locus_tag LOCUS_13740 gene typA 726 2534 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_13740 2610 4295 gene locus_tag LOCUS_13750 2610 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4324 4857 gene locus_tag LOCUS_13760 4324 4857 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146526238.1 protein_id gnl|my_center|LOCUS_13760 4946 5746 gene locus_tag LOCUS_13770 4946 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence085 991 1941 gene locus_tag LOCUS_13780 991 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1946 2593 gene locus_tag LOCUS_13790 1946 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2605 3330 gene locus_tag LOCUS_13800 2605 3330 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036280.1 protein_id gnl|my_center|LOCUS_13800 3557 4564 gene locus_tag LOCUS_13810 3557 4564 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_13810 4755 5120 gene locus_tag LOCUS_13820 4755 5120 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940111.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence086 1452 256 gene locus_tag LOCUS_13830 1452 256 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_13830 1773 1453 gene locus_tag LOCUS_13840 gene porD 1773 1453 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_13840 2345 1770 gene locus_tag LOCUS_13850 2345 1770 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_13850 3127 2528 gene locus_tag LOCUS_13860 gene recR 3127 2528 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_13860 3447 3130 gene locus_tag LOCUS_13870 3447 3130 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_13870 5148 3472 gene locus_tag LOCUS_13880 gene dnaX 5148 3472 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_13880 5758 5390 gene locus_tag LOCUS_13890 5758 5390 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence087 1982 699 gene locus_tag LOCUS_13900 gene hemL 1982 699 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_13900 3062 2076 gene locus_tag LOCUS_13910 3062 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4417 3098 gene locus_tag LOCUS_13920 gene ahbD 4417 3098 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_13920 5400 4417 gene locus_tag LOCUS_13930 gene hemB 5400 4417 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_13930 5686 5459 gene locus_tag LOCUS_13940 5686 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5850 5775 gene locus_tag LOCUS_t00350 5850 5775 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 519 85 gene locus_tag LOCUS_13950 gene mraZ 519 85 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_13950 919 1083 gene locus_tag LOCUS_13960 919 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1195 2202 gene locus_tag LOCUS_13970 1195 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2206 2466 gene locus_tag LOCUS_13980 2206 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3564 2659 gene locus_tag LOCUS_13990 gene xerD 3564 2659 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_13990 4737 3658 gene locus_tag LOCUS_14000 4737 3658 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_14000 <5561 4742 gene locus_tag LOCUS_14010 <5561 4742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000609803.1:tripeptidase T >Feature sequence089 <1 995 gene locus_tag LOCUS_14020 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017711988.1:AarF/ABC1/UbiB kinase family protein 1073 1483 gene locus_tag LOCUS_14030 1073 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2280 1480 gene locus_tag LOCUS_14040 gene larE 2280 1480 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_14040 2377 4362 gene locus_tag LOCUS_14050 gene acs 2377 4362 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_14050 <5466 4387 gene locus_tag LOCUS_14060 <5466 4387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938529.1:[protein-PII] uridylyltransferase >Feature sequence090 1916 1131 gene locus_tag LOCUS_14070 gene dapB 1916 1131 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_14070 3212 1935 gene locus_tag LOCUS_14080 3212 1935 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_14080 <5012 3291 gene locus_tag LOCUS_14090 <5012 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722460.1:polyribonucleotide nucleotidyltransferase >Feature sequence091 1968 1159 gene locus_tag LOCUS_14100 1968 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2874 2002 gene locus_tag LOCUS_14110 2874 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3045 4322 gene locus_tag LOCUS_14120 3045 4322 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence092 2273 291 gene locus_tag LOCUS_14130 gene ftsH 2273 291 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_14130 2835 2296 gene locus_tag LOCUS_14140 gene hpt 2835 2296 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_14140 4328 2871 gene locus_tag LOCUS_14150 gene tilS 4328 2871 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_14150 <4926 4330 gene locus_tag LOCUS_14160 <4926 4330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000824854.1:ABC transporter permease >Feature sequence093 181 3483 gene locus_tag LOCUS_14170 181 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence094 <1 1206 gene locus_tag LOCUS_14180 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459119.1:OFA family MFS transporter 1356 3038 gene locus_tag LOCUS_14190 1356 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3138 4157 gene locus_tag LOCUS_14200 3138 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 4717 4160 gene locus_tag LOCUS_14210 4717 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence095 >Feature sequence096 1322 42 gene locus_tag LOCUS_14220 gene hisZ 1322 42 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_14220 <4677 1402 gene locus_tag LOCUS_14230 <4677 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence097 1370 201 gene locus_tag LOCUS_14240 1370 201 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_14240 <4619 1429 gene locus_tag LOCUS_14250 <4619 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200903603.1:acyl-CoA dehydratase activase >Feature sequence098 >Feature sequence099 648 73 gene locus_tag LOCUS_14260 gene gmk 648 73 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_14260 972 664 gene locus_tag LOCUS_14270 gene mihF 972 664 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_14270 1676 1098 gene locus_tag LOCUS_14280 gene pyrE 1676 1098 