>Feature sequence01 3304 1697 gene locus_tag LOCUS_00010 3304 1697 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546159.1 protein_id gnl|my_center|LOCUS_00010 4162 3341 gene locus_tag LOCUS_00020 gene lpxI 4162 3341 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_00020 5065 4259 gene locus_tag LOCUS_00030 gene lpxA 5065 4259 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_00030 6333 5026 gene locus_tag LOCUS_00040 6333 5026 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_00040 6849 6346 gene locus_tag LOCUS_00050 6849 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9254 6894 gene locus_tag LOCUS_00060 gene bamA 9254 6894 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_00060 10618 9254 gene locus_tag LOCUS_00070 gene dnaB 10618 9254 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_00070 11086 10640 gene locus_tag LOCUS_00080 gene rplI 11086 10640 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_00080 11932 11462 gene locus_tag LOCUS_00090 11932 11462 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_00090 12330 11959 gene locus_tag LOCUS_00100 12330 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13119 12526 gene locus_tag LOCUS_00110 gene pth 13119 12526 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_00110 13909 13184 gene locus_tag LOCUS_00120 13909 13184 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_00120 14953 13958 gene locus_tag LOCUS_00130 14953 13958 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_00130 16258 14984 gene locus_tag LOCUS_00140 gene glmU 16258 14984 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119056.1 protein_id gnl|my_center|LOCUS_00140 17131 16262 gene locus_tag LOCUS_00150 17131 16262 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258534.1 protein_id gnl|my_center|LOCUS_00150 18046 17141 gene locus_tag LOCUS_00160 18046 17141 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_00160 19356 18043 gene locus_tag LOCUS_00170 gene clpX 19356 18043 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_00170 19397 19325 gene locus_tag LOCUS_t00010 19397 19325 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20404 19454 gene locus_tag LOCUS_00180 gene ispE 20404 19454 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_00180 21419 20547 gene locus_tag LOCUS_00190 gene hisG 21419 20547 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_00190 21918 21481 gene locus_tag LOCUS_00200 21918 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23050 21965 gene locus_tag LOCUS_00210 gene tsaD 23050 21965 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583326.1 protein_id gnl|my_center|LOCUS_00210 24504 23050 gene locus_tag LOCUS_00220 gene gatB 24504 23050 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_00220 25962 24523 gene locus_tag LOCUS_00230 gene gatA 25962 24523 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_00230 26259 25975 gene locus_tag LOCUS_00240 gene gatC 26259 25975 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_00240 27755 26745 gene locus_tag LOCUS_00250 gene akrN 27755 26745 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_00250 28140 27778 gene locus_tag LOCUS_00260 28140 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29108 28221 gene locus_tag LOCUS_00270 29108 28221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30539 29127 gene locus_tag LOCUS_00280 30539 29127 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_00280 31498 30554 gene locus_tag LOCUS_00290 31498 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32755 31877 gene locus_tag LOCUS_00300 gene rsmA 32755 31877 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_00300 33827 32772 gene locus_tag LOCUS_00310 gene pdxA 33827 32772 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_00310 34753 33860 gene locus_tag LOCUS_00320 34753 33860 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_00320 36804 34891 gene locus_tag LOCUS_00330 36804 34891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38130 36919 gene locus_tag LOCUS_00340 38130 36919 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142594.1 protein_id gnl|my_center|LOCUS_00340 38590 38090 gene locus_tag LOCUS_00350 38590 38090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39723 38707 gene locus_tag LOCUS_00360 39723 38707 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_00360 40415 39789 gene locus_tag LOCUS_00370 gene rpsD 40415 39789 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_00370 40791 40420 gene locus_tag LOCUS_00380 gene rpsK 40791 40420 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_00380 41203 40817 gene locus_tag LOCUS_00390 gene rpsM 41203 40817 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_00390 41624 41406 gene locus_tag LOCUS_00400 gene infA 41624 41406 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_00400 42402 41641 gene locus_tag LOCUS_00410 gene map 42402 41641 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_00410 43058 42399 gene locus_tag LOCUS_00420 43058 42399 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_00420 44430 43060 gene locus_tag LOCUS_00430 gene secY 44430 43060 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_00430 44852 44427 gene locus_tag LOCUS_00440 gene rplO 44852 44427 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_00440 45496 44849 gene locus_tag LOCUS_00450 45496 44849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45801 45496 gene locus_tag LOCUS_00460 gene rplR 45801 45496 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_00460 46420 45884 gene locus_tag LOCUS_00470 gene rplF 46420 45884 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088138.1 protein_id gnl|my_center|LOCUS_00470 46840 46442 gene locus_tag LOCUS_00480 gene rpsH 46840 46442 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_00480 47628 47065 gene locus_tag LOCUS_00490 gene rplE 47628 47065 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081811.1 protein_id gnl|my_center|LOCUS_00490 47950 47630 gene locus_tag LOCUS_00500 gene rplX 47950 47630 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_00500 48347 47952 gene locus_tag LOCUS_00510 gene rplN 48347 47952 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_00510 48577 48317 gene locus_tag LOCUS_00520 gene rpsQ 48577 48317 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_00520 48783 48574 gene locus_tag LOCUS_00530 gene rpmC 48783 48574 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_00530 49154 48789 gene locus_tag LOCUS_00540 gene rplP 49154 48789 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_00540 50126 49230 gene locus_tag LOCUS_00550 50126 49230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 50631 50140 gene locus_tag LOCUS_00560 50631 50140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 50940 50641 gene locus_tag LOCUS_00570 gene rpsS 50940 50641 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_00570 51764 50937 gene locus_tag LOCUS_00580 gene rplB 51764 50937 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546860.1 protein_id gnl|my_center|LOCUS_00580 52063 51776 gene locus_tag LOCUS_00590 gene rplW 52063 51776 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_00590 52705 52070 gene locus_tag LOCUS_00600 gene rplD 52705 52070 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_00600 53550 52792 gene locus_tag LOCUS_00610 gene rplC 53550 52792 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015720.1 protein_id gnl|my_center|LOCUS_00610 53938 53627 gene locus_tag LOCUS_00620 gene rpsJ 53938 53627 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_00620 56060 53958 gene locus_tag LOCUS_00630 gene fusA 56060 53958 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545225.1 protein_id gnl|my_center|LOCUS_00630 56567 56100 gene locus_tag LOCUS_00640 gene rpsG 56567 56100 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_00640 56966 56589 gene locus_tag LOCUS_00650 gene rpsL 56966 56589 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118744.1 protein_id gnl|my_center|LOCUS_00650 61015 56966 gene locus_tag LOCUS_00660 gene rpoC 61015 56966 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_00660 64797 61012 gene locus_tag LOCUS_00670 gene rpoB 64797 61012 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_00670 65444 64977 gene locus_tag LOCUS_00680 gene rplL 65444 64977 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_00680 66000 65467 gene locus_tag LOCUS_00690 gene rplJ 66000 65467 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385333.1 protein_id gnl|my_center|LOCUS_00690 66706 66011 gene locus_tag LOCUS_00700 gene rplA 66706 66011 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_00700 67141 66710 gene locus_tag LOCUS_00710 gene rplK 67141 66710 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_00710 67693 67160 gene locus_tag LOCUS_00720 gene nusG 67693 67160 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_00720 67884 67699 gene locus_tag LOCUS_00730 gene secE 67884 67699 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_00730 67971 67897 gene locus_tag LOCUS_t00020 67971 67897 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 69371 68172 gene locus_tag LOCUS_00740 gene tuf 69371 68172 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_00740 69488 69416 gene locus_tag LOCUS_t00030 69488 69416 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 69874 69801 gene locus_tag LOCUS_t00040 69874 69801 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 70704 69991 gene locus_tag LOCUS_00750 70704 69991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 70878 71651 gene locus_tag LOCUS_00760 70878 71651 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_00760 72031 72873 gene locus_tag LOCUS_00770 72031 72873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 72918 73148 gene locus_tag LOCUS_00780 72918 73148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 73162 73662 gene locus_tag LOCUS_00790 gene atpF 73162 73662 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 protein_id gnl|my_center|LOCUS_00790 73659 74198 gene locus_tag LOCUS_00800 gene atpH 73659 74198 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_00800 74218 75717 gene locus_tag LOCUS_00810 gene atpA 74218 75717 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_00810 75722 76597 gene locus_tag LOCUS_00820 gene atpG 75722 76597 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_00820 76615 78021 gene locus_tag LOCUS_00830 gene atpD 76615 78021 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_00830 78018 78293 gene locus_tag LOCUS_00840 78018 78293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 80011 78290 gene locus_tag LOCUS_00850 80011 78290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 81102 79990 gene locus_tag LOCUS_00860 81102 79990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 81486 81121 gene locus_tag LOCUS_00870 81486 81121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 82509 81514 gene locus_tag LOCUS_00880 82509 81514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 83834 82506 gene locus_tag LOCUS_00890 83834 82506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 84965 83982 gene locus_tag LOCUS_00900 84965 83982 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_00900 86486 85083 gene locus_tag LOCUS_00910 86486 85083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 88649 86619 gene locus_tag LOCUS_00920 88649 86619 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_00920 89173 88685 gene locus_tag LOCUS_00930 89173 88685 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_00930 90635 89481 gene locus_tag LOCUS_00940 90635 89481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 91209 90562 gene locus_tag LOCUS_00950 91209 90562 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908611.1 protein_id gnl|my_center|LOCUS_00950 91691 91206 gene locus_tag LOCUS_00960 91691 91206 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208310.1 protein_id gnl|my_center|LOCUS_00960 92488 91694 gene locus_tag LOCUS_00970 92488 91694 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_00970 93686 92577 gene locus_tag LOCUS_00980 gene amrS 93686 92577 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_00980 94321 94638 gene locus_tag LOCUS_00990 94321 94638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 96359 94812 gene locus_tag LOCUS_01000 96359 94812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 98830 96389 gene locus_tag LOCUS_01010 98830 96389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 100042 98855 gene locus_tag LOCUS_01020 gene pseC 100042 98855 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_01020 100764 100039 gene locus_tag LOCUS_01030 100764 100039 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_01030 101471 100761 gene locus_tag LOCUS_01040 101471 100761 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812818.1 protein_id gnl|my_center|LOCUS_01040 102500 101496 gene locus_tag LOCUS_01050 102500 101496 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973529.1 protein_id gnl|my_center|LOCUS_01050 103642 102497 gene locus_tag LOCUS_01060 103642 102497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 104865 103639 gene locus_tag LOCUS_01070 104865 103639 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_01070 105623 104844 gene locus_tag LOCUS_01080 105623 104844 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_01080 106399 105620 gene locus_tag LOCUS_01090 106399 105620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 107920 106424 gene locus_tag LOCUS_01100 107920 106424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 108802 107936 gene locus_tag LOCUS_01110 108802 107936 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_01110 109904 109059 gene locus_tag LOCUS_01120 109904 109059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 111049 109904 gene locus_tag LOCUS_01130 111049 109904 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259312.1 protein_id gnl|my_center|LOCUS_01130 112560 111046 gene locus_tag LOCUS_01140 112560 111046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 114320 113040 gene locus_tag LOCUS_01150 114320 113040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 115125 114310 gene locus_tag LOCUS_01160 115125 114310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 116101 115226 gene locus_tag LOCUS_01170 116101 115226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 116143 116301 gene locus_tag LOCUS_01180 116143 116301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 117312 116386 gene locus_tag LOCUS_01190 117312 116386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 118417 117305 gene locus_tag LOCUS_01200 118417 117305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 119238 118414 gene locus_tag LOCUS_01210 119238 118414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 122280 119272 gene locus_tag LOCUS_01220 122280 119272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 124775 122277 gene locus_tag LOCUS_01230 124775 122277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 126895 124772 gene locus_tag LOCUS_01240 126895 124772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 128786 126906 gene locus_tag LOCUS_01250 128786 126906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_01250 129468 128908 gene locus_tag LOCUS_01260 129468 128908 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_01260 129791 129573 gene locus_tag LOCUS_01270 129791 129573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 131310 130765 gene locus_tag LOCUS_01280 gene pyrE 131310 130765 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_01280 132144 131404 gene locus_tag LOCUS_01290 132144 131404 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544934.1 protein_id gnl|my_center|LOCUS_01290 132326 133024 gene locus_tag LOCUS_01300 132326 133024 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095737.1 protein_id gnl|my_center|LOCUS_01300 133304 132987 gene locus_tag LOCUS_01310 133304 132987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 133952 133371 gene locus_tag LOCUS_01320 gene cobO 133952 133371 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254597.1 protein_id gnl|my_center|LOCUS_01320 134321 133956 gene locus_tag LOCUS_01330 134321 133956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 134952 134494 gene locus_tag LOCUS_01340 134952 134494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 136428 135043 gene locus_tag LOCUS_01350 gene noeA 136428 135043 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967406.1 protein_id gnl|my_center|LOCUS_01350 136664 136431 gene locus_tag LOCUS_01360 136664 136431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 138185 136686 gene locus_tag LOCUS_01370 138185 136686 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_01370 139337 138243 gene locus_tag LOCUS_01380 139337 138243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 139706 139347 gene locus_tag LOCUS_01390 139706 139347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 140151 139735 gene locus_tag LOCUS_01400 140151 139735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 140863 140177 gene locus_tag LOCUS_01410 gene cysE 140863 140177 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_01410 153829 141203 gene locus_tag LOCUS_01420 153829 141203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 172430 172717 gene locus_tag LOCUS_01430 172430 172717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 173423 173572 gene locus_tag LOCUS_01440 173423 173572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 176693 176998 gene locus_tag LOCUS_01450 176693 176998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 179129 178035 gene locus_tag LOCUS_01460 gene ychF 179129 178035 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_01460 179253 180974 gene locus_tag LOCUS_01470 179253 180974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 180971 181321 gene locus_tag LOCUS_01480 180971 181321 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_01480 182436 181375 gene locus_tag LOCUS_01490 gene rlmN 182436 181375 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082231.1 protein_id gnl|my_center|LOCUS_01490 183410 182427 gene locus_tag LOCUS_01500 gene corA 183410 182427 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_01500 184174 183410 gene locus_tag LOCUS_01510 184174 183410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_01510 185090 184176 gene locus_tag LOCUS_01520 185090 184176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721785.1 protein_id gnl|my_center|LOCUS_01520 185618 185529 gene locus_tag LOCUS_t00050 185618 185529 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 186307 185816 gene locus_tag LOCUS_01530 gene tadA 186307 185816 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_01530 186553 186478 gene locus_tag LOCUS_t00060 186553 186478 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 187297 189132 gene locus_tag LOCUS_01540 gene asnB 187297 189132 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_01540 189672 189307 gene locus_tag LOCUS_01550 189672 189307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 191229 189703 gene locus_tag LOCUS_01560 191229 189703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 191844 198965 gene locus_tag LOCUS_01570 191844 198965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 200493 199042 gene locus_tag LOCUS_01580 200493 199042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 201395 200508 gene locus_tag LOCUS_01590 201395 200508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 201652 201558 gene locus_tag LOCUS_t00070 201652 201558 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 202006 201918 gene locus_tag LOCUS_t00080 202006 201918 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 203362 202106 gene locus_tag LOCUS_01600 gene serS 203362 202106 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458807.1 protein_id gnl|my_center|LOCUS_01600 205865 203370 gene locus_tag LOCUS_01610 gene gyrA 205865 203370 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_01610 <208086 205884 gene locus_tag LOCUS_01620 <208086 205884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882923.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence02 1070 369 gene locus_tag LOCUS_01630 gene rsmI 1070 369 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081030.1 protein_id gnl|my_center|LOCUS_01630 2617 1601 gene locus_tag LOCUS_01640 2617 1601 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_01640 2882 2709 gene locus_tag LOCUS_01650 2882 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 4280 2985 gene locus_tag LOCUS_01660 gene hemL 4280 2985 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880497.1 protein_id gnl|my_center|LOCUS_01660 4638 4300 gene locus_tag LOCUS_01670 4638 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 6671 4926 gene locus_tag LOCUS_01680 6671 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7842 6829 gene locus_tag LOCUS_01690 gene hemB 7842 6829 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_01690 8802 7996 gene locus_tag LOCUS_01700 8802 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9721 8777 gene locus_tag LOCUS_01710 gene hemC 9721 8777 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_01710 11001 9718 gene locus_tag LOCUS_01720 gene hemA 11001 9718 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_01720 12952 11519 gene locus_tag LOCUS_01730 12952 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 13837 13043 gene locus_tag LOCUS_01740 gene panB 13837 13043 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_01740 14730 13858 gene locus_tag LOCUS_01750 gene folD 14730 13858 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654480.1 protein_id gnl|my_center|LOCUS_01750 15322 14714 gene locus_tag LOCUS_01760 15322 14714 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198967.1 protein_id gnl|my_center|LOCUS_01760 15513 16340 gene locus_tag LOCUS_01770 15513 16340 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_01770 17563 16358 gene locus_tag LOCUS_01780 17563 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 18040 17684 gene locus_tag LOCUS_01790 18040 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 18231 18932 gene locus_tag LOCUS_01800 gene tsaB 18231 18932 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_01800 18929 20065 gene locus_tag LOCUS_01810 gene alr 18929 20065 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_01810 20078 20647 gene locus_tag LOCUS_01820 20078 20647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 20865 21392 gene locus_tag LOCUS_01830 20865 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 21530 23167 gene locus_tag LOCUS_01840 gene groL 21530 23167 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_01840 23258 23548 gene locus_tag LOCUS_01850 gene groES 23258 23548 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_01850 23584 25209 gene locus_tag LOCUS_01860 gene groL 23584 25209 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_01860 25713 25273 gene locus_tag LOCUS_01870 25713 25273 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_01870 26178 25837 gene locus_tag LOCUS_01880 26178 25837 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931828.1 protein_id gnl|my_center|LOCUS_01880 27530 26199 gene locus_tag LOCUS_01890 27530 26199 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931827.1 protein_id gnl|my_center|LOCUS_01890 28270 27776 gene locus_tag LOCUS_01900 28270 27776 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_01900 29278 28586 gene locus_tag LOCUS_01910 29278 28586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 29874 29275 gene locus_tag LOCUS_01920 29874 29275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 30013 32271 gene locus_tag LOCUS_01930 30013 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 32420 32250 gene locus_tag LOCUS_01940 32420 32250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 33412 32417 gene locus_tag LOCUS_01950 gene amrS 33412 32417 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_01950 33684 33409 gene locus_tag LOCUS_01960 33684 33409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 35005 33653 gene locus_tag LOCUS_01970 35005 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 35177 35935 gene locus_tag LOCUS_01980 35177 35935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 36349 35951 gene locus_tag LOCUS_01990 36349 35951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 39022 36413 gene locus_tag LOCUS_02000 39022 36413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 39725 39087 gene locus_tag LOCUS_02010 39725 39087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 40161 39727 gene locus_tag LOCUS_02020 40161 39727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 43538 40215 gene locus_tag LOCUS_02030 43538 40215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 44654 43551 gene locus_tag LOCUS_02040 44654 43551 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_02040 46888 44783 gene locus_tag LOCUS_02050 46888 44783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 47907 46885 gene locus_tag LOCUS_02060 47907 46885 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176666.1 protein_id gnl|my_center|LOCUS_02060 48277 47951 gene locus_tag LOCUS_02070 48277 47951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 49083 48319 gene locus_tag LOCUS_02080 49083 48319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 51660 49102 gene locus_tag LOCUS_02090 51660 49102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 52731 51919 gene locus_tag LOCUS_02100 52731 51919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 54127 52838 gene locus_tag LOCUS_02110 54127 52838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 55365 54124 gene locus_tag LOCUS_02120 55365 54124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 55775 55416 gene locus_tag LOCUS_02130 55775 55416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 56595 55879 gene locus_tag LOCUS_02140 56595 55879 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_02140 56657 57496 gene locus_tag LOCUS_02150 gene lgt 56657 57496 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_02150 57503 58153 gene locus_tag LOCUS_02160 57503 58153 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_02160 58478 58227 gene locus_tag LOCUS_02170 gene yidD 58478 58227 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_02170 58912 58511 gene locus_tag LOCUS_02180 58912 58511 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926834.1 protein_id gnl|my_center|LOCUS_02180 59089 58937 gene locus_tag LOCUS_02190 gene rpmG 59089 58937 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873598.1 protein_id gnl|my_center|LOCUS_02190 59266 59093 gene locus_tag LOCUS_02200 59266 59093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 59962 59360 gene locus_tag LOCUS_02210 gene sodB 59962 59360 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366881.1 protein_id gnl|my_center|LOCUS_02210 60418 60077 gene locus_tag LOCUS_02220 60418 60077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 61308 60559 gene locus_tag LOCUS_02230 gene gpmA 61308 60559 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_02230 63090 61411 gene locus_tag LOCUS_02240 63090 61411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 63401 64513 gene locus_tag LOCUS_02250 63401 64513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 64510 65259 gene locus_tag LOCUS_02260 64510 65259 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_02260 65979 65287 gene locus_tag LOCUS_02270 65979 65287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 67070 66063 gene locus_tag LOCUS_02280 67070 66063 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_02280 67357 68565 gene locus_tag LOCUS_02290 gene glgA 67357 68565 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_02290 68819 68670 gene locus_tag LOCUS_02300 68819 68670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 71970 68836 gene locus_tag LOCUS_02310 71970 68836 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_02310 72182 71958 gene locus_tag LOCUS_02320 72182 71958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 72660 72148 gene locus_tag LOCUS_02330 72660 72148 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_02330 72900 73727 gene locus_tag LOCUS_02340 72900 73727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 74459 73917 gene locus_tag LOCUS_02350 74459 73917 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949045.1 protein_id gnl|my_center|LOCUS_02350 75277 74492 gene locus_tag LOCUS_02360 75277 74492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 76257 75274 gene locus_tag LOCUS_02370 76257 75274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 77234 76509 gene locus_tag LOCUS_02380 77234 76509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 78419 77340 gene locus_tag LOCUS_02390 78419 77340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 79571 78720 gene locus_tag LOCUS_02400 79571 78720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 80312 79824 gene locus_tag LOCUS_02410 80312 79824 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 protein_id gnl|my_center|LOCUS_02410 83010 80317 gene locus_tag LOCUS_02420 83010 80317 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_02420 84213 83314 gene locus_tag LOCUS_02430 84213 83314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 85812 84235 gene locus_tag LOCUS_02440 85812 84235 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_02440 87281 85809 gene locus_tag LOCUS_02450 87281 85809 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_02450 87945 87286 gene locus_tag LOCUS_02460 87945 87286 CDS product hydrogenase-4 component E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548289.1 protein_id gnl|my_center|LOCUS_02460 88892 87942 gene locus_tag LOCUS_02470 88892 87942 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_02470 90919 88892 gene locus_tag LOCUS_02480 gene hyfB 90919 88892 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_02480 91299 91224 gene locus_tag LOCUS_t00090 91299 91224 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 91676 92986 gene locus_tag LOCUS_02490 gene amt 91676 92986 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_02490 93014 93355 gene locus_tag LOCUS_02500 93014 93355 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_02500 94612 93494 gene locus_tag LOCUS_02510 94612 93494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 94739 95179 gene locus_tag LOCUS_02520 94739 95179 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377010.1 protein_id gnl|my_center|LOCUS_02520 95163 95501 gene locus_tag LOCUS_02530 95163 95501 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_02530 95498 96307 gene locus_tag LOCUS_02540 95498 96307 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_02540 96304 97110 gene locus_tag LOCUS_02550 96304 97110 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_02550 97097 97732 gene locus_tag LOCUS_02560 97097 97732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 100099 97739 gene locus_tag LOCUS_02570 100099 97739 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_02570 100675 100226 gene locus_tag LOCUS_02580 gene dut 100675 100226 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_02580 102870 100672 gene locus_tag LOCUS_02590 gene pnp 102870 100672 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_02590 103176 102907 gene locus_tag LOCUS_02600 gene rpsO 103176 102907 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 protein_id gnl|my_center|LOCUS_02600 104265 103240 gene locus_tag LOCUS_02610 104265 103240 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_02610 104965 104243 gene locus_tag LOCUS_02620 104965 104243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 105945 104962 gene locus_tag LOCUS_02630 105945 104962 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_02630 106335 105979 gene locus_tag LOCUS_02640 gene rbfA 106335 105979 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_02640 108483 106369 gene locus_tag LOCUS_02650 108483 106369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 109641 108493 gene locus_tag LOCUS_02660 gene nusA 109641 108493 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_02660 110476 109862 gene locus_tag LOCUS_02670 110476 109862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 113815 110507 gene locus_tag LOCUS_02680 113815 110507 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_02680 117038 113817 gene locus_tag LOCUS_02690 117038 113817 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766163.1 protein_id gnl|my_center|LOCUS_02690 118397 117042 gene locus_tag LOCUS_02700 118397 117042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 120054 118387 gene locus_tag LOCUS_02710 120054 118387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 120864 120220 gene locus_tag LOCUS_02720 120864 120220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 122866 120878 gene locus_tag LOCUS_02730 122866 120878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 123635 122898 gene locus_tag LOCUS_02740 123635 122898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 124307 123729 gene locus_tag LOCUS_02750 gene recR 124307 123729 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932487.1 protein_id gnl|my_center|LOCUS_02750 126097 124415 gene locus_tag LOCUS_02760 gene dnaX 126097 124415 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_02760 126328 126238 gene locus_tag LOCUS_t00100 126328 126238 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 126564 126352 gene locus_tag LOCUS_02770 126564 126352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 128543 126762 gene locus_tag LOCUS_02780 128543 126762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 130320 128545 gene locus_tag LOCUS_02790 130320 128545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence03 135 2717 gene locus_tag LOCUS_02800 135 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2779 3219 gene locus_tag LOCUS_02810 2779 3219 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_02810 3306 4703 gene locus_tag LOCUS_02820 gene leuC 3306 4703 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972507.1 protein_id gnl|my_center|LOCUS_02820 4843 5481 gene locus_tag LOCUS_02830 gene leuD 4843 5481 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704819.1 protein_id gnl|my_center|LOCUS_02830 5848 27399 gene locus_tag LOCUS_02840 5848 27399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 27660 28460 gene locus_tag LOCUS_02850 27660 28460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_02850 28530 31613 gene locus_tag LOCUS_02860 28530 31613 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942996.1 protein_id gnl|my_center|LOCUS_02860 31610 33466 gene locus_tag LOCUS_02870 gene treZ 31610 33466 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_02870 33743 34384 gene locus_tag LOCUS_02880 gene radC 33743 34384 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527272.1 protein_id gnl|my_center|LOCUS_02880 34725 35273 gene locus_tag LOCUS_02890 34725 35273 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_02890 37242 35290 gene locus_tag LOCUS_02900 37242 35290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 37308 37835 gene locus_tag LOCUS_02910 37308 37835 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_02910 37832 38224 gene locus_tag LOCUS_02920 37832 38224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 38217 39209 gene locus_tag LOCUS_02930 38217 39209 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_02930 39325 39795 gene locus_tag LOCUS_02940 39325 39795 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_02940 39776 41227 gene locus_tag LOCUS_02950 gene sufB 39776 41227 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_02950 41247 42011 gene locus_tag LOCUS_02960 gene sufC 41247 42011 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_02960 42014 43357 gene locus_tag LOCUS_02970 gene sufD 42014 43357 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_02970 43370 44602 gene locus_tag LOCUS_02980 43370 44602 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_02980 44599 45036 gene locus_tag LOCUS_02990 44599 45036 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_02990 45136 46215 gene locus_tag LOCUS_03000 45136 46215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 49665 46234 gene locus_tag LOCUS_03010 gene metH 49665 46234 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 protein_id gnl|my_center|LOCUS_03010 49786 50667 gene locus_tag LOCUS_03020 gene metF 49786 50667 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_03020 51135 50674 gene locus_tag LOCUS_03030 51135 50674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 51301 52728 gene locus_tag LOCUS_03040 gene lysS 51301 52728 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_03040 52762 54063 gene locus_tag LOCUS_03050 52762 54063 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_03050 54056 54769 gene locus_tag LOCUS_03060 54056 54769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_03060 54822 55724 gene locus_tag LOCUS_03070 gene ilvE 54822 55724 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_03070 55755 56273 gene locus_tag LOCUS_03080 55755 56273 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_03080 56270 57334 gene locus_tag LOCUS_03090 56270 57334 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_03090 57415 59868 gene locus_tag LOCUS_03100 57415 59868 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_03100 59885 61798 gene locus_tag LOCUS_03110 59885 61798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 61813 62631 gene locus_tag LOCUS_03120 61813 62631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_03120 62637 63389 gene locus_tag LOCUS_03130 62637 63389 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_03130 63396 64202 gene locus_tag LOCUS_03140 63396 64202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 64254 65342 gene locus_tag LOCUS_03150 64254 65342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 65348 66544 gene locus_tag LOCUS_03160 65348 66544 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_03160 66546 67967 gene locus_tag LOCUS_03170 gene gltX 66546 67967 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880773.1 protein_id gnl|my_center|LOCUS_03170 67977 69479 gene locus_tag LOCUS_03180 gene cysS 67977 69479 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_03180 69479 70108 gene locus_tag LOCUS_03190 gene tmk 69479 70108 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_03190 70089 70916 gene locus_tag LOCUS_03200 70089 70916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 70913 72460 gene locus_tag LOCUS_03210 gene metG 70913 72460 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_03210 72496 73269 gene locus_tag LOCUS_03220 72496 73269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 73266 74357 gene locus_tag LOCUS_03230 73266 74357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 74357 74965 gene locus_tag LOCUS_03240 74357 74965 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_03240 74998 76035 gene locus_tag LOCUS_03250 gene mtnA 74998 76035 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_03250 76042 76974 gene locus_tag LOCUS_03260 gene thiL 76042 76974 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_03260 76856 77428 gene locus_tag LOCUS_03270 76856 77428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 77498 79054 gene locus_tag LOCUS_03280 77498 79054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 79083 80204 gene locus_tag LOCUS_03290 79083 80204 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_03290 80201 80593 gene locus_tag LOCUS_03300 80201 80593 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_03300 80618 82366 gene locus_tag LOCUS_03310 80618 82366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 82370 82738 gene locus_tag LOCUS_03320 82370 82738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 82850 84466 gene locus_tag LOCUS_03330 82850 84466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 84453 86915 gene locus_tag LOCUS_03340 84453 86915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 86993 87598 gene locus_tag LOCUS_03350 86993 87598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941685.1 protein_id gnl|my_center|LOCUS_03350 87613 88989 gene locus_tag LOCUS_03360 87613 88989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 89731 89018 gene locus_tag LOCUS_03370 gene phoB 89731 89018 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_03370 90351 89788 gene locus_tag LOCUS_03380 gene orn 90351 89788 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_03380 90475 91707 gene locus_tag LOCUS_03390 90475 91707 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_03390 91753 92403 gene locus_tag LOCUS_03400 91753 92403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 92519 93388 gene locus_tag LOCUS_03410 92519 93388 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940277.1 protein_id gnl|my_center|LOCUS_03410 93421 94500 gene locus_tag LOCUS_03420 93421 94500 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_03420 94502 94684 gene locus_tag LOCUS_03430 94502 94684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 94681 96555 gene locus_tag LOCUS_03440 94681 96555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 96530 98449 gene locus_tag LOCUS_03450 96530 98449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 99297 99479 gene locus_tag LOCUS_03460 99297 99479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 100012 100470 gene locus_tag LOCUS_03470 100012 100470 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_03470 100478 103123 gene locus_tag LOCUS_03480 gene mutS 100478 103123 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774369.1 protein_id gnl|my_center|LOCUS_03480 103127 104887 gene locus_tag LOCUS_03490 gene mutL 103127 104887 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_03490 104908 106497 gene locus_tag LOCUS_03500 104908 106497 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_03500 106519 108012 gene locus_tag LOCUS_03510 gene amrB 106519 108012 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_03510 108015 108884 gene locus_tag LOCUS_03520 108015 108884 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_03520 108965 109588 gene locus_tag LOCUS_03530 108965 109588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 109566 110159 gene locus_tag LOCUS_03540 gene vpsN 109566 110159 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_03540 110239 110757 gene locus_tag LOCUS_03550 110239 110757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 110788 111189 gene locus_tag LOCUS_03560 110788 111189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 111202 111549 gene locus_tag LOCUS_03570 111202 111549 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 protein_id gnl|my_center|LOCUS_03570 111552 112655 gene locus_tag LOCUS_03580 111552 112655 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_03580 112681 113184 gene locus_tag LOCUS_03590 112681 113184 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146717.1 protein_id gnl|my_center|LOCUS_03590 114632 113199 gene locus_tag LOCUS_03600 114632 113199 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_03600 114800 115303 gene locus_tag LOCUS_03610 114800 115303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 115359 115733 gene locus_tag LOCUS_03620 115359 115733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 115779 116351 gene locus_tag LOCUS_03630 115779 116351 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_03630 116374 117006 gene locus_tag LOCUS_03640 116374 117006 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989851.1 protein_id gnl|my_center|LOCUS_03640 117072 117971 gene locus_tag LOCUS_03650 gene gnd 117072 117971 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_03650 117987 119528 gene locus_tag LOCUS_03660 gene zwf 117987 119528 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080226.1 protein_id gnl|my_center|LOCUS_03660 119501 120262 gene locus_tag LOCUS_03670 gene pgl 119501 120262 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_03670 121036 120245 gene locus_tag LOCUS_03680 121036 120245 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_03680 121334 122677 gene locus_tag LOCUS_03690 121334 122677 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_03690 122677 123432 gene locus_tag LOCUS_03700 122677 123432 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_03700 123459 124217 gene locus_tag LOCUS_03710 123459 124217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 124262 125209 gene locus_tag LOCUS_03720 124262 125209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 125223 125717 gene locus_tag LOCUS_03730 125223 125717 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence04 <1 1155 gene locus_tag LOCUS_03740 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546530.1:RtcB family protein 1182 2150 gene locus_tag LOCUS_03750 1182 2150 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250927.1 protein_id gnl|my_center|LOCUS_03750 2185 2856 gene locus_tag LOCUS_03760 2185 2856 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877296.1 protein_id gnl|my_center|LOCUS_03760 2871 3563 gene locus_tag LOCUS_03770 2871 3563 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_03770 3567 5351 gene locus_tag LOCUS_03780 gene phoR 3567 5351 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_03780 5478 6347 gene locus_tag LOCUS_03790 5478 6347 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_03790 6360 7250 gene locus_tag LOCUS_03800 gene pstC 6360 7250 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_03800 7247 8101 gene locus_tag LOCUS_03810 gene pstA 7247 8101 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_03810 8110 8868 gene locus_tag LOCUS_03820 gene pstB 8110 8868 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_03820 8871 9632 gene locus_tag LOCUS_03830 gene pstB 8871 9632 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788575.1 protein_id gnl|my_center|LOCUS_03830 9649 10326 gene locus_tag LOCUS_03840 gene phoU 9649 10326 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_03840 10598 11926 gene locus_tag LOCUS_03850 gene trkA 10598 11926 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_03850 11929 13380 gene locus_tag LOCUS_03860 11929 13380 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_03860 13555 14631 gene locus_tag LOCUS_03870 13555 14631 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_03870 14651 16015 gene locus_tag LOCUS_03880 gene thiC 14651 16015 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141118.1 protein_id gnl|my_center|LOCUS_03880 16012 17085 gene locus_tag LOCUS_03890 gene ispG 16012 17085 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732336.1 protein_id gnl|my_center|LOCUS_03890 17105 18190 gene locus_tag LOCUS_03900 gene mqnE 17105 18190 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_03900 18221 19258 gene locus_tag LOCUS_03910 gene thiF 18221 19258 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 protein_id gnl|my_center|LOCUS_03910 19233 19655 gene locus_tag LOCUS_03920 19233 19655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 19659 20135 gene locus_tag LOCUS_03930 gene greA 19659 20135 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_03930 20136 20957 gene locus_tag LOCUS_03940 20136 20957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 21634 20954 gene locus_tag LOCUS_03950 21634 20954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 21899 22636 gene locus_tag LOCUS_03960 21899 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 22719 23366 gene locus_tag LOCUS_03970 gene nth 22719 23366 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_03970 23370 24482 gene locus_tag LOCUS_03980 gene queG 23370 24482 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_03980 24881 25081 gene locus_tag LOCUS_03990 gene cspD 24881 25081 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 protein_id gnl|my_center|LOCUS_03990 25244 25609 gene locus_tag LOCUS_04000 25244 25609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 25655 25945 gene locus_tag LOCUS_04010 25655 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 26016 26765 gene locus_tag LOCUS_04020 26016 26765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 29050 26789 gene locus_tag LOCUS_04030 29050 26789 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_04030 29692 30405 gene locus_tag LOCUS_04040 29692 30405 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525670.1 protein_id gnl|my_center|LOCUS_04040 30405 31385 gene locus_tag LOCUS_04050 30405 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 31382 32635 gene locus_tag LOCUS_04060 31382 32635 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 protein_id gnl|my_center|LOCUS_04060 32759 33091 gene locus_tag LOCUS_04070 gene trxA 32759 33091 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_04070 33190 34146 gene locus_tag LOCUS_04080 33190 34146 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_04080 34150 35352 gene locus_tag LOCUS_04090 34150 35352 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_04090 35377 35817 gene locus_tag LOCUS_04100 35377 35817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 35851 37053 gene locus_tag LOCUS_04110 35851 37053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 37050 37943 gene locus_tag LOCUS_04120 gene era 37050 37943 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_04120 37933 38886 gene locus_tag LOCUS_04130 37933 38886 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_04130 38887 39681 gene locus_tag LOCUS_04140 38887 39681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 39688 40353 gene locus_tag LOCUS_04150 gene yihX 39688 40353 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314324.1 protein_id gnl|my_center|LOCUS_04150 40350 41252 gene locus_tag LOCUS_04160 gene htpX 40350 41252 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_04160 41306 41617 gene locus_tag LOCUS_04170 41306 41617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 41790 42389 gene locus_tag LOCUS_04180 41790 42389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 42418 43422 gene locus_tag LOCUS_04190 42418 43422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 43453 44646 gene locus_tag LOCUS_04200 43453 44646 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_04200 44947 45201 gene locus_tag LOCUS_04210 44947 45201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 45573 45986 gene locus_tag LOCUS_04220 45573 45986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 45997 46659 gene locus_tag LOCUS_04230 45997 46659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 46661 48208 gene locus_tag LOCUS_04240 46661 48208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 48227 48499 gene locus_tag LOCUS_04250 48227 48499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 48540 48950 gene locus_tag LOCUS_04260 48540 48950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 48950 49507 gene locus_tag LOCUS_04270 48950 49507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 49779 51185 gene locus_tag LOCUS_04280 49779 51185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 51315 52643 gene locus_tag LOCUS_04290 51315 52643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 52751 53500 gene locus_tag LOCUS_04300 52751 53500 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_04300 53615 54016 gene locus_tag LOCUS_04310 gene queD 53615 54016 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_04310 54009 57215 gene locus_tag LOCUS_04320 gene addB 54009 57215 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_04320 57225 60581 gene locus_tag LOCUS_04330 57225 60581 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680941.1 protein_id gnl|my_center|LOCUS_04330 60583 60765 gene locus_tag LOCUS_04340 60583 60765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 60910 61278 gene locus_tag LOCUS_04350 60910 61278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 61364 62020 gene locus_tag LOCUS_04360 61364 62020 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 protein_id gnl|my_center|LOCUS_04360 62005 62817 gene locus_tag LOCUS_04370 62005 62817 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_04370 62948 63418 gene locus_tag LOCUS_04380 62948 63418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 63703 64287 gene locus_tag LOCUS_04390 63703 64287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 64353 65540 gene locus_tag LOCUS_04400 64353 65540 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_04400 65786 65861 gene locus_tag LOCUS_t00110 65786 65861 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65992 66666 gene locus_tag LOCUS_04410 65992 66666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 66666 67181 gene locus_tag LOCUS_04420 66666 67181 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870058.1 protein_id gnl|my_center|LOCUS_04420 67197 68243 gene locus_tag LOCUS_04430 gene queA 67197 68243 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583955.1 protein_id gnl|my_center|LOCUS_04430 68240 69391 gene locus_tag LOCUS_04440 gene tgt 68240 69391 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_04440 69427 69747 gene locus_tag LOCUS_04450 gene yajC 69427 69747 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_04450 69747 71921 gene locus_tag LOCUS_04460 gene secD 69747 71921 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391418.1 protein_id gnl|my_center|LOCUS_04460 71982 73628 gene locus_tag LOCUS_04470 71982 73628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 73860 73609 gene locus_tag LOCUS_04480 73860 73609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 73957 74256 gene locus_tag LOCUS_04490 73957 74256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 74282 75751 gene locus_tag LOCUS_04500 gene glgA 74282 75751 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_04500 75844 76917 gene locus_tag LOCUS_04510 75844 76917 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_04510 76910 77983 gene locus_tag LOCUS_04520 gene leuB 76910 77983 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_04520 78012 79019 gene locus_tag LOCUS_04530 78012 79019 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_04530 79001 79822 gene locus_tag LOCUS_04540 gene truA 79001 79822 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_04540 79916 80347 gene locus_tag LOCUS_04550 gene rplM 79916 80347 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_04550 80344 80739 gene locus_tag LOCUS_04560 gene rpsI 80344 80739 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_04560 80875 83397 gene locus_tag LOCUS_04570 80875 83397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 84038 83334 gene locus_tag LOCUS_04580 gene rnc 84038 83334 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008630.1 protein_id gnl|my_center|LOCUS_04580 84260 85288 gene locus_tag LOCUS_04590 gene argC 84260 85288 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_04590 85285 86505 gene locus_tag LOCUS_04600 gene argJ 85285 86505 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_04600 86509 87363 gene locus_tag LOCUS_04610 gene argB 86509 87363 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544977.1 protein_id gnl|my_center|LOCUS_04610 87432 88628 gene locus_tag LOCUS_04620 87432 88628 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04620 88625 89545 gene locus_tag LOCUS_04630 gene argF 88625 89545 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_04630 89589 90776 gene locus_tag LOCUS_04640 89589 90776 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584133.1 protein_id gnl|my_center|LOCUS_04640 90773 92173 gene locus_tag LOCUS_04650 gene argH 90773 92173 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_04650 92203 93471 gene locus_tag LOCUS_04660 gene lysA 92203 93471 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_04660 93594 95102 gene locus_tag LOCUS_04670 93594 95102 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_04670 95053 96225 gene locus_tag LOCUS_04680 95053 96225 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082424.1 protein_id gnl|my_center|LOCUS_04680 96361 96816 gene locus_tag LOCUS_04690 96361 96816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 96865 97230 gene locus_tag LOCUS_04700 96865 97230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 97383 97556 gene locus_tag LOCUS_04710 97383 97556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 97758 98564 gene locus_tag LOCUS_04720 gene dapF 97758 98564 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_04720 98620 99507 gene locus_tag LOCUS_04730 gene dapA 98620 99507 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_04730 99504 100307 gene locus_tag LOCUS_04740 gene dapB 99504 100307 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_04740 100363 101895 gene locus_tag LOCUS_04750 100363 101895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 101944 106563 gene locus_tag LOCUS_04760 101944 106563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 106640 107041 gene locus_tag LOCUS_04770 106640 107041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 107177 109969 gene locus_tag LOCUS_04780 gene uvrA 107177 109969 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296519.1 protein_id gnl|my_center|LOCUS_04780 110034 110438 gene locus_tag LOCUS_04790 110034 110438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 110674 112338 gene locus_tag LOCUS_04800 110674 112338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 112335 113693 gene locus_tag LOCUS_04810 112335 113693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 113695 114588 gene locus_tag LOCUS_04820 113695 114588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 114601 115242 gene locus_tag LOCUS_04830 gene grpE 114601 115242 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_04830 115246 116373 gene locus_tag LOCUS_04840 gene dnaJ 115246 116373 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_04840 116377 116802 gene locus_tag LOCUS_04850 116377 116802 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_04850 116990 118000 gene locus_tag LOCUS_04860 116990 118000 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_04860 118043 118315 gene locus_tag LOCUS_04870 118043 118315 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence05 2362 899 gene locus_tag LOCUS_04880 2362 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3478 2369 gene locus_tag LOCUS_04890 gene ugpC 3478 2369 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_04890 4355 3489 gene locus_tag LOCUS_04900 gene accD 4355 3489 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_04900 4526 5971 gene locus_tag LOCUS_04910 gene rpoN 4526 5971 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_04910 6146 7528 gene locus_tag LOCUS_04920 6146 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 7554 7976 gene locus_tag LOCUS_04930 7554 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 8134 8730 gene locus_tag LOCUS_04940 8134 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 8734 9993 gene locus_tag LOCUS_04950 8734 9993 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613583.1 protein_id gnl|my_center|LOCUS_04950 10146 10074 gene locus_tag LOCUS_t00120 10146 10074 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10948 10397 gene locus_tag LOCUS_04960 10948 10397 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_04960 11662 10949 gene locus_tag LOCUS_04970 11662 10949 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_04970 13016 11745 gene locus_tag LOCUS_04980 13016 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 13266 13577 gene locus_tag LOCUS_04990 13266 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 14446 13604 gene locus_tag LOCUS_05000 14446 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 15254 14505 gene locus_tag LOCUS_05010 15254 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 15595 15284 gene locus_tag LOCUS_05020 15595 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 16192 15623 gene locus_tag LOCUS_05030 gene efp 16192 15623 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_05030 46025 16401 gene locus_tag LOCUS_05040 46025 16401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 52556 52483 gene locus_tag LOCUS_t00130 52556 52483 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53634 52705 gene locus_tag LOCUS_05050 53634 52705 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_05050 54277 53624 gene locus_tag LOCUS_05060 gene thiE 54277 53624 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868208.1 protein_id gnl|my_center|LOCUS_05060 54671 54249 gene locus_tag LOCUS_05070 54671 54249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05070 55153 54674 gene locus_tag LOCUS_05080 55153 54674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 55818 55234 gene locus_tag LOCUS_05090 55818 55234 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939175.1 protein_id gnl|my_center|LOCUS_05090 56836 55811 gene locus_tag LOCUS_05100 56836 55811 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_05100 57492 56917 gene locus_tag LOCUS_05110 57492 56917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 58880 57489 gene locus_tag LOCUS_05120 gene accC 58880 57489 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_05120 59457 58987 gene locus_tag LOCUS_05130 gene accB 59457 58987 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 protein_id gnl|my_center|LOCUS_05130 60003 59554 gene locus_tag LOCUS_05140 gene aroQ 60003 59554 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_05140 60202 60035 gene locus_tag LOCUS_05150 60202 60035 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_05150 61179 60199 gene locus_tag LOCUS_05160 61179 60199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 61556 61176 gene locus_tag LOCUS_05170 61556 61176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 62648 61914 gene locus_tag LOCUS_05180 62648 61914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 63542 62784 gene locus_tag LOCUS_05190 63542 62784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 65079 63781 gene locus_tag LOCUS_05200 65079 63781 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_05200 67279 65213 gene locus_tag LOCUS_05210 gene pheT 67279 65213 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_05210 68253 67276 gene locus_tag LOCUS_05220 gene pheS 68253 67276 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_05220 68672 68301 gene locus_tag LOCUS_05230 gene rplT 68672 68301 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264177.1 protein_id gnl|my_center|LOCUS_05230 68947 68747 gene locus_tag LOCUS_05240 gene rpmI 68947 68747 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393258.1 protein_id gnl|my_center|LOCUS_05240 69601 69059 gene locus_tag LOCUS_05250 gene infC 69601 69059 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_05250 71362 69635 gene locus_tag LOCUS_05260 gene thrS 71362 69635 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_05260 71719 72177 gene locus_tag LOCUS_05270 71719 72177 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_05270 72323 73030 gene locus_tag LOCUS_05280 72323 73030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 73098 73174 gene locus_tag LOCUS_t00140 73098 73174 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 73906 73280 gene locus_tag LOCUS_05290 73906 73280 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_05290 74625 73903 gene locus_tag LOCUS_05300 gene rph 74625 73903 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_05300 75418 74636 gene locus_tag LOCUS_05310 75418 74636 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_05310 76019 75327 gene locus_tag LOCUS_05320 gene queC 76019 75327 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057569.1 protein_id gnl|my_center|LOCUS_05320 76765 76016 gene locus_tag LOCUS_05330 gene murI 76765 76016 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_05330 78039 76849 gene locus_tag LOCUS_05340 78039 76849 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877916.1 protein_id gnl|my_center|LOCUS_05340 78381 78109 gene locus_tag LOCUS_05350 78381 78109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 79305 78433 gene locus_tag LOCUS_05360 gene lipA 79305 78433 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_05360 80143 79478 gene locus_tag LOCUS_05370 80143 79478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 81661 80165 gene locus_tag LOCUS_05380 gene miaB 81661 80165 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_05380 83516 81876 gene locus_tag LOCUS_05390 83516 81876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 84751 83864 gene locus_tag LOCUS_05400 84751 83864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 86899 84887 gene locus_tag LOCUS_05410 86899 84887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 88309 87092 gene locus_tag LOCUS_05420 88309 87092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 89062 88349 gene locus_tag LOCUS_05430 89062 88349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 89921 89112 gene locus_tag LOCUS_05440 gene arsM 89921 89112 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_05440 90472 89933 gene locus_tag LOCUS_05450 90472 89933 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787811.1 protein_id gnl|my_center|LOCUS_05450 90789 90556 gene locus_tag LOCUS_05460 90789 90556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 91310 90882 gene locus_tag LOCUS_05470 91310 90882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 92459 91680 gene locus_tag LOCUS_05480 92459 91680 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_05480 92914 92519 gene locus_tag LOCUS_05490 92914 92519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 94200 92914 gene locus_tag LOCUS_05500 94200 92914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 97089 94351 gene locus_tag LOCUS_05510 97089 94351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 97561 97196 gene locus_tag LOCUS_05520 97561 97196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 98619 97669 gene locus_tag LOCUS_05530 gene nadA 98619 97669 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_05530 98921 99373 gene locus_tag LOCUS_05540 98921 99373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 101053 99377 gene locus_tag LOCUS_05550 101053 99377 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237994.1 protein_id gnl|my_center|LOCUS_05550 101541 101119 gene locus_tag LOCUS_05560 101541 101119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 102660 101647 gene locus_tag LOCUS_05570 102660 101647 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338207.1 protein_id gnl|my_center|LOCUS_05570 102926 102774 gene locus_tag LOCUS_05580 102926 102774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 103139 104083 gene locus_tag LOCUS_05590 103139 104083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_05590 104877 104107 gene locus_tag LOCUS_05600 104877 104107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 105983 105105 gene locus_tag LOCUS_05610 105983 105105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 107079 105994 gene locus_tag LOCUS_05620 107079 105994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 107830 107570 gene locus_tag LOCUS_05630 107830 107570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 <109455 108347 gene locus_tag LOCUS_05640 <109455 108347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit >Feature sequence06 2799 1477 gene locus_tag LOCUS_05650 2799 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2989 3357 gene locus_tag LOCUS_05660 2989 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3410 3736 gene locus_tag LOCUS_05670 3410 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3640 4623 gene locus_tag LOCUS_05680 3640 4623 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946112.1 protein_id gnl|my_center|LOCUS_05680 4789 6933 gene locus_tag LOCUS_05690 4789 6933 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_05690 7093 7710 gene locus_tag LOCUS_05700 7093 7710 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722329.1 protein_id gnl|my_center|LOCUS_05700 7735 8106 gene locus_tag LOCUS_05710 gene hypA 7735 8106 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939567.1 protein_id gnl|my_center|LOCUS_05710 8096 8779 gene locus_tag LOCUS_05720 gene hypB 8096 8779 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939602.1 protein_id gnl|my_center|LOCUS_05720 8976 10787 gene locus_tag LOCUS_05730 gene nuoF 8976 10787 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_05730 10812 11534 gene locus_tag LOCUS_05740 gene hoxU 10812 11534 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_05740 11553 12098 gene locus_tag LOCUS_05750 11553 12098 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_05750 12120 13562 gene locus_tag LOCUS_05760 12120 13562 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_05760 13559 14029 gene locus_tag LOCUS_05770 13559 14029 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582503.1 protein_id gnl|my_center|LOCUS_05770 14068 14442 gene locus_tag LOCUS_05780 14068 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14620 15261 gene locus_tag LOCUS_05790 14620 15261 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_05790 15261 17102 gene locus_tag LOCUS_05800 15261 17102 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_05800 17139 17648 gene locus_tag LOCUS_05810 17139 17648 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_05810 17645 18001 gene locus_tag LOCUS_05820 17645 18001 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_05820 18021 19763 gene locus_tag LOCUS_05830 gene nuoF 18021 19763 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_05830 19810 21555 gene locus_tag LOCUS_05840 19810 21555 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_05840 21689 21943 gene locus_tag LOCUS_05850 21689 21943 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_05850 21979 23247 gene locus_tag LOCUS_05860 gene hydF 21979 23247 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_05860 23241 24734 gene locus_tag LOCUS_05870 gene hydG 23241 24734 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546878.1 protein_id gnl|my_center|LOCUS_05870 24760 25764 gene locus_tag LOCUS_05880 gene hydE 24760 25764 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428999.1 protein_id gnl|my_center|LOCUS_05880 25813 28164 gene locus_tag LOCUS_05890 gene hypF 25813 28164 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_05890 28166 28435 gene locus_tag LOCUS_05900 28166 28435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 28428 32042 gene locus_tag LOCUS_05910 gene nifJ 28428 32042 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_05910 32080 33096 gene locus_tag LOCUS_05920 32080 33096 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_05920 33190 34281 gene locus_tag LOCUS_05930 gene hypD 33190 34281 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_05930 34406 35458 gene locus_tag LOCUS_05940 gene hypE 34406 35458 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_05940 35778 36842 gene locus_tag LOCUS_05950 35778 36842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 36907 37857 gene locus_tag LOCUS_05960 36907 37857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 37854 38750 gene locus_tag LOCUS_05970 37854 38750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 38747 39274 gene locus_tag LOCUS_05980 38747 39274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 39410 39604 gene locus_tag LOCUS_05990 39410 39604 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_05990 39674 41023 gene locus_tag LOCUS_06000 39674 41023 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_06000 41039 42067 gene locus_tag LOCUS_06010 gene cydB 41039 42067 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_06010 42067 42231 gene locus_tag LOCUS_06020 42067 42231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 42252 43994 gene locus_tag LOCUS_06030 42252 43994 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_06030 44289 50285 gene locus_tag LOCUS_06040 44289 50285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 51478 51816 gene locus_tag LOCUS_06050 51478 51816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 51995 52129 gene locus_tag LOCUS_06060 51995 52129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 52142 54004 gene locus_tag LOCUS_06070 52142 54004 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_06070 54209 54796 gene locus_tag LOCUS_06080 54209 54796 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310196.1 protein_id gnl|my_center|LOCUS_06080 54850 55311 gene locus_tag LOCUS_06090 54850 55311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 55379 55606 gene locus_tag LOCUS_06100 55379 55606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 55870 56793 gene locus_tag LOCUS_06110 gene trpS 55870 56793 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_06110 56676 57605 gene locus_tag LOCUS_06120 56676 57605 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_06120 57612 58508 gene locus_tag LOCUS_06130 57612 58508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 58474 59547 gene locus_tag LOCUS_06140 gene pheA 58474 59547 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_06140 59561 60679 gene locus_tag LOCUS_06150 gene hisC 59561 60679 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_06150 60686 61702 gene locus_tag LOCUS_06160 gene aroF 60686 61702 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_06160 61722 62564 gene locus_tag LOCUS_06170 61722 62564 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_06170 62712 64283 gene locus_tag LOCUS_06180 gene rpsA 62712 64283 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_06180 64290 65543 gene locus_tag LOCUS_06190 gene fabF 64290 65543 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583310.1 protein_id gnl|my_center|LOCUS_06190 66422 65577 gene locus_tag LOCUS_06200 gene lpxA 66422 65577 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_06200 66562 67785 gene locus_tag LOCUS_06210 gene tyrS 66562 67785 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_06210 67775 68782 gene locus_tag LOCUS_06220 67775 68782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_06220 68779 69555 gene locus_tag LOCUS_06230 68779 69555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 69571 70959 gene locus_tag LOCUS_06240 69571 70959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 70956 71984 gene locus_tag LOCUS_06250 70956 71984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 72007 72705 gene locus_tag LOCUS_06260 72007 72705 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_06260 72792 73556 gene locus_tag LOCUS_06270 gene proC 72792 73556 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769432.1 protein_id gnl|my_center|LOCUS_06270 73570 73872 gene locus_tag LOCUS_06280 73570 73872 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_06280 73887 74735 gene locus_tag LOCUS_06290 73887 74735 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_06290 74768 77602 gene locus_tag LOCUS_06300 gene ileS 74768 77602 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546193.1 protein_id gnl|my_center|LOCUS_06300 77621 79195 gene locus_tag LOCUS_06310 77621 79195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 79255 79626 gene locus_tag LOCUS_06320 79255 79626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 79643 80947 gene locus_tag LOCUS_06330 79643 80947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 81090 81482 gene locus_tag LOCUS_06340 81090 81482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 81503 81931 gene locus_tag LOCUS_06350 gene lspA 81503 81931 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_06350 81945 82889 gene locus_tag LOCUS_06360 81945 82889 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_06360 83044 84501 gene locus_tag LOCUS_06370 83044 84501 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_06370 84485 85354 gene locus_tag LOCUS_06380 gene ubiA 84485 85354 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_06380 85367 85996 gene locus_tag LOCUS_06390 85367 85996 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545244.1 protein_id gnl|my_center|LOCUS_06390 85993 86859 gene locus_tag LOCUS_06400 85993 86859 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_06400 86910 88001 gene locus_tag LOCUS_06410 gene mqnC 86910 88001 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_06410 87994 88701 gene locus_tag LOCUS_06420 gene ubiE 87994 88701 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545681.1 protein_id gnl|my_center|LOCUS_06420 88691 89152 gene locus_tag LOCUS_06430 88691 89152 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_06430 89156 90034 gene locus_tag LOCUS_06440 89156 90034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 90060 91118 gene locus_tag LOCUS_06450 90060 91118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 91307 92629 gene locus_tag LOCUS_06460 91307 92629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 93119 93661 gene locus_tag LOCUS_06470 93119 93661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 93668 94042 gene locus_tag LOCUS_06480 93668 94042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 94118 94399 gene locus_tag LOCUS_06490 94118 94399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 94604 96070 gene locus_tag LOCUS_06500 94604 96070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 97419 96085 gene locus_tag LOCUS_06510 97419 96085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 97759 99699 gene locus_tag LOCUS_06520 97759 99699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence07 162 386 gene locus_tag LOCUS_06530 162 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 657 1046 gene locus_tag LOCUS_06540 gene crcB 657 1046 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_06540 1060 1419 gene locus_tag LOCUS_06550 1060 1419 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_06550 1473 2171 gene locus_tag LOCUS_06560 1473 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2358 3209 gene locus_tag LOCUS_06570 2358 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3316 4266 gene locus_tag LOCUS_06580 3316 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 4733 4338 gene locus_tag LOCUS_06590 4733 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4841 5314 gene locus_tag LOCUS_06600 4841 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5325 5678 gene locus_tag LOCUS_06610 5325 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 6208 6516 gene locus_tag LOCUS_06620 6208 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6726 8528 gene locus_tag LOCUS_06630 6726 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9098 8475 gene locus_tag LOCUS_06640 9098 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9439 10683 gene locus_tag LOCUS_06650 9439 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 10755 12044 gene locus_tag LOCUS_06660 10755 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 12403 13062 gene locus_tag LOCUS_06670 12403 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 13254 14048 gene locus_tag LOCUS_06680 13254 14048 CDS product putative capsular polysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478215.1 protein_id gnl|my_center|LOCUS_06680 14088 14987 gene locus_tag LOCUS_06690 14088 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 15796 14984 gene locus_tag LOCUS_06700 15796 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 15944 16984 gene locus_tag LOCUS_06710 15944 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17083 18195 gene locus_tag LOCUS_06720 17083 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 18192 18548 gene locus_tag LOCUS_06730 18192 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 18729 21002 gene locus_tag LOCUS_06740 gene glgB 18729 21002 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_06740 21030 23078 gene locus_tag LOCUS_06750 21030 23078 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_06750 23087 24895 gene locus_tag LOCUS_06760 23087 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06760 24906 26456 gene locus_tag LOCUS_06770 24906 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06770 26791 27033 gene locus_tag LOCUS_06780 26791 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 27393 27569 gene locus_tag LOCUS_06790 27393 27569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 27689 27880 gene locus_tag LOCUS_06800 27689 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 28040 28339 gene locus_tag LOCUS_06810 28040 28339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 28445 28963 gene locus_tag LOCUS_06820 28445 28963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 29070 29261 gene locus_tag LOCUS_06830 29070 29261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 29334 30017 gene locus_tag LOCUS_06840 29334 30017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 30054 31367 gene locus_tag LOCUS_06850 30054 31367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 31481 31651 gene locus_tag LOCUS_06860 31481 31651 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392923.1 protein_id gnl|my_center|LOCUS_06860 31848 33287 gene locus_tag LOCUS_06870 31848 33287 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_06870 33262 34326 gene locus_tag LOCUS_06880 33262 34326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 34554 35369 gene locus_tag LOCUS_06890 34554 35369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 35622 37115 gene locus_tag LOCUS_06900 35622 37115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 37131 38285 gene locus_tag LOCUS_06910 37131 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 38410 40173 gene locus_tag LOCUS_06920 38410 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 40961 40236 gene locus_tag LOCUS_06930 gene fetB 40961 40236 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_06930 41093 41836 gene locus_tag LOCUS_06940 41093 41836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 41887 43305 gene locus_tag LOCUS_06950 41887 43305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 43320 44510 gene locus_tag LOCUS_06960 43320 44510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 44561 45616 gene locus_tag LOCUS_06970 44561 45616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 45613 46650 gene locus_tag LOCUS_06980 45613 46650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 46655 48154 gene locus_tag LOCUS_06990 gene hemG 46655 48154 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_06990 48208 50307 gene locus_tag LOCUS_07000 48208 50307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 50276 51244 gene locus_tag LOCUS_07010 50276 51244 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_07010 51285 52397 gene locus_tag LOCUS_07020 51285 52397 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_07020 52421 53035 gene locus_tag LOCUS_07030 52421 53035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 53051 53911 gene locus_tag LOCUS_07040 53051 53911 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_07040 55494 53935 gene locus_tag LOCUS_07050 55494 53935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 55519 55752 gene locus_tag LOCUS_07060 55519 55752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 56937 56416 gene locus_tag LOCUS_07070 56937 56416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 57301 59283 gene locus_tag LOCUS_07080 57301 59283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 59291 61054 gene locus_tag LOCUS_07090 59291 61054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 62176 61058 gene locus_tag LOCUS_07100 62176 61058 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705134.1 protein_id gnl|my_center|LOCUS_07100 62931 62173 gene locus_tag LOCUS_07110 62931 62173 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_07110 63403 62933 gene locus_tag LOCUS_07120 63403 62933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 63515 63646 gene locus_tag LOCUS_07130 63515 63646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 63776 63991 gene locus_tag LOCUS_07140 63776 63991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 64079 64219 gene locus_tag LOCUS_07150 64079 64219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 64695 64865 gene locus_tag LOCUS_07160 64695 64865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 66062 65007 gene locus_tag LOCUS_07170 66062 65007 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262583.1 protein_id gnl|my_center|LOCUS_07170 66575 66742 gene locus_tag LOCUS_07180 66575 66742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 67111 67914 gene locus_tag LOCUS_07190 gene cpaB 67111 67914 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_07190 67931 69793 gene locus_tag LOCUS_07200 67931 69793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 69816 71111 gene locus_tag LOCUS_07210 69816 71111 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_07210 71098 72420 gene locus_tag LOCUS_07220 71098 72420 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_07220 72460 73419 gene locus_tag LOCUS_07230 72460 73419 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_07230 73459 74295 gene locus_tag LOCUS_07240 73459 74295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 74327 74677 gene locus_tag LOCUS_07250 74327 74677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 74819 75196 gene locus_tag LOCUS_07260 74819 75196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 75240 77798 gene locus_tag LOCUS_07270 75240 77798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 79037 78024 gene locus_tag LOCUS_07280 gene rfaD 79037 78024 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_07280 79171 79413 gene locus_tag LOCUS_07290 79171 79413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 79858 79406 gene locus_tag LOCUS_07300 gene folK 79858 79406 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_07300 80211 79855 gene locus_tag LOCUS_07310 gene folB 80211 79855 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_07310 80344 81453 gene locus_tag LOCUS_07320 gene rlmD 80344 81453 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_07320 81505 82122 gene locus_tag LOCUS_07330 gene trmB 81505 82122 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_07330 82119 82868 gene locus_tag LOCUS_07340 82119 82868 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583818.1 protein_id gnl|my_center|LOCUS_07340 82974 83432 gene locus_tag LOCUS_07350 82974 83432 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_07350 83432 84970 gene locus_tag LOCUS_07360 83432 84970 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_07360 84970 88140 gene locus_tag LOCUS_07370 84970 88140 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_07370 88137 89246 gene locus_tag LOCUS_07380 88137 89246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 89661 89161 gene locus_tag LOCUS_07390 89661 89161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 89614 89829 gene locus_tag LOCUS_07400 89614 89829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 90290 89985 gene locus_tag LOCUS_07410 90290 89985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 90640 90969 gene locus_tag LOCUS_07420 90640 90969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 90966 92666 gene locus_tag LOCUS_07430 90966 92666 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_07430 92668 93501 gene locus_tag LOCUS_07440 92668 93501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 93498 94205 gene locus_tag LOCUS_07450 93498 94205 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_07450 94329 94682 gene locus_tag LOCUS_07460 94329 94682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 94851 95645 gene locus_tag LOCUS_07470 94851 95645 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_07470 95657 96265 gene locus_tag LOCUS_07480 95657 96265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 96290 97372 gene locus_tag LOCUS_07490 gene lptF 96290 97372 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_07490 98442 97408 gene locus_tag LOCUS_07500 98442 97408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 98563 98333 gene locus_tag LOCUS_07510 98563 98333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 98570 98647 gene locus_tag LOCUS_t00150 98570 98647 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 98933 99772 gene locus_tag LOCUS_07520 98933 99772 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence08 987 184 gene locus_tag LOCUS_07530 987 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1495 1127 gene locus_tag LOCUS_07540 1495 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 2497 1583 gene locus_tag LOCUS_07550 2497 1583 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_07550 6088 2810 gene locus_tag LOCUS_07560 6088 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7515 6085 gene locus_tag LOCUS_07570 7515 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 11122 7541 gene locus_tag LOCUS_07580 11122 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12630 11119 gene locus_tag LOCUS_07590 12630 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 13895 12627 gene locus_tag LOCUS_07600 13895 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14765 13917 gene locus_tag LOCUS_07610 14765 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 17166 14782 gene locus_tag LOCUS_07620 17166 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18131 17163 gene locus_tag LOCUS_07630 18131 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 19120 18128 gene locus_tag LOCUS_07640 19120 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 20730 19201 gene locus_tag LOCUS_07650 gene wzxC 20730 19201 CDS product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058696.1 protein_id gnl|my_center|LOCUS_07650 21914 20883 gene locus_tag LOCUS_07660 21914 20883 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_07660 22763 21951 gene locus_tag LOCUS_07670 22763 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 23228 22770 gene locus_tag LOCUS_07680 23228 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 24593 23607 gene locus_tag LOCUS_07690 24593 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 24839 24648 gene locus_tag LOCUS_07700 24839 24648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 25108 24743 gene locus_tag LOCUS_07710 25108 24743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 26022 25204 gene locus_tag LOCUS_07720 26022 25204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 27226 26012 gene locus_tag LOCUS_07730 27226 26012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 27938 27501 gene locus_tag LOCUS_07740 27938 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 29160 28156 gene locus_tag LOCUS_07750 29160 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 29378 29190 gene locus_tag LOCUS_07760 29378 29190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 30708 31283 gene locus_tag LOCUS_07770 30708 31283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 32429 31365 gene locus_tag LOCUS_07780 32429 31365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 33813 32788 gene locus_tag LOCUS_07790 gene gap 33813 32788 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_07790 34068 34259 gene locus_tag LOCUS_07800 34068 34259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 35370 34264 gene locus_tag LOCUS_07810 35370 34264 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_07810 36251 35367 gene locus_tag LOCUS_07820 gene fmt 36251 35367 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_07820 36959 36447 gene locus_tag LOCUS_07830 gene def 36959 36447 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709217.1 protein_id gnl|my_center|LOCUS_07830 39080 37014 gene locus_tag LOCUS_07840 39080 37014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 39281 39099 gene locus_tag LOCUS_07850 39281 39099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 40081 39338 gene locus_tag LOCUS_07860 40081 39338 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_07860 41199 40078 gene locus_tag LOCUS_07870 41199 40078 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256548.1 protein_id gnl|my_center|LOCUS_07870 41750 41202 gene locus_tag LOCUS_07880 41750 41202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 42907 41774 gene locus_tag LOCUS_07890 42907 41774 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_07890 43675 42908 gene locus_tag LOCUS_07900 43675 42908 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_07900 45234 43831 gene locus_tag LOCUS_07910 45234 43831 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_07910 46321 45221 gene locus_tag LOCUS_07920 46321 45221 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_07920 47616 46501 gene locus_tag LOCUS_07930 47616 46501 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_07930 48941 47622 gene locus_tag LOCUS_07940 gene waaF 48941 47622 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706351.1 protein_id gnl|my_center|LOCUS_07940 49147 48989 gene locus_tag LOCUS_07950 49147 48989 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_07950 49578 49162 gene locus_tag LOCUS_07960 49578 49162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 51408 49591 gene locus_tag LOCUS_07970 51408 49591 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_07970 52877 51633 gene locus_tag LOCUS_07980 52877 51633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 53632 52883 gene locus_tag LOCUS_07990 53632 52883 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 protein_id gnl|my_center|LOCUS_07990 54504 53629 gene locus_tag LOCUS_08000 54504 53629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 54677 55465 gene locus_tag LOCUS_08010 54677 55465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 57197 55509 gene locus_tag LOCUS_08020 57197 55509 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230373.1 protein_id gnl|my_center|LOCUS_08020 58012 57194 gene locus_tag LOCUS_08030 58012 57194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 58919 58224 gene locus_tag LOCUS_08040 58919 58224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 60008 58923 gene locus_tag LOCUS_08050 60008 58923 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_08050 61510 60005 gene locus_tag LOCUS_08060 61510 60005 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_08060 62205 61549 gene locus_tag LOCUS_08070 62205 61549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 62916 62224 gene locus_tag LOCUS_08080 62916 62224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 64022 62964 gene locus_tag LOCUS_08090 gene pseI 64022 62964 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 protein_id gnl|my_center|LOCUS_08090 64946 64056 gene locus_tag LOCUS_08100 64946 64056 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_08100 65927 64983 gene locus_tag LOCUS_08110 65927 64983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 66654 65932 gene locus_tag LOCUS_08120 66654 65932 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920698.1 protein_id gnl|my_center|LOCUS_08120 67721 66672 gene locus_tag LOCUS_08130 gene pseG 67721 66672 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_08130 68476 67715 gene locus_tag LOCUS_08140 68476 67715 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_08140 69583 68516 gene locus_tag LOCUS_08150 69583 68516 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940262.1 protein_id gnl|my_center|LOCUS_08150 71342 69618 gene locus_tag LOCUS_08160 71342 69618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 72384 71452 gene locus_tag LOCUS_08170 72384 71452 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_08170 73708 72392 gene locus_tag LOCUS_08180 73708 72392 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_08180 74656 73853 gene locus_tag LOCUS_08190 74656 73853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 76676 75480 gene locus_tag LOCUS_08200 gene pseC 76676 75480 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_08200 77685 76633 gene locus_tag LOCUS_08210 gene pseB 77685 76633 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_08210 77944 77672 gene locus_tag LOCUS_08220 77944 77672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 79947 78094 gene locus_tag LOCUS_08230 79947 78094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 81254 79944 gene locus_tag LOCUS_08240 81254 79944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 82756 81749 gene locus_tag LOCUS_08250 82756 81749 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937492.1 protein_id gnl|my_center|LOCUS_08250 <83976 82964 gene locus_tag LOCUS_08260 <83976 82964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061496.1:ATP-grasp domain-containing protein >Feature sequence09 429 776 gene locus_tag LOCUS_08270 429 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1778 876 gene locus_tag LOCUS_08280 1778 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3040 1862 gene locus_tag LOCUS_08290 3040 1862 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_08290 3893 3060 gene locus_tag LOCUS_08300 3893 3060 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_08300 4982 3894 gene locus_tag LOCUS_08310 4982 3894 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_08310 6355 4982 gene locus_tag LOCUS_08320 6355 4982 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_08320 6516 6432 gene locus_tag LOCUS_t00160 6516 6432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6877 6530 gene locus_tag LOCUS_08330 6877 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7093 7022 gene locus_tag LOCUS_t00170 7093 7022 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7948 7337 gene locus_tag LOCUS_08340 7948 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8297 7956 gene locus_tag LOCUS_08350 8297 7956 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_08350 9668 8364 gene locus_tag LOCUS_08360 gene gltX 9668 8364 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082426.1 protein_id gnl|my_center|LOCUS_08360 10093 9725 gene locus_tag LOCUS_08370 10093 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 10962 10129 gene locus_tag LOCUS_08380 10962 10129 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_08380 12885 10966 gene locus_tag LOCUS_08390 gene dxs 12885 10966 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_08390 13711 12869 gene locus_tag LOCUS_08400 13711 12869 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_08400 14040 13708 gene locus_tag LOCUS_08410 14040 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15283 14033 gene locus_tag LOCUS_08420 gene xseA 15283 14033 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_08420 16081 15290 gene locus_tag LOCUS_08430 16081 15290 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_08430 16501 16094 gene locus_tag LOCUS_08440 16501 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 18302 16791 gene locus_tag LOCUS_08450 18302 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 22366 18521 gene locus_tag LOCUS_08460 22366 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 25398 22777 gene locus_tag LOCUS_08470 25398 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 25636 25710 gene locus_tag LOCUS_t00180 25636 25710 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26337 25807 gene locus_tag LOCUS_08480 26337 25807 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_08480 27560 26334 gene locus_tag LOCUS_08490 27560 26334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 30258 27577 gene locus_tag LOCUS_08500 gene ppdK 30258 27577 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_08500 32524 30410 gene locus_tag LOCUS_08510 gene glyS 32524 30410 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_08510 33428 32535 gene locus_tag LOCUS_08520 gene glyQ 33428 32535 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460838.1 protein_id gnl|my_center|LOCUS_08520 33900 33568 gene locus_tag LOCUS_08530 33900 33568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 34088 34645 gene locus_tag LOCUS_08540 34088 34645 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 protein_id gnl|my_center|LOCUS_08540 36822 34642 gene locus_tag LOCUS_08550 36822 34642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 37003 36803 gene locus_tag LOCUS_08560 37003 36803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 37200 37024 gene locus_tag LOCUS_08570 37200 37024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 38290 37514 gene locus_tag LOCUS_08580 38290 37514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948946.1 protein_id gnl|my_center|LOCUS_08580 39240 38290 gene locus_tag LOCUS_08590 39240 38290 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_08590 40193 39324 gene locus_tag LOCUS_08600 40193 39324 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545710.1 protein_id gnl|my_center|LOCUS_08600 42490 40220 gene locus_tag LOCUS_08610 42490 40220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 42914 43147 gene locus_tag LOCUS_08620 42914 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 43776 43201 gene locus_tag LOCUS_08630 43776 43201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 44582 43773 gene locus_tag LOCUS_08640 44582 43773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 46710 44671 gene locus_tag LOCUS_08650 46710 44671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 49178 46710 gene locus_tag LOCUS_08660 gene leuS 49178 46710 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_08660 49317 49232 gene locus_tag LOCUS_t00190 49317 49232 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49416 49342 gene locus_tag LOCUS_t00200 49416 49342 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 49996 49673 gene locus_tag LOCUS_08670 49996 49673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 51281 50496 gene locus_tag LOCUS_08680 gene surE 51281 50496 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933221.1 protein_id gnl|my_center|LOCUS_08680 51775 51392 gene locus_tag LOCUS_08690 gene acpS 51775 51392 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880494.1 protein_id gnl|my_center|LOCUS_08690 52080 51790 gene locus_tag LOCUS_08700 52080 51790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 52735 52199 gene locus_tag LOCUS_08710 52735 52199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 52911 54383 gene locus_tag LOCUS_08720 52911 54383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 54380 55123 gene locus_tag LOCUS_08730 54380 55123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_08730 55130 56785 gene locus_tag LOCUS_08740 55130 56785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 56933 57205 gene locus_tag LOCUS_08750 56933 57205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 57218 57496 gene locus_tag LOCUS_08760 57218 57496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 59345 57522 gene locus_tag LOCUS_08770 59345 57522 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 protein_id gnl|my_center|LOCUS_08770 59421 60143 gene locus_tag LOCUS_08780 59421 60143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 60622 60437 gene locus_tag LOCUS_08790 60622 60437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 60985 60758 gene locus_tag LOCUS_08800 60985 60758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 61209 62450 gene locus_tag LOCUS_08810 61209 62450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 63909 62509 gene locus_tag LOCUS_08820 63909 62509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 64368 63973 gene locus_tag LOCUS_08830 gene nikR 64368 63973 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932159.1 protein_id gnl|my_center|LOCUS_08830 65348 64431 gene locus_tag LOCUS_08840 65348 64431 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_08840 66078 65554 gene locus_tag LOCUS_08850 gene msrB 66078 65554 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792822.1 protein_id gnl|my_center|LOCUS_08850 67049 66168 gene locus_tag LOCUS_08860 67049 66168 CDS product DUF1016 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817677.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence10 613 356 gene locus_tag LOCUS_08870 613 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1753 650 gene locus_tag LOCUS_08880 gene dnaN 1753 650 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_08880 3147 1891 gene locus_tag LOCUS_08890 gene dnaA 3147 1891 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_08890 3842 4078 gene locus_tag LOCUS_08900 3842 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4082 5755 gene locus_tag LOCUS_08910 gene yidC 4082 5755 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_08910 5809 7617 gene locus_tag LOCUS_08920 gene mnmG 5809 7617 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_08920 7836 8882 gene locus_tag LOCUS_08930 7836 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8879 9796 gene locus_tag LOCUS_08940 8879 9796 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_08940 10003 11283 gene locus_tag LOCUS_08950 10003 11283 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_08950 11306 13750 gene locus_tag LOCUS_08960 11306 13750 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_08960 13908 15845 gene locus_tag LOCUS_08970 13908 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 15972 17195 gene locus_tag LOCUS_08980 15972 17195 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_08980 17182 17913 gene locus_tag LOCUS_08990 gene tatC 17182 17913 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_08990 18101 18682 gene locus_tag LOCUS_09000 18101 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 18702 19571 gene locus_tag LOCUS_09010 18702 19571 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_09010 19608 20801 gene locus_tag LOCUS_09020 gene sat 19608 20801 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_09020 20812 21768 gene locus_tag LOCUS_09030 gene cysK 20812 21768 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_09030 21791 22843 gene locus_tag LOCUS_09040 gene bioB 21791 22843 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895370.1 protein_id gnl|my_center|LOCUS_09040 22840 23568 gene locus_tag LOCUS_09050 gene fabG 22840 23568 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_09050 23565 24770 gene locus_tag LOCUS_09060 gene fabF 23565 24770 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_09060 24767 25921 gene locus_tag LOCUS_09070 24767 25921 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_09070 26018 26770 gene locus_tag LOCUS_09080 26018 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 26848 27624 gene locus_tag LOCUS_09090 26848 27624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 27678 28073 gene locus_tag LOCUS_09100 27678 28073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 28108 29505 gene locus_tag LOCUS_09110 gene bioA 28108 29505 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144314.1 protein_id gnl|my_center|LOCUS_09110 29516 30247 gene locus_tag LOCUS_09120 gene bioD 29516 30247 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545503.1 protein_id gnl|my_center|LOCUS_09120 30304 31407 gene locus_tag LOCUS_09130 gene mnmA 30304 31407 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_09130 31398 32795 gene locus_tag LOCUS_09140 gene rsxC 31398 32795 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_09140 32828 33754 gene locus_tag LOCUS_09150 32828 33754 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_09150 33893 34444 gene locus_tag LOCUS_09160 33893 34444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 34441 34977 gene locus_tag LOCUS_09170 34441 34977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 34974 35495 gene locus_tag LOCUS_09180 34974 35495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 35575 36648 gene locus_tag LOCUS_09190 35575 36648 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_09190 36922 39600 gene locus_tag LOCUS_09200 gene polA 36922 39600 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_09200 39585 40208 gene locus_tag LOCUS_09210 gene coaE 39585 40208 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_09210 40213 41664 gene locus_tag LOCUS_09220 gene rho 40213 41664 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_09220 41696 41998 gene locus_tag LOCUS_09230 41696 41998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 42013 43092 gene locus_tag LOCUS_09240 gene prfA 42013 43092 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_09240 43089 44015 gene locus_tag LOCUS_09250 gene prmC 43089 44015 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_09250 44022 45287 gene locus_tag LOCUS_09260 gene murA 44022 45287 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_09260 45346 45609 gene locus_tag LOCUS_09270 gene rpsP 45346 45609 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_09270 45625 46317 gene locus_tag LOCUS_09280 gene trmD 45625 46317 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_09280 46353 46667 gene locus_tag LOCUS_09290 gene rplS 46353 46667 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081989.1 protein_id gnl|my_center|LOCUS_09290 46687 47334 gene locus_tag LOCUS_09300 46687 47334 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 protein_id gnl|my_center|LOCUS_09300 47376 47714 gene locus_tag LOCUS_09310 47376 47714 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_09310 47715 50126 gene locus_tag LOCUS_09320 47715 50126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 50262 51596 gene locus_tag LOCUS_09330 50262 51596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 51571 53211 gene locus_tag LOCUS_09340 51571 53211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 53399 54445 gene locus_tag LOCUS_09350 53399 54445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 54641 55108 gene locus_tag LOCUS_09360 54641 55108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 55216 55584 gene locus_tag LOCUS_09370 55216 55584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 55980 55648 gene locus_tag LOCUS_09380 55980 55648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 57007 56057 gene locus_tag LOCUS_09390 57007 56057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 57386 57604 gene locus_tag LOCUS_09400 57386 57604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 57617 59125 gene locus_tag LOCUS_09410 57617 59125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 60675 59146 gene locus_tag LOCUS_09420 60675 59146 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_09420 60827 61288 gene locus_tag LOCUS_09430 60827 61288 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_09430 61353 62069 gene locus_tag LOCUS_09440 61353 62069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 62059 63117 gene locus_tag LOCUS_09450 62059 63117 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_09450 63309 63103 gene locus_tag LOCUS_09460 63309 63103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 63589 64230 gene locus_tag LOCUS_09470 63589 64230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 64237 64479 gene locus_tag LOCUS_09480 64237 64479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 64516 65295 gene locus_tag LOCUS_09490 gene whiG 64516 65295 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_09490 65403 65660 gene locus_tag LOCUS_09500 65403 65660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 65813 67663 gene locus_tag LOCUS_09510 gene glmS 65813 67663 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880146.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence11 1755 745 gene locus_tag LOCUS_09520 gene purM 1755 745 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_09520 3218 1806 gene locus_tag LOCUS_09530 gene purF 3218 1806 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_09530 5486 3249 gene locus_tag LOCUS_09540 gene purL 5486 3249 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_09540 6190 5498 gene locus_tag LOCUS_09550 gene purQ 6190 5498 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 protein_id gnl|my_center|LOCUS_09550 6438 6187 gene locus_tag LOCUS_09560 gene purS 6438 6187 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_09560 7427 6507 gene locus_tag LOCUS_09570 7427 6507 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_09570 8744 7443 gene locus_tag LOCUS_09580 gene purB 8744 7443 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_09580 8860 8783 gene locus_tag LOCUS_t00210 8860 8783 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9372 9028 gene locus_tag LOCUS_09590 9372 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 10392 9475 gene locus_tag LOCUS_09600 gene xerD 10392 9475 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_09600 10999 10337 gene locus_tag LOCUS_09610 10999 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 13025 10989 gene locus_tag LOCUS_09620 gene ligA 13025 10989 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_09620 13392 13045 gene locus_tag LOCUS_09630 13392 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 13947 13414 gene locus_tag LOCUS_09640 13947 13414 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_09640 14493 14053 gene locus_tag LOCUS_09650 14493 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 15037 14961 gene locus_tag LOCUS_t00220 15037 14961 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16478 15111 gene locus_tag LOCUS_09660 16478 15111 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 protein_id gnl|my_center|LOCUS_09660 16585 17559 gene locus_tag LOCUS_09670 gene gshB 16585 17559 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143671.1 protein_id gnl|my_center|LOCUS_09670 19267 17483 gene locus_tag LOCUS_09680 19267 17483 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_09680 19727 19344 gene locus_tag LOCUS_09690 19727 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 20632 19724 gene locus_tag LOCUS_09700 gene rsmH 20632 19724 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_09700 20960 20622 gene locus_tag LOCUS_09710 20960 20622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 21418 20981 gene locus_tag LOCUS_09720 gene mraZ 21418 20981 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_09720 21582 21851 gene locus_tag LOCUS_09730 21582 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 22501 21767 gene locus_tag LOCUS_09740 22501 21767 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_09740 23230 22625 gene locus_tag LOCUS_09750 23230 22625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 24027 23215 gene locus_tag LOCUS_09760 24027 23215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 25121 24024 gene locus_tag LOCUS_09770 25121 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 26190 25222 gene locus_tag LOCUS_09780 26190 25222 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_09780 27217 26276 gene locus_tag LOCUS_09790 27217 26276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 28452 27214 gene locus_tag LOCUS_09800 28452 27214 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_09800 29033 28452 gene locus_tag LOCUS_09810 gene nadD 29033 28452 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583638.1 protein_id gnl|my_center|LOCUS_09810 30317 29049 gene locus_tag LOCUS_09820 30317 29049 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_09820 31457 30345 gene locus_tag LOCUS_09830 gene proB 31457 30345 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_09830 32490 31522 gene locus_tag LOCUS_09840 gene obgE 32490 31522 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_09840 32820 32575 gene locus_tag LOCUS_09850 gene rpmA 32820 32575 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_09850 33165 32845 gene locus_tag LOCUS_09860 gene rplU 33165 32845 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056022.1 protein_id gnl|my_center|LOCUS_09860 34139 33327 gene locus_tag LOCUS_09870 34139 33327 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_09870 35026 34187 gene locus_tag LOCUS_09880 35026 34187 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_09880 35390 35082 gene locus_tag LOCUS_09890 35390 35082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 36354 35422 gene locus_tag LOCUS_09900 gene trxB 36354 35422 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_09900 36774 36364 gene locus_tag LOCUS_09910 36774 36364 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_09910 38431 36761 gene locus_tag LOCUS_09920 38431 36761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 38895 38548 gene locus_tag LOCUS_09930 38895 38548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 39342 39013 gene locus_tag LOCUS_09940 39342 39013 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014431504.1 protein_id gnl|my_center|LOCUS_09940 39724 39329 gene locus_tag LOCUS_09950 39724 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 40076 39741 gene locus_tag LOCUS_09960 40076 39741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 54193 40217 gene locus_tag LOCUS_09970 54193 40217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 55129 54482 gene locus_tag LOCUS_09980 55129 54482 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_09980 56246 55146 gene locus_tag LOCUS_09990 gene ribD 56246 55146 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_09990 56730 56278 gene locus_tag LOCUS_10000 gene nusB 56730 56278 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_10000 57236 56727 gene locus_tag LOCUS_10010 gene ribH 57236 56727 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 protein_id gnl|my_center|LOCUS_10010 58449 57238 gene locus_tag LOCUS_10020 58449 57238 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_10020 58831 59160 gene locus_tag LOCUS_10030 58831 59160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 59175 59750 gene locus_tag LOCUS_10040 59175 59750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 61173 59740 gene locus_tag LOCUS_10050 61173 59740 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_10050 61933 61175 gene locus_tag LOCUS_10060 61933 61175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 62594 61998 gene locus_tag LOCUS_10070 62594 61998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_10070 63972 62626 gene locus_tag LOCUS_10080 63972 62626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 65051 63969 gene locus_tag LOCUS_10090 65051 63969 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_10090 66271 65048 gene locus_tag LOCUS_10100 gene csaB 66271 65048 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181502.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence12 3469 1763 gene locus_tag LOCUS_10110 3469 1763 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_10110 3934 3620 gene locus_tag LOCUS_10120 3934 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4679 4251 gene locus_tag LOCUS_10130 4679 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5208 4666 gene locus_tag LOCUS_10140 5208 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5840 5211 gene locus_tag LOCUS_10150 5840 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 6264 5857 gene locus_tag LOCUS_10160 6264 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6980 6288 gene locus_tag LOCUS_10170 6980 6288 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_10170 7202 7996 gene locus_tag LOCUS_10180 7202 7996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_10180 8002 8799 gene locus_tag LOCUS_10190 8002 8799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932018.1 protein_id gnl|my_center|LOCUS_10190 8792 9436 gene locus_tag LOCUS_10200 8792 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9530 9733 gene locus_tag LOCUS_10210 9530 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 10036 9854 gene locus_tag LOCUS_10220 10036 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 10586 10050 gene locus_tag LOCUS_10230 10586 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 11627 10587 gene locus_tag LOCUS_10240 11627 10587 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_10240 13390 11624 gene locus_tag LOCUS_10250 13390 11624 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_10250 13849 13487 gene locus_tag LOCUS_10260 13849 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 14201 13989 gene locus_tag LOCUS_10270 14201 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 15652 14228 gene locus_tag LOCUS_10280 gene lpdA 15652 14228 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_10280 16951 15686 gene locus_tag LOCUS_10290 16951 15686 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_10290 19847 17097 gene locus_tag LOCUS_10300 gene aceE 19847 17097 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_10300 19946 20665 gene locus_tag LOCUS_10310 19946 20665 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_10310 20944 20672 gene locus_tag LOCUS_10320 20944 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 21197 21700 gene locus_tag LOCUS_10330 21197 21700 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250177.1 protein_id gnl|my_center|LOCUS_10330 21697 21969 gene locus_tag LOCUS_10340 21697 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 21966 22268 gene locus_tag LOCUS_10350 21966 22268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 22265 22795 gene locus_tag LOCUS_10360 22265 22795 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_10360 22792 23244 gene locus_tag LOCUS_10370 22792 23244 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_10370 23238 23618 gene locus_tag LOCUS_10380 23238 23618 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_10380 23615 25084 gene locus_tag LOCUS_10390 23615 25084 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_10390 25087 26562 gene locus_tag LOCUS_10400 25087 26562 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_10400 26567 26791 gene locus_tag LOCUS_10410 26567 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 26772 28454 gene locus_tag LOCUS_10420 26772 28454 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_10420 29081 28587 gene locus_tag LOCUS_10430 29081 28587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 30354 29074 gene locus_tag LOCUS_10440 30354 29074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 31751 30351 gene locus_tag LOCUS_10450 31751 30351 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_10450 31869 32495 gene locus_tag LOCUS_10460 31869 32495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 33997 32498 gene locus_tag LOCUS_10470 33997 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 35360 33984 gene locus_tag LOCUS_10480 35360 33984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 35988 35374 gene locus_tag LOCUS_10490 35988 35374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 36496 35981 gene locus_tag LOCUS_10500 36496 35981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 36996 36493 gene locus_tag LOCUS_10510 gene pssD 36996 36493 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_10510 38056 36998 gene locus_tag LOCUS_10520 38056 36998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 39051 38047 gene locus_tag LOCUS_10530 39051 38047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 40046 39057 gene locus_tag LOCUS_10540 40046 39057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 40693 40097 gene locus_tag LOCUS_10550 40693 40097 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813215.1 protein_id gnl|my_center|LOCUS_10550 41531 40773 gene locus_tag LOCUS_10560 41531 40773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 42544 41531 gene locus_tag LOCUS_10570 42544 41531 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 protein_id gnl|my_center|LOCUS_10570 43035 42541 gene locus_tag LOCUS_10580 43035 42541 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021906.1 protein_id gnl|my_center|LOCUS_10580 44197 43061 gene locus_tag LOCUS_10590 gene pseC 44197 43061 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_10590 45285 44206 gene locus_tag LOCUS_10600 45285 44206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 46865 45255 gene locus_tag LOCUS_10610 46865 45255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 47410 46862 gene locus_tag LOCUS_10620 47410 46862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 48566 47505 gene locus_tag LOCUS_10630 48566 47505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 50324 48588 gene locus_tag LOCUS_10640 50324 48588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 52463 50325 gene locus_tag LOCUS_10650 52463 50325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 52931 52527 gene locus_tag LOCUS_10660 52931 52527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 53665 52928 gene locus_tag LOCUS_10670 53665 52928 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021473.1 protein_id gnl|my_center|LOCUS_10670 54785 53850 gene locus_tag LOCUS_10680 54785 53850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 55465 54782 gene locus_tag LOCUS_10690 55465 54782 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_10690 56710 55472 gene locus_tag LOCUS_10700 56710 55472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 57365 56961 gene locus_tag LOCUS_10710 57365 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 58040 57429 gene locus_tag LOCUS_10720 58040 57429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 59178 58153 gene locus_tag LOCUS_10730 59178 58153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 59735 59568 gene locus_tag LOCUS_10740 59735 59568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 60238 60162 gene locus_tag LOCUS_t00230 60238 60162 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 61417 60335 gene locus_tag LOCUS_10750 gene mrdB 61417 60335 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816839.1 protein_id gnl|my_center|LOCUS_10750 <62488 61398 gene locus_tag LOCUS_10760 <62488 61398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583753.1:penicillin-binding protein 2 >Feature sequence13 56 493 gene locus_tag LOCUS_10770 56 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 787 1707 gene locus_tag LOCUS_10780 787 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1729 2337 gene locus_tag LOCUS_10790 gene tsf 1729 2337 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_10790 2441 3157 gene locus_tag LOCUS_10800 gene pyrH 2441 3157 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_10800 3177 3749 gene locus_tag LOCUS_10810 gene frr 3177 3749 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_10810 3990 4065 gene locus_tag LOCUS_t00240 3990 4065 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4122 4196 gene locus_tag LOCUS_t00250 4122 4196 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4303 5256 gene locus_tag LOCUS_10820 4303 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5316 7271 gene locus_tag LOCUS_10830 gene ftsH 5316 7271 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_10830 7268 8134 gene locus_tag LOCUS_10840 gene folP 7268 8134 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_10840 8103 8849 gene locus_tag LOCUS_10850 8103 8849 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_10850 8850 9404 gene locus_tag LOCUS_10860 gene ruvC 8850 9404 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814225.1 protein_id gnl|my_center|LOCUS_10860 9389 9985 gene locus_tag LOCUS_10870 gene ruvA 9389 9985 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_10870 10045 10476 gene locus_tag LOCUS_10880 10045 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 10477 11505 gene locus_tag LOCUS_10890 gene ruvB 10477 11505 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_10890 11680 11895 gene locus_tag LOCUS_10900 11680 11895 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138162.1 protein_id gnl|my_center|LOCUS_10900 11899 12714 gene locus_tag LOCUS_10910 gene cdaA 11899 12714 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808428.1 protein_id gnl|my_center|LOCUS_10910 12711 13640 gene locus_tag LOCUS_10920 12711 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 13648 14370 gene locus_tag LOCUS_10930 gene pdxJ 13648 14370 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818969.1 protein_id gnl|my_center|LOCUS_10930 14367 15233 gene locus_tag LOCUS_10940 14367 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 17339 15234 gene locus_tag LOCUS_10950 17339 15234 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_10950 19186 17468 gene locus_tag LOCUS_10960 19186 17468 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_10960 19503 19649 gene locus_tag LOCUS_10970 19503 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 19713 21374 gene locus_tag LOCUS_10980 19713 21374 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_10980 21367 22440 gene locus_tag LOCUS_10990 21367 22440 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_10990 22453 22875 gene locus_tag LOCUS_11000 22453 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 22891 23826 gene locus_tag LOCUS_11010 22891 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 23835 24371 gene locus_tag LOCUS_11020 23835 24371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 24417 26255 gene locus_tag LOCUS_11030 24417 26255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 26603 27454 gene locus_tag LOCUS_11040 26603 27454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 27455 27916 gene locus_tag LOCUS_11050 27455 27916 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_11050 27989 28062 gene locus_tag LOCUS_t00260 27989 28062 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29369 28308 gene locus_tag LOCUS_11060 29369 28308 CDS product DUF1016 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817677.1 protein_id gnl|my_center|LOCUS_11060 29741 29816 gene locus_tag LOCUS_t00270 29741 29816 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29984 30253 gene locus_tag LOCUS_11070 29984 30253 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894375.1 protein_id gnl|my_center|LOCUS_11070 30308 30634 gene locus_tag LOCUS_11080 gene trxA 30308 30634 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_11080 30657 32339 gene locus_tag LOCUS_11090 30657 32339 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_11090 32362 32721 gene locus_tag LOCUS_11100 32362 32721 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_11100 32968 33288 gene locus_tag LOCUS_11110 32968 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 33671 34528 gene locus_tag LOCUS_11120 33671 34528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 34639 34714 gene locus_tag LOCUS_t00280 34639 34714 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34873 34957 gene locus_tag LOCUS_t00290 34873 34957 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35415 35488 gene locus_tag LOCUS_t00300 35415 35488 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35538 36803 gene locus_tag LOCUS_11130 gene tig 35538 36803 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_11130 36899 37507 gene locus_tag LOCUS_11140 gene clpP 36899 37507 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_11140 37504 38616 gene locus_tag LOCUS_11150 37504 38616 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_11150 38635 40272 gene locus_tag LOCUS_11160 gene serA 38635 40272 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_11160 40304 41578 gene locus_tag LOCUS_11170 40304 41578 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_11170 41582 42319 gene locus_tag LOCUS_11180 41582 42319 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_11180 42316 43116 gene locus_tag LOCUS_11190 42316 43116 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_11190 43113 44264 gene locus_tag LOCUS_11200 43113 44264 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_11200 44268 45359 gene locus_tag LOCUS_11210 gene rseP 44268 45359 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_11210 45361 47064 gene locus_tag LOCUS_11220 gene proS 45361 47064 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231918.1 protein_id gnl|my_center|LOCUS_11220 47357 47097 gene locus_tag LOCUS_11230 47357 47097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 47659 47453 gene locus_tag LOCUS_11240 47659 47453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 47721 48695 gene locus_tag LOCUS_11250 gene dinB 47721 48695 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 protein_id gnl|my_center|LOCUS_11250 48989 48798 gene locus_tag LOCUS_11260 48989 48798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 49316 49020 gene locus_tag LOCUS_11270 49316 49020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 49743 49324 gene locus_tag LOCUS_11280 49743 49324 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_11280 50070 49777 gene locus_tag LOCUS_11290 50070 49777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 50525 50893 gene locus_tag LOCUS_11300 50525 50893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 51004 51606 gene locus_tag LOCUS_11310 51004 51606 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_11310 51590 52027 gene locus_tag LOCUS_11320 51590 52027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 52024 52473 gene locus_tag LOCUS_11330 52024 52473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 52650 53258 gene locus_tag LOCUS_11340 52650 53258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 53359 54009 gene locus_tag LOCUS_11350 53359 54009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 54021 54515 gene locus_tag LOCUS_11360 54021 54515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 54817 55533 gene locus_tag LOCUS_11370 54817 55533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 56248 56532 gene locus_tag LOCUS_11380 56248 56532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 56730 58298 gene locus_tag LOCUS_11390 56730 58298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 58522 59067 gene locus_tag LOCUS_11400 58522 59067 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_11400 59064 59474 gene locus_tag LOCUS_11410 59064 59474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 59678 61849 gene locus_tag LOCUS_11420 59678 61849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence14 209 964 gene locus_tag LOCUS_11430 209 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 967 3483 gene locus_tag LOCUS_11440 967 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3483 4850 gene locus_tag LOCUS_11450 3483 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5669 5040 gene locus_tag LOCUS_11460 5669 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 6195 26357 gene locus_tag LOCUS_11470 6195 26357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 26583 27365 gene locus_tag LOCUS_11480 26583 27365 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_11480 27362 28171 gene locus_tag LOCUS_11490 27362 28171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 28537 28385 gene locus_tag LOCUS_11500 28537 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 29460 28669 gene locus_tag LOCUS_11510 29460 28669 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_11510 29522 30613 gene locus_tag LOCUS_11520 29522 30613 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_11520 30817 31749 gene locus_tag LOCUS_11530 gene mdh 30817 31749 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_11530 31750 34395 gene locus_tag LOCUS_11540 gene acnA 31750 34395 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_11540 34452 35615 gene locus_tag LOCUS_11550 34452 35615 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_11550 35612 36505 gene locus_tag LOCUS_11560 gene sucD 35612 36505 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114648.1 protein_id gnl|my_center|LOCUS_11560 36486 37847 gene locus_tag LOCUS_11570 36486 37847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 37849 38580 gene locus_tag LOCUS_11580 37849 38580 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_11580 38577 38996 gene locus_tag LOCUS_11590 38577 38996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 39027 39572 gene locus_tag LOCUS_11600 39027 39572 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_11600 39688 40737 gene locus_tag LOCUS_11610 39688 40737 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_11610 41639 40824 gene locus_tag LOCUS_11620 41639 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 42303 41701 gene locus_tag LOCUS_11630 gene pgsA 42303 41701 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 protein_id gnl|my_center|LOCUS_11630 43539 42433 gene locus_tag LOCUS_11640 43539 42433 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_11640 43871 44191 gene locus_tag LOCUS_11650 43871 44191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 44617 44204 gene locus_tag LOCUS_11660 44617 44204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 44777 46087 gene locus_tag LOCUS_11670 44777 46087 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_11670 46098 47168 gene locus_tag LOCUS_11680 gene hflK 46098 47168 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_11680 47165 48106 gene locus_tag LOCUS_11690 gene hflC 47165 48106 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655940.1 protein_id gnl|my_center|LOCUS_11690 48150 49631 gene locus_tag LOCUS_11700 gene pabB 48150 49631 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 protein_id gnl|my_center|LOCUS_11700 49628 50485 gene locus_tag LOCUS_11710 gene ilvE 49628 50485 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_11710 50482 52062 gene locus_tag LOCUS_11720 gene purH 50482 52062 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_11720 52115 53371 gene locus_tag LOCUS_11730 52115 53371 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583125.1 protein_id gnl|my_center|LOCUS_11730 53352 54761 gene locus_tag LOCUS_11740 gene mnmE 53352 54761 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546495.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence15 <1 585 gene locus_tag LOCUS_11750 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942597.1:asparagine synthase (glutamine-hydrolyzing) 600 1793 gene locus_tag LOCUS_11760 600 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1943 2854 gene locus_tag LOCUS_11770 1943 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3010 4395 gene locus_tag LOCUS_11780 3010 4395 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_11780 4464 5921 gene locus_tag LOCUS_11790 4464 5921 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_11790 6014 6817 gene locus_tag LOCUS_11800 6014 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6952 8229 gene locus_tag LOCUS_11810 6952 8229 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_11810 8232 10340 gene locus_tag LOCUS_11820 gene fadJ 8232 10340 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 protein_id gnl|my_center|LOCUS_11820 10374 10649 gene locus_tag LOCUS_11830 10374 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 10758 12350 gene locus_tag LOCUS_11840 10758 12350 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788346.1 protein_id gnl|my_center|LOCUS_11840 12360 14843 gene locus_tag LOCUS_11850 12360 14843 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_11850 14896 15261 gene locus_tag LOCUS_11860 14896 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 15306 17117 gene locus_tag LOCUS_11870 15306 17117 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879752.1 protein_id gnl|my_center|LOCUS_11870 17261 18358 gene locus_tag LOCUS_11880 17261 18358 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_11880 18376 19314 gene locus_tag LOCUS_11890 18376 19314 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_11890 19338 20426 gene locus_tag LOCUS_11900 19338 20426 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_11900 20440 21006 gene locus_tag LOCUS_11910 20440 21006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 21150 22550 gene locus_tag LOCUS_11920 21150 22550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 22708 23055 gene locus_tag LOCUS_11930 22708 23055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 23264 23485 gene locus_tag LOCUS_11940 23264 23485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 24132 23503 gene locus_tag LOCUS_11950 24132 23503 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930750.1 protein_id gnl|my_center|LOCUS_11950 24344 24952 gene locus_tag LOCUS_11960 gene nfi 24344 24952 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_11960 24949 25458 gene locus_tag LOCUS_11970 24949 25458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 25996 26673 gene locus_tag LOCUS_11980 25996 26673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 26854 43086 gene locus_tag LOCUS_11990 26854 43086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 43430 44263 gene locus_tag LOCUS_12000 43430 44263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 44372 44851 gene locus_tag LOCUS_12010 gene sixA 44372 44851 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947703.1 protein_id gnl|my_center|LOCUS_12010 44870 45394 gene locus_tag LOCUS_12020 44870 45394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 45419 45886 gene locus_tag LOCUS_12030 gene dtd 45419 45886 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933491.1 protein_id gnl|my_center|LOCUS_12030 45913 46329 gene locus_tag LOCUS_12040 45913 46329 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_12040 46450 47334 gene locus_tag LOCUS_12050 46450 47334 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_12050 47459 49531 gene locus_tag LOCUS_12060 47459 49531 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921460.1 protein_id gnl|my_center|LOCUS_12060 49657 50814 gene locus_tag LOCUS_12070 gene pseC 49657 50814 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_12070 50811 52340 gene locus_tag LOCUS_12080 50811 52340 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_12080 52659 52381 gene locus_tag LOCUS_12090 52659 52381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence16 304 1731 gene locus_tag LOCUS_12100 304 1731 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_12100 1742 2737 gene locus_tag LOCUS_12110 1742 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2731 4680 gene locus_tag LOCUS_12120 2731 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4677 6806 gene locus_tag LOCUS_12130 4677 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6803 8842 gene locus_tag LOCUS_12140 6803 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 8826 9902 gene locus_tag LOCUS_12150 gene waaF 8826 9902 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_12150 9899 11008 gene locus_tag LOCUS_12160 9899 11008 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939431.1 protein_id gnl|my_center|LOCUS_12160 11024 11830 gene locus_tag LOCUS_12170 11024 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11859 12725 gene locus_tag LOCUS_12180 11859 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 12921 13964 gene locus_tag LOCUS_12190 12921 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 13969 14718 gene locus_tag LOCUS_12200 gene kdsB 13969 14718 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_12200 14722 16422 gene locus_tag LOCUS_12210 14722 16422 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546318.1 protein_id gnl|my_center|LOCUS_12210 16427 17269 gene locus_tag LOCUS_12220 gene kdsA 16427 17269 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_12220 17266 18234 gene locus_tag LOCUS_12230 17266 18234 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_12230 18234 19172 gene locus_tag LOCUS_12240 18234 19172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 19169 20050 gene locus_tag LOCUS_12250 19169 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 20050 20775 gene locus_tag LOCUS_12260 gene lptB 20050 20775 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_12260 20811 21368 gene locus_tag LOCUS_12270 gene raiA 20811 21368 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_12270 21422 21886 gene locus_tag LOCUS_12280 21422 21886 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_12280 21907 23166 gene locus_tag LOCUS_12290 21907 23166 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_12290 23202 23471 gene locus_tag LOCUS_12300 23202 23471 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_12300 23471 25219 gene locus_tag LOCUS_12310 gene ptsP 23471 25219 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_12310 25256 25999 gene locus_tag LOCUS_12320 25256 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 26024 27217 gene locus_tag LOCUS_12330 gene metK 26024 27217 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_12330 27201 28457 gene locus_tag LOCUS_12340 gene ahcY 27201 28457 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_12340 28552 29058 gene locus_tag LOCUS_12350 28552 29058 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879756.1 protein_id gnl|my_center|LOCUS_12350 32258 29055 gene locus_tag LOCUS_12360 32258 29055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 32552 32980 gene locus_tag LOCUS_12370 32552 32980 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_12370 32977 36171 gene locus_tag LOCUS_12380 32977 36171 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_12380 36185 36949 gene locus_tag LOCUS_12390 36185 36949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 36965 37513 gene locus_tag LOCUS_12400 36965 37513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 37510 38544 gene locus_tag LOCUS_12410 37510 38544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 38640 39455 gene locus_tag LOCUS_12420 38640 39455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 39648 49391 gene locus_tag LOCUS_12430 39648 49391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 51126 49708 gene locus_tag LOCUS_12440 51126 49708 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_12440 52598 51126 gene locus_tag LOCUS_12450 52598 51126 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence17 1423 1034 gene locus_tag LOCUS_12460 gene gcvH 1423 1034 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_12460 2576 1494 gene locus_tag LOCUS_12470 gene gcvT 2576 1494 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_12470 3907 2660 gene locus_tag LOCUS_12480 gene ftsA 3907 2660 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019996.1 protein_id gnl|my_center|LOCUS_12480 4719 3904 gene locus_tag LOCUS_12490 4719 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5696 4740 gene locus_tag LOCUS_12500 5696 4740 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_12500 6558 5644 gene locus_tag LOCUS_12510 gene murB 6558 5644 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_12510 7912 6512 gene locus_tag LOCUS_12520 gene murC 7912 6512 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_12520 8781 7909 gene locus_tag LOCUS_12530 gene murG 8781 7909 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769484.1 protein_id gnl|my_center|LOCUS_12530 10252 9158 gene locus_tag LOCUS_12540 gene ftsW 10252 9158 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_12540 11516 10245 gene locus_tag LOCUS_12550 gene murD 11516 10245 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881357.1 protein_id gnl|my_center|LOCUS_12550 12603 11518 gene locus_tag LOCUS_12560 gene mraY 12603 11518 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_12560 14002 12608 gene locus_tag LOCUS_12570 gene murF 14002 12608 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595957.1 protein_id gnl|my_center|LOCUS_12570 15470 13986 gene locus_tag LOCUS_12580 15470 13986 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_12580 15979 15509 gene locus_tag LOCUS_12590 15979 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 16672 16001 gene locus_tag LOCUS_12600 16672 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 16926 16711 gene locus_tag LOCUS_12610 16926 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 18484 16931 gene locus_tag LOCUS_12620 18484 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 19635 18496 gene locus_tag LOCUS_12630 19635 18496 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_12630 19916 19632 gene locus_tag LOCUS_12640 19916 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 21804 20089 gene locus_tag LOCUS_12650 21804 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 23409 22081 gene locus_tag LOCUS_12660 23409 22081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 24782 23406 gene locus_tag LOCUS_12670 24782 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_12670 25574 24825 gene locus_tag LOCUS_12680 25574 24825 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_12680 26241 25675 gene locus_tag LOCUS_12690 26241 25675 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_12690 27545 26265 gene locus_tag LOCUS_12700 27545 26265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081492.1 protein_id gnl|my_center|LOCUS_12700 28254 27772 gene locus_tag LOCUS_12710 28254 27772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 28594 28232 gene locus_tag LOCUS_12720 28594 28232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 30196 28709 gene locus_tag LOCUS_12730 30196 28709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_12730 30867 30193 gene locus_tag LOCUS_12740 30867 30193 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_12740 31761 30871 gene locus_tag LOCUS_12750 31761 30871 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_12750 31905 32282 gene locus_tag LOCUS_12760 31905 32282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 32501 32815 gene locus_tag LOCUS_12770 32501 32815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 33788 32820 gene locus_tag LOCUS_12780 33788 32820 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_12780 34844 33834 gene locus_tag LOCUS_12790 34844 33834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 34939 35229 gene locus_tag LOCUS_12800 34939 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 35229 36788 gene locus_tag LOCUS_12810 35229 36788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 36788 37093 gene locus_tag LOCUS_12820 36788 37093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 37096 38004 gene locus_tag LOCUS_12830 37096 38004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 37997 39157 gene locus_tag LOCUS_12840 37997 39157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 39099 39290 gene locus_tag LOCUS_12850 39099 39290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 39312 40235 gene locus_tag LOCUS_12860 39312 40235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 40232 41287 gene locus_tag LOCUS_12870 40232 41287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 41259 42194 gene locus_tag LOCUS_12880 41259 42194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 43095 42232 gene locus_tag LOCUS_12890 43095 42232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 43422 44243 gene locus_tag LOCUS_12900 43422 44243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 44230 45039 gene locus_tag LOCUS_12910 44230 45039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 protein_id gnl|my_center|LOCUS_12910 45202 45489 gene locus_tag LOCUS_12920 45202 45489 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 protein_id gnl|my_center|LOCUS_12920 45479 45835 gene locus_tag LOCUS_12930 45479 45835 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546264.1 protein_id gnl|my_center|LOCUS_12930 47555 46221 gene locus_tag LOCUS_12940 47555 46221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 48606 47701 gene locus_tag LOCUS_12950 48606 47701 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082180.1 protein_id gnl|my_center|LOCUS_12950 49522 48599 gene locus_tag LOCUS_12960 49522 48599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 50523 49519 gene locus_tag LOCUS_12970 50523 49519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 51707 50520 gene locus_tag LOCUS_12980 51707 50520 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence18 1060 227 gene locus_tag LOCUS_12990 1060 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1696 1073 gene locus_tag LOCUS_13000 1696 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2895 1699 gene locus_tag LOCUS_13010 2895 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3887 3075 gene locus_tag LOCUS_13020 3887 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5099 3900 gene locus_tag LOCUS_13030 5099 3900 CDS product glycosyltransferase family 61 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190897490.1 protein_id gnl|my_center|LOCUS_13030 5801 5139 gene locus_tag LOCUS_13040 5801 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038033.1 protein_id gnl|my_center|LOCUS_13040 6626 5802 gene locus_tag LOCUS_13050 6626 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7414 6638 gene locus_tag LOCUS_13060 7414 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7568 8485 gene locus_tag LOCUS_13070 7568 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9518 8439 gene locus_tag LOCUS_13080 9518 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 10401 9511 gene locus_tag LOCUS_13090 10401 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 10852 10481 gene locus_tag LOCUS_13100 10852 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 11573 10866 gene locus_tag LOCUS_13110 11573 10866 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770360.1 protein_id gnl|my_center|LOCUS_13110 12318 11557 gene locus_tag LOCUS_13120 12318 11557 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770694.1 protein_id gnl|my_center|LOCUS_13120 12567 12319 gene locus_tag LOCUS_13130 12567 12319 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770362.1 protein_id gnl|my_center|LOCUS_13130 13993 12716 gene locus_tag LOCUS_13140 13993 12716 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_13140 14448 13990 gene locus_tag LOCUS_13150 14448 13990 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_13150 15050 14445 gene locus_tag LOCUS_13160 gene fabA 15050 14445 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770369.1 protein_id gnl|my_center|LOCUS_13160 16054 15047 gene locus_tag LOCUS_13170 16054 15047 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772652.1 protein_id gnl|my_center|LOCUS_13170 17799 16315 gene locus_tag LOCUS_13180 17799 16315 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_13180 22418 17811 gene locus_tag LOCUS_13190 gene gltB 22418 17811 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_13190 24288 22609 gene locus_tag LOCUS_13200 24288 22609 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_13200 25430 24369 gene locus_tag LOCUS_13210 25430 24369 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_13210 26249 25440 gene locus_tag LOCUS_13220 26249 25440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 28437 26584 gene locus_tag LOCUS_13230 28437 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 30800 28521 gene locus_tag LOCUS_13240 30800 28521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 48985 31454 gene locus_tag LOCUS_13250 48985 31454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence19 201 3746 gene locus_tag LOCUS_13260 201 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4773 3757 gene locus_tag LOCUS_13270 gene lpxB 4773 3757 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947101.1 protein_id gnl|my_center|LOCUS_13270 5846 4905 gene locus_tag LOCUS_13280 5846 4905 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771932.1 protein_id gnl|my_center|LOCUS_13280 6055 7806 gene locus_tag LOCUS_13290 gene msbA 6055 7806 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_13290 7901 8332 gene locus_tag LOCUS_13300 7901 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 8476 9015 gene locus_tag LOCUS_13310 8476 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 9105 9536 gene locus_tag LOCUS_13320 9105 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 9762 11057 gene locus_tag LOCUS_13330 9762 11057 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_13330 11066 12139 gene locus_tag LOCUS_13340 gene thrC 11066 12139 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_13340 12136 13332 gene locus_tag LOCUS_13350 12136 13332 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_13350 13368 14609 gene locus_tag LOCUS_13360 13368 14609 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_13360 14606 16165 gene locus_tag LOCUS_13370 gene cimA 14606 16165 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_13370 16178 18883 gene locus_tag LOCUS_13380 16178 18883 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082363.1 protein_id gnl|my_center|LOCUS_13380 18920 19504 gene locus_tag LOCUS_13390 18920 19504 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_13390 19823 19485 gene locus_tag LOCUS_13400 19823 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 21177 23033 gene locus_tag LOCUS_13410 21177 23033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 23035 23607 gene locus_tag LOCUS_13420 23035 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 23976 23629 gene locus_tag LOCUS_13430 23976 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 24851 26656 gene locus_tag LOCUS_13440 24851 26656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 26754 27491 gene locus_tag LOCUS_13450 26754 27491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 27605 27892 gene locus_tag LOCUS_13460 27605 27892 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_13460 28026 28904 gene locus_tag LOCUS_13470 gene nadC 28026 28904 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_13470 28936 30948 gene locus_tag LOCUS_13480 gene uvrB 28936 30948 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_13480 31048 31689 gene locus_tag LOCUS_13490 31048 31689 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_13490 32119 32814 gene locus_tag LOCUS_13500 32119 32814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 32848 34542 gene locus_tag LOCUS_13510 gene ilvB 32848 34542 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_13510 34579 35136 gene locus_tag LOCUS_13520 gene ilvN 34579 35136 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_13520 35194 36216 gene locus_tag LOCUS_13530 gene ilvC 35194 36216 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_13530 36235 37788 gene locus_tag LOCUS_13540 36235 37788 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_13540 37785 38669 gene locus_tag LOCUS_13550 gene aroE 37785 38669 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544907.1 protein_id gnl|my_center|LOCUS_13550 38669 39448 gene locus_tag LOCUS_13560 38669 39448 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13560 39505 40626 gene locus_tag LOCUS_13570 gene aroC 39505 40626 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545839.1 protein_id gnl|my_center|LOCUS_13570 40635 41147 gene locus_tag LOCUS_13580 40635 41147 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_13580 41144 42241 gene locus_tag LOCUS_13590 gene aroB 41144 42241 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 protein_id gnl|my_center|LOCUS_13590 42259 43407 gene locus_tag LOCUS_13600 gene dprA 42259 43407 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403940.1 protein_id gnl|my_center|LOCUS_13600 43527 43940 gene locus_tag LOCUS_13610 43527 43940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 44199 45077 gene locus_tag LOCUS_13620 44199 45077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 45166 45579 gene locus_tag LOCUS_13630 45166 45579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 45749 47878 gene locus_tag LOCUS_13640 gene topA 45749 47878 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence20 1312 29 gene locus_tag LOCUS_13650 1312 29 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_13650 2262 1312 gene locus_tag LOCUS_13660 2262 1312 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_13660 2807 2259 gene locus_tag LOCUS_13670 gene pyrR 2807 2259 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_13670 3851 3507 gene locus_tag LOCUS_13680 3851 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5320 4031 gene locus_tag LOCUS_13690 5320 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5424 5594 gene locus_tag LOCUS_13700 5424 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 5685 5610 gene locus_tag LOCUS_t00310 5685 5610 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6186 5779 gene locus_tag LOCUS_13710 6186 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7922 6222 gene locus_tag LOCUS_13720 7922 6222 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_13720 9840 8071 gene locus_tag LOCUS_13730 gene dnaG 9840 8071 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_13730 10479 9907 gene locus_tag LOCUS_13740 10479 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 11973 10489 gene locus_tag LOCUS_13750 gene mtaB 11973 10489 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_13750 12593 11961 gene locus_tag LOCUS_13760 12593 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 13194 12856 gene locus_tag LOCUS_13770 13194 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13574 13302 gene locus_tag LOCUS_13780 13574 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 17448 14011 gene locus_tag LOCUS_13790 17448 14011 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_13790 19218 17680 gene locus_tag LOCUS_13800 gene guaA 19218 17680 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_13800 20425 19265 gene locus_tag LOCUS_13810 20425 19265 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_13810 22100 20670 gene locus_tag LOCUS_13820 22100 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 23183 22167 gene locus_tag LOCUS_13830 23183 22167 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_13830 25218 23260 gene locus_tag LOCUS_13840 25218 23260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 26705 25320 gene locus_tag LOCUS_13850 26705 25320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 26826 27560 gene locus_tag LOCUS_13860 26826 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 27950 27576 gene locus_tag LOCUS_13870 27950 27576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 28447 28016 gene locus_tag LOCUS_13880 gene gspG 28447 28016 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_13880 29036 28503 gene locus_tag LOCUS_13890 29036 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 30491 29049 gene locus_tag LOCUS_13900 30491 29049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 31694 30654 gene locus_tag LOCUS_13910 31694 30654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 32331 31702 gene locus_tag LOCUS_13920 32331 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 32843 32430 gene locus_tag LOCUS_13930 32843 32430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 34089 32827 gene locus_tag LOCUS_13940 34089 32827 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_13940 35837 34092 gene locus_tag LOCUS_13950 35837 34092 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_13950 36295 35852 gene locus_tag LOCUS_13960 36295 35852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 37729 36308 gene locus_tag LOCUS_13970 gene atpD 37729 36308 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_13970 38617 37754 gene locus_tag LOCUS_13980 38617 37754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 40187 38700 gene locus_tag LOCUS_13990 gene atpA 40187 38700 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880405.1 protein_id gnl|my_center|LOCUS_13990 40956 40207 gene locus_tag LOCUS_14000 40956 40207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 41185 40973 gene locus_tag LOCUS_14010 41185 40973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 41427 41182 gene locus_tag LOCUS_14020 41427 41182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence21 1718 957 gene locus_tag LOCUS_14030 1718 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3447 1711 gene locus_tag LOCUS_14040 3447 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4202 3444 gene locus_tag LOCUS_14050 4202 3444 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_14050 4798 4202 gene locus_tag LOCUS_14060 gene cysE 4798 4202 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_14060 6650 4791 gene locus_tag LOCUS_14070 gene asnB 6650 4791 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_14070 7431 6685 gene locus_tag LOCUS_14080 7431 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 8540 7542 gene locus_tag LOCUS_14090 8540 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 9420 8704 gene locus_tag LOCUS_14100 9420 8704 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_14100 11737 9428 gene locus_tag LOCUS_14110 11737 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 12071 13591 gene locus_tag LOCUS_14120 12071 13591 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_14120 14572 13646 gene locus_tag LOCUS_14130 14572 13646 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_14130 14894 14595 gene locus_tag LOCUS_14140 14894 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 15760 14891 gene locus_tag LOCUS_14150 15760 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 17070 15757 gene locus_tag LOCUS_14160 17070 15757 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_14160 18686 17100 gene locus_tag LOCUS_14170 18686 17100 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083340.1 protein_id gnl|my_center|LOCUS_14170 19705 18683 gene locus_tag LOCUS_14180 19705 18683 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_14180 20466 19738 gene locus_tag LOCUS_14190 20466 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 21401 20751 gene locus_tag LOCUS_14200 21401 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 24087 21490 gene locus_tag LOCUS_14210 24087 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 25254 24115 gene locus_tag LOCUS_14220 gene wecB 25254 24115 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_14220 26056 25229 gene locus_tag LOCUS_14230 26056 25229 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427759.1 protein_id gnl|my_center|LOCUS_14230 27020 26061 gene locus_tag LOCUS_14240 27020 26061 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_14240 28779 27112 gene locus_tag LOCUS_14250 28779 27112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 29881 28781 gene locus_tag LOCUS_14260 29881 28781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 30910 29918 gene locus_tag LOCUS_14270 30910 29918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_14270 31646 30903 gene locus_tag LOCUS_14280 31646 30903 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_14280 33446 31758 gene locus_tag LOCUS_14290 33446 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 34198 33479 gene locus_tag LOCUS_14300 34198 33479 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_14300 35160 34195 gene locus_tag LOCUS_14310 35160 34195 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_14310 36149 35157 gene locus_tag LOCUS_14320 gene gmd 36149 35157 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_14320 37127 36180 gene locus_tag LOCUS_14330 37127 36180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_14330 38139 37180 gene locus_tag LOCUS_14340 38139 37180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_14340 39453 38140 gene locus_tag LOCUS_14350 39453 38140 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_14350 40384 39446 gene locus_tag LOCUS_14360 gene rfbD 40384 39446 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_14360 41365 40388 gene locus_tag LOCUS_14370 gene rfbB 41365 40388 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_14370 42096 41362 gene locus_tag LOCUS_14380 42096 41362 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_14380 43403 42111 gene locus_tag LOCUS_14390 43403 42111 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_14390 45783 43492 gene locus_tag LOCUS_14400 45783 43492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence22 1266 775 gene locus_tag LOCUS_14410 1266 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3650 1266 gene locus_tag LOCUS_14420 3650 1266 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_14420 4581 3631 gene locus_tag LOCUS_14430 4581 3631 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880868.1 protein_id gnl|my_center|LOCUS_14430 6354 4591 gene locus_tag LOCUS_14440 gene aspS 6354 4591 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881092.1 protein_id gnl|my_center|LOCUS_14440 7622 6351 gene locus_tag LOCUS_14450 gene hisS 7622 6351 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124931.1 protein_id gnl|my_center|LOCUS_14450 8495 7707 gene locus_tag LOCUS_14460 8495 7707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_14460 9107 8562 gene locus_tag LOCUS_14470 gene amrA 9107 8562 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_14470 10282 9134 gene locus_tag LOCUS_14480 10282 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 11135 10329 gene locus_tag LOCUS_14490 gene amrB 11135 10329 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880539.1 protein_id gnl|my_center|LOCUS_14490 11347 11165 gene locus_tag LOCUS_14500 11347 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11590 12246 gene locus_tag LOCUS_14510 11590 12246 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986808.1 protein_id gnl|my_center|LOCUS_14510 12243 13340 gene locus_tag LOCUS_14520 12243 13340 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_14520 14185 13556 gene locus_tag LOCUS_14530 14185 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 14578 14201 gene locus_tag LOCUS_14540 14578 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 15761 14499 gene locus_tag LOCUS_14550 15761 14499 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_14550 16072 15758 gene locus_tag LOCUS_14560 16072 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 16419 16069 gene locus_tag LOCUS_14570 16419 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 17550 16579 gene locus_tag LOCUS_14580 17550 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 20056 17948 gene locus_tag LOCUS_14590 20056 17948 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_14590 20902 20708 gene locus_tag LOCUS_14600 20902 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 21552 21409 gene locus_tag LOCUS_14610 21552 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 22066 21692 gene locus_tag LOCUS_14620 22066 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 22887 22138 gene locus_tag LOCUS_14630 22887 22138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 23753 22899 gene locus_tag LOCUS_14640 23753 22899 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_14640 25765 23930 gene locus_tag LOCUS_14650 gene typA 25765 23930 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_14650 26077 25992 gene locus_tag LOCUS_t00320 26077 25992 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 26172 26099 gene locus_tag LOCUS_t00330 26172 26099 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <41689 26734 gene locus_tag LOCUS_14660 <41689 26734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388592.1:leucine-rich repeat domain-containing protein 30022 30375 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caaattcgtcaactccgataaagg >Feature sequence23 4209 2098 gene locus_tag LOCUS_14670 4209 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4592 10840 gene locus_tag LOCUS_14680 4592 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10807 25575 gene locus_tag LOCUS_14690 10807 25575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 25707 26549 gene locus_tag LOCUS_14700 25707 26549 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_14700 26653 27300 gene locus_tag LOCUS_14710 26653 27300 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_14710 27521 28114 gene locus_tag LOCUS_14720 27521 28114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 29326 28325 gene locus_tag LOCUS_14730 29326 28325 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_14730 29572 29880 gene locus_tag LOCUS_14740 gene nirD 29572 29880 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_14740 29985 30803 gene locus_tag LOCUS_14750 29985 30803 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_14750 30803 31738 gene locus_tag LOCUS_14760 30803 31738 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_14760 31994 33673 gene locus_tag LOCUS_14770 gene ggt 31994 33673 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262987.1 protein_id gnl|my_center|LOCUS_14770 33657 34187 gene locus_tag LOCUS_14780 33657 34187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 34180 34644 gene locus_tag LOCUS_14790 34180 34644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 35197 34604 gene locus_tag LOCUS_14800 35197 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence24 <1 1622 gene locus_tag LOCUS_14810 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928959.1:ABC transporter ATP-binding protein 1632 2618 gene locus_tag LOCUS_14820 1632 2618 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_14820 2847 3899 gene locus_tag LOCUS_14830 2847 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3903 5492 gene locus_tag LOCUS_14840 3903 5492 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_14840 5536 5745 gene locus_tag LOCUS_14850 5536 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5902 8403 gene locus_tag LOCUS_14860 5902 8403 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_14860 8433 9332 gene locus_tag LOCUS_14870 8433 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 9387 9665 gene locus_tag LOCUS_14880 9387 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9805 10305 gene locus_tag LOCUS_14890 gene ftnA 9805 10305 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348910.1 protein_id gnl|my_center|LOCUS_14890 10435 10911 gene locus_tag LOCUS_14900 10435 10911 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_14900 10875 11159 gene locus_tag LOCUS_14910 10875 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 11152 13374 gene locus_tag LOCUS_14920 gene feoB 11152 13374 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510008.1 protein_id gnl|my_center|LOCUS_14920 13586 14719 gene locus_tag LOCUS_14930 13586 14719 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046900.1 protein_id gnl|my_center|LOCUS_14930 14768 15583 gene locus_tag LOCUS_14940 14768 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 15567 16115 gene locus_tag LOCUS_14950 15567 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 16115 17275 gene locus_tag LOCUS_14960 16115 17275 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582848.1 protein_id gnl|my_center|LOCUS_14960 17272 17739 gene locus_tag LOCUS_14970 17272 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 17778 18503 gene locus_tag LOCUS_14980 17778 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 18538 18867 gene locus_tag LOCUS_14990 18538 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 18867 19670 gene locus_tag LOCUS_15000 18867 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 19735 20223 gene locus_tag LOCUS_15010 19735 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 20358 20990 gene locus_tag LOCUS_15020 20358 20990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 21033 22268 gene locus_tag LOCUS_15030 gene lhgO 21033 22268 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_15030 22427 23089 gene locus_tag LOCUS_15040 22427 23089 CDS product PEP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921553.1 protein_id gnl|my_center|LOCUS_15040 23235 23450 gene locus_tag LOCUS_15050 23235 23450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 23591 24898 gene locus_tag LOCUS_15060 23591 24898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 24965 26059 gene locus_tag LOCUS_15070 24965 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 26674 26066 gene locus_tag LOCUS_15080 26674 26066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 27186 29000 gene locus_tag LOCUS_15090 27186 29000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 29060 30622 gene locus_tag LOCUS_15100 29060 30622 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_15100 30622 31782 gene locus_tag LOCUS_15110 gene hflX 30622 31782 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081386.1 protein_id gnl|my_center|LOCUS_15110 31840 33651 gene locus_tag LOCUS_15120 31840 33651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 33717 34283 gene locus_tag LOCUS_15130 33717 34283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15130 >Feature sequence25 704 174 gene locus_tag LOCUS_15140 704 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1062 769 gene locus_tag LOCUS_15150 1062 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1709 1155 gene locus_tag LOCUS_15160 1709 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2254 2018 gene locus_tag LOCUS_15170 2254 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3195 2473 gene locus_tag LOCUS_15180 3195 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4556 3585 gene locus_tag LOCUS_15190 4556 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4964 4599 gene locus_tag LOCUS_15200 4964 4599 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_15200 6234 4966 gene locus_tag LOCUS_15210 6234 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 7660 6248 gene locus_tag LOCUS_15220 7660 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 9114 7660 gene locus_tag LOCUS_15230 9114 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 11795 9111 gene locus_tag LOCUS_15240 11795 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13036 11828 gene locus_tag LOCUS_15250 13036 11828 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_15250 13514 14740 gene locus_tag LOCUS_15260 13514 14740 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_15260 17463 14743 gene locus_tag LOCUS_15270 17463 14743 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_15270 18227 17460 gene locus_tag LOCUS_15280 18227 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 19523 18282 gene locus_tag LOCUS_15290 19523 18282 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_15290 19738 19565 gene locus_tag LOCUS_15300 19738 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 20127 19921 gene locus_tag LOCUS_15310 20127 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 20331 20173 gene locus_tag LOCUS_15320 20331 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 23337 20812 gene locus_tag LOCUS_15330 23337 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 23968 23324 gene locus_tag LOCUS_15340 23968 23324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_15340 26527 24083 gene locus_tag LOCUS_15350 26527 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 26889 26578 gene locus_tag LOCUS_15360 26889 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 27205 26879 gene locus_tag LOCUS_15370 27205 26879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 28519 27587 gene locus_tag LOCUS_15380 28519 27587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 29063 28788 gene locus_tag LOCUS_15390 29063 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 29759 29121 gene locus_tag LOCUS_15400 29759 29121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_15400 30628 29756 gene locus_tag LOCUS_15410 30628 29756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 30912 31061 gene locus_tag LOCUS_15420 30912 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 31088 31309 gene locus_tag LOCUS_15430 31088 31309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 31338 31898 gene locus_tag LOCUS_15440 31338 31898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 32766 32446 gene locus_tag LOCUS_15450 32766 32446 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_15450 33341 32778 gene locus_tag LOCUS_15460 33341 32778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence26 199 1155 gene locus_tag LOCUS_15470 199 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3042 1165 gene locus_tag LOCUS_15480 3042 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3354 3854 gene locus_tag LOCUS_15490 3354 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3997 4617 gene locus_tag LOCUS_15500 3997 4617 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_15500 5205 5840 gene locus_tag LOCUS_15510 5205 5840 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769043.1 protein_id gnl|my_center|LOCUS_15510 5837 6565 gene locus_tag LOCUS_15520 5837 6565 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245498.1 protein_id gnl|my_center|LOCUS_15520 6632 7345 gene locus_tag LOCUS_15530 6632 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 7368 8468 gene locus_tag LOCUS_15540 7368 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8486 9988 gene locus_tag LOCUS_15550 8486 9988 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165153.1 protein_id gnl|my_center|LOCUS_15550 10001 10543 gene locus_tag LOCUS_15560 10001 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 10575 11366 gene locus_tag LOCUS_15570 10575 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 11377 12024 gene locus_tag LOCUS_15580 11377 12024 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_15580 12031 12915 gene locus_tag LOCUS_15590 12031 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 12912 13859 gene locus_tag LOCUS_15600 12912 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 13862 15193 gene locus_tag LOCUS_15610 13862 15193 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973131.1 protein_id gnl|my_center|LOCUS_15610 15190 16413 gene locus_tag LOCUS_15620 15190 16413 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860104.1 protein_id gnl|my_center|LOCUS_15620 16615 17043 gene locus_tag LOCUS_15630 16615 17043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 17120 17461 gene locus_tag LOCUS_15640 17120 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 17496 17888 gene locus_tag LOCUS_15650 17496 17888 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047760.1 protein_id gnl|my_center|LOCUS_15650 17902 18222 gene locus_tag LOCUS_15660 17902 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 18222 18707 gene locus_tag LOCUS_15670 gene tsaA 18222 18707 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_15670 18744 19115 gene locus_tag LOCUS_15680 18744 19115 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_15680 19117 19962 gene locus_tag LOCUS_15690 19117 19962 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_15690 19959 20852 gene locus_tag LOCUS_15700 19959 20852 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_15700 20883 21602 gene locus_tag LOCUS_15710 20883 21602 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_15710 21928 22842 gene locus_tag LOCUS_15720 21928 22842 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880542.1 protein_id gnl|my_center|LOCUS_15720 22845 23624 gene locus_tag LOCUS_15730 22845 23624 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080893.1 protein_id gnl|my_center|LOCUS_15730 23625 25391 gene locus_tag LOCUS_15740 gene ilvD 23625 25391 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence27 914 705 gene locus_tag LOCUS_15750 914 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1015 1440 gene locus_tag LOCUS_15760 1015 1440 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_15760 3430 1427 gene locus_tag LOCUS_15770 3430 1427 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_15770 4051 3461 gene locus_tag LOCUS_15780 4051 3461 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_15780 6282 4264 gene locus_tag LOCUS_15790 6282 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 6267 6452 gene locus_tag LOCUS_15800 6267 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 7750 6968 gene locus_tag LOCUS_15810 7750 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 8736 8089 gene locus_tag LOCUS_15820 8736 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 8930 10276 gene locus_tag LOCUS_15830 8930 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 11420 10245 gene locus_tag LOCUS_15840 11420 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 11565 12332 gene locus_tag LOCUS_15850 11565 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13066 12455 gene locus_tag LOCUS_15860 13066 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 13810 14586 gene locus_tag LOCUS_15870 13810 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 14602 15159 gene locus_tag LOCUS_15880 gene rpoE 14602 15159 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_15880 15156 15647 gene locus_tag LOCUS_15890 15156 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 15702 16262 gene locus_tag LOCUS_15900 15702 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 17010 16429 gene locus_tag LOCUS_15910 17010 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 17571 17101 gene locus_tag LOCUS_15920 17571 17101 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_15920 18083 17652 gene locus_tag LOCUS_15930 18083 17652 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_15930 18336 18148 gene locus_tag LOCUS_15940 18336 18148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 18514 18344 gene locus_tag LOCUS_15950 18514 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 19047 18511 gene locus_tag LOCUS_15960 gene tpx 19047 18511 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_15960 19222 19743 gene locus_tag LOCUS_15970 19222 19743 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_15970 20398 19820 gene locus_tag LOCUS_15980 20398 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 20520 21884 gene locus_tag LOCUS_15990 20520 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 22550 21927 gene locus_tag LOCUS_16000 22550 21927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 22655 22840 gene locus_tag LOCUS_16010 22655 22840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 23290 23784 gene locus_tag LOCUS_16020 gene fkpB 23290 23784 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_16020 27132 24355 gene locus_tag LOCUS_16030 27132 24355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 27711 27493 gene locus_tag LOCUS_16040 27711 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 28381 27746 gene locus_tag LOCUS_16050 28381 27746 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_16050 29023 28403 gene locus_tag LOCUS_16060 29023 28403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence28 295 98 gene locus_tag LOCUS_16070 295 98 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_16070 2752 3549 gene locus_tag LOCUS_16080 2752 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3703 4845 gene locus_tag LOCUS_16090 3703 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6252 4852 gene locus_tag LOCUS_16100 6252 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 7654 6254 gene locus_tag LOCUS_16110 7654 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 9100 7673 gene locus_tag LOCUS_16120 9100 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 9881 9174 gene locus_tag LOCUS_16130 9881 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 11599 9998 gene locus_tag LOCUS_16140 11599 9998 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_16140 12006 11641 gene locus_tag LOCUS_16150 12006 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 12717 12112 gene locus_tag LOCUS_16160 12717 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 13288 12917 gene locus_tag LOCUS_16170 13288 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 13751 13293 gene locus_tag LOCUS_16180 13751 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 14272 13820 gene locus_tag LOCUS_16190 14272 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 14586 14374 gene locus_tag LOCUS_16200 14586 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 14932 16011 gene locus_tag LOCUS_16210 14932 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 16742 16008 gene locus_tag LOCUS_16220 16742 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 17632 16835 gene locus_tag LOCUS_16230 17632 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 20523 17659 gene locus_tag LOCUS_16240 20523 17659 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402866.1 protein_id gnl|my_center|LOCUS_16240 21485 20670 gene locus_tag LOCUS_16250 21485 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 22387 21788 gene locus_tag LOCUS_16260 22387 21788 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_16260 22680 22928 gene locus_tag LOCUS_16270 22680 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 22968 23123 gene locus_tag LOCUS_16280 22968 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 23660 23433 gene locus_tag LOCUS_16290 gene cspE 23660 23433 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034826.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence29 5806 4670 gene locus_tag LOCUS_16300 5806 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7448 5829 gene locus_tag LOCUS_16310 7448 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8139 7420 gene locus_tag LOCUS_16320 8139 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 8963 8094 gene locus_tag LOCUS_16330 8963 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 11300 9207 gene locus_tag LOCUS_16340 11300 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 12133 11327 gene locus_tag LOCUS_16350 12133 11327 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_16350 13178 12138 gene locus_tag LOCUS_16360 13178 12138 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_16360 13903 13193 gene locus_tag LOCUS_16370 13903 13193 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_16370 14641 13907 gene locus_tag LOCUS_16380 14641 13907 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391446.1 protein_id gnl|my_center|LOCUS_16380 16517 14655 gene locus_tag LOCUS_16390 16517 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 18039 16504 gene locus_tag LOCUS_16400 18039 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 19009 18032 gene locus_tag LOCUS_16410 19009 18032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 19745 19080 gene locus_tag LOCUS_16420 19745 19080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 20134 19733 gene locus_tag LOCUS_16430 20134 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 20505 20134 gene locus_tag LOCUS_16440 20505 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 20617 21108 gene locus_tag LOCUS_16450 20617 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 21143 22159 gene locus_tag LOCUS_16460 21143 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 22224 23273 gene locus_tag LOCUS_16470 gene lpxD 22224 23273 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011212755.1 protein_id gnl|my_center|LOCUS_16470 23897 23298 gene locus_tag LOCUS_16480 gene folE 23897 23298 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_16480 24940 23906 gene locus_tag LOCUS_16490 24940 23906 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_16490 26963 25164 gene locus_tag LOCUS_16500 26963 25164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 27573 27001 gene locus_tag LOCUS_16510 gene uppC 27573 27001 CDS product polysaccharide export protein UppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971492.1 protein_id gnl|my_center|LOCUS_16510 28140 27655 gene locus_tag LOCUS_16520 28140 27655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence30 1806 1420 gene locus_tag LOCUS_16530 1806 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2605 2108 gene locus_tag LOCUS_16540 2605 2108 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_16540 2986 2618 gene locus_tag LOCUS_16550 2986 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 4072 3020 gene locus_tag LOCUS_16560 4072 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4575 4087 gene locus_tag LOCUS_16570 4575 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4815 4588 gene locus_tag LOCUS_16580 4815 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5653 4862 gene locus_tag LOCUS_16590 5653 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 6332 5718 gene locus_tag LOCUS_16600 6332 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7151 6471 gene locus_tag LOCUS_16610 gene lepB 7151 6471 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_16610 8934 7153 gene locus_tag LOCUS_16620 gene lepA 8934 7153 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_16620 9586 8936 gene locus_tag LOCUS_16630 gene rpe 9586 8936 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_16630 10877 9606 gene locus_tag LOCUS_16640 10877 9606 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_16640 11324 10890 gene locus_tag LOCUS_16650 gene ruvX 11324 10890 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_16650 12246 11422 gene locus_tag LOCUS_16660 gene trpA 12246 11422 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_16660 13429 12239 gene locus_tag LOCUS_16670 gene trpB 13429 12239 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105014.1 protein_id gnl|my_center|LOCUS_16670 14208 13426 gene locus_tag LOCUS_16680 14208 13426 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_16680 16125 14215 gene locus_tag LOCUS_16690 16125 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 17112 16147 gene locus_tag LOCUS_16700 17112 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 18263 17094 gene locus_tag LOCUS_16710 18263 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 19377 18265 gene locus_tag LOCUS_16720 19377 18265 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392745.1 protein_id gnl|my_center|LOCUS_16720 20128 19367 gene locus_tag LOCUS_16730 20128 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 20811 20125 gene locus_tag LOCUS_16740 20811 20125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 21186 22415 gene locus_tag LOCUS_16750 21186 22415 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_16750 22417 23547 gene locus_tag LOCUS_16760 22417 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence31 487 957 gene locus_tag LOCUS_16770 gene folK 487 957 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_16770 941 1837 gene locus_tag LOCUS_16780 gene panC 941 1837 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_16780 1970 2320 gene locus_tag LOCUS_16790 1970 2320 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723010.1 protein_id gnl|my_center|LOCUS_16790 2419 3231 gene locus_tag LOCUS_16800 2419 3231 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_16800 3228 6005 gene locus_tag LOCUS_16810 gene uvrA 3228 6005 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583250.1 protein_id gnl|my_center|LOCUS_16810 6177 6392 gene locus_tag LOCUS_16820 6177 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 6411 6725 gene locus_tag LOCUS_16830 6411 6725 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_16830 6880 10029 gene locus_tag LOCUS_16840 6880 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 10037 10558 gene locus_tag LOCUS_16850 10037 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 10527 10724 gene locus_tag LOCUS_16860 10527 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 10777 11727 gene locus_tag LOCUS_16870 10777 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 11983 11714 gene locus_tag LOCUS_16880 gene rpsT 11983 11714 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_16880 12087 13649 gene locus_tag LOCUS_16890 gene murJ 12087 13649 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_16890 13674 15098 gene locus_tag LOCUS_16900 13674 15098 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence32 2851 3129 gene locus_tag LOCUS_16910 2851 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3157 3525 gene locus_tag LOCUS_16920 3157 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3747 4094 gene locus_tag LOCUS_16930 3747 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4330 4704 gene locus_tag LOCUS_16940 4330 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5077 6255 gene locus_tag LOCUS_16950 5077 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6851 7369 gene locus_tag LOCUS_16960 6851 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 7464 8081 gene locus_tag LOCUS_16970 7464 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8594 9001 gene locus_tag LOCUS_16980 8594 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9934 9011 gene locus_tag LOCUS_16990 9934 9011 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_16990 10290 10790 gene locus_tag LOCUS_17000 10290 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 11326 11868 gene locus_tag LOCUS_17010 gene rfbC 11326 11868 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_17010 12848 12096 gene locus_tag LOCUS_17020 12848 12096 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545809.1 protein_id gnl|my_center|LOCUS_17020 13007 14017 gene locus_tag LOCUS_17030 13007 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 14014 15594 gene locus_tag LOCUS_17040 14014 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 16017 16472 gene locus_tag LOCUS_17050 16017 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 16555 16863 gene locus_tag LOCUS_17060 16555 16863 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_17060 16964 18232 gene locus_tag LOCUS_17070 16964 18232 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969160.1 protein_id gnl|my_center|LOCUS_17070 18260 18481 gene locus_tag LOCUS_17080 18260 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 18559 19332 gene locus_tag LOCUS_17090 18559 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 20492 19314 gene locus_tag LOCUS_17100 20492 19314 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664911.1 protein_id gnl|my_center|LOCUS_17100 20640 22070 gene locus_tag LOCUS_17110 20640 22070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence33 751 383 gene locus_tag LOCUS_17120 751 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17120 2948 852 gene locus_tag LOCUS_17130 2948 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3854 3078 gene locus_tag LOCUS_17140 3854 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4342 4596 gene locus_tag LOCUS_17150 4342 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 4703 6022 gene locus_tag LOCUS_17160 4703 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6517 6026 gene locus_tag LOCUS_17170 6517 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 6688 7320 gene locus_tag LOCUS_17180 6688 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 8213 7551 gene locus_tag LOCUS_17190 8213 7551 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_17190 8935 8399 gene locus_tag LOCUS_17200 8935 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 9742 9113 gene locus_tag LOCUS_17210 9742 9113 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939818.1 protein_id gnl|my_center|LOCUS_17210 9983 9801 gene locus_tag LOCUS_17220 9983 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 10494 10114 gene locus_tag LOCUS_17230 10494 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11765 10590 gene locus_tag LOCUS_17240 11765 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 12288 11782 gene locus_tag LOCUS_17250 12288 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 12516 12316 gene locus_tag LOCUS_17260 12516 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 12924 12541 gene locus_tag LOCUS_17270 12924 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 13394 12921 gene locus_tag LOCUS_17280 13394 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 14115 13513 gene locus_tag LOCUS_17290 gene metW 14115 13513 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_17290 15265 14132 gene locus_tag LOCUS_17300 15265 14132 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_17300 16581 15283 gene locus_tag LOCUS_17310 16581 15283 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_17310 17048 16737 gene locus_tag LOCUS_17320 17048 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 17808 17230 gene locus_tag LOCUS_17330 17808 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 18486 17851 gene locus_tag LOCUS_17340 18486 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 18582 19994 gene locus_tag LOCUS_17350 18582 19994 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence34 >Feature sequence35 7708 8586 gene locus_tag LOCUS_17360 7708 8586 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_17360 8612 9202 gene locus_tag LOCUS_17370 gene gmk 8612 9202 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_17370 9183 9407 gene locus_tag LOCUS_17380 9183 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 9367 9960 gene locus_tag LOCUS_17390 9367 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17390 9960 10634 gene locus_tag LOCUS_17400 9960 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 10731 11189 gene locus_tag LOCUS_17410 10731 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 11263 11334 gene locus_tag LOCUS_t00340 11263 11334 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 11443 11531 gene locus_tag LOCUS_t00350 11443 11531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence36 1221 109 gene locus_tag LOCUS_17420 1221 109 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_17420 2477 1716 gene locus_tag LOCUS_17430 2477 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3073 2876 gene locus_tag LOCUS_17440 3073 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3249 3070 gene locus_tag LOCUS_17450 3249 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3551 3390 gene locus_tag LOCUS_17460 3551 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3891 3607 gene locus_tag LOCUS_17470 3891 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4333 3974 gene locus_tag LOCUS_17480 4333 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4571 4365 gene locus_tag LOCUS_17490 4571 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5044 4661 gene locus_tag LOCUS_17500 5044 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5316 5026 gene locus_tag LOCUS_17510 5316 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6835 5360 gene locus_tag LOCUS_17520 6835 5360 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009922704.1 protein_id gnl|my_center|LOCUS_17520 8272 6863 gene locus_tag LOCUS_17530 8272 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 10330 8348 gene locus_tag LOCUS_17540 10330 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 10665 10405 gene locus_tag LOCUS_17550 10665 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 12067 11222 gene locus_tag LOCUS_17560 12067 11222 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_17560 13310 12078 gene locus_tag LOCUS_17570 13310 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 13859 13314 gene locus_tag LOCUS_17580 13859 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 <14881 14040 gene locus_tag LOCUS_17590 <14881 14040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_031153501.1:ice-binding family protein >Feature sequence37 >Feature sequence38 >Feature sequence39 7468 6977 gene locus_tag LOCUS_17600 7468 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 9558 7897 gene locus_tag LOCUS_17610 gene argS 9558 7897 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_17610 9896 9555 gene locus_tag LOCUS_17620 gene rsfS 9896 9555 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_17620 12238 10571 gene locus_tag LOCUS_17630 12238 10571 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946471.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence40 8440 7898 gene locus_tag LOCUS_17640 8440 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence41 4997 5611 gene locus_tag LOCUS_17650 4997 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5616 6848 gene locus_tag LOCUS_17660 5616 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 6962 7609 gene locus_tag LOCUS_17670 gene vpsN 6962 7609 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_17670 7632 9566 gene locus_tag LOCUS_17680 7632 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence42 1093 575 gene locus_tag LOCUS_17690 1093 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1866 1054 gene locus_tag LOCUS_17700 1866 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3058 2006 gene locus_tag LOCUS_17710 3058 2006 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_17710 4344 3229 gene locus_tag LOCUS_17720 gene aroA 4344 3229 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_17720 5461 4580 gene locus_tag LOCUS_17730 5461 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 5852 5598 gene locus_tag LOCUS_17740 5852 5598 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_17740 6442 5990 gene locus_tag LOCUS_17750 gene nrdR 6442 5990 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_17750 7806 6499 gene locus_tag LOCUS_17760 7806 6499 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_17760 8209 7754 gene locus_tag LOCUS_17770 gene rpiB 8209 7754 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869549.1 protein_id gnl|my_center|LOCUS_17770 9267 8206 gene locus_tag LOCUS_17780 9267 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 9857 9360 gene locus_tag LOCUS_17790 gene purE 9857 9360 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence43 543 1511 gene locus_tag LOCUS_17800 543 1511 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_17800 1508 2443 gene locus_tag LOCUS_17810 1508 2443 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_17810 2499 3404 gene locus_tag LOCUS_17820 2499 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4826 3834 gene locus_tag LOCUS_17830 4826 3834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_17830 4743 5015 gene locus_tag LOCUS_17840 4743 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence44 467 318 gene locus_tag LOCUS_17850 467 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 423 584 gene locus_tag LOCUS_17860 423 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 685 1524 gene locus_tag LOCUS_17870 685 1524 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_17870 2679 1576 gene locus_tag LOCUS_17880 2679 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4082 2955 gene locus_tag LOCUS_17890 4082 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4957 4244 gene locus_tag LOCUS_17900 4957 4244 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_17900 6210 5008 gene locus_tag LOCUS_17910 6210 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 7132 6776 gene locus_tag LOCUS_17920 7132 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 <9448 7542 gene locus_tag LOCUS_17930 <9448 7542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein >Feature sequence45 1934 1296 gene locus_tag LOCUS_17940 1934 1296 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 protein_id gnl|my_center|LOCUS_17940 2281 2940 gene locus_tag LOCUS_17950 2281 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3096 3545 gene locus_tag LOCUS_17960 3096 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3596 3817 gene locus_tag LOCUS_17970 3596 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 4250 4735 gene locus_tag LOCUS_17980 4250 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4739 5038 gene locus_tag LOCUS_17990 4739 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5048 5452 gene locus_tag LOCUS_18000 5048 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5762 6421 gene locus_tag LOCUS_18010 5762 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 6525 6944 gene locus_tag LOCUS_18020 6525 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6971 7144 gene locus_tag LOCUS_18030 6971 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7208 7897 gene locus_tag LOCUS_18040 7208 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence46 59 424 gene locus_tag LOCUS_18050 59 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 468 1589 gene locus_tag LOCUS_18060 gene carA 468 1589 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_18060 1662 1919 gene locus_tag LOCUS_18070 1662 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2067 5363 gene locus_tag LOCUS_18080 gene carB 2067 5363 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_18080 5372 6130 gene locus_tag LOCUS_18090 5372 6130 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_18090 6120 7037 gene locus_tag LOCUS_18100 6120 7037 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_18100 7075 7434 gene locus_tag LOCUS_18110 7075 7434 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_18110 7514 8221 gene locus_tag LOCUS_18120 gene pyrF 7514 8221 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence47 334 1839 gene locus_tag LOCUS_18130 gene gcvPB 334 1839 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_18130 1854 2537 gene locus_tag LOCUS_18140 1854 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2544 2924 gene locus_tag LOCUS_18150 2544 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_18150 2921 4954 gene locus_tag LOCUS_18160 gene pcrA 2921 4954 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence48 1116 427 gene locus_tag LOCUS_18170 1116 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2680 1223 gene locus_tag LOCUS_18180 2680 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3536 2982 gene locus_tag LOCUS_18190 3536 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4717 3548 gene locus_tag LOCUS_18200 4717 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 6427 5612 gene locus_tag LOCUS_18210 6427 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence49 393 184 gene locus_tag LOCUS_18220 393 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 841 380 gene locus_tag LOCUS_18230 841 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1208 834 gene locus_tag LOCUS_18240 1208 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1299 1541 gene locus_tag LOCUS_18250 1299 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1794 1516 gene locus_tag LOCUS_18260 1794 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1865 2359 gene locus_tag LOCUS_18270 1865 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2447 2812 gene locus_tag LOCUS_18280 2447 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2816 3226 gene locus_tag LOCUS_18290 2816 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3230 3421 gene locus_tag LOCUS_18300 3230 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3574 6507 gene locus_tag LOCUS_18310 3574 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence50 576 1853 gene locus_tag LOCUS_18320 576 1853 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_18320 1876 3402 gene locus_tag LOCUS_18330 1876 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4198 5493 gene locus_tag LOCUS_18340 4198 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5486 6031 gene locus_tag LOCUS_18350 5486 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence51 1231 245 gene locus_tag LOCUS_18360 1231 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1392 1808 gene locus_tag LOCUS_18370 1392 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3850 2075 gene locus_tag LOCUS_18380 gene msbA 3850 2075 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_18380 4072 5025 gene locus_tag LOCUS_18390 4072 5025 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947102.1 protein_id gnl|my_center|LOCUS_18390 5159 6178 gene locus_tag LOCUS_18400 gene lpxB 5159 6178 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947101.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence52 2460 1480 gene locus_tag LOCUS_18410 gene prfB 2460 1480 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence53 313 2343 gene locus_tag LOCUS_18420 313 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2382 3032 gene locus_tag LOCUS_18430 2382 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3094 4947 gene locus_tag LOCUS_18440 3094 4947 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_18440 4974 5822 gene locus_tag LOCUS_18450 4974 5822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142701.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence54 1396 140 gene locus_tag LOCUS_18460 gene fabF 1396 140 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_18460 2720 1428 gene locus_tag LOCUS_18470 2720 1428 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_18470 3452 2961 gene locus_tag LOCUS_18480 3452 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3786 3538 gene locus_tag LOCUS_18490 3786 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 4666 3956 gene locus_tag LOCUS_18500 4666 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5182 4673 gene locus_tag LOCUS_18510 5182 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 <5710 5182 gene locus_tag LOCUS_18520 <5710 5182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421576.1:HAMP domain-containing sensor histidine kinase >Feature sequence55 1818 1483 gene locus_tag LOCUS_18530 1818 1483 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_18530 2277 2080 gene locus_tag LOCUS_18540 2277 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4701 2536 gene locus_tag LOCUS_18550 4701 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence56 2142 2819 gene locus_tag LOCUS_18560 2142 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2899 3204 gene locus_tag LOCUS_18570 2899 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3474 4196 gene locus_tag LOCUS_18580 3474 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence57 1387 212 gene locus_tag LOCUS_18590 1387 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2712 1399 gene locus_tag LOCUS_18600 2712 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4281 2713 gene locus_tag LOCUS_18610 4281 2713 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence58 2078 840 gene locus_tag LOCUS_18620 2078 840 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_18620 2231 2100 gene locus_tag LOCUS_18630 2231 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3298 2258 gene locus_tag LOCUS_18640 3298 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence59 3032 546 gene locus_tag LOCUS_18650 3032 546 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_18650 3420 3037 gene locus_tag LOCUS_18660 3420 3037 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940728.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence60 1821 64 gene locus_tag LOCUS_18670 1821 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3366 1972 gene locus_tag LOCUS_18680 3366 1972 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence61 430 1191 gene locus_tag LOCUS_18690 430 1191 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868017.1 protein_id gnl|my_center|LOCUS_18690 1464 2348 gene locus_tag LOCUS_18700 1464 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2863 2435 gene locus_tag LOCUS_18710 2863 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 3139 2975 gene locus_tag LOCUS_18720 3139 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence62 180 743 gene locus_tag LOCUS_18730 180 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 793 1254 gene locus_tag LOCUS_18740 793 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1518 2135 gene locus_tag LOCUS_18750 1518 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2830 2132 gene locus_tag LOCUS_18760 2830 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence63 446 1276 gene locus_tag LOCUS_18770 446 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1257 1433 gene locus_tag LOCUS_18780 1257 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1448 1648 gene locus_tag LOCUS_18790 1448 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790