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_14280 2380 1673 gene locus_tag LOCUS_14290 gene pyrF 2380 1673 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_14290 3383 2451 gene locus_tag LOCUS_14300 3383 2451 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_14300 4195 3380 gene locus_tag LOCUS_14310 4195 3380 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence100 1255 95 gene locus_tag LOCUS_14320 1255 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2340 1252 gene locus_tag LOCUS_14330 2340 1252 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_14330 3460 2327 gene locus_tag LOCUS_14340 3460 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence101 <1 1071 gene locus_tag LOCUS_14350 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266726.1:glycosyltransferase family 1 protein 1072 2136 gene locus_tag LOCUS_14360 1072 2136 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_14360 3982 2129 gene locus_tag LOCUS_14370 3982 2129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence102 >Feature sequence103 71 898 gene locus_tag LOCUS_14380 71 898 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 protein_id gnl|my_center|LOCUS_14380 998 1858 gene locus_tag LOCUS_14390 998 1858 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_14390 1983 3365 gene locus_tag LOCUS_14400 1983 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence104 131 2731 gene locus_tag LOCUS_14410 gene clpB 131 2731 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_14410 2740 3063 gene locus_tag LOCUS_14420 2740 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3133 3579 gene locus_tag LOCUS_14430 3133 3579 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence105 44 538 gene locus_tag LOCUS_14440 44 538 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_14440 583 948 gene locus_tag LOCUS_14450 583 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 945 2774 gene locus_tag LOCUS_14460 945 2774 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_14460 <4030 2918 gene locus_tag LOCUS_14470 <4030 2918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089497.1:bifunctional transaldolase/phosoglucose isomerase >Feature sequence106 2174 1323 gene locus_tag LOCUS_14480 2174 1323 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878537.1 protein_id gnl|my_center|LOCUS_14480 2268 3305 gene locus_tag LOCUS_14490 2268 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 <4029 3336 gene locus_tag LOCUS_14500 <4029 3336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272645.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence107 729 388 gene locus_tag LOCUS_14510 729 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1621 827 gene locus_tag LOCUS_14520 1621 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2553 1618 gene locus_tag LOCUS_14530 2553 1618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_14530 2689 3399 gene locus_tag LOCUS_14540 2689 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence108 432 1136 gene locus_tag LOCUS_14550 gene rnc 432 1136 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence109 367 762 gene locus_tag LOCUS_14560 367 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1030 1437 gene locus_tag LOCUS_14570 1030 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1557 2381 gene locus_tag LOCUS_14580 1557 2381 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence110 702 1532 gene locus_tag LOCUS_14590 702 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1764 3161 gene locus_tag LOCUS_14600 1764 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence111 378 710 gene locus_tag LOCUS_14610 378 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 745 1146 gene locus_tag LOCUS_14620 745 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1139 1924 gene locus_tag LOCUS_14630 1139 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1925 3142 gene locus_tag LOCUS_14640 1925 3142 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence112 <1 1158 gene locus_tag LOCUS_14650 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986828.1:MFS transporter 1855 1139 gene locus_tag LOCUS_14660 1855 1139 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228828.1 protein_id gnl|my_center|LOCUS_14660 2339 1869 gene locus_tag LOCUS_14670 2339 1869 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_14670 2501 2920 gene locus_tag LOCUS_14680 2501 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3162 2953 gene locus_tag LOCUS_14690 3162 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3328 3059 gene locus_tag LOCUS_14700 3328 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14700 >Feature sequence113 <1 1070 gene locus_tag LOCUS_14710 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303084.1:discoidin domain-containing protein 2854 1154 gene locus_tag LOCUS_14720 2854 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3301 2870 gene locus_tag LOCUS_14730 3301 2870 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_14730 3465 3549 gene locus_tag LOCUS_t00360 3465 3549 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 690 1562 gene locus_tag LOCUS_14740 690 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1669 2991 gene locus_tag LOCUS_14750 1669 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence115 >Feature sequence116 1306 146 gene locus_tag LOCUS_14760 1306 146 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670244.1 protein_id gnl|my_center|LOCUS_14760 1876 1397 gene locus_tag LOCUS_14770 1876 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2340 1903 gene locus_tag LOCUS_14780 2340 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence117 510 2816 gene locus_tag LOCUS_14790 510 2816 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence118 417 584 gene locus_tag LOCUS_14800 417 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 922 2226 gene locus_tag LOCUS_14810 922 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2577 3050 gene locus_tag LOCUS_14820 2577 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence119 558 1481 gene locus_tag LOCUS_14830 558 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1646 2017 gene locus_tag LOCUS_14840 1646 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2123 2413 gene locus_tag LOCUS_14850 2123 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2413 2847 gene locus_tag LOCUS_14860 2413 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence120 658 834 gene locus_tag LOCUS_14870 658 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1357 2958 gene locus_tag LOCUS_14880 1357 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence121 <1 927 gene locus_tag LOCUS_14890 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393749.1:fructose-1,6-bisphosphate aldolase/phosphatase 920 1537 gene locus_tag LOCUS_14900 920 1537 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_14900 1573 2706 gene locus_tag LOCUS_14910 gene dnaN 1573 2706 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence122 589 1299 gene locus_tag LOCUS_14920 589 1299 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_14920 1341 3056 gene locus_tag LOCUS_14930 gene phoR 1341 3056 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence123 833 2119 gene locus_tag LOCUS_14940 833 2119 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030529.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence124 1837 479 gene locus_tag LOCUS_14950 1837 479 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_14950 2637 1834 gene locus_tag LOCUS_14960 gene trpC 2637 1834 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence125 <1 747 gene locus_tag LOCUS_14970 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976820.1:30S ribosomal protein S1 833 1444 gene locus_tag LOCUS_14980 gene coaE 833 1444 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence126 1963 1385 gene locus_tag LOCUS_14990 1963 1385 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_14990 2897 2058 gene locus_tag LOCUS_15000 2897 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence127 711 154 gene locus_tag LOCUS_15010 711 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1752 745 gene locus_tag LOCUS_15020 1752 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence128 1267 812 gene locus_tag LOCUS_15030 1267 812 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_15030 2136 1264 gene locus_tag LOCUS_15040 gene rfbA 2136 1264 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676077.1 protein_id gnl|my_center|LOCUS_15040 <2916 2133 gene locus_tag LOCUS_15050 <2916 2133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096179.1:dTDP-glucose 4,6-dehydratase >Feature sequence129 2371 137 gene locus_tag LOCUS_15060 2371 137 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051509115.1 protein_id gnl|my_center|LOCUS_15060 2513 2340 gene locus_tag LOCUS_15070 2513 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2557 2787 gene locus_tag LOCUS_15080 2557 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence130 987 457 gene locus_tag LOCUS_15090 987 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <2853 1013 gene locus_tag LOCUS_15100 <2853 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003226808.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence131 <1 745 gene locus_tag LOCUS_15110 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000840888.1:aspartate--tRNA ligase 756 1058 gene locus_tag LOCUS_15120 756 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1294 1842 gene locus_tag LOCUS_15130 1294 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence132 1114 557 gene locus_tag LOCUS_15140 1114 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1619 1098 gene locus_tag LOCUS_15150 1619 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1912 1616 gene locus_tag LOCUS_15160 1912 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2396 1902 gene locus_tag LOCUS_15170 2396 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2701 2393 gene locus_tag LOCUS_15180 2701 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence133 224 610 gene locus_tag LOCUS_15190 gene flgB 224 610 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_15190 614 1024 gene locus_tag LOCUS_15200 gene flgC 614 1024 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_15200 1138 1431 gene locus_tag LOCUS_15210 gene fliE 1138 1431 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705271.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence134 2554 1580 gene locus_tag LOCUS_15220 2554 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2773 2698 gene locus_tag LOCUS_t00370 2773 2698 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 1495 353 gene locus_tag LOCUS_15230 gene radA 1495 353 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_15230 <2704 1829 gene locus_tag LOCUS_15240 <2704 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence136 <1 964 gene locus_tag LOCUS_15250 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583548.1:biosynthetic-type acetolactate synthase large subunit 965 1450 gene locus_tag LOCUS_15260 gene ilvN 965 1450 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_15260 1497 2492 gene locus_tag LOCUS_15270 gene ilvC 1497 2492 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence137 1378 866 gene locus_tag LOCUS_15280 1378 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2229 1375 gene locus_tag LOCUS_15290 2229 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence138 2506 1067 gene locus_tag LOCUS_15300 2506 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence139 395 682 gene locus_tag LOCUS_15310 395 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 834 679 gene locus_tag LOCUS_15320 834 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1296 883 gene locus_tag LOCUS_15330 1296 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1532 1290 gene locus_tag LOCUS_15340 1532 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1706 1861 gene locus_tag LOCUS_15350 1706 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1946 2176 gene locus_tag LOCUS_15360 1946 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 2173 2568 gene locus_tag LOCUS_15370 2173 2568 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence140 106 258 gene locus_tag LOCUS_15380 106 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 907 1437 gene locus_tag LOCUS_15390 907 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1608 1994 gene locus_tag LOCUS_15400 1608 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1981 2268 gene locus_tag LOCUS_15410 1981 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence141 1351 329 gene locus_tag LOCUS_15420 1351 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1509 2180 gene locus_tag LOCUS_15430 1509 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence142