>Feature sequence001 2223 1396 gene locus_tag LOCUS_00010 2223 1396 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967704.1 protein_id gnl|my_center|LOCUS_00010 2575 2204 gene locus_tag LOCUS_00020 2575 2204 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391352.1 protein_id gnl|my_center|LOCUS_00020 3798 2572 gene locus_tag LOCUS_00030 3798 2572 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_00030 5119 3920 gene locus_tag LOCUS_00040 5119 3920 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_00040 6061 5135 gene locus_tag LOCUS_00050 6061 5135 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_00050 6949 6200 gene locus_tag LOCUS_00060 6949 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7875 7027 gene locus_tag LOCUS_00070 7875 7027 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_00070 9005 7956 gene locus_tag LOCUS_00080 9005 7956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528082.1 protein_id gnl|my_center|LOCUS_00080 10090 9002 gene locus_tag LOCUS_00090 10090 9002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970664.1 protein_id gnl|my_center|LOCUS_00090 11087 10092 gene locus_tag LOCUS_00100 11087 10092 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528079.1 protein_id gnl|my_center|LOCUS_00100 12226 11093 gene locus_tag LOCUS_00110 12226 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13632 12313 gene locus_tag LOCUS_00120 13632 12313 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_00120 14050 14934 gene locus_tag LOCUS_00130 14050 14934 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967714.1 protein_id gnl|my_center|LOCUS_00130 14941 16164 gene locus_tag LOCUS_00140 14941 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16211 17071 gene locus_tag LOCUS_00150 16211 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16971 17201 gene locus_tag LOCUS_00160 16971 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17648 17235 gene locus_tag LOCUS_00170 17648 17235 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_00170 18374 17811 gene locus_tag LOCUS_00180 18374 17811 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_00180 19754 18381 gene locus_tag LOCUS_00190 19754 18381 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105055.1 protein_id gnl|my_center|LOCUS_00190 20248 19919 gene locus_tag LOCUS_00200 gene cyaY 20248 19919 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196764.1 protein_id gnl|my_center|LOCUS_00200 20505 20242 gene locus_tag LOCUS_00210 20505 20242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20482 21726 gene locus_tag LOCUS_00220 gene lysA 20482 21726 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028114612.1 protein_id gnl|my_center|LOCUS_00220 24159 21940 gene locus_tag LOCUS_00230 24159 21940 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_00230 24641 25720 gene locus_tag LOCUS_00240 24641 25720 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_00240 25717 26283 gene locus_tag LOCUS_00250 gene pilN 25717 26283 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_00250 26283 26954 gene locus_tag LOCUS_00260 gene pilO 26283 26954 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765501.1 protein_id gnl|my_center|LOCUS_00260 26951 27472 gene locus_tag LOCUS_00270 26951 27472 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692554.1 protein_id gnl|my_center|LOCUS_00270 27473 29530 gene locus_tag LOCUS_00280 gene pilQ 27473 29530 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_00280 29618 30154 gene locus_tag LOCUS_00290 29618 30154 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222978.1 protein_id gnl|my_center|LOCUS_00290 30142 31230 gene locus_tag LOCUS_00300 gene aroB 30142 31230 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_00300 31223 32344 gene locus_tag LOCUS_00310 31223 32344 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_00310 32851 32390 gene locus_tag LOCUS_00320 32851 32390 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_00320 34552 33134 gene locus_tag LOCUS_00330 gene pntB 34552 33134 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014056.1 protein_id gnl|my_center|LOCUS_00330 36151 34559 gene locus_tag LOCUS_00340 gene pntA 36151 34559 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602311.1 protein_id gnl|my_center|LOCUS_00340 36865 41538 gene locus_tag LOCUS_00350 36865 41538 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_00350 41541 42983 gene locus_tag LOCUS_00360 41541 42983 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_00360 43306 44664 gene locus_tag LOCUS_00370 gene glmU 43306 44664 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_00370 44672 46501 gene locus_tag LOCUS_00380 gene glmS 44672 46501 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_00380 48704 46539 gene locus_tag LOCUS_00390 48704 46539 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_00390 50411 49224 gene locus_tag LOCUS_00400 50411 49224 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_00400 50783 51655 gene locus_tag LOCUS_00410 50783 51655 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_00410 51648 53750 gene locus_tag LOCUS_00420 51648 53750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 54550 53903 gene locus_tag LOCUS_00430 54550 53903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 56103 54649 gene locus_tag LOCUS_00440 gene rng 56103 54649 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_00440 56260 57513 gene locus_tag LOCUS_00450 gene yegQ 56260 57513 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_00450 57527 58645 gene locus_tag LOCUS_00460 57527 58645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_00460 58642 59187 gene locus_tag LOCUS_00470 gene petA 58642 59187 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707597.1 protein_id gnl|my_center|LOCUS_00470 59180 59608 gene locus_tag LOCUS_00480 59180 59608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 59868 63575 gene locus_tag LOCUS_00490 gene metH 59868 63575 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_00490 63602 64639 gene locus_tag LOCUS_00500 gene murB 63602 64639 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_00500 65368 64667 gene locus_tag LOCUS_00510 65368 64667 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930119.1 protein_id gnl|my_center|LOCUS_00510 66013 65669 gene locus_tag LOCUS_00520 66013 65669 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_00520 66400 67002 gene locus_tag LOCUS_00530 66400 67002 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_00530 67197 67928 gene locus_tag LOCUS_00540 67197 67928 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_00540 68916 67975 gene locus_tag LOCUS_00550 68916 67975 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_00550 68975 69178 gene locus_tag LOCUS_00560 68975 69178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 69447 70472 gene locus_tag LOCUS_00570 gene dnaJ 69447 70472 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_00570 71583 70480 gene locus_tag LOCUS_00580 71583 70480 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 protein_id gnl|my_center|LOCUS_00580 73117 71618 gene locus_tag LOCUS_00590 73117 71618 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_00590 73410 73817 gene locus_tag LOCUS_00600 73410 73817 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496720.1 protein_id gnl|my_center|LOCUS_00600 75288 73891 gene locus_tag LOCUS_00610 75288 73891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 77191 75530 gene locus_tag LOCUS_00620 77191 75530 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_00620 77514 77188 gene locus_tag LOCUS_00630 77514 77188 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_00630 77654 78769 gene locus_tag LOCUS_00640 77654 78769 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_00640 78766 81828 gene locus_tag LOCUS_00650 78766 81828 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_00650 82816 81854 gene locus_tag LOCUS_00660 82816 81854 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814870.1 protein_id gnl|my_center|LOCUS_00660 83703 82813 gene locus_tag LOCUS_00670 83703 82813 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 protein_id gnl|my_center|LOCUS_00670 83968 83690 gene locus_tag LOCUS_00680 83968 83690 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113606.1 protein_id gnl|my_center|LOCUS_00680 84545 83961 gene locus_tag LOCUS_00690 84545 83961 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 protein_id gnl|my_center|LOCUS_00690 84849 86789 gene locus_tag LOCUS_00700 84849 86789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085303.1 protein_id gnl|my_center|LOCUS_00700 86800 88446 gene locus_tag LOCUS_00710 86800 88446 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085302.1 protein_id gnl|my_center|LOCUS_00710 89302 88643 gene locus_tag LOCUS_00720 89302 88643 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_00720 91279 89585 gene locus_tag LOCUS_00730 gene leuA 91279 89585 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_00730 91455 91925 gene locus_tag LOCUS_00740 91455 91925 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_00740 91922 92548 gene locus_tag LOCUS_00750 91922 92548 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_00750 93397 92570 gene locus_tag LOCUS_00760 93397 92570 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 protein_id gnl|my_center|LOCUS_00760 93296 93517 gene locus_tag LOCUS_00770 93296 93517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 93610 93936 gene locus_tag LOCUS_00780 93610 93936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 94160 94801 gene locus_tag LOCUS_00790 94160 94801 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388742.1 protein_id gnl|my_center|LOCUS_00790 96120 94885 gene locus_tag LOCUS_00800 96120 94885 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_00800 96872 96210 gene locus_tag LOCUS_00810 gene cobC 96872 96210 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_00810 97747 97094 gene locus_tag LOCUS_00820 gene can 97747 97094 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_00820 99837 97981 gene locus_tag LOCUS_00830 99837 97981 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_00830 99949 100689 gene locus_tag LOCUS_00840 99949 100689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 100874 101215 gene locus_tag LOCUS_00850 100874 101215 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_00850 101713 101348 gene locus_tag LOCUS_00860 101713 101348 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_00860 102999 101971 gene locus_tag LOCUS_00870 102999 101971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 103424 104647 gene locus_tag LOCUS_00880 103424 104647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 105170 104733 gene locus_tag LOCUS_00890 105170 104733 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383062.1 protein_id gnl|my_center|LOCUS_00890 105952 105167 gene locus_tag LOCUS_00900 105952 105167 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_00900 106494 105949 gene locus_tag LOCUS_00910 106494 105949 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 protein_id gnl|my_center|LOCUS_00910 107798 106491 gene locus_tag LOCUS_00920 107798 106491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_00920 108319 107795 gene locus_tag LOCUS_00930 108319 107795 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267595.1 protein_id gnl|my_center|LOCUS_00930 109551 108316 gene locus_tag LOCUS_00940 109551 108316 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_00940 110312 109548 gene locus_tag LOCUS_00950 110312 109548 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_00950 111637 110309 gene locus_tag LOCUS_00960 111637 110309 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_00960 112470 111655 gene locus_tag LOCUS_00970 gene folE2 112470 111655 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813103.1 protein_id gnl|my_center|LOCUS_00970 113067 112507 gene locus_tag LOCUS_00980 113067 112507 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036687.1 protein_id gnl|my_center|LOCUS_00980 115275 113287 gene locus_tag LOCUS_00990 115275 113287 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_00990 116827 115295 gene locus_tag LOCUS_01000 116827 115295 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_01000 117928 116930 gene locus_tag LOCUS_01010 gene meaB 117928 116930 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_01010 120135 117961 gene locus_tag LOCUS_01020 gene scpA 120135 117961 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_01020 120337 121011 gene locus_tag LOCUS_01030 120337 121011 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930715.1 protein_id gnl|my_center|LOCUS_01030 121008 121787 gene locus_tag LOCUS_01040 121008 121787 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928184.1 protein_id gnl|my_center|LOCUS_01040 122595 121795 gene locus_tag LOCUS_01050 122595 121795 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_01050 123705 122629 gene locus_tag LOCUS_01060 gene rfbB 123705 122629 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_01060 125181 123760 gene locus_tag LOCUS_01070 125181 123760 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_01070 125331 126287 gene locus_tag LOCUS_01080 gene waaC 125331 126287 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530067.1 protein_id gnl|my_center|LOCUS_01080 126278 127555 gene locus_tag LOCUS_01090 gene waaA 126278 127555 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_01090 128879 127530 gene locus_tag LOCUS_01100 128879 127530 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_01100 129654 128989 gene locus_tag LOCUS_01110 129654 128989 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_01110 130149 129880 gene locus_tag LOCUS_01120 gene rpsT 130149 129880 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_01120 130417 131337 gene locus_tag LOCUS_01130 130417 131337 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_01130 131458 132657 gene locus_tag LOCUS_01140 131458 132657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526570.1 protein_id gnl|my_center|LOCUS_01140 133913 132675 gene locus_tag LOCUS_01150 133913 132675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 135460 133925 gene locus_tag LOCUS_01160 gene ppx 135460 133925 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_01160 137735 135705 gene locus_tag LOCUS_01170 137735 135705 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247688.1 protein_id gnl|my_center|LOCUS_01170 139131 138037 gene locus_tag LOCUS_01180 gene hemE 139131 138037 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706638.1 protein_id gnl|my_center|LOCUS_01180 140645 139191 gene locus_tag LOCUS_01190 140645 139191 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_01190 142087 140657 gene locus_tag LOCUS_01200 gene trkA 142087 140657 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_01200 143392 142130 gene locus_tag LOCUS_01210 143392 142130 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690124.1 protein_id gnl|my_center|LOCUS_01210 145548 143395 gene locus_tag LOCUS_01220 145548 143395 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_01220 146168 145545 gene locus_tag LOCUS_01230 146168 145545 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_01230 147099 146143 gene locus_tag LOCUS_01240 147099 146143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 147566 148561 gene locus_tag LOCUS_01250 147566 148561 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_01250 149533 148607 gene locus_tag LOCUS_01260 gene fmt 149533 148607 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_01260 149973 149530 gene locus_tag LOCUS_01270 gene def 149973 149530 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_01270 150215 151231 gene locus_tag LOCUS_01280 150215 151231 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_01280 151234 152364 gene locus_tag LOCUS_01290 gene dprA 151234 152364 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_01290 152624 155218 gene locus_tag LOCUS_01300 152624 155218 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_01300 156257 155346 gene locus_tag LOCUS_01310 156257 155346 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_01310 157161 156382 gene locus_tag LOCUS_01320 157161 156382 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_01320 157218 157574 gene locus_tag LOCUS_01330 157218 157574 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463615.1 protein_id gnl|my_center|LOCUS_01330 159628 157712 gene locus_tag LOCUS_01340 gene thiC 159628 157712 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521865.1 protein_id gnl|my_center|LOCUS_01340 160043 159968 gene locus_tag LOCUS_t00010 160043 159968 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 160144 160069 gene locus_tag LOCUS_t00020 160144 160069 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 160819 160217 gene locus_tag LOCUS_01350 160819 160217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 160971 161810 gene locus_tag LOCUS_01360 gene pyrF 160971 161810 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_01360 164356 161882 gene locus_tag LOCUS_01370 gene gyrB 164356 161882 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_01370 165552 164419 gene locus_tag LOCUS_01380 gene dnaN 165552 164419 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_01380 167153 165765 gene locus_tag LOCUS_01390 167153 165765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 167600 167989 gene locus_tag LOCUS_01400 167600 167989 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816026.1 protein_id gnl|my_center|LOCUS_01400 168230 169912 gene locus_tag LOCUS_01410 gene yidC 168230 169912 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_01410 169977 171254 gene locus_tag LOCUS_01420 gene mnmE 169977 171254 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 protein_id gnl|my_center|LOCUS_01420 172269 171295 gene locus_tag LOCUS_01430 172269 171295 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388784.1 protein_id gnl|my_center|LOCUS_01430 172822 175350 gene locus_tag LOCUS_01440 172822 175350 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965877.1 protein_id gnl|my_center|LOCUS_01440 175414 175830 gene locus_tag LOCUS_01450 175414 175830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 175856 176092 gene locus_tag LOCUS_01460 175856 176092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 176546 176857 gene locus_tag LOCUS_01470 176546 176857 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_01470 178080 176929 gene locus_tag LOCUS_01480 178080 176929 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_01480 178731 178159 gene locus_tag LOCUS_01490 178731 178159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 179911 178733 gene locus_tag LOCUS_01500 179911 178733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 180576 179917 gene locus_tag LOCUS_01510 180576 179917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 182068 180788 gene locus_tag LOCUS_01520 gene gltA 182068 180788 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 protein_id gnl|my_center|LOCUS_01520 182598 182918 gene locus_tag LOCUS_01530 182598 182918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 182915 185515 gene locus_tag LOCUS_01540 182915 185515 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811808.1 protein_id gnl|my_center|LOCUS_01540 185572 188946 gene locus_tag LOCUS_01550 185572 188946 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 protein_id gnl|my_center|LOCUS_01550 188985 191528 gene locus_tag LOCUS_01560 188985 191528 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 protein_id gnl|my_center|LOCUS_01560 191534 192529 gene locus_tag LOCUS_01570 191534 192529 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_01570 193134 192601 gene locus_tag LOCUS_01580 193134 192601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 193658 195340 gene locus_tag LOCUS_01590 gene ilvB 193658 195340 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937667.1 protein_id gnl|my_center|LOCUS_01590 195344 195652 gene locus_tag LOCUS_01600 gene ilvN 195344 195652 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937668.1 protein_id gnl|my_center|LOCUS_01600 196603 195713 gene locus_tag LOCUS_01610 196603 195713 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_01610 197605 196610 gene locus_tag LOCUS_01620 gene bioB 197605 196610 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_01620 197674 198393 gene locus_tag LOCUS_01630 197674 198393 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_01630 198839 198381 gene locus_tag LOCUS_01640 198839 198381 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 protein_id gnl|my_center|LOCUS_01640 198976 199593 gene locus_tag LOCUS_01650 198976 199593 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337686.1 protein_id gnl|my_center|LOCUS_01650 200103 202319 gene locus_tag LOCUS_01660 200103 202319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 203847 202765 gene locus_tag LOCUS_01670 203847 202765 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405391.1 protein_id gnl|my_center|LOCUS_01670 203850 204056 gene locus_tag LOCUS_01680 203850 204056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 204251 204553 gene locus_tag LOCUS_01690 204251 204553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence002 653 54 gene locus_tag LOCUS_01700 gene mobA 653 54 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192903.1 protein_id gnl|my_center|LOCUS_01700 918 2081 gene locus_tag LOCUS_01710 918 2081 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_01710 3244 2156 gene locus_tag LOCUS_01720 3244 2156 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226367.1 protein_id gnl|my_center|LOCUS_01720 3499 5262 gene locus_tag LOCUS_01730 3499 5262 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114602.1 protein_id gnl|my_center|LOCUS_01730 5551 5264 gene locus_tag LOCUS_01740 5551 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 6004 8727 gene locus_tag LOCUS_01750 6004 8727 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_01750 9214 8774 gene locus_tag LOCUS_01760 gene mscL 9214 8774 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 protein_id gnl|my_center|LOCUS_01760 10251 9610 gene locus_tag LOCUS_01770 10251 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 11676 10519 gene locus_tag LOCUS_01780 11676 10519 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_01780 11858 12925 gene locus_tag LOCUS_01790 11858 12925 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_01790 13563 13051 gene locus_tag LOCUS_01800 gene lysM 13563 13051 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369692.1 protein_id gnl|my_center|LOCUS_01800 13852 15720 gene locus_tag LOCUS_01810 gene nadN 13852 15720 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_01810 17003 15834 gene locus_tag LOCUS_01820 17003 15834 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_01820 17896 17054 gene locus_tag LOCUS_01830 17896 17054 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_01830 18409 17981 gene locus_tag LOCUS_01840 18409 17981 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_01840 19523 18390 gene locus_tag LOCUS_01850 19523 18390 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_01850 20206 19520 gene locus_tag LOCUS_01860 gene nth 20206 19520 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_01860 20897 20199 gene locus_tag LOCUS_01870 20897 20199 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944880.1 protein_id gnl|my_center|LOCUS_01870 21562 20894 gene locus_tag LOCUS_01880 gene rsxG 21562 20894 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_01880 22581 21559 gene locus_tag LOCUS_01890 gene rsxD 22581 21559 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863730.1 protein_id gnl|my_center|LOCUS_01890 24329 22578 gene locus_tag LOCUS_01900 24329 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 24876 24334 gene locus_tag LOCUS_01910 gene rsxB 24876 24334 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650033.1 protein_id gnl|my_center|LOCUS_01910 25484 24873 gene locus_tag LOCUS_01920 gene rsxA 25484 24873 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_01920 26592 25555 gene locus_tag LOCUS_01930 26592 25555 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_01930 26811 27047 gene locus_tag LOCUS_01940 26811 27047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 27719 27294 gene locus_tag LOCUS_01950 27719 27294 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_01950 28022 28846 gene locus_tag LOCUS_01960 28022 28846 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_01960 28857 29549 gene locus_tag LOCUS_01970 28857 29549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061034.1 protein_id gnl|my_center|LOCUS_01970 29546 30196 gene locus_tag LOCUS_01980 29546 30196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943340.1 protein_id gnl|my_center|LOCUS_01980 31144 30245 gene locus_tag LOCUS_01990 gene truB 31144 30245 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_01990 31568 31146 gene locus_tag LOCUS_02000 gene rbfA 31568 31146 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220822.1 protein_id gnl|my_center|LOCUS_02000 34376 31569 gene locus_tag LOCUS_02010 34376 31569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 35868 34396 gene locus_tag LOCUS_02020 gene nusA 35868 34396 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_02020 36320 35883 gene locus_tag LOCUS_02030 gene rimP 36320 35883 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_02030 37210 36491 gene locus_tag LOCUS_02040 37210 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 38033 37434 gene locus_tag LOCUS_02050 38033 37434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02050 38865 38023 gene locus_tag LOCUS_02060 38865 38023 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_02060 40094 38892 gene locus_tag LOCUS_02070 40094 38892 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_02070 40766 40110 gene locus_tag LOCUS_02080 40766 40110 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_02080 41406 40780 gene locus_tag LOCUS_02090 41406 40780 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_02090 42254 41424 gene locus_tag LOCUS_02100 42254 41424 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_02100 42486 46364 gene locus_tag LOCUS_02110 42486 46364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 46361 48139 gene locus_tag LOCUS_02120 46361 48139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 48173 48781 gene locus_tag LOCUS_02130 48173 48781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 48735 49160 gene locus_tag LOCUS_02140 48735 49160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 49162 54135 gene locus_tag LOCUS_02150 49162 54135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 54465 54371 gene locus_tag LOCUS_t00030 54465 54371 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 55617 55318 gene locus_tag LOCUS_02160 55617 55318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02160 59873 56184 gene locus_tag LOCUS_02170 59873 56184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 60907 59903 gene locus_tag LOCUS_02180 60907 59903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 62478 61174 gene locus_tag LOCUS_02190 62478 61174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 63734 63060 gene locus_tag LOCUS_02200 63734 63060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 67392 64786 gene locus_tag LOCUS_02210 gene acnB 67392 64786 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 protein_id gnl|my_center|LOCUS_02210 67369 67899 gene locus_tag LOCUS_02220 67369 67899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 67915 69282 gene locus_tag LOCUS_02230 gene miaB 67915 69282 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_02230 69273 70304 gene locus_tag LOCUS_02240 69273 70304 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_02240 70285 70755 gene locus_tag LOCUS_02250 70285 70755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 70830 71675 gene locus_tag LOCUS_02260 70830 71675 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_02260 71722 73203 gene locus_tag LOCUS_02270 gene lnt 71722 73203 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555980.1 protein_id gnl|my_center|LOCUS_02270 75051 73390 gene locus_tag LOCUS_02280 75051 73390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 75508 75332 gene locus_tag LOCUS_02290 75508 75332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 75754 76329 gene locus_tag LOCUS_02300 75754 76329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768758.1 protein_id gnl|my_center|LOCUS_02300 77205 76453 gene locus_tag LOCUS_02310 77205 76453 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_02310 77826 77380 gene locus_tag LOCUS_02320 77826 77380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 79711 77837 gene locus_tag LOCUS_02330 79711 77837 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_02330 80447 79737 gene locus_tag LOCUS_02340 80447 79737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 81427 80540 gene locus_tag LOCUS_02350 81427 80540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 82296 81430 gene locus_tag LOCUS_02360 82296 81430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 protein_id gnl|my_center|LOCUS_02360 83090 82293 gene locus_tag LOCUS_02370 gene tauC 83090 82293 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 protein_id gnl|my_center|LOCUS_02370 84819 83116 gene locus_tag LOCUS_02380 84819 83116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 85552 84842 gene locus_tag LOCUS_02390 85552 84842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 85643 86383 gene locus_tag LOCUS_02400 85643 86383 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_02400 87394 86495 gene locus_tag LOCUS_02410 87394 86495 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_02410 88508 87507 gene locus_tag LOCUS_02420 gene nhaR 88508 87507 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_02420 88612 89001 gene locus_tag LOCUS_02430 88612 89001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 89199 90077 gene locus_tag LOCUS_02440 gene htpX 89199 90077 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_02440 93138 90094 gene locus_tag LOCUS_02450 93138 90094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 93579 93151 gene locus_tag LOCUS_02460 93579 93151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 94472 93576 gene locus_tag LOCUS_02470 gene ubiA 94472 93576 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_02470 96363 94483 gene locus_tag LOCUS_02480 96363 94483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_02480 97589 96360 gene locus_tag LOCUS_02490 97589 96360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 98151 99791 gene locus_tag LOCUS_02500 98151 99791 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941068.1 protein_id gnl|my_center|LOCUS_02500 101968 99923 gene locus_tag LOCUS_02510 gene recG 101968 99923 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02510 102351 101968 gene locus_tag LOCUS_02520 102351 101968 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_02520 102480 102845 gene locus_tag LOCUS_02530 102480 102845 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 protein_id gnl|my_center|LOCUS_02530 103455 102826 gene locus_tag LOCUS_02540 103455 102826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 104084 103497 gene locus_tag LOCUS_02550 104084 103497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 105442 104240 gene locus_tag LOCUS_02560 105442 104240 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810108.1 protein_id gnl|my_center|LOCUS_02560 107850 105463 gene locus_tag LOCUS_02570 107850 105463 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064157.1 protein_id gnl|my_center|LOCUS_02570 109344 108055 gene locus_tag LOCUS_02580 109344 108055 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_02580 110014 109616 gene locus_tag LOCUS_02590 110014 109616 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_02590 111935 110007 gene locus_tag LOCUS_02600 111935 110007 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064156.1 protein_id gnl|my_center|LOCUS_02600 113272 111971 gene locus_tag LOCUS_02610 113272 111971 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 protein_id gnl|my_center|LOCUS_02610 115711 113360 gene locus_tag LOCUS_02620 115711 113360 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039380.1 protein_id gnl|my_center|LOCUS_02620 116500 115742 gene locus_tag LOCUS_02630 116500 115742 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 protein_id gnl|my_center|LOCUS_02630 116704 118536 gene locus_tag LOCUS_02640 116704 118536 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_02640 118994 118599 gene locus_tag LOCUS_02650 gene rplQ 118994 118599 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064753.1 protein_id gnl|my_center|LOCUS_02650 119999 119025 gene locus_tag LOCUS_02660 gene rpoA 119999 119025 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_02660 120668 120039 gene locus_tag LOCUS_02670 gene rpsD 120668 120039 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_02670 121076 120681 gene locus_tag LOCUS_02680 gene rpsK 121076 120681 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_02680 121459 121097 gene locus_tag LOCUS_02690 gene rpsM 121459 121097 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_02690 121911 121717 gene locus_tag LOCUS_02700 gene infA 121911 121717 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_02700 123262 121937 gene locus_tag LOCUS_02710 gene secY 123262 121937 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_02710 123720 123286 gene locus_tag LOCUS_02720 gene rplO 123720 123286 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_02720 123904 123722 gene locus_tag LOCUS_02730 gene rpmD 123904 123722 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_02730 124432 123908 gene locus_tag LOCUS_02740 gene rpsE 124432 123908 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_02740 124818 124462 gene locus_tag LOCUS_02750 gene rplR 124818 124462 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_02750 125365 124829 gene locus_tag LOCUS_02760 gene rplF 125365 124829 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_02760 125770 125375 gene locus_tag LOCUS_02770 gene rpsH 125770 125375 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_02770 126090 125785 gene locus_tag LOCUS_02780 gene rpsN 126090 125785 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_02780 126636 126097 gene locus_tag LOCUS_02790 gene rplE 126636 126097 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202757.1 protein_id gnl|my_center|LOCUS_02790 126963 126646 gene locus_tag LOCUS_02800 gene rplX 126963 126646 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_02800 127340 126972 gene locus_tag LOCUS_02810 gene rplN 127340 126972 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 protein_id gnl|my_center|LOCUS_02810 127737 127471 gene locus_tag LOCUS_02820 gene rpsQ 127737 127471 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_02820 127925 127734 gene locus_tag LOCUS_02830 gene rpmC 127925 127734 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_02830 128341 127928 gene locus_tag LOCUS_02840 gene rplP 128341 127928 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_02840 129161 128325 gene locus_tag LOCUS_02850 gene rpsC 129161 128325 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_02850 129506 129171 gene locus_tag LOCUS_02860 gene rplV 129506 129171 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199272.1 protein_id gnl|my_center|LOCUS_02860 129786 129511 gene locus_tag LOCUS_02870 gene rpsS 129786 129511 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_02870 130627 129800 gene locus_tag LOCUS_02880 gene rplB 130627 129800 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_02880 130929 130627 gene locus_tag LOCUS_02890 gene rplW 130929 130627 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 protein_id gnl|my_center|LOCUS_02890 131546 130926 gene locus_tag LOCUS_02900 gene rplD 131546 130926 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_02900 132191 131547 gene locus_tag LOCUS_02910 gene rplC 132191 131547 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215400.1 protein_id gnl|my_center|LOCUS_02910 132617 132306 gene locus_tag LOCUS_02920 gene rpsJ 132617 132306 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_02920 133869 132679 gene locus_tag LOCUS_02930 gene tuf 133869 132679 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_02930 135984 133891 gene locus_tag LOCUS_02940 gene fusA 135984 133891 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 protein_id gnl|my_center|LOCUS_02940 136519 136049 gene locus_tag LOCUS_02950 gene rpsG 136519 136049 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_02950 136992 136615 gene locus_tag LOCUS_02960 gene rpsL 136992 136615 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_02960 141373 137159 gene locus_tag LOCUS_02970 gene rpoC 141373 137159 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_02970 145744 141461 gene locus_tag LOCUS_02980 145744 141461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 146371 146003 gene locus_tag LOCUS_02990 gene rplL 146371 146003 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_02990 146915 146418 gene locus_tag LOCUS_03000 gene rplJ 146915 146418 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_03000 147898 147209 gene locus_tag LOCUS_03010 gene rplA 147898 147209 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_03010 148331 147900 gene locus_tag LOCUS_03020 gene rplK 148331 147900 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_03020 148991 148458 gene locus_tag LOCUS_03030 gene nusG 148991 148458 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_03030 149341 148988 gene locus_tag LOCUS_03040 gene secE 149341 148988 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_03040 149440 149365 gene locus_tag LOCUS_t00040 149440 149365 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 150690 149500 gene locus_tag LOCUS_03050 gene tuf 150690 149500 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_03050 150818 150744 gene locus_tag LOCUS_t00050 150818 150744 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 150934 150861 gene locus_tag LOCUS_t00060 150934 150861 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 151070 150986 gene locus_tag LOCUS_t00070 151070 150986 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 151115 151435 gene locus_tag LOCUS_03060 151115 151435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 151541 155092 gene locus_tag LOCUS_03070 151541 155092 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_03070 155149 155949 gene locus_tag LOCUS_03080 155149 155949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 156070 156519 gene locus_tag LOCUS_03090 156070 156519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 157771 156605 gene locus_tag LOCUS_03100 157771 156605 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_03100 158271 157768 gene locus_tag LOCUS_03110 158271 157768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 159089 158277 gene locus_tag LOCUS_03120 159089 158277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_03120 160506 159175 gene locus_tag LOCUS_03130 160506 159175 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_03130 161669 160593 gene locus_tag LOCUS_03140 161669 160593 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_03140 162614 161685 gene locus_tag LOCUS_03150 162614 161685 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_03150 163409 162627 gene locus_tag LOCUS_03160 163409 162627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_03160 165367 163409 gene locus_tag LOCUS_03170 165367 163409 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_03170 165583 166866 gene locus_tag LOCUS_03180 165583 166866 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_03180 166996 167898 gene locus_tag LOCUS_03190 166996 167898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 168220 168029 gene locus_tag LOCUS_03200 168220 168029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 169418 168342 gene locus_tag LOCUS_03210 gene zapE 169418 168342 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_03210 170374 169568 gene locus_tag LOCUS_03220 170374 169568 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 protein_id gnl|my_center|LOCUS_03220 171360 170374 gene locus_tag LOCUS_03230 171360 170374 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389259.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence003 2820 814 gene locus_tag LOCUS_03240 2820 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6557 2817 gene locus_tag LOCUS_03250 6557 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7905 8252 gene locus_tag LOCUS_03260 7905 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 8374 8934 gene locus_tag LOCUS_03270 8374 8934 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_03270 8931 9653 gene locus_tag LOCUS_03280 8931 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 9732 10523 gene locus_tag LOCUS_03290 9732 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10613 13228 gene locus_tag LOCUS_03300 gene leuS 10613 13228 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456399.1 protein_id gnl|my_center|LOCUS_03300 13248 13760 gene locus_tag LOCUS_03310 gene lptE 13248 13760 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 protein_id gnl|my_center|LOCUS_03310 13779 14783 gene locus_tag LOCUS_03320 gene holA 13779 14783 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_03320 15057 14812 gene locus_tag LOCUS_03330 15057 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 15177 16433 gene locus_tag LOCUS_03340 15177 16433 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557250.1 protein_id gnl|my_center|LOCUS_03340 16494 17066 gene locus_tag LOCUS_03350 16494 17066 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_03350 17085 17573 gene locus_tag LOCUS_03360 17085 17573 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_03360 17560 18474 gene locus_tag LOCUS_03370 gene xerD 17560 18474 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 protein_id gnl|my_center|LOCUS_03370 19114 18530 gene locus_tag LOCUS_03380 gene cobC 19114 18530 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 protein_id gnl|my_center|LOCUS_03380 19851 19099 gene locus_tag LOCUS_03390 19851 19099 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_03390 20234 20890 gene locus_tag LOCUS_03400 20234 20890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 21108 21452 gene locus_tag LOCUS_03410 21108 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 21554 21730 gene locus_tag LOCUS_03420 21554 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 23082 21853 gene locus_tag LOCUS_03430 gene icd 23082 21853 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_03430 23391 25142 gene locus_tag LOCUS_03440 gene aceK 23391 25142 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_03440 25623 26108 gene locus_tag LOCUS_03450 25623 26108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 26943 26143 gene locus_tag LOCUS_03460 gene hyi 26943 26143 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 protein_id gnl|my_center|LOCUS_03460 27554 27027 gene locus_tag LOCUS_03470 27554 27027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 28394 28753 gene locus_tag LOCUS_03480 28394 28753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 29630 29277 gene locus_tag LOCUS_03490 29630 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 30238 31293 gene locus_tag LOCUS_03500 30238 31293 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337841.1 protein_id gnl|my_center|LOCUS_03500 31277 32923 gene locus_tag LOCUS_03510 31277 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 33039 33689 gene locus_tag LOCUS_03520 33039 33689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 33877 34437 gene locus_tag LOCUS_03530 33877 34437 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_03530 34490 35047 gene locus_tag LOCUS_03540 34490 35047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 36268 35081 gene locus_tag LOCUS_03550 36268 35081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 36625 37986 gene locus_tag LOCUS_03560 36625 37986 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_03560 38108 39181 gene locus_tag LOCUS_03570 38108 39181 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_03570 39193 40005 gene locus_tag LOCUS_03580 gene cbiQ 39193 40005 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_03580 40002 40757 gene locus_tag LOCUS_03590 40002 40757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_03590 41263 40784 gene locus_tag LOCUS_03600 gene nikR 41263 40784 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_03600 41417 42139 gene locus_tag LOCUS_03610 gene creB 41417 42139 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873813.1 protein_id gnl|my_center|LOCUS_03610 42147 43574 gene locus_tag LOCUS_03620 gene creC 42147 43574 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 protein_id gnl|my_center|LOCUS_03620 43690 45042 gene locus_tag LOCUS_03630 gene creD 43690 45042 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_03630 45544 45233 gene locus_tag LOCUS_03640 45544 45233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 46856 45645 gene locus_tag LOCUS_03650 46856 45645 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921427.1 protein_id gnl|my_center|LOCUS_03650 47300 46977 gene locus_tag LOCUS_03660 47300 46977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 47805 48623 gene locus_tag LOCUS_03670 47805 48623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 48620 49252 gene locus_tag LOCUS_03680 48620 49252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 49277 49675 gene locus_tag LOCUS_03690 49277 49675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 49932 50207 gene locus_tag LOCUS_03700 49932 50207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 50219 50749 gene locus_tag LOCUS_03710 50219 50749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 50746 51114 gene locus_tag LOCUS_03720 50746 51114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 52905 51292 gene locus_tag LOCUS_03730 52905 51292 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_03730 58102 53198 gene locus_tag LOCUS_03740 58102 53198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 58749 58300 gene locus_tag LOCUS_03750 58749 58300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 58946 58746 gene locus_tag LOCUS_03760 58946 58746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 59726 59127 gene locus_tag LOCUS_03770 gene gstA 59726 59127 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_03770 59877 61052 gene locus_tag LOCUS_03780 59877 61052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085748.1 protein_id gnl|my_center|LOCUS_03780 61590 61105 gene locus_tag LOCUS_03790 61590 61105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 62231 63064 gene locus_tag LOCUS_03800 62231 63064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03800 63077 63616 gene locus_tag LOCUS_03810 63077 63616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03810 63768 65531 gene locus_tag LOCUS_03820 63768 65531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 66774 65614 gene locus_tag LOCUS_03830 66774 65614 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_03830 67548 66862 gene locus_tag LOCUS_03840 gene rluA 67548 66862 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525162.1 protein_id gnl|my_center|LOCUS_03840 67691 68512 gene locus_tag LOCUS_03850 67691 68512 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_03850 68533 69471 gene locus_tag LOCUS_03860 68533 69471 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215599.1 protein_id gnl|my_center|LOCUS_03860 70131 69487 gene locus_tag LOCUS_03870 70131 69487 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528803.1 protein_id gnl|my_center|LOCUS_03870 70367 71611 gene locus_tag LOCUS_03880 70367 71611 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_03880 71671 72516 gene locus_tag LOCUS_03890 gene rlmJ 71671 72516 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_03890 72912 72535 gene locus_tag LOCUS_03900 72912 72535 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_03900 73852 72917 gene locus_tag LOCUS_03910 73852 72917 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 protein_id gnl|my_center|LOCUS_03910 75005 74019 gene locus_tag LOCUS_03920 75005 74019 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_03920 75233 75952 gene locus_tag LOCUS_03930 75233 75952 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188685.1 protein_id gnl|my_center|LOCUS_03930 76183 76464 gene locus_tag LOCUS_03940 76183 76464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 76458 76805 gene locus_tag LOCUS_03950 gene sdhD 76458 76805 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_03950 76806 78590 gene locus_tag LOCUS_03960 gene sdhA 76806 78590 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688397.1 protein_id gnl|my_center|LOCUS_03960 78615 79328 gene locus_tag LOCUS_03970 78615 79328 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221124.1 protein_id gnl|my_center|LOCUS_03970 79328 79582 gene locus_tag LOCUS_03980 79328 79582 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_03980 79652 80947 gene locus_tag LOCUS_03990 79652 80947 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_03990 81059 83899 gene locus_tag LOCUS_04000 81059 83899 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526855.1 protein_id gnl|my_center|LOCUS_04000 83912 85156 gene locus_tag LOCUS_04010 gene odhB 83912 85156 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065167.1 protein_id gnl|my_center|LOCUS_04010 85247 86683 gene locus_tag LOCUS_04020 gene lpdA 85247 86683 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534933.1 protein_id gnl|my_center|LOCUS_04020 87413 86781 gene locus_tag LOCUS_04030 87413 86781 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211304.1 protein_id gnl|my_center|LOCUS_04030 87773 87540 gene locus_tag LOCUS_04040 87773 87540 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_04040 87885 88481 gene locus_tag LOCUS_04050 87885 88481 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_04050 88424 89140 gene locus_tag LOCUS_04060 88424 89140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 89137 90597 gene locus_tag LOCUS_04070 89137 90597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 90617 91471 gene locus_tag LOCUS_04080 90617 91471 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811372.1 protein_id gnl|my_center|LOCUS_04080 91682 92827 gene locus_tag LOCUS_04090 gene dauA 91682 92827 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_04090 94129 92954 gene locus_tag LOCUS_04100 94129 92954 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196472.1 protein_id gnl|my_center|LOCUS_04100 95363 94209 gene locus_tag LOCUS_04110 95363 94209 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194378.1 protein_id gnl|my_center|LOCUS_04110 97186 95831 gene locus_tag LOCUS_04120 97186 95831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 97853 97485 gene locus_tag LOCUS_04130 97853 97485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 99112 97853 gene locus_tag LOCUS_04140 99112 97853 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_04140 99433 99128 gene locus_tag LOCUS_04150 99433 99128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 100054 99722 gene locus_tag LOCUS_04160 100054 99722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 100525 104454 gene locus_tag LOCUS_04170 100525 104454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 104534 106705 gene locus_tag LOCUS_04180 gene glgB 104534 106705 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_04180 107046 108200 gene locus_tag LOCUS_04190 107046 108200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 109190 108456 gene locus_tag LOCUS_04200 109190 108456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 110099 109404 gene locus_tag LOCUS_04210 gene kdpE 110099 109404 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_04210 112822 110096 gene locus_tag LOCUS_04220 112822 110096 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_04220 113553 112978 gene locus_tag LOCUS_04230 gene kdpC 113553 112978 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_04230 115630 113564 gene locus_tag LOCUS_04240 gene kdpB 115630 113564 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_04240 117458 115647 gene locus_tag LOCUS_04250 gene kdpA 117458 115647 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_04250 118980 117934 gene locus_tag LOCUS_04260 118980 117934 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762626.1 protein_id gnl|my_center|LOCUS_04260 120585 119338 gene locus_tag LOCUS_04270 120585 119338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_04270 121310 120597 gene locus_tag LOCUS_04280 121310 120597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_04280 121839 121315 gene locus_tag LOCUS_04290 121839 121315 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261131.1 protein_id gnl|my_center|LOCUS_04290 122194 122367 gene locus_tag LOCUS_04300 122194 122367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 122364 123668 gene locus_tag LOCUS_04310 122364 123668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 123676 124317 gene locus_tag LOCUS_04320 123676 124317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 124317 127124 gene locus_tag LOCUS_04330 124317 127124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 127117 128295 gene locus_tag LOCUS_04340 127117 128295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 128295 128684 gene locus_tag LOCUS_04350 128295 128684 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_04350 129388 130917 gene locus_tag LOCUS_04360 129388 130917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 132520 130994 gene locus_tag LOCUS_04370 gene malQ 132520 130994 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094267720.1 protein_id gnl|my_center|LOCUS_04370 132827 132582 gene locus_tag LOCUS_04380 132827 132582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 135069 132835 gene locus_tag LOCUS_04390 135069 132835 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_04390 135414 140465 gene locus_tag LOCUS_04400 135414 140465 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670058.1 protein_id gnl|my_center|LOCUS_04400 140708 142006 gene locus_tag LOCUS_04410 gene aceA 140708 142006 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104513.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence004 674 1222 gene locus_tag LOCUS_04420 gene msrA 674 1222 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_04420 2039 1206 gene locus_tag LOCUS_04430 2039 1206 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 protein_id gnl|my_center|LOCUS_04430 2133 3080 gene locus_tag LOCUS_04440 2133 3080 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_04440 3869 3285 gene locus_tag LOCUS_04450 3869 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 4177 3866 gene locus_tag LOCUS_04460 4177 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 4670 4179 gene locus_tag LOCUS_04470 4670 4179 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_04470 6450 4747 gene locus_tag LOCUS_04480 gene hybC 6450 4747 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706347.1 protein_id gnl|my_center|LOCUS_04480 7643 6474 gene locus_tag LOCUS_04490 gene hybB 7643 6474 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 protein_id gnl|my_center|LOCUS_04490 8677 7640 gene locus_tag LOCUS_04500 gene hybA 8677 7640 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706349.1 protein_id gnl|my_center|LOCUS_04500 9851 8679 gene locus_tag LOCUS_04510 gene hybO 9851 8679 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173957.1 protein_id gnl|my_center|LOCUS_04510 10372 11718 gene locus_tag LOCUS_04520 10372 11718 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_04520 13329 11782 gene locus_tag LOCUS_04530 13329 11782 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_04530 13611 14612 gene locus_tag LOCUS_04540 13611 14612 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_04540 14602 15456 gene locus_tag LOCUS_04550 14602 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 15528 15788 gene locus_tag LOCUS_04560 15528 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 16238 16984 gene locus_tag LOCUS_04570 16238 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036990101.1 protein_id gnl|my_center|LOCUS_04570 17155 17367 gene locus_tag LOCUS_04580 17155 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 17411 18280 gene locus_tag LOCUS_04590 17411 18280 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_04590 18264 18524 gene locus_tag LOCUS_04600 18264 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 18517 20211 gene locus_tag LOCUS_04610 18517 20211 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150625513.1 protein_id gnl|my_center|LOCUS_04610 20227 20787 gene locus_tag LOCUS_04620 20227 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 20791 21984 gene locus_tag LOCUS_04630 20791 21984 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136258754.1 protein_id gnl|my_center|LOCUS_04630 22121 22975 gene locus_tag LOCUS_04640 22121 22975 CDS product OST-HTH/LOTUS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167399093.1 protein_id gnl|my_center|LOCUS_04640 23175 23945 gene locus_tag LOCUS_04650 23175 23945 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_04650 23942 24490 gene locus_tag LOCUS_04660 23942 24490 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_04660 24487 24870 gene locus_tag LOCUS_04670 24487 24870 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 protein_id gnl|my_center|LOCUS_04670 25157 27172 gene locus_tag LOCUS_04680 25157 27172 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_04680 27961 28212 gene locus_tag LOCUS_04690 27961 28212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_04690 28237 28629 gene locus_tag LOCUS_04700 28237 28629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_04700 28794 29510 gene locus_tag LOCUS_04710 28794 29510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_04710 29794 30591 gene locus_tag LOCUS_04720 29794 30591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054019012.1 protein_id gnl|my_center|LOCUS_04720 31001 31555 gene locus_tag LOCUS_04730 31001 31555 CDS product STY4534 family ICE replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 protein_id gnl|my_center|LOCUS_04730 31611 32216 gene locus_tag LOCUS_04740 31611 32216 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_04740 32307 33134 gene locus_tag LOCUS_04750 32307 33134 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234445.1 protein_id gnl|my_center|LOCUS_04750 33455 34111 gene locus_tag LOCUS_04760 33455 34111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_04760 34180 35289 gene locus_tag LOCUS_04770 34180 35289 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104230471.1 protein_id gnl|my_center|LOCUS_04770 35391 35696 gene locus_tag LOCUS_04780 35391 35696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_04780 35796 38066 gene locus_tag LOCUS_04790 35796 38066 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165797420.1 protein_id gnl|my_center|LOCUS_04790 38442 38648 gene locus_tag LOCUS_04800 38442 38648 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113932710.1 protein_id gnl|my_center|LOCUS_04800 38664 39035 gene locus_tag LOCUS_04810 38664 39035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 39032 41524 gene locus_tag LOCUS_04820 39032 41524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 41528 42970 gene locus_tag LOCUS_04830 41528 42970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 42982 44148 gene locus_tag LOCUS_04840 42982 44148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 44801 46207 gene locus_tag LOCUS_04850 44801 46207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 46218 46862 gene locus_tag LOCUS_04860 46218 46862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 46873 47361 gene locus_tag LOCUS_04870 46873 47361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 47719 48336 gene locus_tag LOCUS_04880 47719 48336 CDS product PilL N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024537152.1 protein_id gnl|my_center|LOCUS_04880 48333 48977 gene locus_tag LOCUS_04890 48333 48977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038884.1 protein_id gnl|my_center|LOCUS_04890 48987 49718 gene locus_tag LOCUS_04900 48987 49718 CDS product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_04900 49703 50293 gene locus_tag LOCUS_04910 49703 50293 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_04910 50290 50850 gene locus_tag LOCUS_04920 50290 50850 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_04920 50876 53035 gene locus_tag LOCUS_04930 gene traD 50876 53035 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_04930 53032 53781 gene locus_tag LOCUS_04940 53032 53781 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_04940 58656 53842 gene locus_tag LOCUS_04950 58656 53842 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933286.1 protein_id gnl|my_center|LOCUS_04950 60085 58781 gene locus_tag LOCUS_04960 60085 58781 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 protein_id gnl|my_center|LOCUS_04960 60411 60085 gene locus_tag LOCUS_04970 60411 60085 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925868.1 protein_id gnl|my_center|LOCUS_04970 60703 61083 gene locus_tag LOCUS_04980 60703 61083 CDS product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317499.1 protein_id gnl|my_center|LOCUS_04980 61080 61319 gene locus_tag LOCUS_04990 61080 61319 CDS product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_04990 61343 61708 gene locus_tag LOCUS_05000 61343 61708 CDS product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_05000 61721 62206 gene locus_tag LOCUS_05010 61721 62206 CDS product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_05010 62203 62904 gene locus_tag LOCUS_05020 62203 62904 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 protein_id gnl|my_center|LOCUS_05020 62901 63833 gene locus_tag LOCUS_05030 62901 63833 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011805409.1 protein_id gnl|my_center|LOCUS_05030 63823 65298 gene locus_tag LOCUS_05040 63823 65298 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_05040 65279 65713 gene locus_tag LOCUS_05050 65279 65713 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_05050 65713 68616 gene locus_tag LOCUS_05060 65713 68616 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_05060 68628 69392 gene locus_tag LOCUS_05070 68628 69392 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 protein_id gnl|my_center|LOCUS_05070 69584 70078 gene locus_tag LOCUS_05080 69584 70078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 70266 70715 gene locus_tag LOCUS_05090 70266 70715 CDS product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672509.1 protein_id gnl|my_center|LOCUS_05090 70712 71662 gene locus_tag LOCUS_05100 70712 71662 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_05100 71672 73075 gene locus_tag LOCUS_05110 71672 73075 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_05110 73072 73425 gene locus_tag LOCUS_05120 73072 73425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 73441 74958 gene locus_tag LOCUS_05130 73441 74958 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038855.1 protein_id gnl|my_center|LOCUS_05130 75748 74966 gene locus_tag LOCUS_05140 75748 74966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 75823 76884 gene locus_tag LOCUS_05150 75823 76884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 76872 77741 gene locus_tag LOCUS_05160 76872 77741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 77753 79120 gene locus_tag LOCUS_05170 77753 79120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 79372 81207 gene locus_tag LOCUS_05180 gene mobH 79372 81207 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_05180 81952 81209 gene locus_tag LOCUS_05190 81952 81209 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_05190 83208 81952 gene locus_tag LOCUS_05200 83208 81952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_05200 84077 83205 gene locus_tag LOCUS_05210 84077 83205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 86012 84078 gene locus_tag LOCUS_05220 86012 84078 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 protein_id gnl|my_center|LOCUS_05220 88139 86046 gene locus_tag LOCUS_05230 gene brxL 88139 86046 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_05230 90643 88145 gene locus_tag LOCUS_05240 90643 88145 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942750.1 protein_id gnl|my_center|LOCUS_05240 91295 90681 gene locus_tag LOCUS_05250 91295 90681 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_05250 92542 91295 gene locus_tag LOCUS_05260 92542 91295 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_05260 93825 92542 gene locus_tag LOCUS_05270 93825 92542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 96347 94455 gene locus_tag LOCUS_05280 96347 94455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05280 99078 96358 gene locus_tag LOCUS_05290 99078 96358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 102722 99081 gene locus_tag LOCUS_05300 gene brxC 102722 99081 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942753.1 protein_id gnl|my_center|LOCUS_05300 103326 102751 gene locus_tag LOCUS_05310 103326 102751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 104101 103307 gene locus_tag LOCUS_05320 104101 103307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 104598 104098 gene locus_tag LOCUS_05330 104598 104098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 105575 104661 gene locus_tag LOCUS_05340 105575 104661 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_05340 105860 106807 gene locus_tag LOCUS_05350 105860 106807 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150790358.1 protein_id gnl|my_center|LOCUS_05350 106821 107714 gene locus_tag LOCUS_05360 106821 107714 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170110004.1 protein_id gnl|my_center|LOCUS_05360 107926 108837 gene locus_tag LOCUS_05370 107926 108837 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038250.1 protein_id gnl|my_center|LOCUS_05370 109048 108866 gene locus_tag LOCUS_05380 109048 108866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 109266 109982 gene locus_tag LOCUS_05390 109266 109982 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037262.1 protein_id gnl|my_center|LOCUS_05390 111894 109966 gene locus_tag LOCUS_05400 111894 109966 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172404515.1 protein_id gnl|my_center|LOCUS_05400 112205 112132 gene locus_tag LOCUS_t00080 112205 112132 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 112678 112259 gene locus_tag LOCUS_05410 112678 112259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 113192 112749 gene locus_tag LOCUS_05420 113192 112749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 115992 113395 gene locus_tag LOCUS_05430 115992 113395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 116457 116900 gene locus_tag LOCUS_05440 116457 116900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 117183 117758 gene locus_tag LOCUS_05450 117183 117758 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377112.1 protein_id gnl|my_center|LOCUS_05450 117801 119156 gene locus_tag LOCUS_05460 117801 119156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence005 94 1554 gene locus_tag LOCUS_05470 94 1554 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_05470 2908 1661 gene locus_tag LOCUS_05480 2908 1661 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_05480 4291 2909 gene locus_tag LOCUS_05490 4291 2909 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_05490 4961 6280 gene locus_tag LOCUS_05500 4961 6280 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_05500 8131 6335 gene locus_tag LOCUS_05510 8131 6335 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_05510 8656 8159 gene locus_tag LOCUS_05520 8656 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8954 10651 gene locus_tag LOCUS_05530 8954 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 10666 11922 gene locus_tag LOCUS_05540 10666 11922 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_05540 12587 11976 gene locus_tag LOCUS_05550 12587 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 12558 12770 gene locus_tag LOCUS_05560 12558 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 13529 12873 gene locus_tag LOCUS_05570 13529 12873 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_05570 13711 13526 gene locus_tag LOCUS_05580 13711 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14066 14401 gene locus_tag LOCUS_05590 14066 14401 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227980.1 protein_id gnl|my_center|LOCUS_05590 14388 14810 gene locus_tag LOCUS_05600 14388 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 15135 17105 gene locus_tag LOCUS_05610 gene glgB 15135 17105 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_05610 17225 18169 gene locus_tag LOCUS_05620 gene egtD 17225 18169 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_05620 18194 19447 gene locus_tag LOCUS_05630 gene egtB 18194 19447 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_05630 21676 19490 gene locus_tag LOCUS_05640 21676 19490 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941831.1 protein_id gnl|my_center|LOCUS_05640 21581 21925 gene locus_tag LOCUS_05650 21581 21925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 22217 22645 gene locus_tag LOCUS_05660 22217 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707164.1 protein_id gnl|my_center|LOCUS_05660 22676 23344 gene locus_tag LOCUS_05670 22676 23344 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604132.1 protein_id gnl|my_center|LOCUS_05670 23341 24123 gene locus_tag LOCUS_05680 23341 24123 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402969.1 protein_id gnl|my_center|LOCUS_05680 24110 24373 gene locus_tag LOCUS_05690 24110 24373 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081091609.1 protein_id gnl|my_center|LOCUS_05690 24397 24642 gene locus_tag LOCUS_05700 24397 24642 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418340.1 protein_id gnl|my_center|LOCUS_05700 24660 25226 gene locus_tag LOCUS_05710 24660 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460553.1 protein_id gnl|my_center|LOCUS_05710 25233 26495 gene locus_tag LOCUS_05720 25233 26495 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074025.1 protein_id gnl|my_center|LOCUS_05720 26486 26845 gene locus_tag LOCUS_05730 26486 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 26842 28524 gene locus_tag LOCUS_05740 26842 28524 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707156.1 protein_id gnl|my_center|LOCUS_05740 28539 28976 gene locus_tag LOCUS_05750 28539 28976 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_05750 29016 29786 gene locus_tag LOCUS_05760 29016 29786 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_05760 29832 31442 gene locus_tag LOCUS_05770 29832 31442 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 protein_id gnl|my_center|LOCUS_05770 31435 31854 gene locus_tag LOCUS_05780 31435 31854 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208353.1 protein_id gnl|my_center|LOCUS_05780 31851 32468 gene locus_tag LOCUS_05790 31851 32468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 32468 34795 gene locus_tag LOCUS_05800 32468 34795 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 protein_id gnl|my_center|LOCUS_05800 34792 35352 gene locus_tag LOCUS_05810 34792 35352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 35349 36542 gene locus_tag LOCUS_05820 35349 36542 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 protein_id gnl|my_center|LOCUS_05820 36539 37012 gene locus_tag LOCUS_05830 36539 37012 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346295.1 protein_id gnl|my_center|LOCUS_05830 37012 37740 gene locus_tag LOCUS_05840 gene fabG 37012 37740 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222115.1 protein_id gnl|my_center|LOCUS_05840 37737 38969 gene locus_tag LOCUS_05850 37737 38969 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707147.1 protein_id gnl|my_center|LOCUS_05850 39298 40578 gene locus_tag LOCUS_05860 gene fabB 39298 40578 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035826.1 protein_id gnl|my_center|LOCUS_05860 41137 40778 gene locus_tag LOCUS_05870 41137 40778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 42353 41487 gene locus_tag LOCUS_05880 42353 41487 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 protein_id gnl|my_center|LOCUS_05880 42457 43416 gene locus_tag LOCUS_05890 42457 43416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 43413 44336 gene locus_tag LOCUS_05900 43413 44336 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_05900 44345 45073 gene locus_tag LOCUS_05910 gene rph 44345 45073 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_05910 45070 45657 gene locus_tag LOCUS_05920 gene rdgB 45070 45657 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 protein_id gnl|my_center|LOCUS_05920 45657 46895 gene locus_tag LOCUS_05930 gene hemW 45657 46895 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_05930 48061 46934 gene locus_tag LOCUS_05940 48061 46934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 48180 48704 gene locus_tag LOCUS_05950 48180 48704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 49388 48663 gene locus_tag LOCUS_05960 gene trmB 49388 48663 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 protein_id gnl|my_center|LOCUS_05960 50203 49409 gene locus_tag LOCUS_05970 50203 49409 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_05970 50431 50231 gene locus_tag LOCUS_05980 gene thiS 50431 50231 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_05980 50474 51151 gene locus_tag LOCUS_05990 50474 51151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 51144 51683 gene locus_tag LOCUS_06000 51144 51683 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_06000 51849 52184 gene locus_tag LOCUS_06010 51849 52184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 52760 52548 gene locus_tag LOCUS_06020 52760 52548 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_06020 55671 53386 gene locus_tag LOCUS_06030 55671 53386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 57050 55668 gene locus_tag LOCUS_06040 57050 55668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 58609 57050 gene locus_tag LOCUS_06050 58609 57050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 62891 58626 gene locus_tag LOCUS_06060 62891 58626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 64283 62907 gene locus_tag LOCUS_06070 64283 62907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 68746 64313 gene locus_tag LOCUS_06080 68746 64313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 69196 68762 gene locus_tag LOCUS_06090 69196 68762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 69621 69205 gene locus_tag LOCUS_06100 69621 69205 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_06100 69814 69626 gene locus_tag LOCUS_06110 69814 69626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 71515 69875 gene locus_tag LOCUS_06120 71515 69875 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_06120 72268 71537 gene locus_tag LOCUS_06130 72268 71537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 72461 72270 gene locus_tag LOCUS_06140 72461 72270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 72907 72464 gene locus_tag LOCUS_06150 72907 72464 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_06150 73375 72932 gene locus_tag LOCUS_06160 73375 72932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 73860 73393 gene locus_tag LOCUS_06170 73860 73393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 75563 73926 gene locus_tag LOCUS_06180 75563 73926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 76688 75588 gene locus_tag LOCUS_06190 76688 75588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 77011 76685 gene locus_tag LOCUS_06200 77011 76685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 78285 77674 gene locus_tag LOCUS_06210 gene ureG 78285 77674 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_06210 78974 78303 gene locus_tag LOCUS_06220 78974 78303 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 protein_id gnl|my_center|LOCUS_06220 79537 78971 gene locus_tag LOCUS_06230 gene ureE 79537 78971 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205202.1 protein_id gnl|my_center|LOCUS_06230 81269 79545 gene locus_tag LOCUS_06240 gene ureC 81269 79545 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_06240 81588 81280 gene locus_tag LOCUS_06250 81588 81280 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391866.1 protein_id gnl|my_center|LOCUS_06250 81902 81600 gene locus_tag LOCUS_06260 gene ureA 81902 81600 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_06260 82700 81936 gene locus_tag LOCUS_06270 82700 81936 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 protein_id gnl|my_center|LOCUS_06270 83497 82805 gene locus_tag LOCUS_06280 gene urtE 83497 82805 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_06280 84356 83505 gene locus_tag LOCUS_06290 gene urtD 84356 83505 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_06290 85501 84353 gene locus_tag LOCUS_06300 gene urtC 85501 84353 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522271.1 protein_id gnl|my_center|LOCUS_06300 87113 85518 gene locus_tag LOCUS_06310 gene urtB 87113 85518 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105141.1 protein_id gnl|my_center|LOCUS_06310 88438 87170 gene locus_tag LOCUS_06320 gene urtA 88438 87170 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_06320 89015 88671 gene locus_tag LOCUS_06330 89015 88671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 91115 89037 gene locus_tag LOCUS_06340 91115 89037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 94424 91173 gene locus_tag LOCUS_06350 94424 91173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 95135 95992 gene locus_tag LOCUS_06360 95135 95992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 96647 96273 gene locus_tag LOCUS_06370 96647 96273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 97214 96795 gene locus_tag LOCUS_06380 97214 96795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 98107 97466 gene locus_tag LOCUS_06390 98107 97466 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_06390 100639 98114 gene locus_tag LOCUS_06400 100639 98114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 101111 100908 gene locus_tag LOCUS_06410 101111 100908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 101236 101152 gene locus_tag LOCUS_t00090 101236 101152 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101398 102207 gene locus_tag LOCUS_06420 gene hpnC 101398 102207 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_06420 102251 103084 gene locus_tag LOCUS_06430 gene hpnD 102251 103084 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_06430 103081 104439 gene locus_tag LOCUS_06440 gene hpnE 103081 104439 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_06440 105028 104360 gene locus_tag LOCUS_06450 105028 104360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_06450 105045 105662 gene locus_tag LOCUS_06460 105045 105662 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009942000.1 protein_id gnl|my_center|LOCUS_06460 105691 106743 gene locus_tag LOCUS_06470 gene mnmH 105691 106743 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_06470 106771 107217 gene locus_tag LOCUS_06480 106771 107217 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_06480 107359 110049 gene locus_tag LOCUS_06490 107359 110049 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_06490 110383 110186 gene locus_tag LOCUS_06500 110383 110186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence006 1320 127 gene locus_tag LOCUS_06510 1320 127 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_06510 2385 1417 gene locus_tag LOCUS_06520 2385 1417 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_06520 3203 2382 gene locus_tag LOCUS_06530 3203 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3467 3216 gene locus_tag LOCUS_06540 3467 3216 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_06540 3885 4265 gene locus_tag LOCUS_06550 3885 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5327 4413 gene locus_tag LOCUS_06560 gene xerC 5327 4413 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038710.1 protein_id gnl|my_center|LOCUS_06560 6015 5362 gene locus_tag LOCUS_06570 6015 5362 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 protein_id gnl|my_center|LOCUS_06570 6842 6012 gene locus_tag LOCUS_06580 gene dapF 6842 6012 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064712.1 protein_id gnl|my_center|LOCUS_06580 7370 6849 gene locus_tag LOCUS_06590 7370 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7618 8805 gene locus_tag LOCUS_06600 7618 8805 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195769.1 protein_id gnl|my_center|LOCUS_06600 10864 8843 gene locus_tag LOCUS_06610 gene tkt 10864 8843 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098658.1 protein_id gnl|my_center|LOCUS_06610 11789 10914 gene locus_tag LOCUS_06620 11789 10914 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_06620 13070 11988 gene locus_tag LOCUS_06630 13070 11988 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_06630 13188 14099 gene locus_tag LOCUS_06640 13188 14099 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_06640 15778 14279 gene locus_tag LOCUS_06650 15778 14279 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_06650 16427 15747 gene locus_tag LOCUS_06660 16427 15747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_06660 17863 16673 gene locus_tag LOCUS_06670 17863 16673 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_06670 17935 18828 gene locus_tag LOCUS_06680 gene rapZ 17935 18828 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_06680 18825 19202 gene locus_tag LOCUS_06690 18825 19202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 19435 20847 gene locus_tag LOCUS_06700 gene ahcY 19435 20847 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_06700 20873 21226 gene locus_tag LOCUS_06710 20873 21226 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_06710 21234 22088 gene locus_tag LOCUS_06720 gene metF 21234 22088 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_06720 22242 22520 gene locus_tag LOCUS_06730 22242 22520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 22517 23059 gene locus_tag LOCUS_06740 22517 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 23059 23790 gene locus_tag LOCUS_06750 23059 23790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 23835 25043 gene locus_tag LOCUS_06760 23835 25043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 26349 25099 gene locus_tag LOCUS_06770 gene yaiW 26349 25099 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092071.1 protein_id gnl|my_center|LOCUS_06770 28279 26408 gene locus_tag LOCUS_06780 gene ggt 28279 26408 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706842.1 protein_id gnl|my_center|LOCUS_06780 28591 29313 gene locus_tag LOCUS_06790 gene queC 28591 29313 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_06790 29310 30413 gene locus_tag LOCUS_06800 29310 30413 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_06800 31746 30433 gene locus_tag LOCUS_06810 31746 30433 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_06810 32274 32954 gene locus_tag LOCUS_06820 32274 32954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 32872 33174 gene locus_tag LOCUS_06830 32872 33174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 35617 33137 gene locus_tag LOCUS_06840 gene plsB 35617 33137 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113856.1 protein_id gnl|my_center|LOCUS_06840 37688 35640 gene locus_tag LOCUS_06850 gene fusA 37688 35640 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_06850 38090 40378 gene locus_tag LOCUS_06860 38090 40378 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_06860 40607 42322 gene locus_tag LOCUS_06870 gene pilB 40607 42322 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_06870 42336 43574 gene locus_tag LOCUS_06880 42336 43574 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_06880 43574 44437 gene locus_tag LOCUS_06890 43574 44437 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_06890 44717 45811 gene locus_tag LOCUS_06900 44717 45811 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243015.1 protein_id gnl|my_center|LOCUS_06900 45889 46599 gene locus_tag LOCUS_06910 45889 46599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509047.1 protein_id gnl|my_center|LOCUS_06910 46701 47498 gene locus_tag LOCUS_06920 46701 47498 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_06920 48010 49542 gene locus_tag LOCUS_06930 48010 49542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 50361 49585 gene locus_tag LOCUS_06940 50361 49585 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039800.1 protein_id gnl|my_center|LOCUS_06940 50870 51640 gene locus_tag LOCUS_06950 50870 51640 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980063.1 protein_id gnl|my_center|LOCUS_06950 51653 52132 gene locus_tag LOCUS_06960 51653 52132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 52833 52363 gene locus_tag LOCUS_06970 52833 52363 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927831.1 protein_id gnl|my_center|LOCUS_06970 55300 52982 gene locus_tag LOCUS_06980 55300 52982 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152615065.1 protein_id gnl|my_center|LOCUS_06980 57409 55388 gene locus_tag LOCUS_06990 57409 55388 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966949.1 protein_id gnl|my_center|LOCUS_06990 58191 57505 gene locus_tag LOCUS_07000 gene lolD 58191 57505 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688655.1 protein_id gnl|my_center|LOCUS_07000 59431 58184 gene locus_tag LOCUS_07010 59431 58184 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_07010 59613 60668 gene locus_tag LOCUS_07020 59613 60668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_07020 60665 62380 gene locus_tag LOCUS_07030 gene recJ 60665 62380 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_07030 63545 62475 gene locus_tag LOCUS_07040 63545 62475 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113877.1 protein_id gnl|my_center|LOCUS_07040 64336 63542 gene locus_tag LOCUS_07050 64336 63542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113878.1 protein_id gnl|my_center|LOCUS_07050 65193 64336 gene locus_tag LOCUS_07060 65193 64336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092241.1 protein_id gnl|my_center|LOCUS_07060 66130 65186 gene locus_tag LOCUS_07070 66130 65186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119359.1 protein_id gnl|my_center|LOCUS_07070 66504 66286 gene locus_tag LOCUS_07080 66504 66286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 66749 66450 gene locus_tag LOCUS_07090 66749 66450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 66720 67463 gene locus_tag LOCUS_07100 66720 67463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 68987 67473 gene locus_tag LOCUS_07110 68987 67473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 69780 68971 gene locus_tag LOCUS_07120 69780 68971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_07120 69835 70632 gene locus_tag LOCUS_07130 69835 70632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 70813 71685 gene locus_tag LOCUS_07140 70813 71685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 71678 73891 gene locus_tag LOCUS_07150 71678 73891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 73894 76095 gene locus_tag LOCUS_07160 73894 76095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 76073 77746 gene locus_tag LOCUS_07170 76073 77746 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_07170 77759 78313 gene locus_tag LOCUS_07180 77759 78313 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 protein_id gnl|my_center|LOCUS_07180 79748 78345 gene locus_tag LOCUS_07190 gene rlmD 79748 78345 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_07190 79916 80395 gene locus_tag LOCUS_07200 79916 80395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 80490 81392 gene locus_tag LOCUS_07210 80490 81392 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389990.1 protein_id gnl|my_center|LOCUS_07210 81989 81570 gene locus_tag LOCUS_07220 81989 81570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 82657 82061 gene locus_tag LOCUS_07230 82657 82061 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_07230 83479 82760 gene locus_tag LOCUS_07240 83479 82760 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_07240 84803 83484 gene locus_tag LOCUS_07250 84803 83484 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_07250 85403 84807 gene locus_tag LOCUS_07260 gene petA 85403 84807 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815815.1 protein_id gnl|my_center|LOCUS_07260 86117 85515 gene locus_tag LOCUS_07270 gene recR 86117 85515 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_07270 86437 86117 gene locus_tag LOCUS_07280 86437 86117 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_07280 88102 86462 gene locus_tag LOCUS_07290 88102 86462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 88618 88340 gene locus_tag LOCUS_07300 88618 88340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 88877 88623 gene locus_tag LOCUS_07310 88877 88623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 90115 88877 gene locus_tag LOCUS_07320 90115 88877 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_07320 91976 90129 gene locus_tag LOCUS_07330 91976 90129 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_07330 92462 91989 gene locus_tag LOCUS_07340 92462 91989 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_07340 92841 93500 gene locus_tag LOCUS_07350 92841 93500 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_07350 94083 93655 gene locus_tag LOCUS_07360 94083 93655 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_07360 94848 94213 gene locus_tag LOCUS_07370 94848 94213 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_07370 94982 95737 gene locus_tag LOCUS_07380 gene yihA 94982 95737 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687358.1 protein_id gnl|my_center|LOCUS_07380 95885 96901 gene locus_tag LOCUS_07390 gene hemB 95885 96901 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687809.1 protein_id gnl|my_center|LOCUS_07390 97967 96885 gene locus_tag LOCUS_07400 97967 96885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 101217 97984 gene locus_tag LOCUS_07410 101217 97984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 101915 101214 gene locus_tag LOCUS_07420 101915 101214 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_07420 102834 101947 gene locus_tag LOCUS_07430 gene argB 102834 101947 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929778.1 protein_id gnl|my_center|LOCUS_07430 102961 103908 gene locus_tag LOCUS_07440 gene gluQRS 102961 103908 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_07440 105050 103890 gene locus_tag LOCUS_07450 gene clsB 105050 103890 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_07450 105933 105112 gene locus_tag LOCUS_07460 105933 105112 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095599.1 protein_id gnl|my_center|LOCUS_07460 106246 106046 gene locus_tag LOCUS_07470 106246 106046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 107298 106411 gene locus_tag LOCUS_07480 gene rarD 107298 106411 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_07480 108344 107340 gene locus_tag LOCUS_07490 108344 107340 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_07490 108545 108375 gene locus_tag LOCUS_07500 108545 108375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 108635 110248 gene locus_tag LOCUS_07510 108635 110248 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706575.1 protein_id gnl|my_center|LOCUS_07510 110249 110767 gene locus_tag LOCUS_07520 110249 110767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence007 <1 1755 gene locus_tag LOCUS_07530 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975242.1:iron ABC transporter permease 1752 2615 gene locus_tag LOCUS_07540 1752 2615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969390.1 protein_id gnl|my_center|LOCUS_07540 2988 3332 gene locus_tag LOCUS_07550 2988 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3405 4715 gene locus_tag LOCUS_07560 3405 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5165 5076 gene locus_tag LOCUS_t00100 5165 5076 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6588 5305 gene locus_tag LOCUS_07570 gene serS 6588 5305 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_07570 7907 6591 gene locus_tag LOCUS_07580 7907 6591 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_07580 8209 8415 gene locus_tag LOCUS_07590 8209 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 10049 8634 gene locus_tag LOCUS_07600 10049 8634 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420440.1 protein_id gnl|my_center|LOCUS_07600 10366 10788 gene locus_tag LOCUS_07610 10366 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07610 11855 10899 gene locus_tag LOCUS_07620 gene gcvA 11855 10899 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 protein_id gnl|my_center|LOCUS_07620 11973 12152 gene locus_tag LOCUS_07630 11973 12152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12209 12649 gene locus_tag LOCUS_07640 12209 12649 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_07640 14073 12646 gene locus_tag LOCUS_07650 14073 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 16285 14090 gene locus_tag LOCUS_07660 16285 14090 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_07660 16663 16289 gene locus_tag LOCUS_07670 16663 16289 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_07670 19462 16676 gene locus_tag LOCUS_07680 19462 16676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_07680 19672 19472 gene locus_tag LOCUS_07690 19672 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 19799 20638 gene locus_tag LOCUS_07700 gene menB 19799 20638 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 protein_id gnl|my_center|LOCUS_07700 20738 21856 gene locus_tag LOCUS_07710 20738 21856 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 protein_id gnl|my_center|LOCUS_07710 21972 24065 gene locus_tag LOCUS_07720 21972 24065 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930672.1 protein_id gnl|my_center|LOCUS_07720 25049 24084 gene locus_tag LOCUS_07730 25049 24084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 25606 25046 gene locus_tag LOCUS_07740 25606 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 25828 25619 gene locus_tag LOCUS_07750 25828 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 27623 25821 gene locus_tag LOCUS_07760 27623 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 29261 27630 gene locus_tag LOCUS_07770 29261 27630 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939975.1 protein_id gnl|my_center|LOCUS_07770 30847 29258 gene locus_tag LOCUS_07780 30847 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_07780 31419 30847 gene locus_tag LOCUS_07790 31419 30847 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124060.1 protein_id gnl|my_center|LOCUS_07790 31678 31391 gene locus_tag LOCUS_07800 31678 31391 CDS product winged-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006249663.1 protein_id gnl|my_center|LOCUS_07800 32079 31705 gene locus_tag LOCUS_07810 32079 31705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 32308 32066 gene locus_tag LOCUS_07820 32308 32066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 32717 32301 gene locus_tag LOCUS_07830 32717 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 33114 32824 gene locus_tag LOCUS_07840 33114 32824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 33368 33111 gene locus_tag LOCUS_07850 33368 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 33846 33385 gene locus_tag LOCUS_07860 33846 33385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 34324 33827 gene locus_tag LOCUS_07870 34324 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 34629 34324 gene locus_tag LOCUS_07880 34629 34324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 35165 34626 gene locus_tag LOCUS_07890 35165 34626 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 protein_id gnl|my_center|LOCUS_07890 35796 35191 gene locus_tag LOCUS_07900 35796 35191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 36130 35786 gene locus_tag LOCUS_07910 36130 35786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 36504 36127 gene locus_tag LOCUS_07920 36504 36127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 36664 36485 gene locus_tag LOCUS_07930 36664 36485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 37980 36724 gene locus_tag LOCUS_07940 37980 36724 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960679.1 protein_id gnl|my_center|LOCUS_07940 39755 37974 gene locus_tag LOCUS_07950 39755 37974 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992438.1 protein_id gnl|my_center|LOCUS_07950 40634 39774 gene locus_tag LOCUS_07960 40634 39774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 40973 40659 gene locus_tag LOCUS_07970 40973 40659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 41188 40970 gene locus_tag LOCUS_07980 41188 40970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 41237 41458 gene locus_tag LOCUS_07990 41237 41458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 41699 41448 gene locus_tag LOCUS_08000 41699 41448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 41732 42037 gene locus_tag LOCUS_08010 41732 42037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 42343 42086 gene locus_tag LOCUS_08020 42343 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 42361 42795 gene locus_tag LOCUS_08030 42361 42795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 42893 43264 gene locus_tag LOCUS_08040 42893 43264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 43254 43865 gene locus_tag LOCUS_08050 43254 43865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 43849 44703 gene locus_tag LOCUS_08060 gene dinD 43849 44703 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_08060 44800 45996 gene locus_tag LOCUS_08070 44800 45996 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232421.1 protein_id gnl|my_center|LOCUS_08070 46032 46439 gene locus_tag LOCUS_08080 46032 46439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 46476 47492 gene locus_tag LOCUS_08090 46476 47492 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_08090 47605 47826 gene locus_tag LOCUS_08100 47605 47826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 47849 49195 gene locus_tag LOCUS_08110 47849 49195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 49213 49623 gene locus_tag LOCUS_08120 49213 49623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 49894 50940 gene locus_tag LOCUS_08130 49894 50940 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_08130 50843 51301 gene locus_tag LOCUS_08140 50843 51301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 51298 51705 gene locus_tag LOCUS_08150 51298 51705 CDS product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 protein_id gnl|my_center|LOCUS_08150 51705 52118 gene locus_tag LOCUS_08160 51705 52118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 52152 52910 gene locus_tag LOCUS_08170 52152 52910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071003.1 protein_id gnl|my_center|LOCUS_08170 53018 56023 gene locus_tag LOCUS_08180 53018 56023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 56023 56406 gene locus_tag LOCUS_08190 56023 56406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 56410 59997 gene locus_tag LOCUS_08200 56410 59997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 60018 61196 gene locus_tag LOCUS_08210 60018 61196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 61199 62248 gene locus_tag LOCUS_08220 61199 62248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 62245 62646 gene locus_tag LOCUS_08230 62245 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 62658 64583 gene locus_tag LOCUS_08240 62658 64583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 64576 64797 gene locus_tag LOCUS_08250 64576 64797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 66012 64822 gene locus_tag LOCUS_08260 66012 64822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 66916 66089 gene locus_tag LOCUS_08270 gene mutM 66916 66089 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 protein_id gnl|my_center|LOCUS_08270 67012 68763 gene locus_tag LOCUS_08280 67012 68763 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_08280 68948 68781 gene locus_tag LOCUS_08290 68948 68781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 68886 69392 gene locus_tag LOCUS_08300 68886 69392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 69379 70260 gene locus_tag LOCUS_08310 gene ispE 69379 70260 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_08310 70416 70492 gene locus_tag LOCUS_t00110 70416 70492 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 70582 71532 gene locus_tag LOCUS_08320 70582 71532 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_08320 71633 72235 gene locus_tag LOCUS_08330 71633 72235 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 protein_id gnl|my_center|LOCUS_08330 72313 72882 gene locus_tag LOCUS_08340 gene pth 72313 72882 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_08340 72899 73990 gene locus_tag LOCUS_08350 gene ychF 72899 73990 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_08350 77423 74235 gene locus_tag LOCUS_08360 77423 74235 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_08360 78130 77420 gene locus_tag LOCUS_08370 78130 77420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_08370 78672 78127 gene locus_tag LOCUS_08380 78672 78127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_08380 79771 78803 gene locus_tag LOCUS_08390 79771 78803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08390 80109 79810 gene locus_tag LOCUS_08400 80109 79810 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_08400 80225 80680 gene locus_tag LOCUS_08410 80225 80680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 80702 82606 gene locus_tag LOCUS_08420 80702 82606 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_08420 82603 82842 gene locus_tag LOCUS_08430 82603 82842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 82898 83971 gene locus_tag LOCUS_08440 82898 83971 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_08440 84471 85961 gene locus_tag LOCUS_08450 84471 85961 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_08450 85961 86887 gene locus_tag LOCUS_08460 85961 86887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence008 10135 50 gene locus_tag LOCUS_08470 10135 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 52188 10516 gene locus_tag LOCUS_08480 52188 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 55635 52552 gene locus_tag LOCUS_08490 55635 52552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 55549 55776 gene locus_tag LOCUS_08500 55549 55776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 56365 57495 gene locus_tag LOCUS_08510 56365 57495 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 protein_id gnl|my_center|LOCUS_08510 58276 57650 gene locus_tag LOCUS_08520 gene cysC 58276 57650 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073511.1 protein_id gnl|my_center|LOCUS_08520 59561 58515 gene locus_tag LOCUS_08530 59561 58515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 60630 59863 gene locus_tag LOCUS_08540 60630 59863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 61574 60627 gene locus_tag LOCUS_08550 61574 60627 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_08550 61665 62456 gene locus_tag LOCUS_08560 61665 62456 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_08560 62511 64214 gene locus_tag LOCUS_08570 62511 64214 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_08570 64207 64728 gene locus_tag LOCUS_08580 64207 64728 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_08580 64725 65450 gene locus_tag LOCUS_08590 64725 65450 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_08590 65473 66393 gene locus_tag LOCUS_08600 gene cysD 65473 66393 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_08600 66393 67682 gene locus_tag LOCUS_08610 66393 67682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 67831 68907 gene locus_tag LOCUS_08620 67831 68907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 69040 69810 gene locus_tag LOCUS_08630 gene rlmB 69040 69810 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_08630 72036 69844 gene locus_tag LOCUS_08640 72036 69844 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 protein_id gnl|my_center|LOCUS_08640 73735 72371 gene locus_tag LOCUS_08650 73735 72371 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706680.1 protein_id gnl|my_center|LOCUS_08650 74300 73860 gene locus_tag LOCUS_08660 74300 73860 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 protein_id gnl|my_center|LOCUS_08660 75850 74306 gene locus_tag LOCUS_08670 75850 74306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 76896 76009 gene locus_tag LOCUS_08680 76896 76009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 77768 78502 gene locus_tag LOCUS_08690 77768 78502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 79183 78554 gene locus_tag LOCUS_08700 gene ureG 79183 78554 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_08700 79854 79183 gene locus_tag LOCUS_08710 79854 79183 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446466.1 protein_id gnl|my_center|LOCUS_08710 80402 79851 gene locus_tag LOCUS_08720 gene ureE 80402 79851 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205202.1 protein_id gnl|my_center|LOCUS_08720 82122 80410 gene locus_tag LOCUS_08730 gene ureC 82122 80410 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_08730 82427 82119 gene locus_tag LOCUS_08740 82427 82119 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_08740 82741 82439 gene locus_tag LOCUS_08750 gene ureA 82741 82439 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence009 243 1106 gene locus_tag LOCUS_08760 243 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1108 15621 gene locus_tag LOCUS_08770 1108 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 15817 17202 gene locus_tag LOCUS_08780 gene cyaD 15817 17202 CDS product cyclolysin T1SS periplasmic adaptor subunit CyaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807486.1 protein_id gnl|my_center|LOCUS_08780 19275 17260 gene locus_tag LOCUS_08790 19275 17260 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_08790 20965 19325 gene locus_tag LOCUS_08800 20965 19325 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446174.1 protein_id gnl|my_center|LOCUS_08800 22512 21064 gene locus_tag LOCUS_08810 gene tldD 22512 21064 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_08810 23397 22552 gene locus_tag LOCUS_08820 23397 22552 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_08820 27385 23429 gene locus_tag LOCUS_08830 27385 23429 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550020.1 protein_id gnl|my_center|LOCUS_08830 27552 30296 gene locus_tag LOCUS_08840 gene glnE 27552 30296 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522142.1 protein_id gnl|my_center|LOCUS_08840 30340 31974 gene locus_tag LOCUS_08850 30340 31974 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811863.1 protein_id gnl|my_center|LOCUS_08850 33440 32058 gene locus_tag LOCUS_08860 33440 32058 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_08860 35270 33642 gene locus_tag LOCUS_08870 35270 33642 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480032.1 protein_id gnl|my_center|LOCUS_08870 36433 35267 gene locus_tag LOCUS_08880 36433 35267 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_08880 37368 36430 gene locus_tag LOCUS_08890 gene cysK 37368 36430 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907957.1 protein_id gnl|my_center|LOCUS_08890 39089 37578 gene locus_tag LOCUS_08900 gene ilvA 39089 37578 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_08900 40158 39238 gene locus_tag LOCUS_08910 40158 39238 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_08910 41780 40236 gene locus_tag LOCUS_08920 41780 40236 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 protein_id gnl|my_center|LOCUS_08920 41937 42596 gene locus_tag LOCUS_08930 41937 42596 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040404.1 protein_id gnl|my_center|LOCUS_08930 42628 44559 gene locus_tag LOCUS_08940 42628 44559 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_08940 48642 44713 gene locus_tag LOCUS_08950 48642 44713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 49353 48745 gene locus_tag LOCUS_08960 49353 48745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 50775 49357 gene locus_tag LOCUS_08970 50775 49357 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_08970 52970 50772 gene locus_tag LOCUS_08980 52970 50772 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_08980 53214 57089 gene locus_tag LOCUS_08990 53214 57089 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815152.1 protein_id gnl|my_center|LOCUS_08990 57385 57816 gene locus_tag LOCUS_09000 57385 57816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 57851 59458 gene locus_tag LOCUS_09010 57851 59458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 59594 60022 gene locus_tag LOCUS_09020 59594 60022 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_09020 60050 60793 gene locus_tag LOCUS_09030 gene ubiE 60050 60793 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_09030 60810 61397 gene locus_tag LOCUS_09040 60810 61397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 61887 61465 gene locus_tag LOCUS_09050 61887 61465 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_09050 63321 61957 gene locus_tag LOCUS_09060 gene atpD 63321 61957 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064897.1 protein_id gnl|my_center|LOCUS_09060 64257 63394 gene locus_tag LOCUS_09070 gene atpG 64257 63394 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_09070 65814 64276 gene locus_tag LOCUS_09080 gene atpA 65814 64276 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_09080 66361 65825 gene locus_tag LOCUS_09090 66361 65825 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815348.1 protein_id gnl|my_center|LOCUS_09090 66836 66366 gene locus_tag LOCUS_09100 66836 66366 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185283.1 protein_id gnl|my_center|LOCUS_09100 67146 66877 gene locus_tag LOCUS_09110 gene atpE 67146 66877 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097235.1 protein_id gnl|my_center|LOCUS_09110 68002 67232 gene locus_tag LOCUS_09120 gene atpB 68002 67232 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 protein_id gnl|my_center|LOCUS_09120 68382 68020 gene locus_tag LOCUS_09130 68382 68020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 69367 68528 gene locus_tag LOCUS_09140 69367 68528 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_09140 70167 69364 gene locus_tag LOCUS_09150 70167 69364 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_09150 70823 70179 gene locus_tag LOCUS_09160 gene rsmG 70823 70179 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_09160 72742 70820 gene locus_tag LOCUS_09170 gene mnmG 72742 70820 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_09170 74070 72943 gene locus_tag LOCUS_09180 74070 72943 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 protein_id gnl|my_center|LOCUS_09180 <75251 74473 gene locus_tag LOCUS_09190 <75251 74473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975689.1:group II intron reverse transcriptase/maturase >Feature sequence010 3263 1077 gene locus_tag LOCUS_09200 3263 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4740 3478 gene locus_tag LOCUS_09210 4740 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5891 4737 gene locus_tag LOCUS_09220 5891 4737 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 protein_id gnl|my_center|LOCUS_09220 7165 5888 gene locus_tag LOCUS_09230 7165 5888 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 protein_id gnl|my_center|LOCUS_09230 7394 7179 gene locus_tag LOCUS_09240 7394 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8635 7406 gene locus_tag LOCUS_09250 8635 7406 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 protein_id gnl|my_center|LOCUS_09250 8795 9301 gene locus_tag LOCUS_09260 8795 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9298 9729 gene locus_tag LOCUS_09270 9298 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 10276 9824 gene locus_tag LOCUS_09280 gene sixA 10276 9824 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_09280 11058 10267 gene locus_tag LOCUS_09290 11058 10267 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_09290 11333 13276 gene locus_tag LOCUS_09300 11333 13276 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_09300 13282 13896 gene locus_tag LOCUS_09310 13282 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 13955 14974 gene locus_tag LOCUS_09320 gene pstS 13955 14974 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_09320 15138 14941 gene locus_tag LOCUS_09330 15138 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 15083 16048 gene locus_tag LOCUS_09340 gene pstC 15083 16048 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_09340 16048 16941 gene locus_tag LOCUS_09350 gene pstA 16048 16941 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_09350 16961 17773 gene locus_tag LOCUS_09360 gene pstB 16961 17773 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_09360 17795 18850 gene locus_tag LOCUS_09370 gene pstS 17795 18850 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_09370 18909 19673 gene locus_tag LOCUS_09380 18909 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 19673 20986 gene locus_tag LOCUS_09390 19673 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 21213 23078 gene locus_tag LOCUS_09400 21213 23078 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_09400 24000 23173 gene locus_tag LOCUS_09410 24000 23173 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_09410 25477 24188 gene locus_tag LOCUS_09420 25477 24188 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_09420 27061 25823 gene locus_tag LOCUS_09430 27061 25823 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_09430 27228 27836 gene locus_tag LOCUS_09440 27228 27836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_09440 29490 27841 gene locus_tag LOCUS_09450 29490 27841 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_09450 29573 30415 gene locus_tag LOCUS_09460 gene asd 29573 30415 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_09460 30480 31736 gene locus_tag LOCUS_09470 30480 31736 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_09470 31733 33124 gene locus_tag LOCUS_09480 31733 33124 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 protein_id gnl|my_center|LOCUS_09480 33745 33254 gene locus_tag LOCUS_09490 33745 33254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 34849 33818 gene locus_tag LOCUS_09500 34849 33818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 36253 34946 gene locus_tag LOCUS_09510 36253 34946 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_09510 37416 36253 gene locus_tag LOCUS_09520 37416 36253 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_09520 37598 37413 gene locus_tag LOCUS_09530 37598 37413 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193501.1 protein_id gnl|my_center|LOCUS_09530 38485 37595 gene locus_tag LOCUS_09540 gene hflC 38485 37595 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_09540 39774 38485 gene locus_tag LOCUS_09550 gene hflK 39774 38485 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_09550 40961 39771 gene locus_tag LOCUS_09560 gene hflX 40961 39771 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_09560 41308 41069 gene locus_tag LOCUS_09570 gene hfq 41308 41069 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687717.1 protein_id gnl|my_center|LOCUS_09570 41567 41743 gene locus_tag LOCUS_09580 41567 41743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 42083 43537 gene locus_tag LOCUS_09590 42083 43537 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_09590 46733 43683 gene locus_tag LOCUS_09600 46733 43683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 48074 46758 gene locus_tag LOCUS_09610 48074 46758 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389343.1 protein_id gnl|my_center|LOCUS_09610 48601 48071 gene locus_tag LOCUS_09620 48601 48071 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_09620 50241 48598 gene locus_tag LOCUS_09630 50241 48598 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941698.1 protein_id gnl|my_center|LOCUS_09630 51878 50241 gene locus_tag LOCUS_09640 51878 50241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 54062 52269 gene locus_tag LOCUS_09650 54062 52269 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_09650 54932 54423 gene locus_tag LOCUS_09660 54932 54423 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_09660 56851 54932 gene locus_tag LOCUS_09670 gene htpG 56851 54932 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_09670 57552 56986 gene locus_tag LOCUS_09680 gene greB 57552 56986 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_09680 58020 57700 gene locus_tag LOCUS_09690 58020 57700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 58087 58785 gene locus_tag LOCUS_09700 58087 58785 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_09700 58830 59132 gene locus_tag LOCUS_09710 58830 59132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 59163 59372 gene locus_tag LOCUS_09720 59163 59372 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_09720 59415 60284 gene locus_tag LOCUS_09730 59415 60284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_09730 61161 60232 gene locus_tag LOCUS_09740 61161 60232 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943315.1 protein_id gnl|my_center|LOCUS_09740 62875 61154 gene locus_tag LOCUS_09750 62875 61154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 63280 62897 gene locus_tag LOCUS_09760 63280 62897 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_09760 63939 63496 gene locus_tag LOCUS_09770 63939 63496 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092588120.1 protein_id gnl|my_center|LOCUS_09770 64982 63954 gene locus_tag LOCUS_09780 64982 63954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 65565 64990 gene locus_tag LOCUS_09790 65565 64990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09790 67737 66172 gene locus_tag LOCUS_09800 67737 66172 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_09800 68875 67742 gene locus_tag LOCUS_09810 68875 67742 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 protein_id gnl|my_center|LOCUS_09810 69330 69061 gene locus_tag LOCUS_09820 69330 69061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 69368 69577 gene locus_tag LOCUS_09830 69368 69577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 70030 69788 gene locus_tag LOCUS_09840 70030 69788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence011 214 2490 gene locus_tag LOCUS_09850 214 2490 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_09850 2496 3803 gene locus_tag LOCUS_09860 2496 3803 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_09860 3807 4796 gene locus_tag LOCUS_09870 gene pdxA 3807 4796 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221872.1 protein_id gnl|my_center|LOCUS_09870 5038 4700 gene locus_tag LOCUS_09880 5038 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4919 5599 gene locus_tag LOCUS_09890 gene rsmA 4919 5599 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 protein_id gnl|my_center|LOCUS_09890 5879 5682 gene locus_tag LOCUS_09900 5879 5682 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_09900 6780 6103 gene locus_tag LOCUS_09910 6780 6103 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_09910 7544 6777 gene locus_tag LOCUS_09920 gene xth 7544 6777 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_09920 8010 8645 gene locus_tag LOCUS_09930 8010 8645 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_09930 8753 10312 gene locus_tag LOCUS_09940 8753 10312 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_09940 10322 11317 gene locus_tag LOCUS_09950 10322 11317 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_09950 11421 12917 gene locus_tag LOCUS_09960 11421 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 12927 14021 gene locus_tag LOCUS_09970 12927 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 14028 15206 gene locus_tag LOCUS_09980 gene wecB 14028 15206 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_09980 15224 16084 gene locus_tag LOCUS_09990 15224 16084 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_09990 16081 17166 gene locus_tag LOCUS_10000 16081 17166 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_10000 17250 18803 gene locus_tag LOCUS_10010 gene xrtA 17250 18803 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_10010 19264 20451 gene locus_tag LOCUS_10020 19264 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 20531 22471 gene locus_tag LOCUS_10030 20531 22471 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_10030 22468 23679 gene locus_tag LOCUS_10040 22468 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 23695 25620 gene locus_tag LOCUS_10050 gene asnB 23695 25620 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_10050 25617 26831 gene locus_tag LOCUS_10060 25617 26831 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_10060 26828 28144 gene locus_tag LOCUS_10070 gene algD 26828 28144 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_10070 28185 29309 gene locus_tag LOCUS_10080 28185 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 29306 30685 gene locus_tag LOCUS_10090 29306 30685 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_10090 30678 32006 gene locus_tag LOCUS_10100 30678 32006 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_10100 32003 32977 gene locus_tag LOCUS_10110 32003 32977 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_10110 33185 34396 gene locus_tag LOCUS_10120 33185 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 34559 36028 gene locus_tag LOCUS_10130 gene wzx 34559 36028 CDS product O83 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102965.1 protein_id gnl|my_center|LOCUS_10130 36025 37185 gene locus_tag LOCUS_10140 36025 37185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 37189 38427 gene locus_tag LOCUS_10150 37189 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 38402 39325 gene locus_tag LOCUS_10160 38402 39325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 39446 40189 gene locus_tag LOCUS_10170 39446 40189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 40170 40973 gene locus_tag LOCUS_10180 40170 40973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 40967 41848 gene locus_tag LOCUS_10190 40967 41848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 41915 43342 gene locus_tag LOCUS_10200 41915 43342 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_10200 44108 43392 gene locus_tag LOCUS_10210 44108 43392 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_10210 45810 44560 gene locus_tag LOCUS_10220 45810 44560 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10220 47626 45923 gene locus_tag LOCUS_10230 gene asnB 47626 45923 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_10230 48313 49374 gene locus_tag LOCUS_10240 48313 49374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 49371 52184 gene locus_tag LOCUS_10250 49371 52184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 54648 52324 gene locus_tag LOCUS_10260 54648 52324 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_10260 54965 55396 gene locus_tag LOCUS_10270 gene fliW 54965 55396 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082606.1 protein_id gnl|my_center|LOCUS_10270 55552 56004 gene locus_tag LOCUS_10280 55552 56004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 56001 56591 gene locus_tag LOCUS_10290 56001 56591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 56569 58620 gene locus_tag LOCUS_10300 56569 58620 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_10300 57297 57388 gene locus_tag LOCUS_t00120 57297 57388 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 58794 60491 gene locus_tag LOCUS_10310 58794 60491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 60601 61572 gene locus_tag LOCUS_10320 60601 61572 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098100.1 protein_id gnl|my_center|LOCUS_10320 61599 62537 gene locus_tag LOCUS_10330 61599 62537 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315817.1 protein_id gnl|my_center|LOCUS_10330 62555 62947 gene locus_tag LOCUS_10340 gene cheY 62555 62947 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 protein_id gnl|my_center|LOCUS_10340 62949 63803 gene locus_tag LOCUS_10350 62949 63803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 63814 65751 gene locus_tag LOCUS_10360 63814 65751 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_10360 65931 67070 gene locus_tag LOCUS_10370 gene flhB 65931 67070 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 protein_id gnl|my_center|LOCUS_10370 67063 69147 gene locus_tag LOCUS_10380 gene flhA 67063 69147 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence012 863 60 gene locus_tag LOCUS_10390 863 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 765 1508 gene locus_tag LOCUS_10400 765 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 1979 2269 gene locus_tag LOCUS_10410 1979 2269 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_10410 2262 2615 gene locus_tag LOCUS_10420 2262 2615 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_10420 3426 3157 gene locus_tag LOCUS_10430 3426 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3698 4321 gene locus_tag LOCUS_10440 3698 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4496 5692 gene locus_tag LOCUS_10450 gene nirJ 4496 5692 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_10450 5689 7278 gene locus_tag LOCUS_10460 5689 7278 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_10460 7519 7758 gene locus_tag LOCUS_10470 7519 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7823 8284 gene locus_tag LOCUS_10480 7823 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 8421 9074 gene locus_tag LOCUS_10490 8421 9074 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105520.1 protein_id gnl|my_center|LOCUS_10490 9056 10042 gene locus_tag LOCUS_10500 9056 10042 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_10500 10539 10063 gene locus_tag LOCUS_10510 10539 10063 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929906.1 protein_id gnl|my_center|LOCUS_10510 10836 10558 gene locus_tag LOCUS_10520 10836 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 12761 11034 gene locus_tag LOCUS_10530 12761 11034 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339077.1 protein_id gnl|my_center|LOCUS_10530 13075 12758 gene locus_tag LOCUS_10540 13075 12758 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_10540 13565 15112 gene locus_tag LOCUS_10550 13565 15112 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_10550 15333 16538 gene locus_tag LOCUS_10560 15333 16538 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_10560 16695 17921 gene locus_tag LOCUS_10570 16695 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 17932 19011 gene locus_tag LOCUS_10580 17932 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 19233 19157 gene locus_tag LOCUS_t00130 19233 19157 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19635 19270 gene locus_tag LOCUS_10590 19635 19270 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 protein_id gnl|my_center|LOCUS_10590 19921 19619 gene locus_tag LOCUS_10600 19921 19619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 21883 19934 gene locus_tag LOCUS_10610 gene pheT 21883 19934 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_10610 21860 22288 gene locus_tag LOCUS_10620 21860 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 23384 22338 gene locus_tag LOCUS_10630 gene pheS 23384 22338 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_10630 23796 23437 gene locus_tag LOCUS_10640 gene rplT 23796 23437 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_10640 24005 23808 gene locus_tag LOCUS_10650 gene rpmI 24005 23808 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_10650 24675 24124 gene locus_tag LOCUS_10660 gene infC 24675 24124 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_10660 26588 24672 gene locus_tag LOCUS_10670 gene thrS 26588 24672 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_10670 29958 26950 gene locus_tag LOCUS_10680 29958 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 30680 30186 gene locus_tag LOCUS_10690 30680 30186 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_10690 30961 30752 gene locus_tag LOCUS_10700 30961 30752 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_10700 32238 31009 gene locus_tag LOCUS_10710 32238 31009 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_10710 33188 32235 gene locus_tag LOCUS_10720 gene argF 33188 32235 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_10720 34373 33198 gene locus_tag LOCUS_10730 34373 33198 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931526.1 protein_id gnl|my_center|LOCUS_10730 35234 34560 gene locus_tag LOCUS_10740 35234 34560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 36830 35430 gene locus_tag LOCUS_10750 36830 35430 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 protein_id gnl|my_center|LOCUS_10750 37766 36870 gene locus_tag LOCUS_10760 37766 36870 CDS product antimicrobial resistance protein Mig-14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114550.1 protein_id gnl|my_center|LOCUS_10760 38301 39206 gene locus_tag LOCUS_10770 38301 39206 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064017.1 protein_id gnl|my_center|LOCUS_10770 39257 40690 gene locus_tag LOCUS_10780 39257 40690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 41018 41863 gene locus_tag LOCUS_10790 41018 41863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 42077 43711 gene locus_tag LOCUS_10800 42077 43711 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_10800 43882 44568 gene locus_tag LOCUS_10810 43882 44568 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528683.1 protein_id gnl|my_center|LOCUS_10810 45340 44780 gene locus_tag LOCUS_10820 45340 44780 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930239.1 protein_id gnl|my_center|LOCUS_10820 46892 45405 gene locus_tag LOCUS_10830 gene nuoN 46892 45405 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_10830 48389 46905 gene locus_tag LOCUS_10840 48389 46905 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_10840 50509 48413 gene locus_tag LOCUS_10850 gene nuoL 50509 48413 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208277753.1 protein_id gnl|my_center|LOCUS_10850 50817 50512 gene locus_tag LOCUS_10860 gene nuoK 50817 50512 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_10860 51531 50929 gene locus_tag LOCUS_10870 51531 50929 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_10870 52032 51544 gene locus_tag LOCUS_10880 gene nuoI 52032 51544 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_10880 53095 52043 gene locus_tag LOCUS_10890 gene nuoH 53095 52043 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196426.1 protein_id gnl|my_center|LOCUS_10890 55419 53092 gene locus_tag LOCUS_10900 gene nuoG 55419 53092 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 protein_id gnl|my_center|LOCUS_10900 56759 55431 gene locus_tag LOCUS_10910 gene nuoF 56759 55431 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_10910 57232 56759 gene locus_tag LOCUS_10920 gene nuoE 57232 56759 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_10920 58485 57232 gene locus_tag LOCUS_10930 58485 57232 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_10930 59083 58478 gene locus_tag LOCUS_10940 59083 58478 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_10940 59584 59108 gene locus_tag LOCUS_10950 59584 59108 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_10950 59974 59588 gene locus_tag LOCUS_10960 59974 59588 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_10960 60106 60022 gene locus_tag LOCUS_t00140 60106 60022 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60541 60170 gene locus_tag LOCUS_10970 gene secG 60541 60170 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_10970 60726 61025 gene locus_tag LOCUS_10980 60726 61025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence013 1110 1631 gene locus_tag LOCUS_10990 1110 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2333 1590 gene locus_tag LOCUS_11000 gene trmB 2333 1590 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 protein_id gnl|my_center|LOCUS_11000 3130 2336 gene locus_tag LOCUS_11010 3130 2336 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446412.1 protein_id gnl|my_center|LOCUS_11010 3355 3155 gene locus_tag LOCUS_11020 gene thiS 3355 3155 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_11020 3501 3683 gene locus_tag LOCUS_11030 3501 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 6075 3781 gene locus_tag LOCUS_11040 6075 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 6310 6552 gene locus_tag LOCUS_11050 6310 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 7760 6609 gene locus_tag LOCUS_11060 7760 6609 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_11060 7955 8911 gene locus_tag LOCUS_11070 7955 8911 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706409.1 protein_id gnl|my_center|LOCUS_11070 9496 8918 gene locus_tag LOCUS_11080 9496 8918 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_11080 9806 9603 gene locus_tag LOCUS_11090 9806 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 9805 11262 gene locus_tag LOCUS_11100 9805 11262 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_11100 12302 11421 gene locus_tag LOCUS_11110 12302 11421 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929974.1 protein_id gnl|my_center|LOCUS_11110 12893 12576 gene locus_tag LOCUS_11120 12893 12576 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_11120 13363 12890 gene locus_tag LOCUS_11130 13363 12890 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_11130 14519 13755 gene locus_tag LOCUS_11140 14519 13755 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_11140 15053 15661 gene locus_tag LOCUS_11150 15053 15661 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194061.1 protein_id gnl|my_center|LOCUS_11150 16295 15753 gene locus_tag LOCUS_11160 16295 15753 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706585.1 protein_id gnl|my_center|LOCUS_11160 16471 16728 gene locus_tag LOCUS_11170 16471 16728 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_11170 16840 17958 gene locus_tag LOCUS_11180 16840 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 18280 18831 gene locus_tag LOCUS_11190 18280 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 18931 20415 gene locus_tag LOCUS_11200 gene thrC 18931 20415 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_11200 20572 20435 gene locus_tag LOCUS_11210 20572 20435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 21591 20734 gene locus_tag LOCUS_11220 gene nadC 21591 20734 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_11220 21650 23128 gene locus_tag LOCUS_11230 21650 23128 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_11230 23812 23255 gene locus_tag LOCUS_11240 23812 23255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 24423 23863 gene locus_tag LOCUS_11250 24423 23863 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_11250 24473 25300 gene locus_tag LOCUS_11260 gene hyi 24473 25300 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244119.1 protein_id gnl|my_center|LOCUS_11260 27143 25368 gene locus_tag LOCUS_11270 gene aceK 27143 25368 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_11270 27485 28714 gene locus_tag LOCUS_11280 gene icd 27485 28714 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_11280 29124 30023 gene locus_tag LOCUS_11290 29124 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 30323 30937 gene locus_tag LOCUS_11300 30323 30937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 32728 31043 gene locus_tag LOCUS_11310 32728 31043 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039376.1 protein_id gnl|my_center|LOCUS_11310 33325 33002 gene locus_tag LOCUS_11320 33325 33002 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_11320 33520 33846 gene locus_tag LOCUS_11330 gene trxA 33520 33846 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_11330 34045 35301 gene locus_tag LOCUS_11340 gene rho 34045 35301 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_11340 35500 35715 gene locus_tag LOCUS_11350 gene rpmE 35500 35715 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_11350 35803 37467 gene locus_tag LOCUS_11360 35803 37467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063980.1 protein_id gnl|my_center|LOCUS_11360 38044 37499 gene locus_tag LOCUS_11370 gene orn 38044 37499 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_11370 38074 39327 gene locus_tag LOCUS_11380 38074 39327 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189931.1 protein_id gnl|my_center|LOCUS_11380 39353 39694 gene locus_tag LOCUS_11390 39353 39694 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_11390 39691 40557 gene locus_tag LOCUS_11400 gene rsgA 39691 40557 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_11400 40580 40858 gene locus_tag LOCUS_11410 40580 40858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 41152 40892 gene locus_tag LOCUS_11420 41152 40892 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_11420 41229 42740 gene locus_tag LOCUS_11430 41229 42740 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_11430 43727 42954 gene locus_tag LOCUS_11440 43727 42954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706124.1 protein_id gnl|my_center|LOCUS_11440 44424 43777 gene locus_tag LOCUS_11450 44424 43777 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_11450 45751 44534 gene locus_tag LOCUS_11460 45751 44534 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_11460 46558 45965 gene locus_tag LOCUS_11470 46558 45965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 46736 48721 gene locus_tag LOCUS_11480 46736 48721 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 protein_id gnl|my_center|LOCUS_11480 48870 49289 gene locus_tag LOCUS_11490 48870 49289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 49391 49951 gene locus_tag LOCUS_11500 49391 49951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 50200 51171 gene locus_tag LOCUS_11510 50200 51171 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_11510 51272 51895 gene locus_tag LOCUS_11520 51272 51895 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084193.1 protein_id gnl|my_center|LOCUS_11520 52059 52790 gene locus_tag LOCUS_11530 52059 52790 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_11530 52808 54025 gene locus_tag LOCUS_11540 52808 54025 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_11540 54043 54840 gene locus_tag LOCUS_11550 54043 54840 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_11550 54837 56495 gene locus_tag LOCUS_11560 54837 56495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 56734 57114 gene locus_tag LOCUS_11570 56734 57114 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944750.1 protein_id gnl|my_center|LOCUS_11570 57278 57739 gene locus_tag LOCUS_11580 57278 57739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 57783 58742 gene locus_tag LOCUS_11590 57783 58742 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_11590 58739 60691 gene locus_tag LOCUS_11600 58739 60691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence014 1479 157 gene locus_tag LOCUS_11610 1479 157 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_11610 2641 1745 gene locus_tag LOCUS_11620 2641 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3671 2730 gene locus_tag LOCUS_11630 gene ttcA 3671 2730 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_11630 4383 3646 gene locus_tag LOCUS_11640 4383 3646 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_11640 4512 5354 gene locus_tag LOCUS_11650 4512 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5357 6541 gene locus_tag LOCUS_11660 5357 6541 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_11660 7841 6612 gene locus_tag LOCUS_11670 7841 6612 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_11670 8916 7951 gene locus_tag LOCUS_11680 8916 7951 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_11680 10912 8957 gene locus_tag LOCUS_11690 10912 8957 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197235.1 protein_id gnl|my_center|LOCUS_11690 10957 11607 gene locus_tag LOCUS_11700 10957 11607 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_11700 14429 11661 gene locus_tag LOCUS_11710 14429 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 14961 14500 gene locus_tag LOCUS_11720 14961 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 15316 17490 gene locus_tag LOCUS_11730 15316 17490 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_11730 17737 18711 gene locus_tag LOCUS_11740 17737 18711 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_11740 18711 20066 gene locus_tag LOCUS_11750 18711 20066 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116611749.1 protein_id gnl|my_center|LOCUS_11750 20063 20686 gene locus_tag LOCUS_11760 20063 20686 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_11760 20873 20676 gene locus_tag LOCUS_11770 20873 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 20812 24288 gene locus_tag LOCUS_11780 gene dnaE 20812 24288 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_11780 24322 24597 gene locus_tag LOCUS_11790 24322 24597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 26210 24726 gene locus_tag LOCUS_11800 gene amt 26210 24726 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_11800 26571 26221 gene locus_tag LOCUS_11810 26571 26221 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_11810 26987 27232 gene locus_tag LOCUS_11820 26987 27232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 27309 28814 gene locus_tag LOCUS_11830 27309 28814 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 protein_id gnl|my_center|LOCUS_11830 29023 29514 gene locus_tag LOCUS_11840 29023 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 29609 30028 gene locus_tag LOCUS_11850 gene speD 29609 30028 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_11850 30088 31449 gene locus_tag LOCUS_11860 30088 31449 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_11860 31449 32147 gene locus_tag LOCUS_11870 31449 32147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 32144 32767 gene locus_tag LOCUS_11880 gene coaE 32144 32767 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_11880 32828 33595 gene locus_tag LOCUS_11890 gene zapD 32828 33595 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_11890 34904 33702 gene locus_tag LOCUS_11900 34904 33702 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_11900 36316 35081 gene locus_tag LOCUS_11910 36316 35081 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_11910 36363 37298 gene locus_tag LOCUS_11920 36363 37298 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_11920 37336 38283 gene locus_tag LOCUS_11930 37336 38283 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_11930 38377 40485 gene locus_tag LOCUS_11940 gene metG 38377 40485 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203868.1 protein_id gnl|my_center|LOCUS_11940 40617 40913 gene locus_tag LOCUS_11950 40617 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 41612 41061 gene locus_tag LOCUS_11960 41612 41061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 42958 41609 gene locus_tag LOCUS_11970 42958 41609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 45122 43077 gene locus_tag LOCUS_11980 gene flgK 45122 43077 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_11980 46129 45194 gene locus_tag LOCUS_11990 gene flgJ 46129 45194 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704936.1 protein_id gnl|my_center|LOCUS_11990 47303 46167 gene locus_tag LOCUS_12000 47303 46167 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_12000 48097 47423 gene locus_tag LOCUS_12010 48097 47423 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_12010 48890 48108 gene locus_tag LOCUS_12020 gene flgG 48890 48108 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367325.1 protein_id gnl|my_center|LOCUS_12020 49650 48901 gene locus_tag LOCUS_12030 gene flgF 49650 48901 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_12030 50931 49681 gene locus_tag LOCUS_12040 gene flgE 50931 49681 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_12040 51629 50949 gene locus_tag LOCUS_12050 gene flgD 51629 50949 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_12050 52069 51662 gene locus_tag LOCUS_12060 gene flgC 52069 51662 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 protein_id gnl|my_center|LOCUS_12060 52473 52069 gene locus_tag LOCUS_12070 gene flgB 52473 52069 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811894.1 protein_id gnl|my_center|LOCUS_12070 52881 53528 gene locus_tag LOCUS_12080 gene flgA 52881 53528 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930322.1 protein_id gnl|my_center|LOCUS_12080 53622 53903 gene locus_tag LOCUS_12090 53622 53903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 53932 54396 gene locus_tag LOCUS_12100 gene flgN 53932 54396 CDS product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032707704.1 protein_id gnl|my_center|LOCUS_12100 55211 54393 gene locus_tag LOCUS_12110 gene motD 55211 54393 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_12110 55956 55216 gene locus_tag LOCUS_12120 55956 55216 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 protein_id gnl|my_center|LOCUS_12120 56698 55949 gene locus_tag LOCUS_12130 56698 55949 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_12130 57601 56717 gene locus_tag LOCUS_12140 57601 56717 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 protein_id gnl|my_center|LOCUS_12140 58163 57594 gene locus_tag LOCUS_12150 58163 57594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence015 1034 3061 gene locus_tag LOCUS_12160 gene ligA 1034 3061 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_12160 3123 3671 gene locus_tag LOCUS_12170 3123 3671 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694420.1 protein_id gnl|my_center|LOCUS_12170 3673 4422 gene locus_tag LOCUS_12180 3673 4422 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_12180 4415 4936 gene locus_tag LOCUS_12190 gene def 4415 4936 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_12190 5026 5964 gene locus_tag LOCUS_12200 5026 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 5969 7102 gene locus_tag LOCUS_12210 5969 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7121 7612 gene locus_tag LOCUS_12220 7121 7612 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_12220 8259 7630 gene locus_tag LOCUS_12230 8259 7630 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389278.1 protein_id gnl|my_center|LOCUS_12230 8424 10823 gene locus_tag LOCUS_12240 8424 10823 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188327.1 protein_id gnl|my_center|LOCUS_12240 11348 12091 gene locus_tag LOCUS_12250 11348 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 protein_id gnl|my_center|LOCUS_12250 12440 14113 gene locus_tag LOCUS_12260 12440 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 14355 16508 gene locus_tag LOCUS_12270 14355 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 17591 16500 gene locus_tag LOCUS_12280 17591 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 21637 17588 gene locus_tag LOCUS_12290 21637 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 21937 23328 gene locus_tag LOCUS_12300 21937 23328 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_12300 25435 23447 gene locus_tag LOCUS_12310 25435 23447 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_12310 26987 25455 gene locus_tag LOCUS_12320 26987 25455 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_12320 28059 27061 gene locus_tag LOCUS_12330 gene meaB 28059 27061 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_12330 30267 28093 gene locus_tag LOCUS_12340 gene scpA 30267 28093 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_12340 30464 31135 gene locus_tag LOCUS_12350 30464 31135 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930715.1 protein_id gnl|my_center|LOCUS_12350 31132 31911 gene locus_tag LOCUS_12360 31132 31911 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928184.1 protein_id gnl|my_center|LOCUS_12360 32721 31921 gene locus_tag LOCUS_12370 32721 31921 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_12370 33759 32857 gene locus_tag LOCUS_12380 gene rfbD 33759 32857 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023623.1 protein_id gnl|my_center|LOCUS_12380 34823 33756 gene locus_tag LOCUS_12390 gene rfbB 34823 33756 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_12390 36260 34902 gene locus_tag LOCUS_12400 36260 34902 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_12400 36454 37407 gene locus_tag LOCUS_12410 gene waaC 36454 37407 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530067.1 protein_id gnl|my_center|LOCUS_12410 37407 38681 gene locus_tag LOCUS_12420 gene waaA 37407 38681 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 protein_id gnl|my_center|LOCUS_12420 39999 38656 gene locus_tag LOCUS_12430 39999 38656 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_12430 40826 40161 gene locus_tag LOCUS_12440 40826 40161 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_12440 41327 41061 gene locus_tag LOCUS_12450 gene rpsT 41327 41061 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_12450 42670 41480 gene locus_tag LOCUS_12460 42670 41480 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 protein_id gnl|my_center|LOCUS_12460 44337 43066 gene locus_tag LOCUS_12470 44337 43066 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195141.1 protein_id gnl|my_center|LOCUS_12470 45502 44714 gene locus_tag LOCUS_12480 gene trpC 45502 44714 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_12480 46555 45530 gene locus_tag LOCUS_12490 gene trpD 46555 45530 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_12490 47124 46552 gene locus_tag LOCUS_12500 47124 46552 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 protein_id gnl|my_center|LOCUS_12500 47652 48167 gene locus_tag LOCUS_12510 47652 48167 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765561.1 protein_id gnl|my_center|LOCUS_12510 48981 48409 gene locus_tag LOCUS_12520 48981 48409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 49250 49008 gene locus_tag LOCUS_12530 49250 49008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 49615 49283 gene locus_tag LOCUS_12540 49615 49283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 50147 51319 gene locus_tag LOCUS_12550 50147 51319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 51316 53376 gene locus_tag LOCUS_12560 51316 53376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 53824 53507 gene locus_tag LOCUS_12570 53824 53507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 53717 53956 gene locus_tag LOCUS_12580 53717 53956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 53957 56344 gene locus_tag LOCUS_12590 gene lon 53957 56344 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_12590 56433 56831 gene locus_tag LOCUS_12600 56433 56831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence016 634 110 gene locus_tag LOCUS_12610 634 110 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_12610 2313 676 gene locus_tag LOCUS_12620 2313 676 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_12620 2715 2341 gene locus_tag LOCUS_12630 2715 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3523 3062 gene locus_tag LOCUS_12640 3523 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4128 3907 gene locus_tag LOCUS_12650 4128 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4163 4363 gene locus_tag LOCUS_12660 4163 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 4388 4639 gene locus_tag LOCUS_12670 4388 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4636 4998 gene locus_tag LOCUS_12680 4636 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5236 5163 gene locus_tag LOCUS_t00150 5236 5163 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5572 7356 gene locus_tag LOCUS_12690 5572 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 8185 7388 gene locus_tag LOCUS_12700 gene tcdA 8185 7388 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_12700 9291 8182 gene locus_tag LOCUS_12710 9291 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 11457 9514 gene locus_tag LOCUS_12720 gene rpoD 11457 9514 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 protein_id gnl|my_center|LOCUS_12720 13254 11509 gene locus_tag LOCUS_12730 13254 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 13853 13641 gene locus_tag LOCUS_12740 gene rpsU 13853 13641 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_12740 15476 14442 gene locus_tag LOCUS_12750 15476 14442 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018642187.1 protein_id gnl|my_center|LOCUS_12750 17289 15571 gene locus_tag LOCUS_12760 17289 15571 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087509.1 protein_id gnl|my_center|LOCUS_12760 18181 17726 gene locus_tag LOCUS_12770 18181 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12770 18352 18200 gene locus_tag LOCUS_12780 18352 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 18687 18349 gene locus_tag LOCUS_12790 18687 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12790 19048 18749 gene locus_tag LOCUS_12800 19048 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 19400 19107 gene locus_tag LOCUS_12810 19400 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12810 20727 19645 gene locus_tag LOCUS_12820 gene hisC 20727 19645 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_12820 21075 20863 gene locus_tag LOCUS_12830 21075 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 20977 21468 gene locus_tag LOCUS_12840 gene hisB 20977 21468 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_12840 21468 22127 gene locus_tag LOCUS_12850 gene hisH 21468 22127 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_12850 22176 22919 gene locus_tag LOCUS_12860 gene hisA 22176 22919 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_12860 22963 23724 gene locus_tag LOCUS_12870 gene hisF 22963 23724 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_12870 23721 24125 gene locus_tag LOCUS_12880 gene hisI 23721 24125 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_12880 24122 24442 gene locus_tag LOCUS_12890 24122 24442 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_12890 24446 24796 gene locus_tag LOCUS_12900 24446 24796 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_12900 24882 25136 gene locus_tag LOCUS_12910 gene tatA 24882 25136 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_12910 25237 25641 gene locus_tag LOCUS_12920 gene tatB 25237 25641 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448907.1 protein_id gnl|my_center|LOCUS_12920 25649 26512 gene locus_tag LOCUS_12930 gene tatC 25649 26512 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_12930 27361 26552 gene locus_tag LOCUS_12940 27361 26552 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_12940 28543 27371 gene locus_tag LOCUS_12950 28543 27371 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_12950 28567 29313 gene locus_tag LOCUS_12960 28567 29313 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 protein_id gnl|my_center|LOCUS_12960 29332 30015 gene locus_tag LOCUS_12970 29332 30015 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_12970 30146 30676 gene locus_tag LOCUS_12980 30146 30676 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940053.1 protein_id gnl|my_center|LOCUS_12980 30736 31284 gene locus_tag LOCUS_12990 gene eetB 30736 31284 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_12990 31277 31894 gene locus_tag LOCUS_13000 31277 31894 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063917.1 protein_id gnl|my_center|LOCUS_13000 31920 33134 gene locus_tag LOCUS_13010 31920 33134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965724.1 protein_id gnl|my_center|LOCUS_13010 33230 37384 gene locus_tag LOCUS_13020 33230 37384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 38543 37455 gene locus_tag LOCUS_13030 gene mutY 38543 37455 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_13030 38858 39442 gene locus_tag LOCUS_13040 38858 39442 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_13040 39789 40094 gene locus_tag LOCUS_13050 39789 40094 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195767.1 protein_id gnl|my_center|LOCUS_13050 40317 41321 gene locus_tag LOCUS_13060 gene galE 40317 41321 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707765.1 protein_id gnl|my_center|LOCUS_13060 41331 42149 gene locus_tag LOCUS_13070 41331 42149 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522249.1 protein_id gnl|my_center|LOCUS_13070 42278 47434 gene locus_tag LOCUS_13080 42278 47434 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952232.1 protein_id gnl|my_center|LOCUS_13080 47431 49125 gene locus_tag LOCUS_13090 gene pbpC 47431 49125 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931115.1 protein_id gnl|my_center|LOCUS_13090 49806 50501 gene locus_tag LOCUS_13100 49806 50501 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_13100 50993 50505 gene locus_tag LOCUS_13110 50993 50505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 51112 52560 gene locus_tag LOCUS_13120 gene purF 51112 52560 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_13120 53386 53036 gene locus_tag LOCUS_13130 53386 53036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 53620 54141 gene locus_tag LOCUS_13140 53620 54141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 54138 54728 gene locus_tag LOCUS_13150 gene rpoE 54138 54728 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_13150 54773 55609 gene locus_tag LOCUS_13160 54773 55609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence017 1022 2218 gene locus_tag LOCUS_13170 gene dapC 1022 2218 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_13170 2238 3059 gene locus_tag LOCUS_13180 gene dapD 2238 3059 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_13180 3094 4275 gene locus_tag LOCUS_13190 3094 4275 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_13190 4345 5469 gene locus_tag LOCUS_13200 gene dapE 4345 5469 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039650.1 protein_id gnl|my_center|LOCUS_13200 5462 6355 gene locus_tag LOCUS_13210 gene prmB 5462 6355 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192731.1 protein_id gnl|my_center|LOCUS_13210 6352 7014 gene locus_tag LOCUS_13220 6352 7014 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_13220 7105 9747 gene locus_tag LOCUS_13230 gene pepN 7105 9747 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522336.1 protein_id gnl|my_center|LOCUS_13230 9945 10214 gene locus_tag LOCUS_13240 gene rpsO 9945 10214 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_13240 10398 12524 gene locus_tag LOCUS_13250 gene pnp 10398 12524 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186494.1 protein_id gnl|my_center|LOCUS_13250 12932 12857 gene locus_tag LOCUS_t00160 12932 12857 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13716 13147 gene locus_tag LOCUS_13260 13716 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 15087 13738 gene locus_tag LOCUS_13270 15087 13738 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_13270 15501 15160 gene locus_tag LOCUS_13280 15501 15160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 16391 15651 gene locus_tag LOCUS_13290 16391 15651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945965.1 protein_id gnl|my_center|LOCUS_13290 16574 17623 gene locus_tag LOCUS_13300 16574 17623 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057677989.1 protein_id gnl|my_center|LOCUS_13300 17636 18454 gene locus_tag LOCUS_13310 17636 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 18646 18789 gene locus_tag LOCUS_13320 18646 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 19145 21088 gene locus_tag LOCUS_13330 19145 21088 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_13330 21558 23177 gene locus_tag LOCUS_13340 21558 23177 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_13340 23167 24417 gene locus_tag LOCUS_13350 23167 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 24417 26150 gene locus_tag LOCUS_13360 24417 26150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 26137 27564 gene locus_tag LOCUS_13370 26137 27564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 27528 28295 gene locus_tag LOCUS_13380 27528 28295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 28292 29299 gene locus_tag LOCUS_13390 gene rhuM 28292 29299 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_13390 29296 32436 gene locus_tag LOCUS_13400 29296 32436 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_13400 32828 32352 gene locus_tag LOCUS_13410 32828 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 33067 32825 gene locus_tag LOCUS_13420 33067 32825 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402169.1 protein_id gnl|my_center|LOCUS_13420 33117 33443 gene locus_tag LOCUS_13430 33117 33443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 33440 33871 gene locus_tag LOCUS_13440 33440 33871 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_13440 33955 34248 gene locus_tag LOCUS_13450 33955 34248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 34245 35390 gene locus_tag LOCUS_13460 34245 35390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 35399 35785 gene locus_tag LOCUS_13470 35399 35785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 35782 36516 gene locus_tag LOCUS_13480 35782 36516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 36548 36937 gene locus_tag LOCUS_13490 36548 36937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 37106 36855 gene locus_tag LOCUS_13500 gene moaD 37106 36855 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093027.1 protein_id gnl|my_center|LOCUS_13500 38327 37122 gene locus_tag LOCUS_13510 38327 37122 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_13510 38841 38314 gene locus_tag LOCUS_13520 gene mobB 38841 38314 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_13520 40166 38838 gene locus_tag LOCUS_13530 40166 38838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 42109 40163 gene locus_tag LOCUS_13540 42109 40163 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_13540 43008 42217 gene locus_tag LOCUS_13550 43008 42217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 43933 43010 gene locus_tag LOCUS_13560 43933 43010 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704890.1 protein_id gnl|my_center|LOCUS_13560 45003 43933 gene locus_tag LOCUS_13570 45003 43933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039035.1 protein_id gnl|my_center|LOCUS_13570 46271 44991 gene locus_tag LOCUS_13580 46271 44991 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_13580 49112 46326 gene locus_tag LOCUS_13590 49112 46326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 50513 49170 gene locus_tag LOCUS_13600 gene prsR 50513 49170 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_13600 52639 50525 gene locus_tag LOCUS_13610 gene prsK 52639 50525 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_13610 54077 52695 gene locus_tag LOCUS_13620 54077 52695 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence018 313 2760 gene locus_tag LOCUS_13630 313 2760 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 protein_id gnl|my_center|LOCUS_13630 2764 3465 gene locus_tag LOCUS_13640 2764 3465 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_13640 3719 4318 gene locus_tag LOCUS_13650 3719 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4315 4824 gene locus_tag LOCUS_13660 4315 4824 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_13660 5194 4868 gene locus_tag LOCUS_13670 5194 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 6975 5296 gene locus_tag LOCUS_13680 gene nirS 6975 5296 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_13680 7184 7972 gene locus_tag LOCUS_13690 7184 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 8874 7969 gene locus_tag LOCUS_13700 gene menA 8874 7969 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391135.1 protein_id gnl|my_center|LOCUS_13700 9220 9136 gene locus_tag LOCUS_t00170 9220 9136 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9333 10391 gene locus_tag LOCUS_13710 gene queA 9333 10391 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538740.1 protein_id gnl|my_center|LOCUS_13710 10404 14609 gene locus_tag LOCUS_13720 10404 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 15584 14724 gene locus_tag LOCUS_13730 15584 14724 CDS product mesaconyl-C(4)-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256090.1 protein_id gnl|my_center|LOCUS_13730 15755 15585 gene locus_tag LOCUS_13740 15755 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 16454 16008 gene locus_tag LOCUS_13750 16454 16008 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_13750 17660 16683 gene locus_tag LOCUS_13760 17660 16683 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_13760 19577 17823 gene locus_tag LOCUS_13770 19577 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 20606 19590 gene locus_tag LOCUS_13780 20606 19590 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_13780 22632 20614 gene locus_tag LOCUS_13790 22632 20614 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_13790 23822 22635 gene locus_tag LOCUS_13800 23822 22635 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 protein_id gnl|my_center|LOCUS_13800 25553 23865 gene locus_tag LOCUS_13810 25553 23865 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_13810 27032 25590 gene locus_tag LOCUS_13820 27032 25590 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_13820 28347 28592 gene locus_tag LOCUS_13830 28347 28592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 28714 29934 gene locus_tag LOCUS_13840 28714 29934 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256085.1 protein_id gnl|my_center|LOCUS_13840 30001 31044 gene locus_tag LOCUS_13850 30001 31044 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256084.1 protein_id gnl|my_center|LOCUS_13850 31078 32136 gene locus_tag LOCUS_13860 31078 32136 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_13860 33209 32214 gene locus_tag LOCUS_13870 33209 32214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 33555 34151 gene locus_tag LOCUS_13880 33555 34151 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_13880 34144 35397 gene locus_tag LOCUS_13890 gene porA 34144 35397 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_13890 35409 36422 gene locus_tag LOCUS_13900 gene porB 35409 36422 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_13900 36422 38044 gene locus_tag LOCUS_13910 36422 38044 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_13910 38208 40940 gene locus_tag LOCUS_13920 gene ppdK 38208 40940 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_13920 41121 42236 gene locus_tag LOCUS_13930 gene tgt 41121 42236 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_13930 42289 42615 gene locus_tag LOCUS_13940 gene yajC 42289 42615 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_13940 42675 44552 gene locus_tag LOCUS_13950 gene secD 42675 44552 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_13950 44564 45508 gene locus_tag LOCUS_13960 gene secF 44564 45508 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_13960 45543 46235 gene locus_tag LOCUS_13970 45543 46235 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_13970 46760 46305 gene locus_tag LOCUS_13980 46760 46305 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_13980 47317 46997 gene locus_tag LOCUS_13990 47317 46997 CDS product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 protein_id gnl|my_center|LOCUS_13990 47650 47321 gene locus_tag LOCUS_14000 47650 47321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 49017 47650 gene locus_tag LOCUS_14010 gene purB 49017 47650 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036678.1 protein_id gnl|my_center|LOCUS_14010 49142 49750 gene locus_tag LOCUS_14020 49142 49750 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 protein_id gnl|my_center|LOCUS_14020 50850 49894 gene locus_tag LOCUS_14030 gene motB 50850 49894 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 protein_id gnl|my_center|LOCUS_14030 51740 50883 gene locus_tag LOCUS_14040 gene motA 51740 50883 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_14040 51988 52533 gene locus_tag LOCUS_14050 51988 52533 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_14050 52967 53578 gene locus_tag LOCUS_14060 52967 53578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 54115 53654 gene locus_tag LOCUS_14070 54115 53654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 55040 54120 gene locus_tag LOCUS_14080 55040 54120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence019 122 1150 gene locus_tag LOCUS_14090 122 1150 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_14090 1147 1776 gene locus_tag LOCUS_14100 gene rsxG 1147 1776 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_14100 1773 2447 gene locus_tag LOCUS_14110 1773 2447 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561393.1 protein_id gnl|my_center|LOCUS_14110 2479 2760 gene locus_tag LOCUS_14120 2479 2760 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 protein_id gnl|my_center|LOCUS_14120 3107 6136 gene locus_tag LOCUS_14130 3107 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6368 6036 gene locus_tag LOCUS_14140 6368 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7831 6386 gene locus_tag LOCUS_14150 7831 6386 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090344.1 protein_id gnl|my_center|LOCUS_14150 9193 7841 gene locus_tag LOCUS_14160 gene creD 9193 7841 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_14160 10723 9287 gene locus_tag LOCUS_14170 gene creC 10723 9287 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 protein_id gnl|my_center|LOCUS_14170 11411 10731 gene locus_tag LOCUS_14180 gene creB 11411 10731 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873813.1 protein_id gnl|my_center|LOCUS_14180 13502 11487 gene locus_tag LOCUS_14190 13502 11487 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546024.1 protein_id gnl|my_center|LOCUS_14190 15333 14059 gene locus_tag LOCUS_14200 15333 14059 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_14200 16829 15627 gene locus_tag LOCUS_14210 16829 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 16935 16756 gene locus_tag LOCUS_14220 16935 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 17966 17097 gene locus_tag LOCUS_14230 17966 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 18420 17959 gene locus_tag LOCUS_14240 18420 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 18739 18425 gene locus_tag LOCUS_14250 18739 18425 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_14250 19281 18754 gene locus_tag LOCUS_14260 19281 18754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 20429 19305 gene locus_tag LOCUS_14270 gene nifV 20429 19305 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_14270 21643 20573 gene locus_tag LOCUS_14280 gene modC 21643 20573 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_14280 22311 21640 gene locus_tag LOCUS_14290 gene modB 22311 21640 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_14290 23224 22403 gene locus_tag LOCUS_14300 gene modA 23224 22403 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463409.1 protein_id gnl|my_center|LOCUS_14300 23772 23224 gene locus_tag LOCUS_14310 23772 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 24033 25457 gene locus_tag LOCUS_14320 gene nifE 24033 25457 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_14320 25450 26853 gene locus_tag LOCUS_14330 gene nifN 25450 26853 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_14330 26867 27286 gene locus_tag LOCUS_14340 gene nifX 26867 27286 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545689.1 protein_id gnl|my_center|LOCUS_14340 27283 27720 gene locus_tag LOCUS_14350 27283 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 27717 28202 gene locus_tag LOCUS_14360 27717 28202 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_14360 28213 28422 gene locus_tag LOCUS_14370 28213 28422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 28427 28723 gene locus_tag LOCUS_14380 gene fdxB 28427 28723 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533478.1 protein_id gnl|my_center|LOCUS_14380 28919 29245 gene locus_tag LOCUS_14390 28919 29245 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565964.1 protein_id gnl|my_center|LOCUS_14390 29256 30140 gene locus_tag LOCUS_14400 gene nifU 29256 30140 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_14400 30165 31373 gene locus_tag LOCUS_14410 gene nifS 30165 31373 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_14410 32276 31476 gene locus_tag LOCUS_14420 32276 31476 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_14420 32872 32273 gene locus_tag LOCUS_14430 gene rnhB 32872 32273 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 protein_id gnl|my_center|LOCUS_14430 34037 32850 gene locus_tag LOCUS_14440 gene lpxB 34037 32850 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205135.1 protein_id gnl|my_center|LOCUS_14440 34822 34034 gene locus_tag LOCUS_14450 gene lpxA 34822 34034 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063749.1 protein_id gnl|my_center|LOCUS_14450 35270 34824 gene locus_tag LOCUS_14460 gene fabZ 35270 34824 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_14460 36298 35267 gene locus_tag LOCUS_14470 gene lpxD 36298 35267 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039864.1 protein_id gnl|my_center|LOCUS_14470 35452 35526 gene locus_tag LOCUS_t00180 35452 35526 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 36837 36319 gene locus_tag LOCUS_14480 36837 36319 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_14480 39138 36853 gene locus_tag LOCUS_14490 gene bamA 39138 36853 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_14490 40510 39143 gene locus_tag LOCUS_14500 gene rseP 40510 39143 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_14500 41715 40507 gene locus_tag LOCUS_14510 41715 40507 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 protein_id gnl|my_center|LOCUS_14510 42548 41712 gene locus_tag LOCUS_14520 42548 41712 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_14520 43335 42541 gene locus_tag LOCUS_14530 gene uppS 43335 42541 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_14530 43919 43359 gene locus_tag LOCUS_14540 gene frr 43919 43359 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_14540 44654 43932 gene locus_tag LOCUS_14550 gene pyrH 44654 43932 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_14550 45578 44682 gene locus_tag LOCUS_14560 gene tsf 45578 44682 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_14560 46439 45717 gene locus_tag LOCUS_14570 gene rpsB 46439 45717 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_14570 46825 46505 gene locus_tag LOCUS_14580 46825 46505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 46848 47618 gene locus_tag LOCUS_14590 gene map 46848 47618 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_14590 47615 50197 gene locus_tag LOCUS_14600 47615 50197 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197089.1 protein_id gnl|my_center|LOCUS_14600 50709 51089 gene locus_tag LOCUS_14610 50709 51089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 51135 51386 gene locus_tag LOCUS_14620 51135 51386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 51383 52327 gene locus_tag LOCUS_14630 51383 52327 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence020 62 2323 gene locus_tag LOCUS_14640 62 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2380 4350 gene locus_tag LOCUS_14650 2380 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4735 5019 gene locus_tag LOCUS_14660 4735 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5021 7309 gene locus_tag LOCUS_14670 5021 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 7306 8028 gene locus_tag LOCUS_14680 7306 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8252 8632 gene locus_tag LOCUS_14690 gene rpsF 8252 8632 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_14690 8595 8975 gene locus_tag LOCUS_14700 8595 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 8947 9222 gene locus_tag LOCUS_14710 gene rpsR 8947 9222 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 protein_id gnl|my_center|LOCUS_14710 9237 9695 gene locus_tag LOCUS_14720 gene rplI 9237 9695 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_14720 9835 11283 gene locus_tag LOCUS_14730 9835 11283 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_14730 12650 11307 gene locus_tag LOCUS_14740 12650 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 14120 12696 gene locus_tag LOCUS_14750 14120 12696 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_14750 14620 14165 gene locus_tag LOCUS_14760 14620 14165 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_14760 14776 15378 gene locus_tag LOCUS_14770 gene lexA 14776 15378 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704040.1 protein_id gnl|my_center|LOCUS_14770 15405 16112 gene locus_tag LOCUS_14780 gene imuA 15405 16112 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_14780 16045 17529 gene locus_tag LOCUS_14790 16045 17529 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550915.1 protein_id gnl|my_center|LOCUS_14790 17619 18056 gene locus_tag LOCUS_14800 17619 18056 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_14800 18334 19968 gene locus_tag LOCUS_14810 gene pgi 18334 19968 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_14810 20038 21675 gene locus_tag LOCUS_14820 20038 21675 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_14820 21763 23007 gene locus_tag LOCUS_14830 gene glgC 21763 23007 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089198.1 protein_id gnl|my_center|LOCUS_14830 23036 24478 gene locus_tag LOCUS_14840 gene glgA 23036 24478 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 protein_id gnl|my_center|LOCUS_14840 24641 25879 gene locus_tag LOCUS_14850 24641 25879 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_14850 27102 25999 gene locus_tag LOCUS_14860 gene selD 27102 25999 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_14860 27531 27316 gene locus_tag LOCUS_14870 27531 27316 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217091.1 protein_id gnl|my_center|LOCUS_14870 30018 27571 gene locus_tag LOCUS_14880 gene copA1 30018 27571 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_14880 30760 30080 gene locus_tag LOCUS_14890 30760 30080 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_14890 32383 30986 gene locus_tag LOCUS_14900 gene hemN 32383 30986 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689506.1 protein_id gnl|my_center|LOCUS_14900 32483 33226 gene locus_tag LOCUS_14910 gene fnr 32483 33226 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_14910 33648 33256 gene locus_tag LOCUS_14920 33648 33256 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_14920 34964 33648 gene locus_tag LOCUS_14930 34964 33648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_14930 35200 34964 gene locus_tag LOCUS_14940 35200 34964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 35658 35197 gene locus_tag LOCUS_14950 35658 35197 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_14950 35959 36402 gene locus_tag LOCUS_14960 35959 36402 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_14960 36579 37256 gene locus_tag LOCUS_14970 36579 37256 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_14970 37269 37529 gene locus_tag LOCUS_14980 37269 37529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 37507 38154 gene locus_tag LOCUS_14990 37507 38154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 38636 38151 gene locus_tag LOCUS_15000 38636 38151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 39261 40442 gene locus_tag LOCUS_15010 39261 40442 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_15010 41161 40493 gene locus_tag LOCUS_15020 gene bioD 41161 40493 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203536601.1 protein_id gnl|my_center|LOCUS_15020 41934 41164 gene locus_tag LOCUS_15030 gene bioC 41934 41164 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 protein_id gnl|my_center|LOCUS_15030 42679 41915 gene locus_tag LOCUS_15040 gene bioH 42679 41915 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_15040 43830 42670 gene locus_tag LOCUS_15050 gene bioF 43830 42670 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_15050 45161 43827 gene locus_tag LOCUS_15060 gene bioA 45161 43827 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 protein_id gnl|my_center|LOCUS_15060 46364 45189 gene locus_tag LOCUS_15070 46364 45189 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_15070 47700 46576 gene locus_tag LOCUS_15080 47700 46576 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_15080 48076 48528 gene locus_tag LOCUS_15090 48076 48528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 48579 49013 gene locus_tag LOCUS_15100 48579 49013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 49127 50353 gene locus_tag LOCUS_15110 49127 50353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence021 1609 275 gene locus_tag LOCUS_15120 1609 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4112 1812 gene locus_tag LOCUS_15130 4112 1812 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_15130 4474 6312 gene locus_tag LOCUS_15140 4474 6312 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_15140 6429 7595 gene locus_tag LOCUS_15150 6429 7595 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_15150 8166 7612 gene locus_tag LOCUS_15160 gene ampD 8166 7612 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_15160 9560 8190 gene locus_tag LOCUS_15170 gene pilR 9560 8190 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_15170 11143 9554 gene locus_tag LOCUS_15180 11143 9554 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946907.1 protein_id gnl|my_center|LOCUS_15180 11375 11148 gene locus_tag LOCUS_15190 11375 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 11619 11543 gene locus_tag LOCUS_t00190 11619 11543 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12600 11638 gene locus_tag LOCUS_15200 gene ispB 12600 11638 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_15200 12773 13108 gene locus_tag LOCUS_15210 gene rplU 12773 13108 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_15210 13128 13394 gene locus_tag LOCUS_15220 gene rpmA 13128 13394 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_15220 13500 14606 gene locus_tag LOCUS_15230 gene obgE 13500 14606 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_15230 14603 15721 gene locus_tag LOCUS_15240 gene proB 14603 15721 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_15240 15896 16579 gene locus_tag LOCUS_15250 15896 16579 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094031.1 protein_id gnl|my_center|LOCUS_15250 16605 17336 gene locus_tag LOCUS_15260 16605 17336 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266464.1 protein_id gnl|my_center|LOCUS_15260 17689 17333 gene locus_tag LOCUS_15270 17689 17333 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554203.1 protein_id gnl|my_center|LOCUS_15270 18089 17703 gene locus_tag LOCUS_15280 gene crcB 18089 17703 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_15280 18453 18653 gene locus_tag LOCUS_15290 18453 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 18883 20709 gene locus_tag LOCUS_15300 gene msbA 18883 20709 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_15300 22186 20750 gene locus_tag LOCUS_15310 22186 20750 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_15310 22982 22209 gene locus_tag LOCUS_15320 22982 22209 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_15320 23803 22979 gene locus_tag LOCUS_15330 gene rfaP 23803 22979 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_15330 24912 23800 gene locus_tag LOCUS_15340 24912 23800 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_15340 25834 24965 gene locus_tag LOCUS_15350 25834 24965 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_15350 26076 27245 gene locus_tag LOCUS_15360 gene metK 26076 27245 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_15360 27364 28593 gene locus_tag LOCUS_15370 27364 28593 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_15370 28760 28620 gene locus_tag LOCUS_15380 28760 28620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 30684 28762 gene locus_tag LOCUS_15390 30684 28762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 31742 30726 gene locus_tag LOCUS_15400 31742 30726 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_15400 32201 31797 gene locus_tag LOCUS_15410 32201 31797 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267180.1 protein_id gnl|my_center|LOCUS_15410 32969 32247 gene locus_tag LOCUS_15420 32969 32247 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_15420 33772 32966 gene locus_tag LOCUS_15430 gene birA 33772 32966 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115072.1 protein_id gnl|my_center|LOCUS_15430 35272 33824 gene locus_tag LOCUS_15440 gene ntrC 35272 33824 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_15440 36387 35314 gene locus_tag LOCUS_15450 gene glnL 36387 35314 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_15450 36956 36468 gene locus_tag LOCUS_15460 36956 36468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 38559 37144 gene locus_tag LOCUS_15470 gene glnA 38559 37144 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_15470 38856 39305 gene locus_tag LOCUS_15480 38856 39305 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_15480 39433 40530 gene locus_tag LOCUS_15490 gene nadA 39433 40530 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_15490 40678 41544 gene locus_tag LOCUS_15500 gene hslO 40678 41544 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191092.1 protein_id gnl|my_center|LOCUS_15500 42975 41566 gene locus_tag LOCUS_15510 42975 41566 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_15510 43310 44275 gene locus_tag LOCUS_15520 43310 44275 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 protein_id gnl|my_center|LOCUS_15520 44298 46745 gene locus_tag LOCUS_15530 gene glgP 44298 46745 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209497.1 protein_id gnl|my_center|LOCUS_15530 46761 48944 gene locus_tag LOCUS_15540 gene glgB 46761 48944 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283713.1 protein_id gnl|my_center|LOCUS_15540 48932 50950 gene locus_tag LOCUS_15550 gene glgX 48932 50950 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111246.1 protein_id gnl|my_center|LOCUS_15550 51080 51155 gene locus_tag LOCUS_t00200 51080 51155 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 614 1690 gene locus_tag LOCUS_15560 gene ribBA 614 1690 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 protein_id gnl|my_center|LOCUS_15560 1690 2208 gene locus_tag LOCUS_15570 gene ribH 1690 2208 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_15570 2205 2696 gene locus_tag LOCUS_15580 gene nusB 2205 2696 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185707.1 protein_id gnl|my_center|LOCUS_15580 2740 3693 gene locus_tag LOCUS_15590 gene thiL 2740 3693 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_15590 3686 4171 gene locus_tag LOCUS_15600 3686 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4168 4677 gene locus_tag LOCUS_15610 gene pncC 4168 4677 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 protein_id gnl|my_center|LOCUS_15610 4914 6683 gene locus_tag LOCUS_15620 4914 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 6837 7856 gene locus_tag LOCUS_15630 gene recA 6837 7856 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_15630 7867 8316 gene locus_tag LOCUS_15640 7867 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 8319 9053 gene locus_tag LOCUS_15650 gene lptB 8319 9053 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_15650 9135 10562 gene locus_tag LOCUS_15660 9135 10562 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_15660 10579 10905 gene locus_tag LOCUS_15670 gene raiA 10579 10905 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_15670 10999 11451 gene locus_tag LOCUS_15680 gene ptsN 10999 11451 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_15680 11448 12392 gene locus_tag LOCUS_15690 gene hprK 11448 12392 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195225.1 protein_id gnl|my_center|LOCUS_15690 12437 12754 gene locus_tag LOCUS_15700 12437 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 13255 12875 gene locus_tag LOCUS_15710 13255 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 13340 14509 gene locus_tag LOCUS_15720 13340 14509 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_15720 14539 15249 gene locus_tag LOCUS_15730 14539 15249 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_15730 16311 15397 gene locus_tag LOCUS_15740 16311 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 16520 16311 gene locus_tag LOCUS_15750 16520 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 16768 16508 gene locus_tag LOCUS_15760 16768 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 17687 16761 gene locus_tag LOCUS_15770 gene liuE 17687 16761 CDS product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 protein_id gnl|my_center|LOCUS_15770 19725 17689 gene locus_tag LOCUS_15780 19725 17689 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_15780 20529 19735 gene locus_tag LOCUS_15790 20529 19735 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_15790 22157 20538 gene locus_tag LOCUS_15800 22157 20538 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035500.1 protein_id gnl|my_center|LOCUS_15800 22759 22157 gene locus_tag LOCUS_15810 22759 22157 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_15810 23329 22850 gene locus_tag LOCUS_15820 23329 22850 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113376.1 protein_id gnl|my_center|LOCUS_15820 24467 23331 gene locus_tag LOCUS_15830 24467 23331 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_15830 25408 24464 gene locus_tag LOCUS_15840 25408 24464 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_15840 26558 25416 gene locus_tag LOCUS_15850 26558 25416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 27829 26666 gene locus_tag LOCUS_15860 27829 26666 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267707.1 protein_id gnl|my_center|LOCUS_15860 28439 27966 gene locus_tag LOCUS_15870 28439 27966 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_15870 28636 29694 gene locus_tag LOCUS_15880 28636 29694 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_15880 29830 30996 gene locus_tag LOCUS_15890 29830 30996 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805048.1 protein_id gnl|my_center|LOCUS_15890 31050 31427 gene locus_tag LOCUS_15900 31050 31427 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_15900 31499 32347 gene locus_tag LOCUS_15910 31499 32347 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940966.1 protein_id gnl|my_center|LOCUS_15910 32942 32433 gene locus_tag LOCUS_15920 gene rfaE2 32942 32433 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_15920 33128 36061 gene locus_tag LOCUS_15930 33128 36061 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704874.1 protein_id gnl|my_center|LOCUS_15930 36796 36951 gene locus_tag LOCUS_15940 36796 36951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 37927 37028 gene locus_tag LOCUS_15950 37927 37028 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_15950 38044 39642 gene locus_tag LOCUS_15960 gene aceB 38044 39642 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193967.1 protein_id gnl|my_center|LOCUS_15960 40900 39797 gene locus_tag LOCUS_15970 gene hemH 40900 39797 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_15970 41928 40900 gene locus_tag LOCUS_15980 gene hrcA 41928 40900 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_15980 42007 42933 gene locus_tag LOCUS_15990 42007 42933 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_15990 42957 44624 gene locus_tag LOCUS_16000 gene recN 42957 44624 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_16000 44967 44629 gene locus_tag LOCUS_16010 44967 44629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 45213 46493 gene locus_tag LOCUS_16020 45213 46493 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_16020 46493 46586 gene locus_tag LOCUS_t00210 46493 46586 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47118 48146 gene locus_tag LOCUS_16030 47118 48146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 48295 48579 gene locus_tag LOCUS_16040 48295 48579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 48608 50059 gene locus_tag LOCUS_16050 48608 50059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 50056 51051 gene locus_tag LOCUS_16060 50056 51051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence023 6079 164 gene locus_tag LOCUS_16070 6079 164 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164452817.1 protein_id gnl|my_center|LOCUS_16070 9622 6098 gene locus_tag LOCUS_16080 9622 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 10524 9643 gene locus_tag LOCUS_16090 10524 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 12236 10524 gene locus_tag LOCUS_16100 12236 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 13869 12358 gene locus_tag LOCUS_16110 13869 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14045 14680 gene locus_tag LOCUS_16120 14045 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 14697 15176 gene locus_tag LOCUS_16130 14697 15176 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 protein_id gnl|my_center|LOCUS_16130 16140 15208 gene locus_tag LOCUS_16140 16140 15208 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039182.1 protein_id gnl|my_center|LOCUS_16140 17204 16299 gene locus_tag LOCUS_16150 17204 16299 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_16150 18049 17210 gene locus_tag LOCUS_16160 gene ccsA 18049 17210 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_16160 18080 19435 gene locus_tag LOCUS_16170 gene ffh 18080 19435 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_16170 20065 19463 gene locus_tag LOCUS_16180 20065 19463 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_16180 21777 20053 gene locus_tag LOCUS_16190 21777 20053 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_16190 22025 22570 gene locus_tag LOCUS_16200 22025 22570 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_16200 22573 23151 gene locus_tag LOCUS_16210 22573 23151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 23309 23932 gene locus_tag LOCUS_16220 gene coq7 23309 23932 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194286.1 protein_id gnl|my_center|LOCUS_16220 24348 23929 gene locus_tag LOCUS_16230 24348 23929 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_16230 24924 25352 gene locus_tag LOCUS_16240 gene rplM 24924 25352 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_16240 25359 25754 gene locus_tag LOCUS_16250 gene rpsI 25359 25754 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_16250 25849 26877 gene locus_tag LOCUS_16260 gene argC 25849 26877 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_16260 27272 27598 gene locus_tag LOCUS_16270 gene erpA 27272 27598 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_16270 28673 27738 gene locus_tag LOCUS_16280 28673 27738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 29893 28670 gene locus_tag LOCUS_16290 29893 28670 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 protein_id gnl|my_center|LOCUS_16290 30018 30167 gene locus_tag LOCUS_16300 30018 30167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 30198 30746 gene locus_tag LOCUS_16310 gene cbaB 30198 30746 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_16310 30761 32455 gene locus_tag LOCUS_16320 30761 32455 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_16320 32586 33482 gene locus_tag LOCUS_16330 32586 33482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 33560 34441 gene locus_tag LOCUS_16340 33560 34441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 34446 34928 gene locus_tag LOCUS_16350 gene nikR 34446 34928 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 protein_id gnl|my_center|LOCUS_16350 35029 36600 gene locus_tag LOCUS_16360 35029 36600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 36593 37090 gene locus_tag LOCUS_16370 36593 37090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 37153 39066 gene locus_tag LOCUS_16380 37153 39066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 39508 40062 gene locus_tag LOCUS_16390 39508 40062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 40721 40140 gene locus_tag LOCUS_16400 40721 40140 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_16400 42013 40718 gene locus_tag LOCUS_16410 42013 40718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880043.1 protein_id gnl|my_center|LOCUS_16410 41895 42341 gene locus_tag LOCUS_16420 41895 42341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 42425 42619 gene locus_tag LOCUS_16430 42425 42619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 43638 42682 gene locus_tag LOCUS_16440 43638 42682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_16440 43782 45014 gene locus_tag LOCUS_16450 43782 45014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 45591 45397 gene locus_tag LOCUS_16460 45591 45397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 45813 47129 gene locus_tag LOCUS_16470 45813 47129 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_16470 47224 47544 gene locus_tag LOCUS_16480 47224 47544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 47541 47963 gene locus_tag LOCUS_16490 47541 47963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 47966 48523 gene locus_tag LOCUS_16500 47966 48523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 48879 49274 gene locus_tag LOCUS_16510 48879 49274 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_16510 49530 49261 gene locus_tag LOCUS_16520 49530 49261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence024 397 3864 gene locus_tag LOCUS_16530 397 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4000 10113 gene locus_tag LOCUS_16540 4000 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6715 6949 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggggcagcggcaatgacg 11076 11726 gene locus_tag LOCUS_16550 11076 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 12169 16797 gene locus_tag LOCUS_16560 12169 16797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 17211 20513 gene locus_tag LOCUS_16570 17211 20513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 21023 22078 gene locus_tag LOCUS_16580 21023 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 23295 22111 gene locus_tag LOCUS_16590 23295 22111 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061605.1 protein_id gnl|my_center|LOCUS_16590 24709 23297 gene locus_tag LOCUS_16600 24709 23297 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 protein_id gnl|my_center|LOCUS_16600 25002 24742 gene locus_tag LOCUS_16610 25002 24742 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191739.1 protein_id gnl|my_center|LOCUS_16610 26447 25002 gene locus_tag LOCUS_16620 26447 25002 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_16620 26965 26531 gene locus_tag LOCUS_16630 26965 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 27634 27035 gene locus_tag LOCUS_16640 gene rpoE 27634 27035 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_16640 27853 29085 gene locus_tag LOCUS_16650 27853 29085 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_16650 29092 32292 gene locus_tag LOCUS_16660 29092 32292 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_16660 32285 33721 gene locus_tag LOCUS_16670 32285 33721 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_16670 33861 34742 gene locus_tag LOCUS_16680 gene ppk2 33861 34742 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705517.1 protein_id gnl|my_center|LOCUS_16680 34800 35165 gene locus_tag LOCUS_16690 34800 35165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 35219 35509 gene locus_tag LOCUS_16700 35219 35509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 35904 37328 gene locus_tag LOCUS_16710 35904 37328 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_16710 37325 39049 gene locus_tag LOCUS_16720 37325 39049 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_16720 40918 39221 gene locus_tag LOCUS_16730 40918 39221 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705581.1 protein_id gnl|my_center|LOCUS_16730 42477 41236 gene locus_tag LOCUS_16740 42477 41236 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_16740 42596 43024 gene locus_tag LOCUS_16750 42596 43024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16750 44155 43226 gene locus_tag LOCUS_16760 44155 43226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 46008 44488 gene locus_tag LOCUS_16770 46008 44488 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_16770 46551 48017 gene locus_tag LOCUS_16780 46551 48017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 48157 48933 gene locus_tag LOCUS_16790 48157 48933 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence025 460 137 gene locus_tag LOCUS_16800 460 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1025 627 gene locus_tag LOCUS_16810 1025 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_16810 2568 1105 gene locus_tag LOCUS_16820 gene ubiD 2568 1105 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_16820 3265 2669 gene locus_tag LOCUS_16830 3265 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3503 4150 gene locus_tag LOCUS_16840 gene thrH 3503 4150 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_16840 4157 5029 gene locus_tag LOCUS_16850 gene purU 4157 5029 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_16850 5079 7028 gene locus_tag LOCUS_16860 5079 7028 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_16860 7054 7479 gene locus_tag LOCUS_16870 7054 7479 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_16870 7693 9450 gene locus_tag LOCUS_16880 7693 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 9580 9780 gene locus_tag LOCUS_16890 9580 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 9794 10126 gene locus_tag LOCUS_16900 9794 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 10841 12166 gene locus_tag LOCUS_16910 10841 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 13047 12244 gene locus_tag LOCUS_16920 13047 12244 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_16920 14597 13050 gene locus_tag LOCUS_16930 14597 13050 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_16930 15576 14641 gene locus_tag LOCUS_16940 15576 14641 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_16940 16325 15714 gene locus_tag LOCUS_16950 16325 15714 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_16950 16736 16407 gene locus_tag LOCUS_16960 16736 16407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 17623 16898 gene locus_tag LOCUS_16970 17623 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 18004 17696 gene locus_tag LOCUS_16980 18004 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 18970 18008 gene locus_tag LOCUS_16990 18970 18008 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_16990 19126 19560 gene locus_tag LOCUS_17000 19126 19560 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194168.1 protein_id gnl|my_center|LOCUS_17000 19573 19947 gene locus_tag LOCUS_17010 19573 19947 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194251.1 protein_id gnl|my_center|LOCUS_17010 20359 21744 gene locus_tag LOCUS_17020 gene eno 20359 21744 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682247.1 protein_id gnl|my_center|LOCUS_17020 22184 21987 gene locus_tag LOCUS_17030 22184 21987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 24164 22866 gene locus_tag LOCUS_17040 gene arsJ 24164 22866 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255925.1 protein_id gnl|my_center|LOCUS_17040 25274 24264 gene locus_tag LOCUS_17050 25274 24264 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_17050 25475 25852 gene locus_tag LOCUS_17060 25475 25852 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530549.1 protein_id gnl|my_center|LOCUS_17060 26167 27408 gene locus_tag LOCUS_17070 gene arsB 26167 27408 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_17070 27428 27970 gene locus_tag LOCUS_17080 27428 27970 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 protein_id gnl|my_center|LOCUS_17080 28500 28132 gene locus_tag LOCUS_17090 28500 28132 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_17090 28794 28982 gene locus_tag LOCUS_17100 28794 28982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 28997 29488 gene locus_tag LOCUS_17110 28997 29488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 29494 30804 gene locus_tag LOCUS_17120 29494 30804 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_17120 34905 31837 gene locus_tag LOCUS_17130 34905 31837 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531051.1 protein_id gnl|my_center|LOCUS_17130 36206 34902 gene locus_tag LOCUS_17140 36206 34902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 36352 36669 gene locus_tag LOCUS_17150 36352 36669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 36666 36893 gene locus_tag LOCUS_17160 36666 36893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 36942 37172 gene locus_tag LOCUS_17170 36942 37172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 37172 37429 gene locus_tag LOCUS_17180 37172 37429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 37476 37685 gene locus_tag LOCUS_17190 37476 37685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17190 37713 38030 gene locus_tag LOCUS_17200 37713 38030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 38381 37968 gene locus_tag LOCUS_17210 38381 37968 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855059.1 protein_id gnl|my_center|LOCUS_17210 38673 38524 gene locus_tag LOCUS_17220 38673 38524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 39837 39016 gene locus_tag LOCUS_17230 39837 39016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 40303 39914 gene locus_tag LOCUS_17240 40303 39914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 40745 40389 gene locus_tag LOCUS_17250 40745 40389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 41718 41035 gene locus_tag LOCUS_17260 41718 41035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 42255 42518 gene locus_tag LOCUS_17270 42255 42518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 42593 43456 gene locus_tag LOCUS_17280 42593 43456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 43679 44041 gene locus_tag LOCUS_17290 43679 44041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 45639 44557 gene locus_tag LOCUS_17300 45639 44557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 46923 46129 gene locus_tag LOCUS_17310 46923 46129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 48218 46989 gene locus_tag LOCUS_17320 48218 46989 CDS product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506888.1 protein_id gnl|my_center|LOCUS_17320 48532 48457 gene locus_tag LOCUS_t00220 48532 48457 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence026 321 1046 gene locus_tag LOCUS_17330 321 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2241 1309 gene locus_tag LOCUS_17340 2241 1309 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_17340 2328 3116 gene locus_tag LOCUS_17350 2328 3116 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_17350 4057 3173 gene locus_tag LOCUS_17360 4057 3173 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616194.1 protein_id gnl|my_center|LOCUS_17360 4935 4057 gene locus_tag LOCUS_17370 4935 4057 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521294.1 protein_id gnl|my_center|LOCUS_17370 5561 5148 gene locus_tag LOCUS_17380 5561 5148 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_17380 6150 5731 gene locus_tag LOCUS_17390 gene arfB 6150 5731 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_17390 6736 6158 gene locus_tag LOCUS_17400 6736 6158 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_17400 6892 8025 gene locus_tag LOCUS_17410 6892 8025 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_17410 8029 8541 gene locus_tag LOCUS_17420 8029 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 9581 8538 gene locus_tag LOCUS_17430 9581 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 11015 9594 gene locus_tag LOCUS_17440 11015 9594 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_17440 11857 11087 gene locus_tag LOCUS_17450 11857 11087 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763753.1 protein_id gnl|my_center|LOCUS_17450 13866 11887 gene locus_tag LOCUS_17460 13866 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 15753 14098 gene locus_tag LOCUS_17470 15753 14098 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921157.1 protein_id gnl|my_center|LOCUS_17470 16448 15750 gene locus_tag LOCUS_17480 16448 15750 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265940.1 protein_id gnl|my_center|LOCUS_17480 17063 16533 gene locus_tag LOCUS_17490 17063 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 17612 17097 gene locus_tag LOCUS_17500 17612 17097 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_17500 18789 17698 gene locus_tag LOCUS_17510 18789 17698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 20304 18904 gene locus_tag LOCUS_17520 20304 18904 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090883.1 protein_id gnl|my_center|LOCUS_17520 20978 20301 gene locus_tag LOCUS_17530 20978 20301 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_17530 21706 20987 gene locus_tag LOCUS_17540 21706 20987 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_17540 23122 21884 gene locus_tag LOCUS_17550 23122 21884 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_17550 24556 23450 gene locus_tag LOCUS_17560 24556 23450 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_17560 25699 24620 gene locus_tag LOCUS_17570 25699 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 26262 25843 gene locus_tag LOCUS_17580 26262 25843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 26713 26273 gene locus_tag LOCUS_17590 26713 26273 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274661.1 protein_id gnl|my_center|LOCUS_17590 27953 26772 gene locus_tag LOCUS_17600 27953 26772 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_17600 28787 28020 gene locus_tag LOCUS_17610 28787 28020 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_17610 29564 29361 gene locus_tag LOCUS_17620 29564 29361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 30883 29543 gene locus_tag LOCUS_17630 30883 29543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 31800 30883 gene locus_tag LOCUS_17640 31800 30883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 32185 34182 gene locus_tag LOCUS_17650 32185 34182 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_17650 34233 34529 gene locus_tag LOCUS_17660 34233 34529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 34751 34500 gene locus_tag LOCUS_17670 34751 34500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 36019 34745 gene locus_tag LOCUS_17680 36019 34745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 36293 36817 gene locus_tag LOCUS_17690 36293 36817 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_17690 36963 37256 gene locus_tag LOCUS_17700 36963 37256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 37253 38437 gene locus_tag LOCUS_17710 37253 38437 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_17710 38660 40213 gene locus_tag LOCUS_17720 38660 40213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 40210 42324 gene locus_tag LOCUS_17730 40210 42324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 42321 43904 gene locus_tag LOCUS_17740 42321 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 44348 44136 gene locus_tag LOCUS_17750 44348 44136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 44829 44434 gene locus_tag LOCUS_17760 44829 44434 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_17760 45076 45327 gene locus_tag LOCUS_17770 45076 45327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 45646 45473 gene locus_tag LOCUS_17780 45646 45473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 46504 45743 gene locus_tag LOCUS_17790 46504 45743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_17790 <47018 46501 gene locus_tag LOCUS_17800 <47018 46501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528681.1:ABC transporter ATP-binding protein >Feature sequence027 376 717 gene locus_tag LOCUS_17810 376 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1899 862 gene locus_tag LOCUS_17820 gene purM 1899 862 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_17820 2043 2699 gene locus_tag LOCUS_17830 gene hda 2043 2699 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_17830 2717 3382 gene locus_tag LOCUS_17840 2717 3382 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_17840 3469 4818 gene locus_tag LOCUS_17850 gene pcnB 3469 4818 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929702.1 protein_id gnl|my_center|LOCUS_17850 4913 5350 gene locus_tag LOCUS_17860 4913 5350 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 protein_id gnl|my_center|LOCUS_17860 5571 6692 gene locus_tag LOCUS_17870 5571 6692 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_17870 6719 7369 gene locus_tag LOCUS_17880 6719 7369 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_17880 7374 8186 gene locus_tag LOCUS_17890 gene panB 7374 8186 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_17890 8297 9142 gene locus_tag LOCUS_17900 gene panC 8297 9142 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_17900 9211 9582 gene locus_tag LOCUS_17910 9211 9582 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_17910 11029 9680 gene locus_tag LOCUS_17920 11029 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 11734 11222 gene locus_tag LOCUS_17930 11734 11222 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_17930 12052 13212 gene locus_tag LOCUS_17940 12052 13212 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_17940 13229 14407 gene locus_tag LOCUS_17950 13229 14407 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_17950 14820 17204 gene locus_tag LOCUS_17960 14820 17204 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_17960 17807 17340 gene locus_tag LOCUS_17970 17807 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 18842 18195 gene locus_tag LOCUS_17980 18842 18195 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812158.1 protein_id gnl|my_center|LOCUS_17980 20104 18953 gene locus_tag LOCUS_17990 20104 18953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 21051 20722 gene locus_tag LOCUS_18000 21051 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 21331 21038 gene locus_tag LOCUS_18010 21331 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 22064 21462 gene locus_tag LOCUS_18020 22064 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 22212 23249 gene locus_tag LOCUS_18030 22212 23249 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_18030 23351 27313 gene locus_tag LOCUS_18040 gene hrpA 23351 27313 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_18040 27340 28098 gene locus_tag LOCUS_18050 27340 28098 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 protein_id gnl|my_center|LOCUS_18050 28723 28175 gene locus_tag LOCUS_18060 28723 28175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 29478 28921 gene locus_tag LOCUS_18070 29478 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 30426 29818 gene locus_tag LOCUS_18080 gene lptA 30426 29818 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_18080 30998 30423 gene locus_tag LOCUS_18090 gene lptC 30998 30423 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522855.1 protein_id gnl|my_center|LOCUS_18090 31564 31016 gene locus_tag LOCUS_18100 31564 31016 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_18100 32547 31564 gene locus_tag LOCUS_18110 32547 31564 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_18110 32659 34626 gene locus_tag LOCUS_18120 32659 34626 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_18120 35338 34637 gene locus_tag LOCUS_18130 35338 34637 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_18130 35500 37227 gene locus_tag LOCUS_18140 35500 37227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 38516 37224 gene locus_tag LOCUS_18150 38516 37224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 39415 38720 gene locus_tag LOCUS_18160 39415 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 40679 39672 gene locus_tag LOCUS_18170 40679 39672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 41129 40683 gene locus_tag LOCUS_18180 41129 40683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 41829 41194 gene locus_tag LOCUS_18190 41829 41194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 43370 41826 gene locus_tag LOCUS_18200 43370 41826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 44475 43375 gene locus_tag LOCUS_18210 44475 43375 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18210 46330 44582 gene locus_tag LOCUS_18220 46330 44582 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_18220 <47004 46346 gene locus_tag LOCUS_18230 <47004 46346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941827.1:tetratricopeptide repeat protein >Feature sequence028 342 1592 gene locus_tag LOCUS_18240 342 1592 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_18240 1598 2068 gene locus_tag LOCUS_18250 gene nrdR 1598 2068 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_18250 2319 1987 gene locus_tag LOCUS_18260 2319 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2242 3174 gene locus_tag LOCUS_18270 gene ribD 2242 3174 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_18270 3925 3116 gene locus_tag LOCUS_18280 gene moeB 3925 3116 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_18280 4354 3935 gene locus_tag LOCUS_18290 4354 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5792 4377 gene locus_tag LOCUS_18300 gene cptA 5792 4377 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446625.1 protein_id gnl|my_center|LOCUS_18300 7440 5935 gene locus_tag LOCUS_18310 7440 5935 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_18310 7593 7901 gene locus_tag LOCUS_18320 7593 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7986 8405 gene locus_tag LOCUS_18330 7986 8405 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522910.1 protein_id gnl|my_center|LOCUS_18330 8402 8677 gene locus_tag LOCUS_18340 gene grxC 8402 8677 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 protein_id gnl|my_center|LOCUS_18340 8732 9199 gene locus_tag LOCUS_18350 gene secB 8732 9199 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225639.1 protein_id gnl|my_center|LOCUS_18350 9203 9637 gene locus_tag LOCUS_18360 9203 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 10002 11123 gene locus_tag LOCUS_18370 10002 11123 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072430.1 protein_id gnl|my_center|LOCUS_18370 11370 13373 gene locus_tag LOCUS_18380 11370 13373 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_18380 13411 14139 gene locus_tag LOCUS_18390 13411 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 14143 14763 gene locus_tag LOCUS_18400 14143 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 15728 14760 gene locus_tag LOCUS_18410 15728 14760 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_18410 16032 16457 gene locus_tag LOCUS_18420 gene dksA 16032 16457 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_18420 16797 18746 gene locus_tag LOCUS_18430 16797 18746 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451799.1 protein_id gnl|my_center|LOCUS_18430 18772 21114 gene locus_tag LOCUS_18440 gene parC 18772 21114 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 protein_id gnl|my_center|LOCUS_18440 21154 21633 gene locus_tag LOCUS_18450 21154 21633 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792825.1 protein_id gnl|my_center|LOCUS_18450 21722 22951 gene locus_tag LOCUS_18460 21722 22951 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611273.1 protein_id gnl|my_center|LOCUS_18460 23046 24356 gene locus_tag LOCUS_18470 gene gshA 23046 24356 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_18470 24347 25300 gene locus_tag LOCUS_18480 gene gshB 24347 25300 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_18480 25282 26322 gene locus_tag LOCUS_18490 25282 26322 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527101.1 protein_id gnl|my_center|LOCUS_18490 26398 26811 gene locus_tag LOCUS_18500 26398 26811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_18500 26812 27081 gene locus_tag LOCUS_18510 26812 27081 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_18510 27089 28831 gene locus_tag LOCUS_18520 gene ptsP 27089 28831 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_18520 28845 29972 gene locus_tag LOCUS_18530 28845 29972 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_18530 29969 30592 gene locus_tag LOCUS_18540 gene metW 29969 30592 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_18540 30592 31854 gene locus_tag LOCUS_18550 30592 31854 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 protein_id gnl|my_center|LOCUS_18550 31821 32552 gene locus_tag LOCUS_18560 31821 32552 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_18560 32956 32636 gene locus_tag LOCUS_18570 32956 32636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 33347 32937 gene locus_tag LOCUS_18580 33347 32937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 33682 33362 gene locus_tag LOCUS_18590 33682 33362 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 protein_id gnl|my_center|LOCUS_18590 34578 33778 gene locus_tag LOCUS_18600 34578 33778 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_18600 34621 35268 gene locus_tag LOCUS_18610 gene pyrE 34621 35268 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_18610 35246 35884 gene locus_tag LOCUS_18620 35246 35884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 37383 35929 gene locus_tag LOCUS_18630 gene gatB 37383 35929 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040609.1 protein_id gnl|my_center|LOCUS_18630 38966 37497 gene locus_tag LOCUS_18640 gene gatA 38966 37497 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_18640 39364 38963 gene locus_tag LOCUS_18650 39364 38963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 39363 40406 gene locus_tag LOCUS_18660 39363 40406 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_18660 40455 41384 gene locus_tag LOCUS_18670 gene mreC 40455 41384 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18670 41389 41913 gene locus_tag LOCUS_18680 gene mreD 41389 41913 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523092.1 protein_id gnl|my_center|LOCUS_18680 41995 43890 gene locus_tag LOCUS_18690 gene mrdA 41995 43890 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_18690 43894 45000 gene locus_tag LOCUS_18700 gene rodA 43894 45000 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence029 447 226 gene locus_tag LOCUS_18710 447 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 383 1678 gene locus_tag LOCUS_18720 383 1678 CDS product depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389460.1 protein_id gnl|my_center|LOCUS_18720 1653 2180 gene locus_tag LOCUS_18730 1653 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 3927 2338 gene locus_tag LOCUS_18740 gene ggt 3927 2338 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083412.1 protein_id gnl|my_center|LOCUS_18740 4112 5530 gene locus_tag LOCUS_18750 gene gltX 4112 5530 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_18750 5661 5736 gene locus_tag LOCUS_t00230 5661 5736 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5757 5832 gene locus_tag LOCUS_t00240 5757 5832 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7325 6021 gene locus_tag LOCUS_18760 7325 6021 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 protein_id gnl|my_center|LOCUS_18760 7517 7861 gene locus_tag LOCUS_18770 7517 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 7877 8248 gene locus_tag LOCUS_18780 7877 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 8318 9268 gene locus_tag LOCUS_18790 8318 9268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940070.1 protein_id gnl|my_center|LOCUS_18790 9857 10357 gene locus_tag LOCUS_18800 9857 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 10977 10525 gene locus_tag LOCUS_18810 gene dtd 10977 10525 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_18810 11432 10974 gene locus_tag LOCUS_18820 11432 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 12289 11429 gene locus_tag LOCUS_18830 12289 11429 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_18830 12203 12424 gene locus_tag LOCUS_18840 12203 12424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 13528 12473 gene locus_tag LOCUS_18850 gene tdt 13528 12473 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870080.1 protein_id gnl|my_center|LOCUS_18850 13727 15613 gene locus_tag LOCUS_18860 13727 15613 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_18860 15628 16125 gene locus_tag LOCUS_18870 15628 16125 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_18870 16208 18052 gene locus_tag LOCUS_18880 16208 18052 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820957.1 protein_id gnl|my_center|LOCUS_18880 18447 18085 gene locus_tag LOCUS_18890 gene arsC 18447 18085 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_18890 19117 18506 gene locus_tag LOCUS_18900 19117 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 20740 19535 gene locus_tag LOCUS_18910 20740 19535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_18910 21972 20764 gene locus_tag LOCUS_18920 21972 20764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_18920 22679 21954 gene locus_tag LOCUS_18930 22679 21954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_18930 23849 22683 gene locus_tag LOCUS_18940 23849 22683 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_18940 24602 24051 gene locus_tag LOCUS_18950 24602 24051 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195907.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18950 24873 26111 gene locus_tag LOCUS_18960 24873 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 26133 26669 gene locus_tag LOCUS_18970 gene hslV 26133 26669 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_18970 26681 28003 gene locus_tag LOCUS_18980 gene hslU 26681 28003 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523084.1 protein_id gnl|my_center|LOCUS_18980 28463 28035 gene locus_tag LOCUS_18990 28463 28035 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809299.1 protein_id gnl|my_center|LOCUS_18990 29203 28460 gene locus_tag LOCUS_19000 29203 28460 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930483.1 protein_id gnl|my_center|LOCUS_19000 30568 29219 gene locus_tag LOCUS_19010 30568 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 30746 31324 gene locus_tag LOCUS_19020 gene grpE 30746 31324 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_19020 31424 33361 gene locus_tag LOCUS_19030 gene dnaK 31424 33361 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_19030 33429 34553 gene locus_tag LOCUS_19040 gene dnaJ 33429 34553 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_19040 35031 34687 gene locus_tag LOCUS_19050 35031 34687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 35126 36268 gene locus_tag LOCUS_19060 35126 36268 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_19060 37229 36480 gene locus_tag LOCUS_19070 37229 36480 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_19070 39984 37234 gene locus_tag LOCUS_19080 39984 37234 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_19080 41177 39993 gene locus_tag LOCUS_19090 41177 39993 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_19090 41820 41344 gene locus_tag LOCUS_19100 41820 41344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 43299 41833 gene locus_tag LOCUS_19110 43299 41833 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_19110 44522 43296 gene locus_tag LOCUS_19120 44522 43296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence030 5695 4937 gene locus_tag LOCUS_19130 gene liaR 5695 4937 CDS product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 protein_id gnl|my_center|LOCUS_19130 6737 8182 gene locus_tag LOCUS_19140 6737 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 8176 8409 gene locus_tag LOCUS_19150 8176 8409 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_19150 8491 9390 gene locus_tag LOCUS_19160 gene glyQ 8491 9390 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 protein_id gnl|my_center|LOCUS_19160 9392 11464 gene locus_tag LOCUS_19170 gene glyS 9392 11464 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244319.1 protein_id gnl|my_center|LOCUS_19170 11461 11997 gene locus_tag LOCUS_19180 gene gmhB 11461 11997 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_19180 11997 12740 gene locus_tag LOCUS_19190 11997 12740 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814405.1 protein_id gnl|my_center|LOCUS_19190 12724 13488 gene locus_tag LOCUS_19200 12724 13488 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_19200 13590 14078 gene locus_tag LOCUS_19210 13590 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 14438 14043 gene locus_tag LOCUS_19220 14438 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 15285 15067 gene locus_tag LOCUS_19230 15285 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 15635 16183 gene locus_tag LOCUS_19240 15635 16183 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_19240 16568 17761 gene locus_tag LOCUS_19250 16568 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 18166 18552 gene locus_tag LOCUS_19260 gene gloA 18166 18552 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_19260 18557 19159 gene locus_tag LOCUS_19270 18557 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_19270 19352 20299 gene locus_tag LOCUS_19280 19352 20299 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192001.1 protein_id gnl|my_center|LOCUS_19280 20302 21051 gene locus_tag LOCUS_19290 20302 21051 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 protein_id gnl|my_center|LOCUS_19290 21048 22052 gene locus_tag LOCUS_19300 21048 22052 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524705.1 protein_id gnl|my_center|LOCUS_19300 22042 22554 gene locus_tag LOCUS_19310 22042 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 22660 23007 gene locus_tag LOCUS_19320 22660 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 23015 23590 gene locus_tag LOCUS_19330 23015 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 23587 24999 gene locus_tag LOCUS_19340 23587 24999 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_19340 25497 25054 gene locus_tag LOCUS_19350 25497 25054 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_19350 25867 27489 gene locus_tag LOCUS_19360 25867 27489 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_19360 28602 27520 gene locus_tag LOCUS_19370 gene mnmA 28602 27520 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_19370 29275 28646 gene locus_tag LOCUS_19380 29275 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 29718 29263 gene locus_tag LOCUS_19390 29718 29263 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_19390 29832 30746 gene locus_tag LOCUS_19400 29832 30746 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_19400 30773 30970 gene locus_tag LOCUS_19410 30773 30970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 31014 32030 gene locus_tag LOCUS_19420 gene waaF 31014 32030 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_19420 32027 32470 gene locus_tag LOCUS_19430 32027 32470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 32467 33441 gene locus_tag LOCUS_19440 32467 33441 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_19440 33443 34822 gene locus_tag LOCUS_19450 33443 34822 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_19450 34865 36124 gene locus_tag LOCUS_19460 34865 36124 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_19460 37794 36298 gene locus_tag LOCUS_19470 37794 36298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 38276 37791 gene locus_tag LOCUS_19480 38276 37791 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_19480 39307 38273 gene locus_tag LOCUS_19490 39307 38273 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_19490 42013 39398 gene locus_tag LOCUS_19500 gene alaS 42013 39398 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence031 3 443 gene locus_tag LOCUS_19510 3 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 503 1243 gene locus_tag LOCUS_19520 503 1243 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 protein_id gnl|my_center|LOCUS_19520 1245 1925 gene locus_tag LOCUS_19530 gene gltK 1245 1925 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194080.1 protein_id gnl|my_center|LOCUS_19530 2061 2789 gene locus_tag LOCUS_19540 2061 2789 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194225.1 protein_id gnl|my_center|LOCUS_19540 2975 7633 gene locus_tag LOCUS_19550 2975 7633 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_19550 7800 8351 gene locus_tag LOCUS_19560 7800 8351 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550823.1 protein_id gnl|my_center|LOCUS_19560 8410 9570 gene locus_tag LOCUS_19570 gene sucC 8410 9570 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_19570 9581 10474 gene locus_tag LOCUS_19580 gene sucD 9581 10474 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 protein_id gnl|my_center|LOCUS_19580 10637 11596 gene locus_tag LOCUS_19590 10637 11596 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_19590 11760 12590 gene locus_tag LOCUS_19600 gene prpC 11760 12590 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_19600 12605 13285 gene locus_tag LOCUS_19610 12605 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 13383 14150 gene locus_tag LOCUS_19620 13383 14150 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_19620 14152 16524 gene locus_tag LOCUS_19630 14152 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 16781 16963 gene locus_tag LOCUS_19640 16781 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 16990 17361 gene locus_tag LOCUS_19650 16990 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 17440 18243 gene locus_tag LOCUS_19660 17440 18243 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_19660 18243 19088 gene locus_tag LOCUS_19670 18243 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 19151 19978 gene locus_tag LOCUS_19680 19151 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 20046 21944 gene locus_tag LOCUS_19690 20046 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 23543 21945 gene locus_tag LOCUS_19700 23543 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 24468 23518 gene locus_tag LOCUS_19710 24468 23518 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_19710 25578 24478 gene locus_tag LOCUS_19720 gene neuB 25578 24478 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_19720 27376 25607 gene locus_tag LOCUS_19730 gene ilvB 27376 25607 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_19730 27855 28766 gene locus_tag LOCUS_19740 gene rfbF 27855 28766 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707823.1 protein_id gnl|my_center|LOCUS_19740 28744 29790 gene locus_tag LOCUS_19750 28744 29790 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037177.1 protein_id gnl|my_center|LOCUS_19750 29831 31144 gene locus_tag LOCUS_19760 gene rfbH 29831 31144 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_19760 31236 32198 gene locus_tag LOCUS_19770 31236 32198 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_19770 32210 33427 gene locus_tag LOCUS_19780 32210 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 33424 34434 gene locus_tag LOCUS_19790 33424 34434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 34594 36060 gene locus_tag LOCUS_19800 34594 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 36118 37875 gene locus_tag LOCUS_19810 36118 37875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 protein_id gnl|my_center|LOCUS_19810 38666 37941 gene locus_tag LOCUS_19820 38666 37941 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 protein_id gnl|my_center|LOCUS_19820 38806 40320 gene locus_tag LOCUS_19830 38806 40320 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298776.1 protein_id gnl|my_center|LOCUS_19830 40613 40425 gene locus_tag LOCUS_19840 40613 40425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 40849 42066 gene locus_tag LOCUS_19850 40849 42066 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence032 1424 144 gene locus_tag LOCUS_19860 gene hemL 1424 144 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_19860 2058 1396 gene locus_tag LOCUS_19870 gene thiE 2058 1396 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_19870 2929 2051 gene locus_tag LOCUS_19880 2929 2051 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_19880 2939 3235 gene locus_tag LOCUS_19890 2939 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 3331 3726 gene locus_tag LOCUS_19900 gene pilG 3331 3726 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_19900 3777 4139 gene locus_tag LOCUS_19910 gene pilH 3777 4139 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_19910 4155 4664 gene locus_tag LOCUS_19920 4155 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 4737 6911 gene locus_tag LOCUS_19930 gene pilJ 4737 6911 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_19930 6938 12301 gene locus_tag LOCUS_19940 6938 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 13727 12267 gene locus_tag LOCUS_19950 13727 12267 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_19950 13775 14335 gene locus_tag LOCUS_19960 13775 14335 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_19960 14328 14810 gene locus_tag LOCUS_19970 gene ruvX 14328 14810 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_19970 14807 15331 gene locus_tag LOCUS_19980 gene pyrR 14807 15331 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_19980 15324 16283 gene locus_tag LOCUS_19990 15324 16283 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_19990 16287 17543 gene locus_tag LOCUS_20000 16287 17543 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_20000 17868 17578 gene locus_tag LOCUS_20010 gene yggU 17868 17578 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482461.1 protein_id gnl|my_center|LOCUS_20010 18411 17872 gene locus_tag LOCUS_20020 18411 17872 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_20020 19226 18411 gene locus_tag LOCUS_20030 gene proC 19226 18411 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_20030 19906 19223 gene locus_tag LOCUS_20040 19906 19223 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_20040 19976 21022 gene locus_tag LOCUS_20050 gene tapT 19976 21022 CDS product type IVa pilus ATPase TapT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707389.1 protein_id gnl|my_center|LOCUS_20050 21049 22188 gene locus_tag LOCUS_20060 21049 22188 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_20060 23359 22220 gene locus_tag LOCUS_20070 23359 22220 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_20070 23795 23379 gene locus_tag LOCUS_20080 23795 23379 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531998.1 protein_id gnl|my_center|LOCUS_20080 24373 23789 gene locus_tag LOCUS_20090 24373 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 24488 24685 gene locus_tag LOCUS_20100 24488 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 24734 25807 gene locus_tag LOCUS_20110 24734 25807 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_20110 25800 26975 gene locus_tag LOCUS_20120 25800 26975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 27724 27014 gene locus_tag LOCUS_20130 27724 27014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204918.1 protein_id gnl|my_center|LOCUS_20130 28510 27743 gene locus_tag LOCUS_20140 28510 27743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_20140 29589 28513 gene locus_tag LOCUS_20150 29589 28513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812851.1 protein_id gnl|my_center|LOCUS_20150 30509 29586 gene locus_tag LOCUS_20160 30509 29586 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812854.1 protein_id gnl|my_center|LOCUS_20160 31944 30682 gene locus_tag LOCUS_20170 31944 30682 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_20170 32420 32115 gene locus_tag LOCUS_20180 gene nirM 32420 32115 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_20180 34465 32609 gene locus_tag LOCUS_20190 gene ilvD 34465 32609 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_20190 34549 35346 gene locus_tag LOCUS_20200 gene lgt 34549 35346 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191241.1 protein_id gnl|my_center|LOCUS_20200 35384 36769 gene locus_tag LOCUS_20210 35384 36769 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_20210 36820 37293 gene locus_tag LOCUS_20220 36820 37293 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_20220 37501 41085 gene locus_tag LOCUS_20230 37501 41085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence033 8717 8469 gene locus_tag LOCUS_20240 8717 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 23030 9192 gene locus_tag LOCUS_20250 23030 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 26767 23486 gene locus_tag LOCUS_20260 26767 23486 CDS product pre-peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975828.1 protein_id gnl|my_center|LOCUS_20260 27746 26913 gene locus_tag LOCUS_20270 gene fabI 27746 26913 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_20270 28097 29125 gene locus_tag LOCUS_20280 28097 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 29531 31327 gene locus_tag LOCUS_20290 gene lepA 29531 31327 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_20290 31340 32128 gene locus_tag LOCUS_20300 gene lepB 31340 32128 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_20300 32141 32512 gene locus_tag LOCUS_20310 32141 32512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 32509 33180 gene locus_tag LOCUS_20320 gene rnc 32509 33180 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20320 33177 34061 gene locus_tag LOCUS_20330 gene era 33177 34061 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_20330 34100 34816 gene locus_tag LOCUS_20340 gene recO 34100 34816 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_20340 34813 35568 gene locus_tag LOCUS_20350 34813 35568 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546437.1 protein_id gnl|my_center|LOCUS_20350 35565 35942 gene locus_tag LOCUS_20360 gene acpS 35565 35942 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_20360 35939 36967 gene locus_tag LOCUS_20370 gene nagZ 35939 36967 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_20370 37806 37015 gene locus_tag LOCUS_20380 37806 37015 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941377.1 protein_id gnl|my_center|LOCUS_20380 38132 38863 gene locus_tag LOCUS_20390 38132 38863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 38946 39929 gene locus_tag LOCUS_20400 38946 39929 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence034 1047 22 gene locus_tag LOCUS_20410 1047 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1536 1670 gene locus_tag LOCUS_20420 1536 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3106 1709 gene locus_tag LOCUS_20430 3106 1709 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_20430 3765 3103 gene locus_tag LOCUS_20440 3765 3103 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_20440 4172 3765 gene locus_tag LOCUS_20450 4172 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4284 4706 gene locus_tag LOCUS_20460 4284 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4865 5356 gene locus_tag LOCUS_20470 4865 5356 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337163.1 protein_id gnl|my_center|LOCUS_20470 5500 6798 gene locus_tag LOCUS_20480 5500 6798 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_20480 7445 6984 gene locus_tag LOCUS_20490 7445 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7812 7456 gene locus_tag LOCUS_20500 7812 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 8821 8057 gene locus_tag LOCUS_20510 8821 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 11773 9425 gene locus_tag LOCUS_20520 11773 9425 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032475098.1 protein_id gnl|my_center|LOCUS_20520 12079 13959 gene locus_tag LOCUS_20530 12079 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 15313 14111 gene locus_tag LOCUS_20540 15313 14111 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 protein_id gnl|my_center|LOCUS_20540 15420 17504 gene locus_tag LOCUS_20550 gene uvrB 15420 17504 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_20550 18071 17526 gene locus_tag LOCUS_20560 18071 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 18649 18107 gene locus_tag LOCUS_20570 18649 18107 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_20570 18834 19367 gene locus_tag LOCUS_20580 18834 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 22259 19554 gene locus_tag LOCUS_20590 gene acnA 22259 19554 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_20590 22635 23360 gene locus_tag LOCUS_20600 22635 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 23383 24825 gene locus_tag LOCUS_20610 23383 24825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 25293 25066 gene locus_tag LOCUS_20620 25293 25066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 26358 25345 gene locus_tag LOCUS_20630 26358 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 26594 27823 gene locus_tag LOCUS_20640 26594 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 28821 27925 gene locus_tag LOCUS_20650 28821 27925 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836194.1 protein_id gnl|my_center|LOCUS_20650 28998 29543 gene locus_tag LOCUS_20660 28998 29543 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405944.1 protein_id gnl|my_center|LOCUS_20660 29894 30754 gene locus_tag LOCUS_20670 29894 30754 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_20670 31190 30786 gene locus_tag LOCUS_20680 31190 30786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 32037 31201 gene locus_tag LOCUS_20690 32037 31201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 32159 32446 gene locus_tag LOCUS_20700 32159 32446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 32813 33250 gene locus_tag LOCUS_20710 32813 33250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 33729 36329 gene locus_tag LOCUS_20720 gene mutS 33729 36329 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_20720 36326 37267 gene locus_tag LOCUS_20730 36326 37267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_20730 37479 38612 gene locus_tag LOCUS_20740 37479 38612 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_20740 <40719 38629 gene locus_tag LOCUS_20750 <40719 38629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545132.1:ferrous iron transport protein B >Feature sequence035 <1 924 gene locus_tag LOCUS_20760 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033446869.1:dienelactone hydrolase family protein 979 1755 gene locus_tag LOCUS_20770 979 1755 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_20770 2214 1780 gene locus_tag LOCUS_20780 2214 1780 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_20780 3427 2585 gene locus_tag LOCUS_20790 3427 2585 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_20790 3795 3424 gene locus_tag LOCUS_20800 3795 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3940 4227 gene locus_tag LOCUS_20810 3940 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 4224 5147 gene locus_tag LOCUS_20820 4224 5147 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_20820 5205 7097 gene locus_tag LOCUS_20830 gene dxs 5205 7097 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_20830 7116 7940 gene locus_tag LOCUS_20840 gene folE2 7116 7940 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_20840 8398 8033 gene locus_tag LOCUS_20850 gene rplS 8398 8033 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_20850 9228 8422 gene locus_tag LOCUS_20860 gene trmD 9228 8422 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_20860 9800 9225 gene locus_tag LOCUS_20870 gene rimM 9800 9225 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 protein_id gnl|my_center|LOCUS_20870 10058 9804 gene locus_tag LOCUS_20880 gene rpsP 10058 9804 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_20880 10384 11907 gene locus_tag LOCUS_20890 10384 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 12746 11904 gene locus_tag LOCUS_20900 12746 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 12767 13363 gene locus_tag LOCUS_20910 gene wrbA 12767 13363 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 protein_id gnl|my_center|LOCUS_20910 13360 13704 gene locus_tag LOCUS_20920 13360 13704 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812700.1 protein_id gnl|my_center|LOCUS_20920 15282 13759 gene locus_tag LOCUS_20930 15282 13759 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_20930 16368 15592 gene locus_tag LOCUS_20940 gene pssA 16368 15592 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_20940 17566 16550 gene locus_tag LOCUS_20950 gene ilvC 17566 16550 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689683.1 protein_id gnl|my_center|LOCUS_20950 18090 17599 gene locus_tag LOCUS_20960 gene ilvN 18090 17599 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_20960 19805 18102 gene locus_tag LOCUS_20970 19805 18102 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_20970 19879 20514 gene locus_tag LOCUS_20980 19879 20514 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_20980 20511 20900 gene locus_tag LOCUS_20990 20511 20900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 20873 21514 gene locus_tag LOCUS_21000 20873 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 21519 21944 gene locus_tag LOCUS_21010 21519 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 23051 21963 gene locus_tag LOCUS_21020 gene lptG 23051 21963 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_21020 24127 23048 gene locus_tag LOCUS_21030 gene lptF 24127 23048 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_21030 24205 25701 gene locus_tag LOCUS_21040 gene pepA 24205 25701 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_21040 25698 26123 gene locus_tag LOCUS_21050 25698 26123 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_21050 26123 26689 gene locus_tag LOCUS_21060 26123 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 26723 29560 gene locus_tag LOCUS_21070 26723 29560 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191922.1 protein_id gnl|my_center|LOCUS_21070 31381 29603 gene locus_tag LOCUS_21080 gene pabB 31381 29603 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927074.1 protein_id gnl|my_center|LOCUS_21080 31663 31436 gene locus_tag LOCUS_21090 31663 31436 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_21090 33160 31703 gene locus_tag LOCUS_21100 33160 31703 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_21100 33349 33783 gene locus_tag LOCUS_21110 gene moaC 33349 33783 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_21110 33788 34285 gene locus_tag LOCUS_21120 gene soxY 33788 34285 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_21120 34302 34646 gene locus_tag LOCUS_21130 gene soxZ 34302 34646 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_21130 34908 34705 gene locus_tag LOCUS_21140 34908 34705 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_21140 35169 35477 gene locus_tag LOCUS_21150 gene clpS 35169 35477 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_21150 35478 37736 gene locus_tag LOCUS_21160 gene clpA 35478 37736 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_21160 37809 38303 gene locus_tag LOCUS_21170 gene rraA 37809 38303 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_21170 38319 38828 gene locus_tag LOCUS_21180 38319 38828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 39268 39002 gene locus_tag LOCUS_21190 gene minE 39268 39002 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186076.1 protein_id gnl|my_center|LOCUS_21190 40053 39271 gene locus_tag LOCUS_21200 gene minD 40053 39271 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence036 <1 1035 gene locus_tag LOCUS_21210 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389503.1:high-affinity branched-chain amino acid ABC transporter permease LivM 1032 1871 gene locus_tag LOCUS_21220 1032 1871 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389502.1 protein_id gnl|my_center|LOCUS_21220 1868 2596 gene locus_tag LOCUS_21230 1868 2596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 protein_id gnl|my_center|LOCUS_21230 2577 3494 gene locus_tag LOCUS_21240 2577 3494 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_21240 3647 3943 gene locus_tag LOCUS_21250 3647 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3916 4362 gene locus_tag LOCUS_21260 3916 4362 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_21260 5302 4607 gene locus_tag LOCUS_21270 5302 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5676 5942 gene locus_tag LOCUS_21280 5676 5942 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143987.1 protein_id gnl|my_center|LOCUS_21280 5942 6226 gene locus_tag LOCUS_21290 5942 6226 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390987.1 protein_id gnl|my_center|LOCUS_21290 6403 7203 gene locus_tag LOCUS_21300 6403 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 8503 7382 gene locus_tag LOCUS_21310 gene ald 8503 7382 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_21310 8732 10378 gene locus_tag LOCUS_21320 8732 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 10413 11735 gene locus_tag LOCUS_21330 10413 11735 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199255502.1 protein_id gnl|my_center|LOCUS_21330 11747 14893 gene locus_tag LOCUS_21340 11747 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 15739 14900 gene locus_tag LOCUS_21350 15739 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 15940 16551 gene locus_tag LOCUS_21360 15940 16551 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_21360 16828 18087 gene locus_tag LOCUS_21370 16828 18087 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_21370 18545 18913 gene locus_tag LOCUS_21380 18545 18913 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390083.1 protein_id gnl|my_center|LOCUS_21380 18923 20251 gene locus_tag LOCUS_21390 18923 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 20273 20578 gene locus_tag LOCUS_21400 20273 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 20619 22814 gene locus_tag LOCUS_21410 20619 22814 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_21410 22894 24534 gene locus_tag LOCUS_21420 22894 24534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 24620 26623 gene locus_tag LOCUS_21430 24620 26623 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537232.1 protein_id gnl|my_center|LOCUS_21430 26680 27528 gene locus_tag LOCUS_21440 26680 27528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 27525 28085 gene locus_tag LOCUS_21450 gene cheD 27525 28085 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_21450 28094 28909 gene locus_tag LOCUS_21460 28094 28909 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 protein_id gnl|my_center|LOCUS_21460 28909 30057 gene locus_tag LOCUS_21470 28909 30057 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_21470 30054 30893 gene locus_tag LOCUS_21480 30054 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 31344 31673 gene locus_tag LOCUS_21490 31344 31673 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_21490 31657 32052 gene locus_tag LOCUS_21500 31657 32052 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227979.1 protein_id gnl|my_center|LOCUS_21500 32377 33021 gene locus_tag LOCUS_21510 32377 33021 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_21510 33021 33260 gene locus_tag LOCUS_21520 33021 33260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 34305 33559 gene locus_tag LOCUS_21530 34305 33559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 36507 34561 gene locus_tag LOCUS_21540 36507 34561 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_21540 37522 36623 gene locus_tag LOCUS_21550 37522 36623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 37869 37495 gene locus_tag LOCUS_21560 37869 37495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence037 2284 203 gene locus_tag LOCUS_21570 2284 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2525 3562 gene locus_tag LOCUS_21580 2525 3562 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192786.1 protein_id gnl|my_center|LOCUS_21580 4102 3704 gene locus_tag LOCUS_21590 4102 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 4278 5555 gene locus_tag LOCUS_21600 gene ugpB 4278 5555 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703703.1 protein_id gnl|my_center|LOCUS_21600 5552 6313 gene locus_tag LOCUS_21610 gene ugpQ 5552 6313 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 protein_id gnl|my_center|LOCUS_21610 6395 7417 gene locus_tag LOCUS_21620 6395 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 9065 7500 gene locus_tag LOCUS_21630 gene guaA 9065 7500 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_21630 10581 9124 gene locus_tag LOCUS_21640 gene guaB 10581 9124 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 protein_id gnl|my_center|LOCUS_21640 10638 11099 gene locus_tag LOCUS_21650 10638 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 11434 11120 gene locus_tag LOCUS_21660 11434 11120 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_21660 11882 11427 gene locus_tag LOCUS_21670 11882 11427 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_21670 11948 12394 gene locus_tag LOCUS_21680 gene smpB 11948 12394 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_21680 13164 12412 gene locus_tag LOCUS_21690 13164 12412 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_21690 13426 14211 gene locus_tag LOCUS_21700 13426 14211 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 protein_id gnl|my_center|LOCUS_21700 14238 14876 gene locus_tag LOCUS_21710 14238 14876 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_21710 14873 16315 gene locus_tag LOCUS_21720 14873 16315 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_21720 17279 16395 gene locus_tag LOCUS_21730 17279 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 18249 17248 gene locus_tag LOCUS_21740 gene clpX 18249 17248 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036185.1 protein_id gnl|my_center|LOCUS_21740 18621 21455 gene locus_tag LOCUS_21750 18621 21455 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_21750 21980 21579 gene locus_tag LOCUS_21760 21980 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 22246 21977 gene locus_tag LOCUS_21770 22246 21977 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_21770 23750 22497 gene locus_tag LOCUS_21780 23750 22497 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266545.1 protein_id gnl|my_center|LOCUS_21780 24078 23806 gene locus_tag LOCUS_21790 24078 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 24995 24204 gene locus_tag LOCUS_21800 24995 24204 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040174.1 protein_id gnl|my_center|LOCUS_21800 25678 24992 gene locus_tag LOCUS_21810 25678 24992 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927005.1 protein_id gnl|my_center|LOCUS_21810 26182 25700 gene locus_tag LOCUS_21820 26182 25700 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_21820 29160 26179 gene locus_tag LOCUS_21830 gene gcvP 29160 26179 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114051.1 protein_id gnl|my_center|LOCUS_21830 29571 29188 gene locus_tag LOCUS_21840 gene gcvH 29571 29188 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_21840 30796 29621 gene locus_tag LOCUS_21850 gene gcvT 30796 29621 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_21850 31311 32579 gene locus_tag LOCUS_21860 gene urtA 31311 32579 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_21860 32669 34270 gene locus_tag LOCUS_21870 gene urtB 32669 34270 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816780.1 protein_id gnl|my_center|LOCUS_21870 34288 35712 gene locus_tag LOCUS_21880 34288 35712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 35880 36311 gene locus_tag LOCUS_21890 35880 36311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 37210 36308 gene locus_tag LOCUS_21900 37210 36308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence038 1536 577 gene locus_tag LOCUS_21910 1536 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2996 1878 gene locus_tag LOCUS_21920 2996 1878 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_21920 3375 4460 gene locus_tag LOCUS_21930 3375 4460 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_21930 4833 4504 gene locus_tag LOCUS_21940 4833 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5084 4830 gene locus_tag LOCUS_21950 5084 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 5455 5117 gene locus_tag LOCUS_21960 5455 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 6903 5455 gene locus_tag LOCUS_21970 6903 5455 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_21970 7289 6903 gene locus_tag LOCUS_21980 7289 6903 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316622.1 protein_id gnl|my_center|LOCUS_21980 7717 7286 gene locus_tag LOCUS_21990 7717 7286 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316621.1 protein_id gnl|my_center|LOCUS_21990 9990 7714 gene locus_tag LOCUS_22000 9990 7714 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_22000 11080 9995 gene locus_tag LOCUS_22010 11080 9995 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_22010 11772 12965 gene locus_tag LOCUS_22020 11772 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 13002 13925 gene locus_tag LOCUS_22030 13002 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 13940 14746 gene locus_tag LOCUS_22040 13940 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 14772 16211 gene locus_tag LOCUS_22050 14772 16211 CDS product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 protein_id gnl|my_center|LOCUS_22050 16208 17077 gene locus_tag LOCUS_22060 gene epsG 16208 17077 CDS product chain length determinant protein tyrosine kinase EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106760242.1 protein_id gnl|my_center|LOCUS_22060 17475 17260 gene locus_tag LOCUS_22070 17475 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 17666 17472 gene locus_tag LOCUS_22080 17666 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 17659 17895 gene locus_tag LOCUS_22090 17659 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 17909 18811 gene locus_tag LOCUS_22100 gene xrt 17909 18811 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_22100 18808 19497 gene locus_tag LOCUS_22110 18808 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 19501 20154 gene locus_tag LOCUS_22120 19501 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 20304 20798 gene locus_tag LOCUS_22130 20304 20798 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_22130 21040 21474 gene locus_tag LOCUS_22140 21040 21474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 21529 23010 gene locus_tag LOCUS_22150 21529 23010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 23015 24469 gene locus_tag LOCUS_22160 23015 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 24466 25278 gene locus_tag LOCUS_22170 24466 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 25275 26339 gene locus_tag LOCUS_22180 25275 26339 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_22180 26336 27658 gene locus_tag LOCUS_22190 gene vpsH 26336 27658 CDS product exopolysaccharide biosynthesis protein VpsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495305.1 protein_id gnl|my_center|LOCUS_22190 27714 28778 gene locus_tag LOCUS_22200 27714 28778 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_22200 28775 30775 gene locus_tag LOCUS_22210 28775 30775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 30772 32784 gene locus_tag LOCUS_22220 30772 32784 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 protein_id gnl|my_center|LOCUS_22220 33810 34103 gene locus_tag LOCUS_22230 33810 34103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 34100 34837 gene locus_tag LOCUS_22240 gene vpsK 34100 34837 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_22240 35795 35205 gene locus_tag LOCUS_22250 35795 35205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 36409 37080 gene locus_tag LOCUS_22260 36409 37080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence039 1244 231 gene locus_tag LOCUS_22270 1244 231 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_22270 2124 1312 gene locus_tag LOCUS_22280 2124 1312 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255957.1 protein_id gnl|my_center|LOCUS_22280 2154 2882 gene locus_tag LOCUS_22290 2154 2882 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_22290 3689 2922 gene locus_tag LOCUS_22300 3689 2922 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_22300 4425 3775 gene locus_tag LOCUS_22310 4425 3775 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_22310 5350 4577 gene locus_tag LOCUS_22320 5350 4577 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197747.1 protein_id gnl|my_center|LOCUS_22320 7143 5371 gene locus_tag LOCUS_22330 gene argS 7143 5371 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_22330 7390 8949 gene locus_tag LOCUS_22340 gene ubiB 7390 8949 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_22340 8987 10111 gene locus_tag LOCUS_22350 8987 10111 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_22350 10558 11550 gene locus_tag LOCUS_22360 10558 11550 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_22360 13011 11797 gene locus_tag LOCUS_22370 gene tyrS 13011 11797 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_22370 13678 13418 gene locus_tag LOCUS_22380 13678 13418 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_22380 14195 13692 gene locus_tag LOCUS_22390 gene coaD 14195 13692 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_22390 14754 14182 gene locus_tag LOCUS_22400 gene rsmD 14754 14182 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690114.1 protein_id gnl|my_center|LOCUS_22400 16036 14741 gene locus_tag LOCUS_22410 16036 14741 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_22410 17415 16048 gene locus_tag LOCUS_22420 17415 16048 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_22420 17510 18502 gene locus_tag LOCUS_22430 gene ftsY 17510 18502 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243928.1 protein_id gnl|my_center|LOCUS_22430 18499 19194 gene locus_tag LOCUS_22440 gene ftsE 18499 19194 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369317.1 protein_id gnl|my_center|LOCUS_22440 19191 20090 gene locus_tag LOCUS_22450 gene ftsX 19191 20090 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084508.1 protein_id gnl|my_center|LOCUS_22450 20556 20182 gene locus_tag LOCUS_22460 20556 20182 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_22460 20735 21397 gene locus_tag LOCUS_22470 gene rpiA 20735 21397 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_22470 21712 21440 gene locus_tag LOCUS_22480 21712 21440 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_22480 23162 21795 gene locus_tag LOCUS_22490 gene argA 23162 21795 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_22490 24825 23116 gene locus_tag LOCUS_22500 gene pap 24825 23116 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_22500 25579 24818 gene locus_tag LOCUS_22510 25579 24818 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_22510 25636 26187 gene locus_tag LOCUS_22520 25636 26187 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_22520 26194 27078 gene locus_tag LOCUS_22530 26194 27078 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_22530 28232 27105 gene locus_tag LOCUS_22540 28232 27105 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112514.1 protein_id gnl|my_center|LOCUS_22540 28377 29468 gene locus_tag LOCUS_22550 gene apbC 28377 29468 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_22550 29614 30147 gene locus_tag LOCUS_22560 gene dcd 29614 30147 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224592.1 protein_id gnl|my_center|LOCUS_22560 30255 32492 gene locus_tag LOCUS_22570 30255 32492 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_22570 34057 32540 gene locus_tag LOCUS_22580 34057 32540 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_22580 34333 34977 gene locus_tag LOCUS_22590 gene hisG 34333 34977 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_22590 34974 36290 gene locus_tag LOCUS_22600 gene hisD 34974 36290 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527888.1 protein_id gnl|my_center|LOCUS_22600 <37156 36383 gene locus_tag LOCUS_22610 <37156 36383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007244361.1:chemotaxis response regulator CheY >Feature sequence040 170 779 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcatcctgcccttcggggcaggcttcgttgaagc 926 1204 gene locus_tag LOCUS_22620 926 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1544 2146 gene locus_tag LOCUS_22630 1544 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2431 5055 gene locus_tag LOCUS_22640 gene gyrA 2431 5055 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_22640 5078 6199 gene locus_tag LOCUS_22650 gene pheA 5078 6199 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_22650 6271 7359 gene locus_tag LOCUS_22660 gene hisC 6271 7359 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_22660 7382 8269 gene locus_tag LOCUS_22670 7382 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22670 8266 10236 gene locus_tag LOCUS_22680 8266 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22680 10453 12132 gene locus_tag LOCUS_22690 gene rpsA 10453 12132 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_22690 12142 12429 gene locus_tag LOCUS_22700 12142 12429 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_22700 12592 13761 gene locus_tag LOCUS_22710 gene lapB 12592 13761 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_22710 13790 14776 gene locus_tag LOCUS_22720 gene rfaE1 13790 14776 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_22720 14786 15796 gene locus_tag LOCUS_22730 gene rfaD 14786 15796 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190173.1 protein_id gnl|my_center|LOCUS_22730 15783 16688 gene locus_tag LOCUS_22740 gene cysM 15783 16688 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_22740 16698 17483 gene locus_tag LOCUS_22750 16698 17483 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_22750 17643 18503 gene locus_tag LOCUS_22760 17643 18503 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_22760 18700 18930 gene locus_tag LOCUS_22770 18700 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 19257 21041 gene locus_tag LOCUS_22780 19257 21041 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_22780 21070 22452 gene locus_tag LOCUS_22790 21070 22452 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_22790 22455 23792 gene locus_tag LOCUS_22800 22455 23792 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 protein_id gnl|my_center|LOCUS_22800 24497 23805 gene locus_tag LOCUS_22810 24497 23805 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_22810 25569 24571 gene locus_tag LOCUS_22820 gene arsS 25569 24571 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_22820 26022 27341 gene locus_tag LOCUS_22830 gene tig 26022 27341 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_22830 27500 28132 gene locus_tag LOCUS_22840 gene clpP 27500 28132 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_22840 28181 29455 gene locus_tag LOCUS_22850 gene clpX 28181 29455 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_22850 29540 31966 gene locus_tag LOCUS_22860 gene lon 29540 31966 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_22860 32076 32151 gene locus_tag LOCUS_t00250 32076 32151 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32186 32262 gene locus_tag LOCUS_t00260 32186 32262 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 32337 34247 gene locus_tag LOCUS_22870 32337 34247 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527215.1 protein_id gnl|my_center|LOCUS_22870 36024 34372 gene locus_tag LOCUS_22880 gene groL 36024 34372 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_22880 36414 36124 gene locus_tag LOCUS_22890 gene groES 36414 36124 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_22890 36844 36920 gene locus_tag LOCUS_t00270 36844 36920 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 403 657 gene locus_tag LOCUS_22900 403 657 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_22900 668 2473 gene locus_tag LOCUS_22910 668 2473 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_22910 2615 2965 gene locus_tag LOCUS_22920 2615 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 5269 3020 gene locus_tag LOCUS_22930 5269 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 6019 5366 gene locus_tag LOCUS_22940 6019 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 6609 6016 gene locus_tag LOCUS_22950 6609 6016 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446211.1 protein_id gnl|my_center|LOCUS_22950 7045 6650 gene locus_tag LOCUS_22960 7045 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 7415 7026 gene locus_tag LOCUS_22970 7415 7026 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_22970 7492 8295 gene locus_tag LOCUS_22980 gene rsmI 7492 8295 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196861.1 protein_id gnl|my_center|LOCUS_22980 10409 8244 gene locus_tag LOCUS_22990 10409 8244 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_22990 10643 12061 gene locus_tag LOCUS_23000 10643 12061 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_23000 12454 15339 gene locus_tag LOCUS_23010 12454 15339 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 protein_id gnl|my_center|LOCUS_23010 15659 15456 gene locus_tag LOCUS_23020 15659 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 16356 15874 gene locus_tag LOCUS_23030 gene bfrB 16356 15874 CDS product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 protein_id gnl|my_center|LOCUS_23030 16854 16369 gene locus_tag LOCUS_23040 gene bfr 16854 16369 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_23040 16888 17160 gene locus_tag LOCUS_23050 16888 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 17839 17123 gene locus_tag LOCUS_23060 17839 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 18594 19292 gene locus_tag LOCUS_23070 18594 19292 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_23070 20286 19267 gene locus_tag LOCUS_23080 20286 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 20179 20379 gene locus_tag LOCUS_23090 20179 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 21139 21372 gene locus_tag LOCUS_23100 21139 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 21369 21800 gene locus_tag LOCUS_23110 21369 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 22249 22884 gene locus_tag LOCUS_23120 22249 22884 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269944.1 protein_id gnl|my_center|LOCUS_23120 22871 23308 gene locus_tag LOCUS_23130 22871 23308 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088625.1 protein_id gnl|my_center|LOCUS_23130 23343 24068 gene locus_tag LOCUS_23140 gene fabG 23343 24068 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 protein_id gnl|my_center|LOCUS_23140 25030 24824 gene locus_tag LOCUS_23150 25030 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 25343 27379 gene locus_tag LOCUS_23160 gene hyfB 25343 27379 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_23160 27376 28323 gene locus_tag LOCUS_23170 27376 28323 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_23170 28334 28993 gene locus_tag LOCUS_23180 28334 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_23180 28995 30449 gene locus_tag LOCUS_23190 28995 30449 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_23190 30454 32028 gene locus_tag LOCUS_23200 30454 32028 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_23200 32028 32558 gene locus_tag LOCUS_23210 32028 32558 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_23210 33990 32854 gene locus_tag LOCUS_23220 33990 32854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_23220 34649 33987 gene locus_tag LOCUS_23230 34649 33987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 35420 34656 gene locus_tag LOCUS_23240 gene modA 35420 34656 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_23240 36385 35429 gene locus_tag LOCUS_23250 36385 35429 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 protein_id gnl|my_center|LOCUS_23250 <36890 36389 gene locus_tag LOCUS_23260 <36890 36389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467505.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase >Feature sequence042 2303 4732 gene locus_tag LOCUS_23270 gene nirB 2303 4732 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_23270 4763 5071 gene locus_tag LOCUS_23280 gene nirD 4763 5071 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_23280 5093 6304 gene locus_tag LOCUS_23290 5093 6304 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103940.1 protein_id gnl|my_center|LOCUS_23290 6381 8063 gene locus_tag LOCUS_23300 6381 8063 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 protein_id gnl|my_center|LOCUS_23300 8165 9199 gene locus_tag LOCUS_23310 gene pyrC 8165 9199 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_23310 9199 9690 gene locus_tag LOCUS_23320 9199 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 9687 10469 gene locus_tag LOCUS_23330 9687 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 10420 10662 gene locus_tag LOCUS_23340 10420 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 11195 11641 gene locus_tag LOCUS_23350 gene mraZ 11195 11641 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_23350 11638 12588 gene locus_tag LOCUS_23360 gene rsmH 11638 12588 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_23360 12590 12868 gene locus_tag LOCUS_23370 12590 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 12865 14622 gene locus_tag LOCUS_23380 12865 14622 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_23380 14619 16127 gene locus_tag LOCUS_23390 14619 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23390 16124 17503 gene locus_tag LOCUS_23400 gene murF 16124 17503 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_23400 17503 18591 gene locus_tag LOCUS_23410 gene mraY 17503 18591 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_23410 18596 19975 gene locus_tag LOCUS_23420 gene murD 18596 19975 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_23420 19975 21135 gene locus_tag LOCUS_23430 gene ftsW 19975 21135 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_23430 21150 22187 gene locus_tag LOCUS_23440 gene murG 21150 22187 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 protein_id gnl|my_center|LOCUS_23440 22184 23572 gene locus_tag LOCUS_23450 gene murC 22184 23572 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_23450 23583 24500 gene locus_tag LOCUS_23460 23583 24500 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763895.1 protein_id gnl|my_center|LOCUS_23460 24504 25256 gene locus_tag LOCUS_23470 24504 25256 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_23470 25253 26482 gene locus_tag LOCUS_23480 gene ftsA 25253 26482 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_23480 26545 27711 gene locus_tag LOCUS_23490 gene ftsZ 26545 27711 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_23490 27806 28735 gene locus_tag LOCUS_23500 gene lpxC 27806 28735 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522022.1 protein_id gnl|my_center|LOCUS_23500 28740 28928 gene locus_tag LOCUS_23510 28740 28928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 29349 28915 gene locus_tag LOCUS_23520 29349 28915 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931255.1 protein_id gnl|my_center|LOCUS_23520 29979 29440 gene locus_tag LOCUS_23530 29979 29440 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_23530 30840 29989 gene locus_tag LOCUS_23540 30840 29989 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_23540 30923 32509 gene locus_tag LOCUS_23550 30923 32509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 33118 32522 gene locus_tag LOCUS_23560 gene mog 33118 32522 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522377.1 protein_id gnl|my_center|LOCUS_23560 33662 33105 gene locus_tag LOCUS_23570 gene yjgA 33662 33105 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189393.1 protein_id gnl|my_center|LOCUS_23570 33757 35130 gene locus_tag LOCUS_23580 gene pmbA 33757 35130 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_23580 35255 36334 gene locus_tag LOCUS_23590 35255 36334 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence043 894 652 gene locus_tag LOCUS_23600 894 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2452 1100 gene locus_tag LOCUS_23610 2452 1100 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539365.1 protein_id gnl|my_center|LOCUS_23610 2608 2471 gene locus_tag LOCUS_23620 2608 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23620 3478 2630 gene locus_tag LOCUS_23630 3478 2630 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23630 3835 3554 gene locus_tag LOCUS_23640 3835 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4648 3905 gene locus_tag LOCUS_23650 4648 3905 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331386.1 protein_id gnl|my_center|LOCUS_23650 5755 4655 gene locus_tag LOCUS_23660 5755 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 6768 5845 gene locus_tag LOCUS_23670 6768 5845 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_23670 8092 6887 gene locus_tag LOCUS_23680 8092 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 9381 8152 gene locus_tag LOCUS_23690 9381 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 10580 9438 gene locus_tag LOCUS_23700 10580 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 11684 10698 gene locus_tag LOCUS_23710 11684 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 12323 11892 gene locus_tag LOCUS_23720 gene tnpA 12323 11892 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_23720 14218 13007 gene locus_tag LOCUS_23730 14218 13007 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039013.1 protein_id gnl|my_center|LOCUS_23730 15482 14232 gene locus_tag LOCUS_23740 15482 14232 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_23740 15843 15535 gene locus_tag LOCUS_23750 15843 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 17290 15971 gene locus_tag LOCUS_23760 17290 15971 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539365.1 protein_id gnl|my_center|LOCUS_23760 18320 17313 gene locus_tag LOCUS_23770 18320 17313 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_23770 18539 18351 gene locus_tag LOCUS_23780 18539 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 19063 18896 gene locus_tag LOCUS_23790 19063 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 19420 19202 gene locus_tag LOCUS_23800 19420 19202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 19754 19506 gene locus_tag LOCUS_23810 19754 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 20699 20211 gene locus_tag LOCUS_23820 20699 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 20953 20696 gene locus_tag LOCUS_23830 20953 20696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 21536 21252 gene locus_tag LOCUS_23840 21536 21252 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_23840 21800 21540 gene locus_tag LOCUS_23850 21800 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 23227 22247 gene locus_tag LOCUS_23860 23227 22247 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_23860 23665 23402 gene locus_tag LOCUS_23870 23665 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 24311 23862 gene locus_tag LOCUS_23880 24311 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 24622 24972 gene locus_tag LOCUS_23890 24622 24972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 25957 24959 gene locus_tag LOCUS_23900 25957 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 26481 26044 gene locus_tag LOCUS_23910 26481 26044 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_23910 27865 26858 gene locus_tag LOCUS_23920 27865 26858 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_23920 28209 27952 gene locus_tag LOCUS_23930 28209 27952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 28326 28511 gene locus_tag LOCUS_23940 28326 28511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 28863 29234 gene locus_tag LOCUS_23950 28863 29234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 29462 29124 gene locus_tag LOCUS_23960 29462 29124 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_23960 31063 29663 gene locus_tag LOCUS_23970 31063 29663 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_23970 32212 31166 gene locus_tag LOCUS_23980 32212 31166 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_23980 33349 32225 gene locus_tag LOCUS_23990 gene gmd 33349 32225 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_23990 33952 33434 gene locus_tag LOCUS_24000 33952 33434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 34174 35622 gene locus_tag LOCUS_24010 34174 35622 CDS product TolC family type I secretion outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938786.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence044 264 1526 gene locus_tag LOCUS_24020 gene hemA 264 1526 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_24020 1599 2681 gene locus_tag LOCUS_24030 gene prfA 1599 2681 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186862.1 protein_id gnl|my_center|LOCUS_24030 2755 3594 gene locus_tag LOCUS_24040 gene prmC 2755 3594 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 protein_id gnl|my_center|LOCUS_24040 3650 3973 gene locus_tag LOCUS_24050 gene grxD 3650 3973 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_24050 4103 4636 gene locus_tag LOCUS_24060 4103 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5926 4691 gene locus_tag LOCUS_24070 5926 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 7136 6291 gene locus_tag LOCUS_24080 7136 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 8575 7133 gene locus_tag LOCUS_24090 8575 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 9239 8673 gene locus_tag LOCUS_24100 9239 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 10879 9491 gene locus_tag LOCUS_24110 gene argH 10879 9491 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_24110 10941 11972 gene locus_tag LOCUS_24120 10941 11972 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 protein_id gnl|my_center|LOCUS_24120 11969 12757 gene locus_tag LOCUS_24130 gene algR 11969 12757 CDS product alginate biosynthesis regulator AlgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096397.1 protein_id gnl|my_center|LOCUS_24130 12849 13523 gene locus_tag LOCUS_24140 12849 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 14165 13527 gene locus_tag LOCUS_24150 14165 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 14276 15217 gene locus_tag LOCUS_24160 gene hemC 14276 15217 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_24160 15217 15993 gene locus_tag LOCUS_24170 15217 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 17032 16115 gene locus_tag LOCUS_24180 gene hemF 17032 16115 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_24180 18368 17088 gene locus_tag LOCUS_24190 gene purD 18368 17088 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_24190 20018 18453 gene locus_tag LOCUS_24200 gene purH 20018 18453 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_24200 20332 20081 gene locus_tag LOCUS_24210 20332 20081 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_24210 21375 20329 gene locus_tag LOCUS_24220 gene dusB 21375 20329 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_24220 26397 21532 gene locus_tag LOCUS_24230 26397 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 27528 26401 gene locus_tag LOCUS_24240 27528 26401 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_24240 28318 27680 gene locus_tag LOCUS_24250 28318 27680 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_24250 29609 28422 gene locus_tag LOCUS_24260 29609 28422 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189895.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24260 30113 29805 gene locus_tag LOCUS_24270 30113 29805 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_24270 30256 30645 gene locus_tag LOCUS_24280 30256 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 30749 31333 gene locus_tag LOCUS_24290 30749 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 32134 31703 gene locus_tag LOCUS_24300 32134 31703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 33176 32496 gene locus_tag LOCUS_24310 33176 32496 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_24310 33572 33234 gene locus_tag LOCUS_24320 33572 33234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 33916 34659 gene locus_tag LOCUS_24330 33916 34659 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028520.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence045 <1 965 gene locus_tag LOCUS_24340 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175550.1:elongation factor P--(R)-beta-lysine ligase 1857 1012 gene locus_tag LOCUS_24350 1857 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3405 1894 gene locus_tag LOCUS_24360 3405 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4052 3402 gene locus_tag LOCUS_24370 4052 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 5346 4084 gene locus_tag LOCUS_24380 5346 4084 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_24380 6142 5462 gene locus_tag LOCUS_24390 6142 5462 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479163.1 protein_id gnl|my_center|LOCUS_24390 6880 6395 gene locus_tag LOCUS_24400 6880 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 8229 6877 gene locus_tag LOCUS_24410 8229 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 8335 8760 gene locus_tag LOCUS_24420 8335 8760 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_24420 9605 8970 gene locus_tag LOCUS_24430 9605 8970 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231449.1 protein_id gnl|my_center|LOCUS_24430 10714 9716 gene locus_tag LOCUS_24440 10714 9716 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_24440 11381 10743 gene locus_tag LOCUS_24450 11381 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 12450 11515 gene locus_tag LOCUS_24460 12450 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 13115 12450 gene locus_tag LOCUS_24470 gene parA 13115 12450 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_24470 15949 13382 gene locus_tag LOCUS_24480 15949 13382 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_24480 17077 16184 gene locus_tag LOCUS_24490 17077 16184 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_24490 17982 17092 gene locus_tag LOCUS_24500 gene ylqF 17982 17092 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_24500 18215 19048 gene locus_tag LOCUS_24510 18215 19048 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521971.1 protein_id gnl|my_center|LOCUS_24510 19105 19422 gene locus_tag LOCUS_24520 19105 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 19604 20503 gene locus_tag LOCUS_24530 gene galU 19604 20503 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_24530 20720 22306 gene locus_tag LOCUS_24540 gene nadB 20720 22306 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_24540 22795 22328 gene locus_tag LOCUS_24550 22795 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 23969 22815 gene locus_tag LOCUS_24560 gene fabF 23969 22815 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_24560 24408 24172 gene locus_tag LOCUS_24570 gene acpP 24408 24172 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_24570 25262 24522 gene locus_tag LOCUS_24580 gene fabG 25262 24522 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_24580 26209 25268 gene locus_tag LOCUS_24590 gene fabD 26209 25268 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_24590 27191 26232 gene locus_tag LOCUS_24600 27191 26232 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447294.1 protein_id gnl|my_center|LOCUS_24600 28206 27193 gene locus_tag LOCUS_24610 gene plsX 28206 27193 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_24610 28449 28270 gene locus_tag LOCUS_24620 gene rpmF 28449 28270 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_24620 28965 28471 gene locus_tag LOCUS_24630 28965 28471 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390869.1 protein_id gnl|my_center|LOCUS_24630 29082 29672 gene locus_tag LOCUS_24640 29082 29672 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_24640 29683 30393 gene locus_tag LOCUS_24650 29683 30393 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_24650 31523 30573 gene locus_tag LOCUS_24660 31523 30573 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_24660 31879 31520 gene locus_tag LOCUS_24670 31879 31520 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_24670 32514 31858 gene locus_tag LOCUS_24680 32514 31858 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_24680 33487 32498 gene locus_tag LOCUS_24690 33487 32498 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813839.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence046 2947 1490 gene locus_tag LOCUS_24700 gene prsR 2947 1490 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_24700 3081 3899 gene locus_tag LOCUS_24710 3081 3899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_24710 3886 4698 gene locus_tag LOCUS_24720 gene mlaE 3886 4698 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 protein_id gnl|my_center|LOCUS_24720 4698 5168 gene locus_tag LOCUS_24730 gene mlaD 4698 5168 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24730 5184 5909 gene locus_tag LOCUS_24740 5184 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5977 6591 gene locus_tag LOCUS_24750 5977 6591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 protein_id gnl|my_center|LOCUS_24750 6588 6881 gene locus_tag LOCUS_24760 6588 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 6906 7829 gene locus_tag LOCUS_24770 6906 7829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_24770 7826 8578 gene locus_tag LOCUS_24780 7826 8578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_24780 8582 8830 gene locus_tag LOCUS_24790 8582 8830 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_24790 8823 10088 gene locus_tag LOCUS_24800 gene murA 8823 10088 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_24800 10171 11436 gene locus_tag LOCUS_24810 10171 11436 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_24810 11433 14942 gene locus_tag LOCUS_24820 11433 14942 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_24820 15102 16040 gene locus_tag LOCUS_24830 15102 16040 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_24830 16481 18205 gene locus_tag LOCUS_24840 gene nirS 16481 18205 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_24840 18327 18632 gene locus_tag LOCUS_24850 gene nirM 18327 18632 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_24850 18805 19482 gene locus_tag LOCUS_24860 18805 19482 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_24860 20299 19529 gene locus_tag LOCUS_24870 20299 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 20863 23910 gene locus_tag LOCUS_24880 20863 23910 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_24880 24010 25221 gene locus_tag LOCUS_24890 24010 25221 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_24890 25244 28063 gene locus_tag LOCUS_24900 25244 28063 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_24900 28060 28671 gene locus_tag LOCUS_24910 28060 28671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 29117 30583 gene locus_tag LOCUS_24920 29117 30583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 30862 30656 gene locus_tag LOCUS_24930 30862 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 31176 30985 gene locus_tag LOCUS_24940 31176 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 32051 31173 gene locus_tag LOCUS_24950 32051 31173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 32387 32303 gene locus_tag LOCUS_t00280 32387 32303 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32557 33366 gene locus_tag LOCUS_24960 gene hpnC 32557 33366 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_24960 33707 33516 gene locus_tag LOCUS_24970 33707 33516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 34160 34750 gene locus_tag LOCUS_24980 34160 34750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 35035 34865 gene locus_tag LOCUS_24990 35035 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence047 1434 280 gene locus_tag LOCUS_25000 1434 280 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525210.1 protein_id gnl|my_center|LOCUS_25000 2575 1787 gene locus_tag LOCUS_25010 gene trpC 2575 1787 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186826.1 protein_id gnl|my_center|LOCUS_25010 3628 2603 gene locus_tag LOCUS_25020 gene trpD 3628 2603 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_25020 4197 3625 gene locus_tag LOCUS_25030 4197 3625 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217367.1 protein_id gnl|my_center|LOCUS_25030 4584 4958 gene locus_tag LOCUS_25040 4584 4958 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088914.1 protein_id gnl|my_center|LOCUS_25040 4973 7372 gene locus_tag LOCUS_25050 gene lon 4973 7372 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_25050 7369 7776 gene locus_tag LOCUS_25060 7369 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 7876 9297 gene locus_tag LOCUS_25070 7876 9297 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948197.1 protein_id gnl|my_center|LOCUS_25070 9608 9360 gene locus_tag LOCUS_25080 9608 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 9819 10322 gene locus_tag LOCUS_25090 9819 10322 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_25090 11834 10362 gene locus_tag LOCUS_25100 gene trpE 11834 10362 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_25100 12677 11991 gene locus_tag LOCUS_25110 12677 11991 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_25110 13363 12674 gene locus_tag LOCUS_25120 gene rpe 13363 12674 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_25120 13521 13904 gene locus_tag LOCUS_25130 gene apaG 13521 13904 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_25130 13912 14505 gene locus_tag LOCUS_25140 13912 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 15740 14502 gene locus_tag LOCUS_25150 gene argJ 15740 14502 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931662.1 protein_id gnl|my_center|LOCUS_25150 18573 15850 gene locus_tag LOCUS_25160 gene secA 18573 15850 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064961.1 protein_id gnl|my_center|LOCUS_25160 18929 19528 gene locus_tag LOCUS_25170 18929 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 19981 19607 gene locus_tag LOCUS_25180 19981 19607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 20304 20086 gene locus_tag LOCUS_25190 20304 20086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 21017 20709 gene locus_tag LOCUS_25200 21017 20709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 21373 22197 gene locus_tag LOCUS_25210 21373 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 22637 22203 gene locus_tag LOCUS_25220 22637 22203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 23942 22788 gene locus_tag LOCUS_25230 23942 22788 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_25230 24541 24038 gene locus_tag LOCUS_25240 24541 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 25157 24552 gene locus_tag LOCUS_25250 25157 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_25250 25255 25890 gene locus_tag LOCUS_25260 25255 25890 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_25260 25887 27071 gene locus_tag LOCUS_25270 25887 27071 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 protein_id gnl|my_center|LOCUS_25270 27068 28261 gene locus_tag LOCUS_25280 27068 28261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_25280 28262 28966 gene locus_tag LOCUS_25290 28262 28966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_25290 29497 29054 gene locus_tag LOCUS_25300 29497 29054 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064361.1 protein_id gnl|my_center|LOCUS_25300 30060 29599 gene locus_tag LOCUS_25310 30060 29599 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943773.1 protein_id gnl|my_center|LOCUS_25310 30531 30112 gene locus_tag LOCUS_25320 30531 30112 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_25320 30689 31891 gene locus_tag LOCUS_25330 30689 31891 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_25330 31878 33983 gene locus_tag LOCUS_25340 gene ptsI 31878 33983 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706834.1 protein_id gnl|my_center|LOCUS_25340 34337 34669 gene locus_tag LOCUS_25350 34337 34669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence048 30 1274 gene locus_tag LOCUS_25360 30 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1913 1323 gene locus_tag LOCUS_25370 1913 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4340 2211 gene locus_tag LOCUS_25380 4340 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 4824 7580 gene locus_tag LOCUS_25390 gene ppc 4824 7580 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_25390 8276 7656 gene locus_tag LOCUS_25400 8276 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25400 8901 8395 gene locus_tag LOCUS_25410 8901 8395 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_25410 11318 9108 gene locus_tag LOCUS_25420 11318 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 12201 11482 gene locus_tag LOCUS_25430 12201 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 13065 12298 gene locus_tag LOCUS_25440 13065 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 14692 13211 gene locus_tag LOCUS_25450 14692 13211 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_25450 15850 15194 gene locus_tag LOCUS_25460 15850 15194 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109354.1 protein_id gnl|my_center|LOCUS_25460 16893 15853 gene locus_tag LOCUS_25470 16893 15853 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_25470 18748 17318 gene locus_tag LOCUS_25480 18748 17318 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_25480 21322 18749 gene locus_tag LOCUS_25490 21322 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 26533 22178 gene locus_tag LOCUS_25500 26533 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 27699 26542 gene locus_tag LOCUS_25510 27699 26542 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_25510 27990 27730 gene locus_tag LOCUS_25520 27990 27730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 27944 28879 gene locus_tag LOCUS_25530 27944 28879 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689718.1 protein_id gnl|my_center|LOCUS_25530 29892 28840 gene locus_tag LOCUS_25540 29892 28840 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038708004.1 protein_id gnl|my_center|LOCUS_25540 30315 29959 gene locus_tag LOCUS_25550 30315 29959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 30608 32026 gene locus_tag LOCUS_25560 30608 32026 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_25560 32931 32083 gene locus_tag LOCUS_25570 32931 32083 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087664.1 protein_id gnl|my_center|LOCUS_25570 34971 33199 gene locus_tag LOCUS_25580 34971 33199 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393611.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence049 1521 1042 gene locus_tag LOCUS_25590 1521 1042 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266668.1 protein_id gnl|my_center|LOCUS_25590 2184 1612 gene locus_tag LOCUS_25600 2184 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3061 2414 gene locus_tag LOCUS_25610 3061 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 4332 3442 gene locus_tag LOCUS_25620 4332 3442 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_25620 4428 5384 gene locus_tag LOCUS_25630 4428 5384 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_25630 5420 6121 gene locus_tag LOCUS_25640 5420 6121 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_25640 6150 6704 gene locus_tag LOCUS_25650 6150 6704 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973634.1 protein_id gnl|my_center|LOCUS_25650 6767 6988 gene locus_tag LOCUS_25660 6767 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 7267 7061 gene locus_tag LOCUS_25670 7267 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 7869 7306 gene locus_tag LOCUS_25680 7869 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 8144 8518 gene locus_tag LOCUS_25690 8144 8518 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_25690 9101 8550 gene locus_tag LOCUS_25700 9101 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 9376 10344 gene locus_tag LOCUS_25710 9376 10344 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060640.1 protein_id gnl|my_center|LOCUS_25710 10331 11221 gene locus_tag LOCUS_25720 10331 11221 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_25720 12165 11269 gene locus_tag LOCUS_25730 12165 11269 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_25730 12278 12553 gene locus_tag LOCUS_25740 12278 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 12742 13323 gene locus_tag LOCUS_25750 12742 13323 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_25750 13857 13456 gene locus_tag LOCUS_25760 13857 13456 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365982.1 protein_id gnl|my_center|LOCUS_25760 14539 13907 gene locus_tag LOCUS_25770 gene yfcF 14539 13907 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365572.1 protein_id gnl|my_center|LOCUS_25770 15172 14555 gene locus_tag LOCUS_25780 15172 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 17643 15385 gene locus_tag LOCUS_25790 17643 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 18472 18176 gene locus_tag LOCUS_25800 18472 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 19481 18462 gene locus_tag LOCUS_25810 gene cas1 19481 18462 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_25810 19845 19498 gene locus_tag LOCUS_25820 19845 19498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 19936 24721 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatccctttgttttcagggctgcatactgac 25752 24730 gene locus_tag LOCUS_25830 gene cas6 25752 24730 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_25830 27389 25749 gene locus_tag LOCUS_25840 27389 25749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 28339 27386 gene locus_tag LOCUS_25850 28339 27386 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_25850 29053 28343 gene locus_tag LOCUS_25860 gene csm3 29053 28343 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_25860 29445 29074 gene locus_tag LOCUS_25870 gene csm2 29445 29074 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546668.1 protein_id gnl|my_center|LOCUS_25870 32188 29525 gene locus_tag LOCUS_25880 gene cas10 32188 29525 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_25880 33372 32203 gene locus_tag LOCUS_25890 gene csx2 33372 32203 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_25890 34579 33431 gene locus_tag LOCUS_25900 34579 33431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence050 <1 1942 gene locus_tag LOCUS_25910 <1 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein 2079 2633 gene locus_tag LOCUS_25920 2079 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2669 3013 gene locus_tag LOCUS_25930 2669 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3285 4274 gene locus_tag LOCUS_25940 3285 4274 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_25940 5488 4457 gene locus_tag LOCUS_25950 5488 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 5643 5942 gene locus_tag LOCUS_25960 5643 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 6034 7314 gene locus_tag LOCUS_25970 6034 7314 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_25970 7322 7927 gene locus_tag LOCUS_25980 7322 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_25980 8717 8151 gene locus_tag LOCUS_25990 gene cobO 8717 8151 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_25990 9753 8725 gene locus_tag LOCUS_26000 gene cobD 9753 8725 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_26000 10575 9817 gene locus_tag LOCUS_26010 gene bluB 10575 9817 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_26010 11219 11434 gene locus_tag LOCUS_26020 11219 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 12658 11858 gene locus_tag LOCUS_26030 12658 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 12964 13788 gene locus_tag LOCUS_26040 12964 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 14787 13948 gene locus_tag LOCUS_26050 14787 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 15487 14900 gene locus_tag LOCUS_26060 15487 14900 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448283.1 protein_id gnl|my_center|LOCUS_26060 16844 15630 gene locus_tag LOCUS_26070 gene ccmI 16844 15630 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_26070 17454 16969 gene locus_tag LOCUS_26080 gene ccmH 17454 16969 CDS product cytochrome c maturation protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114292.1 protein_id gnl|my_center|LOCUS_26080 18035 17451 gene locus_tag LOCUS_26090 18035 17451 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036835.1 protein_id gnl|my_center|LOCUS_26090 20052 18049 gene locus_tag LOCUS_26100 20052 18049 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_26100 20548 20069 gene locus_tag LOCUS_26110 gene ccmE 20548 20069 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_26110 20775 20545 gene locus_tag LOCUS_26120 20775 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 21526 20777 gene locus_tag LOCUS_26130 gene ccmC 21526 20777 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_26130 22195 21527 gene locus_tag LOCUS_26140 gene ccmB 22195 21527 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815897.1 protein_id gnl|my_center|LOCUS_26140 22818 22204 gene locus_tag LOCUS_26150 gene ccmA 22818 22204 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 protein_id gnl|my_center|LOCUS_26150 22963 23988 gene locus_tag LOCUS_26160 22963 23988 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_26160 23981 24322 gene locus_tag LOCUS_26170 gene hypA 23981 24322 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_26170 24342 25367 gene locus_tag LOCUS_26180 24342 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 25369 27669 gene locus_tag LOCUS_26190 gene hypF 25369 27669 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089668.1 protein_id gnl|my_center|LOCUS_26190 27683 27931 gene locus_tag LOCUS_26200 27683 27931 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_26200 27990 29135 gene locus_tag LOCUS_26210 gene hypD 27990 29135 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_26210 29132 30181 gene locus_tag LOCUS_26220 gene hypE 29132 30181 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084546.1 protein_id gnl|my_center|LOCUS_26220 30195 31925 gene locus_tag LOCUS_26230 30195 31925 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_26230 31922 33382 gene locus_tag LOCUS_26240 31922 33382 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_26240 33379 34233 gene locus_tag LOCUS_26250 33379 34233 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence051 884 405 gene locus_tag LOCUS_26260 884 405 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534302.1 protein_id gnl|my_center|LOCUS_26260 2139 934 gene locus_tag LOCUS_26270 2139 934 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195190.1 protein_id gnl|my_center|LOCUS_26270 2211 5114 gene locus_tag LOCUS_26280 gene uvrA 2211 5114 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_26280 5345 5629 gene locus_tag LOCUS_26290 5345 5629 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_26290 5743 6051 gene locus_tag LOCUS_26300 5743 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 6067 6372 gene locus_tag LOCUS_26310 6067 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26310 6459 6534 gene locus_tag LOCUS_t00290 6459 6534 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7253 6792 gene locus_tag LOCUS_26320 7253 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 8623 7250 gene locus_tag LOCUS_26330 8623 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 9009 8620 gene locus_tag LOCUS_26340 9009 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 9559 9122 gene locus_tag LOCUS_26350 9559 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 10093 9653 gene locus_tag LOCUS_26360 10093 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 11093 10254 gene locus_tag LOCUS_26370 11093 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 11433 11110 gene locus_tag LOCUS_26380 11433 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 13246 11414 gene locus_tag LOCUS_26390 13246 11414 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921306.1 protein_id gnl|my_center|LOCUS_26390 13463 13257 gene locus_tag LOCUS_26400 13463 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 14377 13568 gene locus_tag LOCUS_26410 14377 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 15403 14885 gene locus_tag LOCUS_26420 15403 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 15635 15432 gene locus_tag LOCUS_26430 15635 15432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 15790 16101 gene locus_tag LOCUS_26440 15790 16101 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969543.1 protein_id gnl|my_center|LOCUS_26440 16070 16558 gene locus_tag LOCUS_26450 16070 16558 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969542.1 protein_id gnl|my_center|LOCUS_26450 16571 18154 gene locus_tag LOCUS_26460 16571 18154 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_26460 18151 19392 gene locus_tag LOCUS_26470 18151 19392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 19389 20945 gene locus_tag LOCUS_26480 19389 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26480 20946 22412 gene locus_tag LOCUS_26490 20946 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26490 22530 23030 gene locus_tag LOCUS_26500 22530 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 23030 24013 gene locus_tag LOCUS_26510 23030 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 24010 24711 gene locus_tag LOCUS_26520 24010 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 24708 25301 gene locus_tag LOCUS_26530 gene queC 24708 25301 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_26530 25304 25804 gene locus_tag LOCUS_26540 25304 25804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 26854 27831 gene locus_tag LOCUS_26550 26854 27831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 27917 28285 gene locus_tag LOCUS_26560 27917 28285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 28343 28528 gene locus_tag LOCUS_26570 28343 28528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence052 953 546 gene locus_tag LOCUS_26580 953 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1321 1133 gene locus_tag LOCUS_26590 1321 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 3590 1479 gene locus_tag LOCUS_26600 3590 1479 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_26600 4561 3587 gene locus_tag LOCUS_26610 4561 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 7286 4548 gene locus_tag LOCUS_26620 7286 4548 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_26620 8809 7283 gene locus_tag LOCUS_26630 8809 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 9475 8903 gene locus_tag LOCUS_26640 9475 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 9389 9724 gene locus_tag LOCUS_26650 9389 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 9752 10024 gene locus_tag LOCUS_26660 9752 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 10127 10573 gene locus_tag LOCUS_26670 10127 10573 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_26670 12189 10558 gene locus_tag LOCUS_26680 12189 10558 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365322.1 protein_id gnl|my_center|LOCUS_26680 12736 12170 gene locus_tag LOCUS_26690 12736 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 15052 13418 gene locus_tag LOCUS_26700 15052 13418 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_26700 15897 16169 gene locus_tag LOCUS_26710 15897 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 17237 16437 gene locus_tag LOCUS_26720 17237 16437 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_26720 18171 17314 gene locus_tag LOCUS_26730 18171 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 18625 19188 gene locus_tag LOCUS_26740 gene ahpC 18625 19188 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525522.1 protein_id gnl|my_center|LOCUS_26740 19313 20872 gene locus_tag LOCUS_26750 gene ahpF 19313 20872 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 protein_id gnl|my_center|LOCUS_26750 21277 20948 gene locus_tag LOCUS_26760 21277 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 21418 22695 gene locus_tag LOCUS_26770 21418 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 22753 23382 gene locus_tag LOCUS_26780 22753 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 23389 28611 gene locus_tag LOCUS_26790 23389 28611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 29277 28684 gene locus_tag LOCUS_26800 29277 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26800 31064 29301 gene locus_tag LOCUS_26810 31064 29301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence053 1104 295 gene locus_tag LOCUS_26820 1104 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2004 1105 gene locus_tag LOCUS_26830 2004 1105 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_26830 3883 2138 gene locus_tag LOCUS_26840 gene kefC 3883 2138 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377172.1 protein_id gnl|my_center|LOCUS_26840 4518 4138 gene locus_tag LOCUS_26850 4518 4138 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_26850 4760 4515 gene locus_tag LOCUS_26860 4760 4515 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_26860 5532 5960 gene locus_tag LOCUS_26870 5532 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 6144 8054 gene locus_tag LOCUS_26880 6144 8054 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_26880 8187 9227 gene locus_tag LOCUS_26890 8187 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 9229 11037 gene locus_tag LOCUS_26900 9229 11037 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110747.1 protein_id gnl|my_center|LOCUS_26900 11048 12181 gene locus_tag LOCUS_26910 11048 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 12191 13441 gene locus_tag LOCUS_26920 12191 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 13519 14061 gene locus_tag LOCUS_26930 13519 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 14689 14252 gene locus_tag LOCUS_26940 14689 14252 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064916.1 protein_id gnl|my_center|LOCUS_26940 15089 14700 gene locus_tag LOCUS_26950 15089 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 18274 15125 gene locus_tag LOCUS_26960 18274 15125 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_26960 19409 18282 gene locus_tag LOCUS_26970 19409 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 19906 19406 gene locus_tag LOCUS_26980 19906 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 21132 19903 gene locus_tag LOCUS_26990 21132 19903 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_26990 21597 21232 gene locus_tag LOCUS_27000 21597 21232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 22285 22659 gene locus_tag LOCUS_27010 22285 22659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 23112 23588 gene locus_tag LOCUS_27020 23112 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 24198 23704 gene locus_tag LOCUS_27030 24198 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 25539 24328 gene locus_tag LOCUS_27040 25539 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 26113 27564 gene locus_tag LOCUS_27050 gene gabD 26113 27564 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_27050 27587 28243 gene locus_tag LOCUS_27060 27587 28243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114342.1 protein_id gnl|my_center|LOCUS_27060 29200 28274 gene locus_tag LOCUS_27070 29200 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 29505 30269 gene locus_tag LOCUS_27080 29505 30269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence054 154 594 gene locus_tag LOCUS_27090 154 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 844 2292 gene locus_tag LOCUS_27100 844 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2591 2316 gene locus_tag LOCUS_27110 2591 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2636 3373 gene locus_tag LOCUS_27120 2636 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3460 5301 gene locus_tag LOCUS_27130 gene typA 3460 5301 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 protein_id gnl|my_center|LOCUS_27130 5361 7004 gene locus_tag LOCUS_27140 5361 7004 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_27140 7149 8045 gene locus_tag LOCUS_27150 7149 8045 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418502.1 protein_id gnl|my_center|LOCUS_27150 8547 8152 gene locus_tag LOCUS_27160 8547 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 9439 8639 gene locus_tag LOCUS_27170 9439 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 10292 9510 gene locus_tag LOCUS_27180 10292 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 11196 10402 gene locus_tag LOCUS_27190 11196 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 11823 12632 gene locus_tag LOCUS_27200 11823 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 13621 12752 gene locus_tag LOCUS_27210 13621 12752 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_27210 14688 13648 gene locus_tag LOCUS_27220 14688 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 15775 14702 gene locus_tag LOCUS_27230 15775 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 15946 17181 gene locus_tag LOCUS_27240 15946 17181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 protein_id gnl|my_center|LOCUS_27240 17214 18425 gene locus_tag LOCUS_27250 17214 18425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 protein_id gnl|my_center|LOCUS_27250 19959 18487 gene locus_tag LOCUS_27260 19959 18487 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_27260 21076 20354 gene locus_tag LOCUS_27270 21076 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 23405 21480 gene locus_tag LOCUS_27280 23405 21480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 23545 25362 gene locus_tag LOCUS_27290 23545 25362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 26035 25472 gene locus_tag LOCUS_27300 26035 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 26941 26261 gene locus_tag LOCUS_27310 26941 26261 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_27310 30522 26938 gene locus_tag LOCUS_27320 30522 26938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence055 2021 1263 gene locus_tag LOCUS_27330 2021 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2769 2014 gene locus_tag LOCUS_27340 2769 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2977 3639 gene locus_tag LOCUS_27350 2977 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 3737 5257 gene locus_tag LOCUS_27360 3737 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 6102 5308 gene locus_tag LOCUS_27370 6102 5308 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_27370 7836 6199 gene locus_tag LOCUS_27380 7836 6199 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_27380 8486 7866 gene locus_tag LOCUS_27390 8486 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 9421 8483 gene locus_tag LOCUS_27400 9421 8483 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189757.1 protein_id gnl|my_center|LOCUS_27400 10366 9569 gene locus_tag LOCUS_27410 10366 9569 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 protein_id gnl|my_center|LOCUS_27410 11478 10366 gene locus_tag LOCUS_27420 11478 10366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929619.1 protein_id gnl|my_center|LOCUS_27420 13140 11608 gene locus_tag LOCUS_27430 gene ppx 13140 11608 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_27430 13374 15494 gene locus_tag LOCUS_27440 gene ppk1 13374 15494 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192053.1 protein_id gnl|my_center|LOCUS_27440 17753 15528 gene locus_tag LOCUS_27450 17753 15528 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_27450 17820 18725 gene locus_tag LOCUS_27460 17820 18725 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_27460 18722 19516 gene locus_tag LOCUS_27470 18722 19516 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_27470 20390 19632 gene locus_tag LOCUS_27480 20390 19632 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888285.1 protein_id gnl|my_center|LOCUS_27480 21127 20402 gene locus_tag LOCUS_27490 21127 20402 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479930.1 protein_id gnl|my_center|LOCUS_27490 21955 21182 gene locus_tag LOCUS_27500 21955 21182 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228488.1 protein_id gnl|my_center|LOCUS_27500 23162 22305 gene locus_tag LOCUS_27510 23162 22305 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704890.1 protein_id gnl|my_center|LOCUS_27510 24215 23364 gene locus_tag LOCUS_27520 gene rlmA 24215 23364 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_27520 25556 24288 gene locus_tag LOCUS_27530 25556 24288 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_27530 26096 25752 gene locus_tag LOCUS_27540 26096 25752 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102247109.1 protein_id gnl|my_center|LOCUS_27540 26619 28016 gene locus_tag LOCUS_27550 26619 28016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 28013 30259 gene locus_tag LOCUS_27560 28013 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence056 1039 665 gene locus_tag LOCUS_27570 1039 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1734 1078 gene locus_tag LOCUS_27580 gene gph 1734 1078 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_27580 2428 1727 gene locus_tag LOCUS_27590 2428 1727 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_27590 3219 2548 gene locus_tag LOCUS_27600 3219 2548 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_27600 4622 3297 gene locus_tag LOCUS_27610 4622 3297 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_27610 5348 4692 gene locus_tag LOCUS_27620 5348 4692 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_27620 5556 6305 gene locus_tag LOCUS_27630 5556 6305 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258788.1 protein_id gnl|my_center|LOCUS_27630 6478 6239 gene locus_tag LOCUS_27640 6478 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6468 9878 gene locus_tag LOCUS_27650 gene mfd 6468 9878 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_27650 9875 10948 gene locus_tag LOCUS_27660 9875 10948 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_27660 12872 11139 gene locus_tag LOCUS_27670 12872 11139 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_27670 13213 14601 gene locus_tag LOCUS_27680 gene mgtE 13213 14601 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_27680 16115 14589 gene locus_tag LOCUS_27690 16115 14589 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_27690 17694 16261 gene locus_tag LOCUS_27700 17694 16261 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_27700 19093 17777 gene locus_tag LOCUS_27710 19093 17777 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_27710 19722 19090 gene locus_tag LOCUS_27720 19722 19090 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_27720 19996 20829 gene locus_tag LOCUS_27730 gene hpnD 19996 20829 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_27730 20826 22181 gene locus_tag LOCUS_27740 gene hpnE 20826 22181 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_27740 22770 22102 gene locus_tag LOCUS_27750 22770 22102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_27750 22787 23407 gene locus_tag LOCUS_27760 22787 23407 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009942000.1 protein_id gnl|my_center|LOCUS_27760 23436 24488 gene locus_tag LOCUS_27770 gene mnmH 23436 24488 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_27770 25037 24489 gene locus_tag LOCUS_27780 25037 24489 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_27780 25085 25510 gene locus_tag LOCUS_27790 25085 25510 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_27790 25737 28427 gene locus_tag LOCUS_27800 25737 28427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_27800 29020 28577 gene locus_tag LOCUS_27810 29020 28577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 29040 29705 gene locus_tag LOCUS_27820 29040 29705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 <30598 29829 gene locus_tag LOCUS_27830 <30598 29829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003702540.1:ATP-dependent chaperone ClpB >Feature sequence057 272 913 gene locus_tag LOCUS_27840 272 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1146 3755 gene locus_tag LOCUS_27850 1146 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3918 4241 gene locus_tag LOCUS_27860 3918 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 6206 4500 gene locus_tag LOCUS_27870 6206 4500 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_27870 7443 6370 gene locus_tag LOCUS_27880 gene fbaA 7443 6370 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_27880 8635 7889 gene locus_tag LOCUS_27890 8635 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 9615 8695 gene locus_tag LOCUS_27900 9615 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 11546 9612 gene locus_tag LOCUS_27910 11546 9612 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929498.1 protein_id gnl|my_center|LOCUS_27910 14058 11575 gene locus_tag LOCUS_27920 14058 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 15558 14254 gene locus_tag LOCUS_27930 15558 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 15880 15572 gene locus_tag LOCUS_27940 15880 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 17370 15877 gene locus_tag LOCUS_27950 17370 15877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 18645 17377 gene locus_tag LOCUS_27960 18645 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 18778 19320 gene locus_tag LOCUS_27970 18778 19320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 20133 19357 gene locus_tag LOCUS_27980 20133 19357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 21662 20130 gene locus_tag LOCUS_27990 21662 20130 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194357.1 protein_id gnl|my_center|LOCUS_27990 22350 21664 gene locus_tag LOCUS_28000 22350 21664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194035.1 protein_id gnl|my_center|LOCUS_28000 23144 22347 gene locus_tag LOCUS_28010 23144 22347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 protein_id gnl|my_center|LOCUS_28010 24190 23141 gene locus_tag LOCUS_28020 24190 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 24165 24332 gene locus_tag LOCUS_28030 24165 24332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 26120 24888 gene locus_tag LOCUS_28040 26120 24888 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974404.1 protein_id gnl|my_center|LOCUS_28040 26275 27060 gene locus_tag LOCUS_28050 26275 27060 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811236.1 protein_id gnl|my_center|LOCUS_28050 27077 28048 gene locus_tag LOCUS_28060 27077 28048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 28137 28898 gene locus_tag LOCUS_28070 gene fnr 28137 28898 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077129.1 protein_id gnl|my_center|LOCUS_28070 29954 29568 gene locus_tag LOCUS_28080 29954 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence058 911 2815 gene locus_tag LOCUS_28090 911 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 5444 2862 gene locus_tag LOCUS_28100 gene cphA 5444 2862 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_28100 7741 5525 gene locus_tag LOCUS_28110 gene cphA 7741 5525 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_28110 8333 7860 gene locus_tag LOCUS_28120 8333 7860 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_28120 10693 8330 gene locus_tag LOCUS_28130 10693 8330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_28130 11489 10734 gene locus_tag LOCUS_28140 11489 10734 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930714.1 protein_id gnl|my_center|LOCUS_28140 12574 11573 gene locus_tag LOCUS_28150 12574 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 12856 17532 gene locus_tag LOCUS_28160 12856 17532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 17601 17885 gene locus_tag LOCUS_28170 17601 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 17882 18199 gene locus_tag LOCUS_28180 17882 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 18326 19864 gene locus_tag LOCUS_28190 gene murJ 18326 19864 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211214.1 protein_id gnl|my_center|LOCUS_28190 19887 20516 gene locus_tag LOCUS_28200 19887 20516 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_28200 23044 20639 gene locus_tag LOCUS_28210 23044 20639 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_28210 23985 23332 gene locus_tag LOCUS_28220 gene adk 23985 23332 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_28220 24881 24117 gene locus_tag LOCUS_28230 gene kdsB 24881 24117 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_28230 25081 24905 gene locus_tag LOCUS_28240 25081 24905 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812895.1 protein_id gnl|my_center|LOCUS_28240 26108 25062 gene locus_tag LOCUS_28250 gene lpxK 26108 25062 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_28250 26524 26108 gene locus_tag LOCUS_28260 26524 26108 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_28260 27208 26540 gene locus_tag LOCUS_28270 27208 26540 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_28270 27452 28822 gene locus_tag LOCUS_28280 gene xseA 27452 28822 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_28280 29065 29652 gene locus_tag LOCUS_28290 gene sodB 29065 29652 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence059 598 275 gene locus_tag LOCUS_28300 598 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1094 591 gene locus_tag LOCUS_28310 1094 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3167 2310 gene locus_tag LOCUS_28320 3167 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3702 3160 gene locus_tag LOCUS_28330 3702 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 4486 3791 gene locus_tag LOCUS_28340 4486 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 4984 4577 gene locus_tag LOCUS_28350 4984 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 5182 6198 gene locus_tag LOCUS_28360 5182 6198 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_28360 9479 6297 gene locus_tag LOCUS_28370 9479 6297 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_28370 11172 9529 gene locus_tag LOCUS_28380 11172 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 12443 11169 gene locus_tag LOCUS_28390 12443 11169 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_28390 13412 12687 gene locus_tag LOCUS_28400 13412 12687 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531904.1 protein_id gnl|my_center|LOCUS_28400 13752 13372 gene locus_tag LOCUS_28410 13752 13372 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 protein_id gnl|my_center|LOCUS_28410 14062 15396 gene locus_tag LOCUS_28420 gene gltA 14062 15396 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969265.1 protein_id gnl|my_center|LOCUS_28420 15786 15469 gene locus_tag LOCUS_28430 15786 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 15954 16769 gene locus_tag LOCUS_28440 15954 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 17771 18226 gene locus_tag LOCUS_28450 17771 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447940.1 protein_id gnl|my_center|LOCUS_28450 18329 19468 gene locus_tag LOCUS_28460 18329 19468 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_28460 19497 19754 gene locus_tag LOCUS_28470 19497 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 19776 22097 gene locus_tag LOCUS_28480 19776 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 22563 22156 gene locus_tag LOCUS_28490 22563 22156 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970304.1 protein_id gnl|my_center|LOCUS_28490 22832 22560 gene locus_tag LOCUS_28500 22832 22560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 23223 24311 gene locus_tag LOCUS_28510 23223 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 24369 24590 gene locus_tag LOCUS_28520 24369 24590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 24768 25751 gene locus_tag LOCUS_28530 24768 25751 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114502.1 protein_id gnl|my_center|LOCUS_28530 26126 25899 gene locus_tag LOCUS_28540 26126 25899 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_28540 26261 27988 gene locus_tag LOCUS_28550 26261 27988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 28084 28401 gene locus_tag LOCUS_28560 28084 28401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 28385 28609 gene locus_tag LOCUS_28570 28385 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence060 <1 700 gene locus_tag LOCUS_28580 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259423.1:FAD-dependent oxidoreductase 1696 806 gene locus_tag LOCUS_28590 gene prmA 1696 806 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_28590 3077 1713 gene locus_tag LOCUS_28600 gene accC 3077 1713 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522043.1 protein_id gnl|my_center|LOCUS_28600 3541 3092 gene locus_tag LOCUS_28610 gene accB 3541 3092 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214627.1 protein_id gnl|my_center|LOCUS_28610 4121 3630 gene locus_tag LOCUS_28620 gene aroQ 4121 3630 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_28620 4845 4237 gene locus_tag LOCUS_28630 4845 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 protein_id gnl|my_center|LOCUS_28630 4961 6334 gene locus_tag LOCUS_28640 gene mpl 4961 6334 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_28640 7215 6322 gene locus_tag LOCUS_28650 gene cyoE 7215 6322 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 protein_id gnl|my_center|LOCUS_28650 8091 7441 gene locus_tag LOCUS_28660 8091 7441 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 protein_id gnl|my_center|LOCUS_28660 9716 8145 gene locus_tag LOCUS_28670 gene ctaD 9716 8145 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404827.1 protein_id gnl|my_center|LOCUS_28670 10528 9737 gene locus_tag LOCUS_28680 10528 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 11237 10521 gene locus_tag LOCUS_28690 11237 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 12076 11303 gene locus_tag LOCUS_28700 12076 11303 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881437.1 protein_id gnl|my_center|LOCUS_28700 12253 12912 gene locus_tag LOCUS_28710 12253 12912 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_28710 13887 13024 gene locus_tag LOCUS_28720 gene rpoH 13887 13024 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 protein_id gnl|my_center|LOCUS_28720 14213 14473 gene locus_tag LOCUS_28730 14213 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_28730 14541 15380 gene locus_tag LOCUS_28740 14541 15380 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_28740 15377 16150 gene locus_tag LOCUS_28750 15377 16150 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_28750 16791 16336 gene locus_tag LOCUS_28760 gene nudB 16791 16336 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_28760 17231 16788 gene locus_tag LOCUS_28770 17231 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 17629 17228 gene locus_tag LOCUS_28780 17629 17228 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726744.1 protein_id gnl|my_center|LOCUS_28780 19438 17636 gene locus_tag LOCUS_28790 gene aspS 19438 17636 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_28790 20105 19452 gene locus_tag LOCUS_28800 20105 19452 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_28800 20422 20090 gene locus_tag LOCUS_28810 20422 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 20816 21619 gene locus_tag LOCUS_28820 20816 21619 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_28820 22217 23830 gene locus_tag LOCUS_28830 22217 23830 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_28830 24562 23978 gene locus_tag LOCUS_28840 24562 23978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 25271 24573 gene locus_tag LOCUS_28850 25271 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 25451 26755 gene locus_tag LOCUS_28860 25451 26755 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_28860 26762 27550 gene locus_tag LOCUS_28870 26762 27550 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908611.1 protein_id gnl|my_center|LOCUS_28870 28370 27681 gene locus_tag LOCUS_28880 gene mnmD 28370 27681 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence061 1055 612 gene locus_tag LOCUS_28890 gene queD 1055 612 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 protein_id gnl|my_center|LOCUS_28890 1304 1582 gene locus_tag LOCUS_28900 1304 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 2169 1600 gene locus_tag LOCUS_28910 2169 1600 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_28910 3432 2332 gene locus_tag LOCUS_28920 3432 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 4950 3517 gene locus_tag LOCUS_28930 4950 3517 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530004.1 protein_id gnl|my_center|LOCUS_28930 5956 5057 gene locus_tag LOCUS_28940 5956 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 7123 6137 gene locus_tag LOCUS_28950 7123 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 8368 7358 gene locus_tag LOCUS_28960 8368 7358 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416068.1 protein_id gnl|my_center|LOCUS_28960 8617 9195 gene locus_tag LOCUS_28970 8617 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28970 9226 11118 gene locus_tag LOCUS_28980 9226 11118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28980 11230 11559 gene locus_tag LOCUS_28990 11230 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 12448 12062 gene locus_tag LOCUS_29000 12448 12062 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_29000 12678 12445 gene locus_tag LOCUS_29010 12678 12445 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_29010 13438 13034 gene locus_tag LOCUS_29020 13438 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 14821 14225 gene locus_tag LOCUS_29030 14821 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 15130 14840 gene locus_tag LOCUS_29040 15130 14840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 15407 15141 gene locus_tag LOCUS_29050 15407 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 15608 16525 gene locus_tag LOCUS_29060 15608 16525 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_29060 16522 17628 gene locus_tag LOCUS_29070 16522 17628 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118140.1 protein_id gnl|my_center|LOCUS_29070 19753 19139 gene locus_tag LOCUS_29080 19753 19139 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_29080 20581 19877 gene locus_tag LOCUS_29090 20581 19877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 20926 20600 gene locus_tag LOCUS_29100 20926 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 21887 21189 gene locus_tag LOCUS_29110 21887 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 23859 22702 gene locus_tag LOCUS_29120 23859 22702 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_29120 24718 23870 gene locus_tag LOCUS_29130 24718 23870 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390505.1 protein_id gnl|my_center|LOCUS_29130 26201 25722 gene locus_tag LOCUS_29140 26201 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 27252 26152 gene locus_tag LOCUS_29150 27252 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 27975 27532 gene locus_tag LOCUS_29160 27975 27532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence062 858 571 gene locus_tag LOCUS_29170 858 571 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267914.1 protein_id gnl|my_center|LOCUS_29170 1924 1013 gene locus_tag LOCUS_29180 1924 1013 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_29180 2252 3487 gene locus_tag LOCUS_29190 2252 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3758 4342 gene locus_tag LOCUS_29200 3758 4342 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_29200 4392 4832 gene locus_tag LOCUS_29210 gene yiaA 4392 4832 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524062.1 protein_id gnl|my_center|LOCUS_29210 5126 4863 gene locus_tag LOCUS_29220 5126 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5346 5609 gene locus_tag LOCUS_29230 5346 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 6029 6394 gene locus_tag LOCUS_29240 6029 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 6673 7293 gene locus_tag LOCUS_29250 6673 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 7618 7935 gene locus_tag LOCUS_29260 7618 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 7965 8894 gene locus_tag LOCUS_29270 7965 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 8998 10593 gene locus_tag LOCUS_29280 8998 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222614.1 protein_id gnl|my_center|LOCUS_29280 10670 11152 gene locus_tag LOCUS_29290 10670 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 11677 12291 gene locus_tag LOCUS_29300 11677 12291 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470592.1 protein_id gnl|my_center|LOCUS_29300 12469 13269 gene locus_tag LOCUS_29310 12469 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 13286 14392 gene locus_tag LOCUS_29320 13286 14392 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974691.1 protein_id gnl|my_center|LOCUS_29320 15940 14414 gene locus_tag LOCUS_29330 15940 14414 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_29330 17307 16024 gene locus_tag LOCUS_29340 17307 16024 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930370.1 protein_id gnl|my_center|LOCUS_29340 18470 17379 gene locus_tag LOCUS_29350 gene moaA 18470 17379 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_29350 19236 18583 gene locus_tag LOCUS_29360 19236 18583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 19984 19211 gene locus_tag LOCUS_29370 19984 19211 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_29370 20332 21099 gene locus_tag LOCUS_29380 20332 21099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 21478 26094 gene locus_tag LOCUS_29390 21478 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 26094 26321 gene locus_tag LOCUS_29400 26094 26321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 26895 26362 gene locus_tag LOCUS_29410 26895 26362 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_29410 27223 27624 gene locus_tag LOCUS_29420 27223 27624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence063 >Feature sequence064 261 437 gene locus_tag LOCUS_29430 261 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 501 722 gene locus_tag LOCUS_29440 501 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 719 922 gene locus_tag LOCUS_29450 719 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1123 1854 gene locus_tag LOCUS_29460 1123 1854 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_29460 1909 2748 gene locus_tag LOCUS_29470 1909 2748 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_29470 3253 2915 gene locus_tag LOCUS_29480 3253 2915 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809432.1 protein_id gnl|my_center|LOCUS_29480 4342 3593 gene locus_tag LOCUS_29490 4342 3593 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_29490 5172 4339 gene locus_tag LOCUS_29500 5172 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 5464 5246 gene locus_tag LOCUS_29510 5464 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 8339 5454 gene locus_tag LOCUS_29520 8339 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 9139 8654 gene locus_tag LOCUS_29530 9139 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 9810 9367 gene locus_tag LOCUS_29540 9810 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 10596 9976 gene locus_tag LOCUS_29550 10596 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 10923 11207 gene locus_tag LOCUS_29560 10923 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 11383 11562 gene locus_tag LOCUS_29570 11383 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 11753 11490 gene locus_tag LOCUS_29580 11753 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 12193 15096 gene locus_tag LOCUS_29590 12193 15096 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_29590 15283 15113 gene locus_tag LOCUS_29600 15283 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 15260 16954 gene locus_tag LOCUS_29610 15260 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 17305 17916 gene locus_tag LOCUS_29620 17305 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 18232 18035 gene locus_tag LOCUS_29630 18232 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 18395 18700 gene locus_tag LOCUS_29640 18395 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 18788 19309 gene locus_tag LOCUS_29650 18788 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 19312 19869 gene locus_tag LOCUS_29660 19312 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 20624 19908 gene locus_tag LOCUS_29670 20624 19908 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771783.1 protein_id gnl|my_center|LOCUS_29670 21562 20621 gene locus_tag LOCUS_29680 21562 20621 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_29680 22401 21559 gene locus_tag LOCUS_29690 22401 21559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_29690 23542 22403 gene locus_tag LOCUS_29700 23542 22403 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_29700 25320 23608 gene locus_tag LOCUS_29710 25320 23608 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_29710 26097 25375 gene locus_tag LOCUS_29720 26097 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 26622 27173 gene locus_tag LOCUS_29730 26622 27173 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence065 734 150 gene locus_tag LOCUS_29740 gene rsxA 734 150 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_29740 1860 847 gene locus_tag LOCUS_29750 1860 847 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534868.1 protein_id gnl|my_center|LOCUS_29750 2375 1902 gene locus_tag LOCUS_29760 2375 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 3140 2388 gene locus_tag LOCUS_29770 3140 2388 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_29770 3852 3145 gene locus_tag LOCUS_29780 gene aat 3852 3145 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_29780 4958 3849 gene locus_tag LOCUS_29790 4958 3849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_29790 5077 6723 gene locus_tag LOCUS_29800 5077 6723 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_29800 7784 6759 gene locus_tag LOCUS_29810 7784 6759 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_29810 8443 7934 gene locus_tag LOCUS_29820 8443 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 8789 8490 gene locus_tag LOCUS_29830 8789 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 8799 9794 gene locus_tag LOCUS_29840 8799 9794 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_29840 9829 10971 gene locus_tag LOCUS_29850 9829 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 11016 12914 gene locus_tag LOCUS_29860 11016 12914 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_29860 14194 13565 gene locus_tag LOCUS_29870 14194 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 15915 14191 gene locus_tag LOCUS_29880 gene soxB 15915 14191 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_29880 16620 15970 gene locus_tag LOCUS_29890 16620 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 17448 16633 gene locus_tag LOCUS_29900 gene soxA 17448 16633 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_29900 17839 17525 gene locus_tag LOCUS_29910 gene soxZ 17839 17525 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_29910 18343 17876 gene locus_tag LOCUS_29920 gene soxY 18343 17876 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_29920 19421 18366 gene locus_tag LOCUS_29930 19421 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 20778 19405 gene locus_tag LOCUS_29940 gene soxC 20778 19405 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_29940 21089 21394 gene locus_tag LOCUS_29950 21089 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 21407 22684 gene locus_tag LOCUS_29960 21407 22684 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_29960 23376 22756 gene locus_tag LOCUS_29970 23376 22756 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_29970 23543 24553 gene locus_tag LOCUS_29980 23543 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 24553 24921 gene locus_tag LOCUS_29990 24553 24921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 24923 25411 gene locus_tag LOCUS_30000 24923 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 25833 25639 gene locus_tag LOCUS_30010 25833 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 26099 25881 gene locus_tag LOCUS_30020 26099 25881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 <27256 26113 gene locus_tag LOCUS_30030 <27256 26113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001059249.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase >Feature sequence066 3090 3389 gene locus_tag LOCUS_30040 3090 3389 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_30040 3373 3645 gene locus_tag LOCUS_30050 3373 3645 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_30050 4329 3763 gene locus_tag LOCUS_30060 4329 3763 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021918.1 protein_id gnl|my_center|LOCUS_30060 6941 4344 gene locus_tag LOCUS_30070 6941 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 7345 6938 gene locus_tag LOCUS_30080 7345 6938 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_30080 10512 7342 gene locus_tag LOCUS_30090 10512 7342 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036267.1 protein_id gnl|my_center|LOCUS_30090 10762 11349 gene locus_tag LOCUS_30100 10762 11349 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926772.1 protein_id gnl|my_center|LOCUS_30100 11623 12210 gene locus_tag LOCUS_30110 11623 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 12741 12406 gene locus_tag LOCUS_30120 12741 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 12885 13373 gene locus_tag LOCUS_30130 12885 13373 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_30130 14231 13467 gene locus_tag LOCUS_30140 14231 13467 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063819.1 protein_id gnl|my_center|LOCUS_30140 14877 14224 gene locus_tag LOCUS_30150 14877 14224 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 protein_id gnl|my_center|LOCUS_30150 15687 14884 gene locus_tag LOCUS_30160 15687 14884 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_30160 16816 16010 gene locus_tag LOCUS_30170 gene pstB 16816 16010 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_30170 17694 16879 gene locus_tag LOCUS_30180 gene pstB 17694 16879 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_30180 18578 17688 gene locus_tag LOCUS_30190 gene pstA 18578 17688 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_30190 19534 18584 gene locus_tag LOCUS_30200 gene pstC 19534 18584 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_30200 20597 19536 gene locus_tag LOCUS_30210 20597 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 21536 20676 gene locus_tag LOCUS_30220 21536 20676 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_30220 21831 23402 gene locus_tag LOCUS_30230 21831 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 23392 24015 gene locus_tag LOCUS_30240 gene fixJ 23392 24015 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 protein_id gnl|my_center|LOCUS_30240 25077 24049 gene locus_tag LOCUS_30250 25077 24049 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921653.1 protein_id gnl|my_center|LOCUS_30250 25455 27122 gene locus_tag LOCUS_30260 25455 27122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence067 1669 170 gene locus_tag LOCUS_30270 1669 170 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616429.1 protein_id gnl|my_center|LOCUS_30270 2256 1669 gene locus_tag LOCUS_30280 2256 1669 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812635.1 protein_id gnl|my_center|LOCUS_30280 3994 2660 gene locus_tag LOCUS_30290 3994 2660 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_30290 4476 3994 gene locus_tag LOCUS_30300 4476 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 7743 4639 gene locus_tag LOCUS_30310 7743 4639 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_30310 8837 7740 gene locus_tag LOCUS_30320 8837 7740 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085209.1 protein_id gnl|my_center|LOCUS_30320 9511 8840 gene locus_tag LOCUS_30330 9511 8840 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_30330 9788 9976 gene locus_tag LOCUS_30340 9788 9976 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106997.1 protein_id gnl|my_center|LOCUS_30340 9973 10353 gene locus_tag LOCUS_30350 9973 10353 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_30350 10814 11206 gene locus_tag LOCUS_30360 10814 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 11206 12540 gene locus_tag LOCUS_30370 11206 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 13243 13866 gene locus_tag LOCUS_30380 13243 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 13879 14412 gene locus_tag LOCUS_30390 13879 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 14409 14657 gene locus_tag LOCUS_30400 14409 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30400 15037 16647 gene locus_tag LOCUS_30410 15037 16647 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083751.1 protein_id gnl|my_center|LOCUS_30410 18377 16725 gene locus_tag LOCUS_30420 18377 16725 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_30420 19881 18382 gene locus_tag LOCUS_30430 19881 18382 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_30430 20915 20322 gene locus_tag LOCUS_30440 20915 20322 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811907.1 protein_id gnl|my_center|LOCUS_30440 21754 22851 gene locus_tag LOCUS_30450 gene ydiK 21754 22851 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_30450 22913 23521 gene locus_tag LOCUS_30460 22913 23521 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_30460 25095 23659 gene locus_tag LOCUS_30470 25095 23659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 26741 25461 gene locus_tag LOCUS_30480 26741 25461 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence068 687 475 gene locus_tag LOCUS_30490 687 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818304.1 protein_id gnl|my_center|LOCUS_30490 4717 701 gene locus_tag LOCUS_30500 4717 701 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705805.1 protein_id gnl|my_center|LOCUS_30500 6252 4714 gene locus_tag LOCUS_30510 6252 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552171.1 protein_id gnl|my_center|LOCUS_30510 8257 6260 gene locus_tag LOCUS_30520 gene vgrG1b 8257 6260 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_30520 9724 8333 gene locus_tag LOCUS_30530 9724 8333 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929319.1 protein_id gnl|my_center|LOCUS_30530 10273 9815 gene locus_tag LOCUS_30540 10273 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 10804 10289 gene locus_tag LOCUS_30550 10804 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 13586 10791 gene locus_tag LOCUS_30560 gene tssH 13586 10791 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525311.1 protein_id gnl|my_center|LOCUS_30560 14673 13600 gene locus_tag LOCUS_30570 gene tssG 14673 13600 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_30570 16529 14649 gene locus_tag LOCUS_30580 gene tssF 16529 14649 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_30580 17049 16543 gene locus_tag LOCUS_30590 gene tssE 17049 16543 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064511.1 protein_id gnl|my_center|LOCUS_30590 17876 17052 gene locus_tag LOCUS_30600 gene tagJ 17876 17052 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_30600 18410 17922 gene locus_tag LOCUS_30610 gene hcp 18410 17922 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_30610 19074 18586 gene locus_tag LOCUS_30620 gene hcp 19074 18586 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_30620 20705 19212 gene locus_tag LOCUS_30630 gene tssC 20705 19212 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_30630 21294 20782 gene locus_tag LOCUS_30640 gene tssB 21294 20782 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502644.1 protein_id gnl|my_center|LOCUS_30640 22410 21358 gene locus_tag LOCUS_30650 gene tssA 22410 21358 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_30650 <26165 22505 gene locus_tag LOCUS_30660 <26165 22505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence069 262 597 gene locus_tag LOCUS_30670 262 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 611 3361 gene locus_tag LOCUS_30680 611 3361 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 protein_id gnl|my_center|LOCUS_30680 3579 3256 gene locus_tag LOCUS_30690 3579 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 5903 3951 gene locus_tag LOCUS_30700 5903 3951 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_30700 6849 6133 gene locus_tag LOCUS_30710 6849 6133 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_30710 7205 6846 gene locus_tag LOCUS_30720 7205 6846 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_30720 8315 7260 gene locus_tag LOCUS_30730 8315 7260 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_30730 10050 8317 gene locus_tag LOCUS_30740 10050 8317 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_30740 12004 10166 gene locus_tag LOCUS_30750 12004 10166 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_30750 12330 12779 gene locus_tag LOCUS_30760 12330 12779 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_30760 13543 12674 gene locus_tag LOCUS_30770 13543 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 14306 14869 gene locus_tag LOCUS_30780 14306 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 14962 15516 gene locus_tag LOCUS_30790 14962 15516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 16596 15715 gene locus_tag LOCUS_30800 16596 15715 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_30800 17292 16636 gene locus_tag LOCUS_30810 17292 16636 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_30810 18213 17695 gene locus_tag LOCUS_30820 18213 17695 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_30820 18590 18231 gene locus_tag LOCUS_30830 18590 18231 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523720.1 protein_id gnl|my_center|LOCUS_30830 18858 19394 gene locus_tag LOCUS_30840 18858 19394 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_30840 19446 19745 gene locus_tag LOCUS_30850 19446 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 19986 20417 gene locus_tag LOCUS_30860 19986 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 20614 21456 gene locus_tag LOCUS_30870 20614 21456 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941377.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence070 2503 4365 gene locus_tag LOCUS_30880 gene uvrC 2503 4365 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 protein_id gnl|my_center|LOCUS_30880 4365 4943 gene locus_tag LOCUS_30890 gene pgsA 4365 4943 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_30890 5048 5123 gene locus_tag LOCUS_t00300 5048 5123 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5187 5260 gene locus_tag LOCUS_t00310 5187 5260 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6157 5501 gene locus_tag LOCUS_30900 6157 5501 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_30900 6779 6291 gene locus_tag LOCUS_30910 gene sixA 6779 6291 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947703.1 protein_id gnl|my_center|LOCUS_30910 7489 7169 gene locus_tag LOCUS_30920 7489 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 9649 7535 gene locus_tag LOCUS_30930 9649 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30930 12835 9707 gene locus_tag LOCUS_30940 12835 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 13784 14107 gene locus_tag LOCUS_30950 13784 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 14332 14781 gene locus_tag LOCUS_30960 14332 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 15177 15683 gene locus_tag LOCUS_30970 15177 15683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 15753 16811 gene locus_tag LOCUS_30980 15753 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 16861 17604 gene locus_tag LOCUS_30990 16861 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 17604 18947 gene locus_tag LOCUS_31000 17604 18947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 18944 19234 gene locus_tag LOCUS_31010 18944 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 19222 20463 gene locus_tag LOCUS_31020 19222 20463 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_31020 21360 20470 gene locus_tag LOCUS_31030 21360 20470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 21748 23067 gene locus_tag LOCUS_31040 21748 23067 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 protein_id gnl|my_center|LOCUS_31040 24853 23096 gene locus_tag LOCUS_31050 24853 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence071 732 265 gene locus_tag LOCUS_31060 732 265 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039937.1 protein_id gnl|my_center|LOCUS_31060 1295 732 gene locus_tag LOCUS_31070 1295 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 2760 1438 gene locus_tag LOCUS_31080 2760 1438 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_31080 3877 2813 gene locus_tag LOCUS_31090 gene fba 3877 2813 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_31090 5434 3995 gene locus_tag LOCUS_31100 gene pyk 5434 3995 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_31100 6503 5505 gene locus_tag LOCUS_31110 gene gap 6503 5505 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_31110 8415 6526 gene locus_tag LOCUS_31120 gene tkt 8415 6526 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098658.1 protein_id gnl|my_center|LOCUS_31120 8960 10339 gene locus_tag LOCUS_31130 8960 10339 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_31130 10423 11226 gene locus_tag LOCUS_31140 10423 11226 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_31140 11241 13538 gene locus_tag LOCUS_31150 11241 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 13640 18952 gene locus_tag LOCUS_31160 13640 18952 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_31160 18956 21796 gene locus_tag LOCUS_31170 18956 21796 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_31170 22215 22000 gene locus_tag LOCUS_31180 22215 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 22153 23445 gene locus_tag LOCUS_31190 22153 23445 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence072 307 14 gene locus_tag LOCUS_31200 307 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 1016 351 gene locus_tag LOCUS_31210 1016 351 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_31210 1973 1041 gene locus_tag LOCUS_31220 1973 1041 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_31220 2725 1976 gene locus_tag LOCUS_31230 2725 1976 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 protein_id gnl|my_center|LOCUS_31230 2941 3549 gene locus_tag LOCUS_31240 2941 3549 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_31240 3589 5097 gene locus_tag LOCUS_31250 gene glpK 3589 5097 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_31250 6042 5107 gene locus_tag LOCUS_31260 6042 5107 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_31260 7459 6161 gene locus_tag LOCUS_31270 7459 6161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_31270 7682 8908 gene locus_tag LOCUS_31280 gene dinB 7682 8908 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 protein_id gnl|my_center|LOCUS_31280 11591 8943 gene locus_tag LOCUS_31290 11591 8943 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940229.1 protein_id gnl|my_center|LOCUS_31290 12434 11910 gene locus_tag LOCUS_31300 12434 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 12614 13372 gene locus_tag LOCUS_31310 12614 13372 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814239.1 protein_id gnl|my_center|LOCUS_31310 13369 14679 gene locus_tag LOCUS_31320 13369 14679 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039169.1 protein_id gnl|my_center|LOCUS_31320 14966 15955 gene locus_tag LOCUS_31330 14966 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 16026 17579 gene locus_tag LOCUS_31340 16026 17579 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_31340 17654 17899 gene locus_tag LOCUS_31350 17654 17899 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768492.1 protein_id gnl|my_center|LOCUS_31350 17958 20162 gene locus_tag LOCUS_31360 gene plpD 17958 20162 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_31360 21491 20457 gene locus_tag LOCUS_31370 21491 20457 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728707.1 protein_id gnl|my_center|LOCUS_31370 21969 21670 gene locus_tag LOCUS_31380 21969 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 22739 22290 gene locus_tag LOCUS_31390 22739 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 23246 22857 gene locus_tag LOCUS_31400 23246 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 23738 23376 gene locus_tag LOCUS_31410 23738 23376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence073 <1 595 gene locus_tag LOCUS_31420 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895568.1:flagellar hook-length control protein FliK 662 1213 gene locus_tag LOCUS_31430 662 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 1220 2224 gene locus_tag LOCUS_31440 gene fliM 1220 2224 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_31440 2217 2654 gene locus_tag LOCUS_31450 2217 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2769 3248 gene locus_tag LOCUS_31460 2769 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3235 3990 gene locus_tag LOCUS_31470 gene fliP 3235 3990 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704950.1 protein_id gnl|my_center|LOCUS_31470 3987 4256 gene locus_tag LOCUS_31480 gene fliQ 3987 4256 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 protein_id gnl|my_center|LOCUS_31480 4264 5049 gene locus_tag LOCUS_31490 gene fliR 4264 5049 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525780.1 protein_id gnl|my_center|LOCUS_31490 8355 5080 gene locus_tag LOCUS_31500 8355 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 9457 8591 gene locus_tag LOCUS_31510 9457 8591 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530905.1 protein_id gnl|my_center|LOCUS_31510 10347 9523 gene locus_tag LOCUS_31520 10347 9523 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927689.1 protein_id gnl|my_center|LOCUS_31520 11759 10359 gene locus_tag LOCUS_31530 11759 10359 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_31530 12811 11909 gene locus_tag LOCUS_31540 12811 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 13278 12901 gene locus_tag LOCUS_31550 13278 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 14285 13404 gene locus_tag LOCUS_31560 14285 13404 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119903.1 protein_id gnl|my_center|LOCUS_31560 14677 14384 gene locus_tag LOCUS_31570 14677 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 14912 16384 gene locus_tag LOCUS_31580 14912 16384 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142531.1 protein_id gnl|my_center|LOCUS_31580 16391 19573 gene locus_tag LOCUS_31590 16391 19573 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122713.1 protein_id gnl|my_center|LOCUS_31590 19570 21120 gene locus_tag LOCUS_31600 19570 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 21117 22619 gene locus_tag LOCUS_31610 21117 22619 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_31610 22612 24108 gene locus_tag LOCUS_31620 22612 24108 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969262.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence074 474 13 gene locus_tag LOCUS_31630 474 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2395 482 gene locus_tag LOCUS_31640 2395 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 4287 2392 gene locus_tag LOCUS_31650 4287 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 5248 4355 gene locus_tag LOCUS_31660 5248 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 6090 5245 gene locus_tag LOCUS_31670 6090 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 6893 6090 gene locus_tag LOCUS_31680 6893 6090 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_31680 7325 6960 gene locus_tag LOCUS_31690 7325 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 7529 7347 gene locus_tag LOCUS_31700 7529 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 10158 7786 gene locus_tag LOCUS_31710 10158 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 10927 10160 gene locus_tag LOCUS_31720 10927 10160 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_31720 11705 11025 gene locus_tag LOCUS_31730 11705 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 12550 11720 gene locus_tag LOCUS_31740 gene prpC 12550 11720 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_31740 13673 12714 gene locus_tag LOCUS_31750 13673 12714 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_31750 14729 13836 gene locus_tag LOCUS_31760 gene sucD 14729 13836 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 protein_id gnl|my_center|LOCUS_31760 15900 14740 gene locus_tag LOCUS_31770 gene sucC 15900 14740 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_31770 16459 15959 gene locus_tag LOCUS_31780 16459 15959 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550823.1 protein_id gnl|my_center|LOCUS_31780 21347 16689 gene locus_tag LOCUS_31790 21347 16689 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_31790 22247 21519 gene locus_tag LOCUS_31800 22247 21519 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194225.1 protein_id gnl|my_center|LOCUS_31800 22961 22281 gene locus_tag LOCUS_31810 gene gltK 22961 22281 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194080.1 protein_id gnl|my_center|LOCUS_31810 23703 22963 gene locus_tag LOCUS_31820 23703 22963 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 protein_id gnl|my_center|LOCUS_31820 24203 23763 gene locus_tag LOCUS_31830 24203 23763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence075 922 50 gene locus_tag LOCUS_31840 922 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 1133 3805 gene locus_tag LOCUS_31850 1133 3805 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_31850 4035 4538 gene locus_tag LOCUS_31860 gene tpx 4035 4538 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_31860 4531 5430 gene locus_tag LOCUS_31870 4531 5430 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 protein_id gnl|my_center|LOCUS_31870 5715 6539 gene locus_tag LOCUS_31880 5715 6539 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_31880 6541 7116 gene locus_tag LOCUS_31890 6541 7116 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931244.1 protein_id gnl|my_center|LOCUS_31890 7116 9035 gene locus_tag LOCUS_31900 7116 9035 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527764.1 protein_id gnl|my_center|LOCUS_31900 9094 9927 gene locus_tag LOCUS_31910 9094 9927 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 protein_id gnl|my_center|LOCUS_31910 9924 10760 gene locus_tag LOCUS_31920 gene aroE 9924 10760 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_31920 10757 11449 gene locus_tag LOCUS_31930 gene mtgA 10757 11449 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_31930 11576 12091 gene locus_tag LOCUS_31940 11576 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228841.1 protein_id gnl|my_center|LOCUS_31940 13629 12205 gene locus_tag LOCUS_31950 13629 12205 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192408.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31950 14103 15530 gene locus_tag LOCUS_31960 14103 15530 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_31960 15549 16484 gene locus_tag LOCUS_31970 15549 16484 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174267.1 protein_id gnl|my_center|LOCUS_31970 16745 16819 gene locus_tag LOCUS_t00320 16745 16819 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17028 17327 gene locus_tag LOCUS_31980 17028 17327 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_31980 18434 17451 gene locus_tag LOCUS_31990 gene ybiB 18434 17451 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210242.1 protein_id gnl|my_center|LOCUS_31990 18856 19878 gene locus_tag LOCUS_32000 18856 19878 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036507.1 protein_id gnl|my_center|LOCUS_32000 20553 21908 gene locus_tag LOCUS_32010 gene ltrA 20553 21908 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090914.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence076 3498 1507 gene locus_tag LOCUS_32020 gene brxL 3498 1507 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_32020 5038 3593 gene locus_tag LOCUS_32030 5038 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 5925 5035 gene locus_tag LOCUS_32040 5925 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32040 7308 5941 gene locus_tag LOCUS_32050 7308 5941 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_32050 9419 7320 gene locus_tag LOCUS_32060 9419 7320 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_32060 10666 9416 gene locus_tag LOCUS_32070 10666 9416 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_32070 13345 10697 gene locus_tag LOCUS_32080 13345 10697 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_32080 16779 13342 gene locus_tag LOCUS_32090 16779 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 17159 16776 gene locus_tag LOCUS_32100 17159 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 20629 17156 gene locus_tag LOCUS_32110 gene brxC 20629 17156 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_32110 21227 20664 gene locus_tag LOCUS_32120 21227 20664 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_32120 22017 21217 gene locus_tag LOCUS_32130 22017 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_32130 22226 22014 gene locus_tag LOCUS_32140 22226 22014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence077 1808 258 gene locus_tag LOCUS_32150 1808 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3142 1805 gene locus_tag LOCUS_32160 3142 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 5077 3599 gene locus_tag LOCUS_32170 5077 3599 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 protein_id gnl|my_center|LOCUS_32170 6397 5183 gene locus_tag LOCUS_32180 6397 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 6625 7722 gene locus_tag LOCUS_32190 6625 7722 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530327.1 protein_id gnl|my_center|LOCUS_32190 8216 7683 gene locus_tag LOCUS_32200 8216 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 9740 8232 gene locus_tag LOCUS_32210 9740 8232 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_32210 10303 9749 gene locus_tag LOCUS_32220 10303 9749 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_32220 11036 10305 gene locus_tag LOCUS_32230 11036 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 12910 11033 gene locus_tag LOCUS_32240 12910 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 15037 13079 gene locus_tag LOCUS_32250 15037 13079 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_32250 15722 16795 gene locus_tag LOCUS_32260 15722 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 17541 16882 gene locus_tag LOCUS_32270 gene queE 17541 16882 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_32270 18337 17546 gene locus_tag LOCUS_32280 gene ybgF 18337 17546 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_32280 18874 18347 gene locus_tag LOCUS_32290 gene pal 18874 18347 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 protein_id gnl|my_center|LOCUS_32290 20206 18914 gene locus_tag LOCUS_32300 gene tolB 20206 18914 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_32300 21248 20301 gene locus_tag LOCUS_32310 21248 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 22267 21293 gene locus_tag LOCUS_32320 22267 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 22683 22279 gene locus_tag LOCUS_32330 gene tolR 22683 22279 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence078 744 277 gene locus_tag LOCUS_32340 gene fur 744 277 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_32340 923 1405 gene locus_tag LOCUS_32350 923 1405 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105026.1 protein_id gnl|my_center|LOCUS_32350 1449 2213 gene locus_tag LOCUS_32360 gene dapB 1449 2213 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_32360 2440 3603 gene locus_tag LOCUS_32370 gene carA 2440 3603 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_32370 3581 6787 gene locus_tag LOCUS_32380 gene carB 3581 6787 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_32380 6861 7337 gene locus_tag LOCUS_32390 gene greA 6861 7337 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_32390 7346 7810 gene locus_tag LOCUS_32400 7346 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 8228 7869 gene locus_tag LOCUS_32410 8228 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 8273 8893 gene locus_tag LOCUS_32420 gene rlmE 8273 8893 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438562.1 protein_id gnl|my_center|LOCUS_32420 9012 10898 gene locus_tag LOCUS_32430 gene ftsH 9012 10898 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_32430 10940 11788 gene locus_tag LOCUS_32440 gene folP 10940 11788 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930173.1 protein_id gnl|my_center|LOCUS_32440 12004 13371 gene locus_tag LOCUS_32450 gene glmM 12004 13371 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_32450 14726 13515 gene locus_tag LOCUS_32460 14726 13515 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_32460 15319 14738 gene locus_tag LOCUS_32470 15319 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 16528 15464 gene locus_tag LOCUS_32480 16528 15464 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_32480 16980 16525 gene locus_tag LOCUS_32490 16980 16525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 17327 17833 gene locus_tag LOCUS_32500 17327 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 17830 18435 gene locus_tag LOCUS_32510 gene msrA 17830 18435 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947811.1 protein_id gnl|my_center|LOCUS_32510 19766 18576 gene locus_tag LOCUS_32520 gene rlmI 19766 18576 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_32520 19962 20336 gene locus_tag LOCUS_32530 19962 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 20333 20962 gene locus_tag LOCUS_32540 20333 20962 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921332.1 protein_id gnl|my_center|LOCUS_32540 21012 21485 gene locus_tag LOCUS_32550 21012 21485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 21692 21561 gene locus_tag LOCUS_32560 21692 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 22432 21779 gene locus_tag LOCUS_32570 22432 21779 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_32570 >Feature sequence079 790 2049 gene locus_tag LOCUS_32580 790 2049 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_32580 2073 3392 gene locus_tag LOCUS_32590 2073 3392 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_32590 3772 3575 gene locus_tag LOCUS_32600 3772 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 5418 4006 gene locus_tag LOCUS_32610 gene parS 5418 4006 CDS product sensor histidine kinase ParS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113589.1 protein_id gnl|my_center|LOCUS_32610 6217 5405 gene locus_tag LOCUS_32620 6217 5405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184573.1 protein_id gnl|my_center|LOCUS_32620 6306 7469 gene locus_tag LOCUS_32630 6306 7469 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_32630 7473 7970 gene locus_tag LOCUS_32640 7473 7970 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406623.1 protein_id gnl|my_center|LOCUS_32640 8466 8005 gene locus_tag LOCUS_32650 gene dut 8466 8005 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816756.1 protein_id gnl|my_center|LOCUS_32650 9659 8463 gene locus_tag LOCUS_32660 gene coaBC 9659 8463 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_32660 9829 10506 gene locus_tag LOCUS_32670 gene radC 9829 10506 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_32670 10594 10827 gene locus_tag LOCUS_32680 gene rpmB 10594 10827 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_32680 10842 10997 gene locus_tag LOCUS_32690 gene rpmG 10842 10997 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_32690 12213 11134 gene locus_tag LOCUS_32700 gene aroG 12213 11134 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_32700 13508 12354 gene locus_tag LOCUS_32710 13508 12354 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_32710 13963 14038 gene locus_tag LOCUS_t00330 13963 14038 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 14533 15999 gene locus_tag LOCUS_32720 14533 15999 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_32720 16003 16428 gene locus_tag LOCUS_32730 16003 16428 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_32730 16425 17945 gene locus_tag LOCUS_32740 16425 17945 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_32740 17955 19646 gene locus_tag LOCUS_32750 17955 19646 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994769.1 protein_id gnl|my_center|LOCUS_32750 19643 22042 gene locus_tag LOCUS_32760 19643 22042 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence080 <1 1037 gene locus_tag LOCUS_32770 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966688.1:nitrous oxide reductase family maturation protein NosD 1655 2557 gene locus_tag LOCUS_32780 1655 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2557 3519 gene locus_tag LOCUS_32790 gene napH 2557 3519 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 protein_id gnl|my_center|LOCUS_32790 3532 4404 gene locus_tag LOCUS_32800 3532 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4418 4891 gene locus_tag LOCUS_32810 4418 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 4902 5729 gene locus_tag LOCUS_32820 4902 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 5737 6249 gene locus_tag LOCUS_32830 5737 6249 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_32830 6399 7553 gene locus_tag LOCUS_32840 gene nirF 6399 7553 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_32840 7559 8542 gene locus_tag LOCUS_32850 7559 8542 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_32850 8535 9014 gene locus_tag LOCUS_32860 8535 9014 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_32860 9011 9496 gene locus_tag LOCUS_32870 9011 9496 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_32870 9884 9678 gene locus_tag LOCUS_32880 9884 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 11847 10078 gene locus_tag LOCUS_32890 11847 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 12545 13105 gene locus_tag LOCUS_32900 12545 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 15101 13254 gene locus_tag LOCUS_32910 15101 13254 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_32910 15670 15098 gene locus_tag LOCUS_32920 15670 15098 CDS product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524145.1 protein_id gnl|my_center|LOCUS_32920 15618 15917 gene locus_tag LOCUS_32930 15618 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 16061 16387 gene locus_tag LOCUS_32940 16061 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 16680 17015 gene locus_tag LOCUS_32950 16680 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 17713 17012 gene locus_tag LOCUS_32960 17713 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 18819 17710 gene locus_tag LOCUS_32970 gene amrS 18819 17710 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_32970 19361 18804 gene locus_tag LOCUS_32980 19361 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 20175 19351 gene locus_tag LOCUS_32990 gene amrB 20175 19351 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_32990 20239 20949 gene locus_tag LOCUS_33000 gene ispD 20239 20949 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_33000 20946 21425 gene locus_tag LOCUS_33010 gene ispF 20946 21425 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence081 139 2763 gene locus_tag LOCUS_33020 139 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 2763 3617 gene locus_tag LOCUS_33030 2763 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 6020 3930 gene locus_tag LOCUS_33040 6020 3930 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_33040 7354 6017 gene locus_tag LOCUS_33050 7354 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 8148 7351 gene locus_tag LOCUS_33060 8148 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 9697 8150 gene locus_tag LOCUS_33070 9697 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 <21694 9711 gene locus_tag LOCUS_33080 <21694 9711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086345.1:VCBS domain-containing protein >Feature sequence082 520 1419 gene locus_tag LOCUS_33090 520 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 1744 1514 gene locus_tag LOCUS_33100 1744 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 6593 1911 gene locus_tag LOCUS_33110 6593 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 7646 6744 gene locus_tag LOCUS_33120 7646 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 7860 8741 gene locus_tag LOCUS_33130 7860 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 8773 9588 gene locus_tag LOCUS_33140 8773 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 9679 9918 gene locus_tag LOCUS_33150 9679 9918 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968496.1 protein_id gnl|my_center|LOCUS_33150 9918 10349 gene locus_tag LOCUS_33160 9918 10349 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_33160 10907 10500 gene locus_tag LOCUS_33170 10907 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 12015 10897 gene locus_tag LOCUS_33180 12015 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 12668 12030 gene locus_tag LOCUS_33190 12668 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 13512 12694 gene locus_tag LOCUS_33200 13512 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 14162 13710 gene locus_tag LOCUS_33210 14162 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 14266 14862 gene locus_tag LOCUS_33220 14266 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 15499 15143 gene locus_tag LOCUS_33230 15499 15143 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_33230 15775 15521 gene locus_tag LOCUS_33240 15775 15521 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_33240 15973 16356 gene locus_tag LOCUS_33250 15973 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 17397 16870 gene locus_tag LOCUS_33260 17397 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 18619 17756 gene locus_tag LOCUS_33270 18619 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 18941 18606 gene locus_tag LOCUS_33280 18941 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 21355 19280 gene locus_tag LOCUS_33290 21355 19280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 >Feature sequence083 3189 349 gene locus_tag LOCUS_33300 3189 349 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526855.1 protein_id gnl|my_center|LOCUS_33300 4596 3301 gene locus_tag LOCUS_33310 gene gltA 4596 3301 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 protein_id gnl|my_center|LOCUS_33310 4921 4667 gene locus_tag LOCUS_33320 4921 4667 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_33320 5634 4921 gene locus_tag LOCUS_33330 5634 4921 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_33330 7443 5659 gene locus_tag LOCUS_33340 gene sdhA 7443 5659 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688397.1 protein_id gnl|my_center|LOCUS_33340 7791 7444 gene locus_tag LOCUS_33350 gene sdhD 7791 7444 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_33350 8177 7785 gene locus_tag LOCUS_33360 gene sdhC 8177 7785 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 protein_id gnl|my_center|LOCUS_33360 9048 8293 gene locus_tag LOCUS_33370 9048 8293 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813656.1 protein_id gnl|my_center|LOCUS_33370 9349 9143 gene locus_tag LOCUS_33380 9349 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 9245 10231 gene locus_tag LOCUS_33390 9245 10231 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_33390 10344 11327 gene locus_tag LOCUS_33400 10344 11327 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_33400 11332 11742 gene locus_tag LOCUS_33410 11332 11742 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_33410 12562 11717 gene locus_tag LOCUS_33420 gene rlmJ 12562 11717 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_33420 13863 12616 gene locus_tag LOCUS_33430 13863 12616 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_33430 14100 14744 gene locus_tag LOCUS_33440 14100 14744 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968906.1 protein_id gnl|my_center|LOCUS_33440 15590 14763 gene locus_tag LOCUS_33450 15590 14763 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267692.1 protein_id gnl|my_center|LOCUS_33450 15722 16450 gene locus_tag LOCUS_33460 15722 16450 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 protein_id gnl|my_center|LOCUS_33460 16744 16484 gene locus_tag LOCUS_33470 16744 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 16858 18009 gene locus_tag LOCUS_33480 16858 18009 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_33480 18076 18621 gene locus_tag LOCUS_33490 18076 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 18683 21427 gene locus_tag LOCUS_33500 18683 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence084 347 1555 gene locus_tag LOCUS_33510 347 1555 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202275.1 protein_id gnl|my_center|LOCUS_33510 2300 1722 gene locus_tag LOCUS_33520 gene phaR 2300 1722 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_33520 3308 2565 gene locus_tag LOCUS_33530 3308 2565 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_33530 3496 3717 gene locus_tag LOCUS_33540 3496 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 4683 3868 gene locus_tag LOCUS_33550 gene pgeF 4683 3868 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_33550 5847 4738 gene locus_tag LOCUS_33560 5847 4738 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_33560 5867 6661 gene locus_tag LOCUS_33570 5867 6661 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937181.1 protein_id gnl|my_center|LOCUS_33570 9100 6683 gene locus_tag LOCUS_33580 9100 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 10440 9097 gene locus_tag LOCUS_33590 gene rmuC 10440 9097 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_33590 13842 10468 gene locus_tag LOCUS_33600 13842 10468 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931090.1 protein_id gnl|my_center|LOCUS_33600 13948 14349 gene locus_tag LOCUS_33610 13948 14349 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_33610 15356 14595 gene locus_tag LOCUS_33620 gene gloB 15356 14595 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 protein_id gnl|my_center|LOCUS_33620 15384 16106 gene locus_tag LOCUS_33630 15384 16106 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 protein_id gnl|my_center|LOCUS_33630 16099 16560 gene locus_tag LOCUS_33640 gene rnhA 16099 16560 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931354.1 protein_id gnl|my_center|LOCUS_33640 16585 17304 gene locus_tag LOCUS_33650 gene dnaQ 16585 17304 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_33650 17319 18581 gene locus_tag LOCUS_33660 17319 18581 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_33660 19066 18677 gene locus_tag LOCUS_33670 19066 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 19654 19370 gene locus_tag LOCUS_33680 19654 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 19905 21488 gene locus_tag LOCUS_33690 19905 21488 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence085 851 600 gene locus_tag LOCUS_33700 851 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1066 851 gene locus_tag LOCUS_33710 1066 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 2424 1219 gene locus_tag LOCUS_33720 2424 1219 CDS product zonular occludens toxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689773.1 protein_id gnl|my_center|LOCUS_33720 2708 2421 gene locus_tag LOCUS_33730 2708 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 4053 2701 gene locus_tag LOCUS_33740 4053 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 4411 4124 gene locus_tag LOCUS_33750 4411 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 4746 4408 gene locus_tag LOCUS_33760 4746 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 5062 4802 gene locus_tag LOCUS_33770 5062 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 6032 5073 gene locus_tag LOCUS_33780 6032 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 6641 6363 gene locus_tag LOCUS_33790 6641 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 6811 7203 gene locus_tag LOCUS_33800 6811 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 7191 7604 gene locus_tag LOCUS_33810 7191 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 7982 7674 gene locus_tag LOCUS_33820 7982 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 8835 7966 gene locus_tag LOCUS_33830 8835 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 9757 8948 gene locus_tag LOCUS_33840 9757 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 10562 9762 gene locus_tag LOCUS_33850 10562 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 11269 10565 gene locus_tag LOCUS_33860 11269 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 11822 11280 gene locus_tag LOCUS_33870 11822 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 11993 11826 gene locus_tag LOCUS_33880 11993 11826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 12250 11990 gene locus_tag LOCUS_33890 12250 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 12772 12257 gene locus_tag LOCUS_33900 12772 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 13026 12847 gene locus_tag LOCUS_33910 13026 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 14696 13077 gene locus_tag LOCUS_33920 14696 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 14953 14693 gene locus_tag LOCUS_33930 14953 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 15177 14950 gene locus_tag LOCUS_33940 15177 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 15791 15174 gene locus_tag LOCUS_33950 15791 15174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 17974 15995 gene locus_tag LOCUS_33960 17974 15995 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_33960 18401 17991 gene locus_tag LOCUS_33970 18401 17991 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_33970 20258 18465 gene locus_tag LOCUS_33980 20258 18465 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_33980 21196 20315 gene locus_tag LOCUS_33990 21196 20315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence086 516 178 gene locus_tag LOCUS_34000 516 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1181 513 gene locus_tag LOCUS_34010 1181 513 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108306299.1 protein_id gnl|my_center|LOCUS_34010 2847 1561 gene locus_tag LOCUS_34020 2847 1561 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 protein_id gnl|my_center|LOCUS_34020 3195 4859 gene locus_tag LOCUS_34030 3195 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 4856 5272 gene locus_tag LOCUS_34040 4856 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 5586 5308 gene locus_tag LOCUS_34050 5586 5308 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_34050 6525 6079 gene locus_tag LOCUS_34060 6525 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 7100 6522 gene locus_tag LOCUS_34070 7100 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 7332 8177 gene locus_tag LOCUS_34080 7332 8177 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064743.1 protein_id gnl|my_center|LOCUS_34080 8188 9558 gene locus_tag LOCUS_34090 8188 9558 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_34090 10086 9904 gene locus_tag LOCUS_34100 10086 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 10367 10059 gene locus_tag LOCUS_34110 10367 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 10761 10339 gene locus_tag LOCUS_34120 10761 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 13823 10758 gene locus_tag LOCUS_34130 13823 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 14791 13820 gene locus_tag LOCUS_34140 14791 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 15170 16507 gene locus_tag LOCUS_34150 15170 16507 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_34150 17032 16802 gene locus_tag LOCUS_34160 17032 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 17615 17208 gene locus_tag LOCUS_34170 17615 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 17887 17612 gene locus_tag LOCUS_34180 17887 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 18721 19872 gene locus_tag LOCUS_34190 18721 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence087 522 253 gene locus_tag LOCUS_34200 522 253 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_34200 2631 595 gene locus_tag LOCUS_34210 2631 595 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_34210 3357 2644 gene locus_tag LOCUS_34220 3357 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 5270 3360 gene locus_tag LOCUS_34230 5270 3360 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 protein_id gnl|my_center|LOCUS_34230 7424 5460 gene locus_tag LOCUS_34240 gene acs 7424 5460 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_34240 7634 8233 gene locus_tag LOCUS_34250 7634 8233 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 protein_id gnl|my_center|LOCUS_34250 8217 9815 gene locus_tag LOCUS_34260 8217 9815 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_34260 10008 10352 gene locus_tag LOCUS_34270 10008 10352 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704159.1 protein_id gnl|my_center|LOCUS_34270 10571 11356 gene locus_tag LOCUS_34280 gene murI 10571 11356 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_34280 11676 11957 gene locus_tag LOCUS_34290 11676 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 11954 13825 gene locus_tag LOCUS_34300 11954 13825 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_34300 13827 14093 gene locus_tag LOCUS_34310 13827 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 14438 15847 gene locus_tag LOCUS_34320 14438 15847 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920728.1 protein_id gnl|my_center|LOCUS_34320 16342 15962 gene locus_tag LOCUS_34330 16342 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 19683 16540 gene locus_tag LOCUS_34340 19683 16540 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_34340 <20481 19839 gene locus_tag LOCUS_34350 <20481 19839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003116286.1:multidrug efflux RND transporter periplasmic adaptor subunit MexC >Feature sequence088 <1 1414 gene locus_tag LOCUS_34360 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947070.1:flagellin 1503 1874 gene locus_tag LOCUS_34370 1503 1874 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073120.1 protein_id gnl|my_center|LOCUS_34370 1918 3345 gene locus_tag LOCUS_34380 gene fliD 1918 3345 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146832.1 protein_id gnl|my_center|LOCUS_34380 3346 3759 gene locus_tag LOCUS_34390 gene fliS 3346 3759 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_34390 3756 4091 gene locus_tag LOCUS_34400 3756 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 4148 5281 gene locus_tag LOCUS_34410 4148 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 5262 8210 gene locus_tag LOCUS_34420 5262 8210 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538617.1 protein_id gnl|my_center|LOCUS_34420 8248 8970 gene locus_tag LOCUS_34430 8248 8970 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_34430 8967 10073 gene locus_tag LOCUS_34440 8967 10073 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390555.1 protein_id gnl|my_center|LOCUS_34440 10078 11091 gene locus_tag LOCUS_34450 10078 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 11092 11883 gene locus_tag LOCUS_34460 11092 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 11899 12846 gene locus_tag LOCUS_34470 11899 12846 CDS product glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028148.1 protein_id gnl|my_center|LOCUS_34470 12871 13545 gene locus_tag LOCUS_34480 12871 13545 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_34480 13555 15108 gene locus_tag LOCUS_34490 13555 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 15847 15122 gene locus_tag LOCUS_34500 15847 15122 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_34500 16094 15855 gene locus_tag LOCUS_34510 16094 15855 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 protein_id gnl|my_center|LOCUS_34510 17228 16116 gene locus_tag LOCUS_34520 gene vioA 17228 16116 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 protein_id gnl|my_center|LOCUS_34520 17480 17809 gene locus_tag LOCUS_34530 17480 17809 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930342.1 protein_id gnl|my_center|LOCUS_34530 17929 18732 gene locus_tag LOCUS_34540 17929 18732 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197265.1 protein_id gnl|my_center|LOCUS_34540 19167 18799 gene locus_tag LOCUS_34550 gene frdD 19167 18799 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095272.1 protein_id gnl|my_center|LOCUS_34550 19562 19164 gene locus_tag LOCUS_34560 19562 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 20314 19559 gene locus_tag LOCUS_34570 20314 19559 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence089 501 1514 gene locus_tag LOCUS_34580 501 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 1551 3071 gene locus_tag LOCUS_34590 1551 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3082 4557 gene locus_tag LOCUS_34600 3082 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 4983 5585 gene locus_tag LOCUS_34610 4983 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 5585 7756 gene locus_tag LOCUS_34620 5585 7756 CDS product DUF802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205575.1 protein_id gnl|my_center|LOCUS_34620 7756 8400 gene locus_tag LOCUS_34630 7756 8400 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064407.1 protein_id gnl|my_center|LOCUS_34630 8393 9139 gene locus_tag LOCUS_34640 8393 9139 CDS product DUF2894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198086.1 protein_id gnl|my_center|LOCUS_34640 9616 9999 gene locus_tag LOCUS_34650 9616 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 10018 10425 gene locus_tag LOCUS_34660 10018 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 10719 11267 gene locus_tag LOCUS_34670 10719 11267 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350817.1 protein_id gnl|my_center|LOCUS_34670 11416 11571 gene locus_tag LOCUS_34680 11416 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 13180 11798 gene locus_tag LOCUS_34690 13180 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 14471 13158 gene locus_tag LOCUS_34700 14471 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 14484 14849 gene locus_tag LOCUS_34710 14484 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 15301 14816 gene locus_tag LOCUS_34720 15301 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 15745 15425 gene locus_tag LOCUS_34730 15745 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 15744 16070 gene locus_tag LOCUS_34740 15744 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 16282 16046 gene locus_tag LOCUS_34750 16282 16046 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_34750 17667 16672 gene locus_tag LOCUS_34760 17667 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 18143 18847 gene locus_tag LOCUS_34770 18143 18847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 19206 20063 gene locus_tag LOCUS_34780 19206 20063 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence090 131 1972 gene locus_tag LOCUS_34790 131 1972 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_34790 1972 4836 gene locus_tag LOCUS_34800 gene fdhF 1972 4836 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_34800 4826 5701 gene locus_tag LOCUS_34810 4826 5701 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 protein_id gnl|my_center|LOCUS_34810 5960 6793 gene locus_tag LOCUS_34820 5960 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929178.1 protein_id gnl|my_center|LOCUS_34820 7269 9242 gene locus_tag LOCUS_34830 7269 9242 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087534.1 protein_id gnl|my_center|LOCUS_34830 9242 10219 gene locus_tag LOCUS_34840 9242 10219 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_34840 10216 10989 gene locus_tag LOCUS_34850 10216 10989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_34850 10997 11890 gene locus_tag LOCUS_34860 10997 11890 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_34860 12467 12030 gene locus_tag LOCUS_34870 12467 12030 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_34870 12721 12467 gene locus_tag LOCUS_34880 12721 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 13652 12918 gene locus_tag LOCUS_34890 13652 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 14923 14228 gene locus_tag LOCUS_34900 14923 14228 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_34900 15459 14920 gene locus_tag LOCUS_34910 15459 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_34910 16835 15456 gene locus_tag LOCUS_34920 16835 15456 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_34920 18148 17003 gene locus_tag LOCUS_34930 18148 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 18751 18155 gene locus_tag LOCUS_34940 18751 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 19950 18748 gene locus_tag LOCUS_34950 19950 18748 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence091 571 305 gene locus_tag LOCUS_34960 571 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 3375 580 gene locus_tag LOCUS_34970 3375 580 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_34970 4253 3372 gene locus_tag LOCUS_34980 4253 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 4941 4435 gene locus_tag LOCUS_34990 4941 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 5921 4938 gene locus_tag LOCUS_35000 5921 4938 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947898.1 protein_id gnl|my_center|LOCUS_35000 6468 6112 gene locus_tag LOCUS_35010 6468 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 6585 7496 gene locus_tag LOCUS_35020 gene nhaR 6585 7496 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_35020 8076 7570 gene locus_tag LOCUS_35030 8076 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 9334 8096 gene locus_tag LOCUS_35040 9334 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 10891 9368 gene locus_tag LOCUS_35050 gene lysS 10891 9368 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 protein_id gnl|my_center|LOCUS_35050 12030 10981 gene locus_tag LOCUS_35060 gene prfB 12030 10981 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_35060 12205 12002 gene locus_tag LOCUS_35070 12205 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 12840 12172 gene locus_tag LOCUS_35080 12840 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 13763 12837 gene locus_tag LOCUS_35090 13763 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 14451 13774 gene locus_tag LOCUS_35100 14451 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 15577 14486 gene locus_tag LOCUS_35110 15577 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 15981 15574 gene locus_tag LOCUS_35120 15981 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 16238 16480 gene locus_tag LOCUS_35130 16238 16480 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_35130 16477 16887 gene locus_tag LOCUS_35140 16477 16887 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_35140 17260 16970 gene locus_tag LOCUS_35150 17260 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35150 17747 17253 gene locus_tag LOCUS_35160 17747 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35160 18559 17744 gene locus_tag LOCUS_35170 gene cbiQ 18559 17744 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_35170 19698 18649 gene locus_tag LOCUS_35180 19698 18649 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence092 81 1550 gene locus_tag LOCUS_35190 81 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 1938 1612 gene locus_tag LOCUS_35200 1938 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 2218 3135 gene locus_tag LOCUS_35210 2218 3135 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_35210 3184 4845 gene locus_tag LOCUS_35220 3184 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387941.1 protein_id gnl|my_center|LOCUS_35220 4945 7623 gene locus_tag LOCUS_35230 4945 7623 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_35230 7627 9168 gene locus_tag LOCUS_35240 7627 9168 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 protein_id gnl|my_center|LOCUS_35240 9724 10095 gene locus_tag LOCUS_35250 9724 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 11096 10767 gene locus_tag LOCUS_35260 11096 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 12561 11182 gene locus_tag LOCUS_35270 12561 11182 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268444.1 protein_id gnl|my_center|LOCUS_35270 13745 12567 gene locus_tag LOCUS_35280 13745 12567 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268445.1 protein_id gnl|my_center|LOCUS_35280 13851 15578 gene locus_tag LOCUS_35290 gene fliF 13851 15578 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_35290 15568 16566 gene locus_tag LOCUS_35300 gene fliG 15568 16566 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_35300 16579 17328 gene locus_tag LOCUS_35310 16579 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 17344 18777 gene locus_tag LOCUS_35320 gene fliI 17344 18777 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_35320 18822 19268 gene locus_tag LOCUS_35330 gene fliJ 18822 19268 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811846.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence093 741 268 gene locus_tag LOCUS_35340 741 268 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249558.1 protein_id gnl|my_center|LOCUS_35340 1313 891 gene locus_tag LOCUS_35350 1313 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 1922 1332 gene locus_tag LOCUS_35360 1922 1332 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_35360 2560 3816 gene locus_tag LOCUS_35370 2560 3816 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196258.1 protein_id gnl|my_center|LOCUS_35370 4233 4490 gene locus_tag LOCUS_35380 4233 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 4819 5628 gene locus_tag LOCUS_35390 4819 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 5696 6427 gene locus_tag LOCUS_35400 5696 6427 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_35400 6394 7908 gene locus_tag LOCUS_35410 6394 7908 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_35410 8363 7917 gene locus_tag LOCUS_35420 8363 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 9739 8357 gene locus_tag LOCUS_35430 9739 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 11365 9770 gene locus_tag LOCUS_35440 11365 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 11816 11532 gene locus_tag LOCUS_35450 11816 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 13712 12372 gene locus_tag LOCUS_35460 gene gdhA 13712 12372 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905419.1 protein_id gnl|my_center|LOCUS_35460 16470 13903 gene locus_tag LOCUS_35470 16470 13903 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_35470 17025 16675 gene locus_tag LOCUS_35480 17025 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 16961 17398 gene locus_tag LOCUS_35490 16961 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 18006 17707 gene locus_tag LOCUS_35500 18006 17707 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_35500 18259 17990 gene locus_tag LOCUS_35510 18259 17990 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812626.1 protein_id gnl|my_center|LOCUS_35510 18597 18334 gene locus_tag LOCUS_35520 18597 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 18844 18569 gene locus_tag LOCUS_35530 18844 18569 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence094 690 603 gene locus_tag LOCUS_t00340 690 603 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 926 1618 gene locus_tag LOCUS_35540 926 1618 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 protein_id gnl|my_center|LOCUS_35540 2541 1663 gene locus_tag LOCUS_35550 2541 1663 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539670.1 protein_id gnl|my_center|LOCUS_35550 2967 2596 gene locus_tag LOCUS_35560 2967 2596 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_35560 3116 4300 gene locus_tag LOCUS_35570 gene alaC 3116 4300 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_35570 4287 5543 gene locus_tag LOCUS_35580 4287 5543 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_35580 5612 6922 gene locus_tag LOCUS_35590 5612 6922 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_35590 7034 7909 gene locus_tag LOCUS_35600 7034 7909 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 protein_id gnl|my_center|LOCUS_35600 8059 9822 gene locus_tag LOCUS_35610 8059 9822 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_35610 9822 11324 gene locus_tag LOCUS_35620 9822 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 11404 12999 gene locus_tag LOCUS_35630 11404 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 13223 14479 gene locus_tag LOCUS_35640 13223 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35640 14555 15322 gene locus_tag LOCUS_35650 gene tpiA 14555 15322 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_35650 17098 15452 gene locus_tag LOCUS_35660 gene gpmI 17098 15452 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_35660 18151 17291 gene locus_tag LOCUS_35670 18151 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence095 211 702 gene locus_tag LOCUS_35680 211 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 596 3076 gene locus_tag LOCUS_35690 596 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 3421 3735 gene locus_tag LOCUS_35700 3421 3735 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_35700 3911 12823 gene locus_tag LOCUS_35710 3911 12823 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_35710 13191 13832 gene locus_tag LOCUS_35720 13191 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 14788 15399 gene locus_tag LOCUS_35730 14788 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 16334 15990 gene locus_tag LOCUS_35740 16334 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 17392 16622 gene locus_tag LOCUS_35750 gene istB 17392 16622 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_35750 <18926 17389 gene locus_tag LOCUS_35760 <18926 17389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917171.1:IS21 family transposase >Feature sequence096 468 1736 gene locus_tag LOCUS_35770 468 1736 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_35770 1738 2328 gene locus_tag LOCUS_35780 1738 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 2325 3071 gene locus_tag LOCUS_35790 2325 3071 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967226.1 protein_id gnl|my_center|LOCUS_35790 3064 4005 gene locus_tag LOCUS_35800 3064 4005 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_35800 4509 4988 gene locus_tag LOCUS_35810 4509 4988 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 protein_id gnl|my_center|LOCUS_35810 5389 5051 gene locus_tag LOCUS_35820 5389 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35820 5616 5867 gene locus_tag LOCUS_35830 5616 5867 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804328.1 protein_id gnl|my_center|LOCUS_35830 5864 6259 gene locus_tag LOCUS_35840 5864 6259 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036811.1 protein_id gnl|my_center|LOCUS_35840 6674 7309 gene locus_tag LOCUS_35850 6674 7309 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552112.1 protein_id gnl|my_center|LOCUS_35850 7335 9404 gene locus_tag LOCUS_35860 7335 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 9474 10913 gene locus_tag LOCUS_35870 9474 10913 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 protein_id gnl|my_center|LOCUS_35870 11906 11025 gene locus_tag LOCUS_35880 11906 11025 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104037.1 protein_id gnl|my_center|LOCUS_35880 14468 12276 gene locus_tag LOCUS_35890 14468 12276 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_35890 15474 14623 gene locus_tag LOCUS_35900 15474 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 16304 15513 gene locus_tag LOCUS_35910 16304 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 17435 16545 gene locus_tag LOCUS_35920 17435 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 17501 17824 gene locus_tag LOCUS_35930 17501 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence097 112 1095 gene locus_tag LOCUS_35940 112 1095 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_35940 1719 1222 gene locus_tag LOCUS_35950 1719 1222 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_35950 2039 1683 gene locus_tag LOCUS_35960 2039 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 2127 2984 gene locus_tag LOCUS_35970 2127 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 7119 3304 gene locus_tag LOCUS_35980 7119 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 7519 7193 gene locus_tag LOCUS_35990 7519 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 7879 8178 gene locus_tag LOCUS_36000 7879 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 9058 9888 gene locus_tag LOCUS_36010 9058 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 9885 12110 gene locus_tag LOCUS_36020 9885 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 13236 17990 gene locus_tag LOCUS_36030 13236 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence098 1409 453 gene locus_tag LOCUS_36040 1409 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 2256 1501 gene locus_tag LOCUS_36050 2256 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3640 2246 gene locus_tag LOCUS_36060 3640 2246 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478391.1 protein_id gnl|my_center|LOCUS_36060 3962 4828 gene locus_tag LOCUS_36070 3962 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 5982 5314 gene locus_tag LOCUS_36080 5982 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 6252 7358 gene locus_tag LOCUS_36090 6252 7358 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142183.1 protein_id gnl|my_center|LOCUS_36090 9379 7715 gene locus_tag LOCUS_36100 9379 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 10057 9647 gene locus_tag LOCUS_36110 10057 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 11415 10054 gene locus_tag LOCUS_36120 11415 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 11719 12057 gene locus_tag LOCUS_36130 11719 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 12786 11941 gene locus_tag LOCUS_36140 12786 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 13701 12940 gene locus_tag LOCUS_36150 13701 12940 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_36150 14858 13698 gene locus_tag LOCUS_36160 14858 13698 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_36160 16130 14904 gene locus_tag LOCUS_36170 16130 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 16963 16127 gene locus_tag LOCUS_36180 16963 16127 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257988.1 protein_id gnl|my_center|LOCUS_36180 18368 17121 gene locus_tag LOCUS_36190 18368 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 18801 18544 gene locus_tag LOCUS_36200 18801 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence099 2415 1690 gene locus_tag LOCUS_36210 2415 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2311 3639 gene locus_tag LOCUS_36220 2311 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 5010 3697 gene locus_tag LOCUS_36230 gene paaF 5010 3697 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064014.1 protein_id gnl|my_center|LOCUS_36230 5202 6536 gene locus_tag LOCUS_36240 5202 6536 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550337.1 protein_id gnl|my_center|LOCUS_36240 6552 8495 gene locus_tag LOCUS_36250 6552 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 10737 8587 gene locus_tag LOCUS_36260 10737 8587 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_36260 13118 10734 gene locus_tag LOCUS_36270 13118 10734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044858.1 protein_id gnl|my_center|LOCUS_36270 13672 13118 gene locus_tag LOCUS_36280 13672 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 15752 13683 gene locus_tag LOCUS_36290 15752 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 16020 16355 gene locus_tag LOCUS_36300 16020 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 16348 18315 gene locus_tag LOCUS_36310 16348 18315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044858.1 protein_id gnl|my_center|LOCUS_36310 >Feature sequence100 385 71 gene locus_tag LOCUS_36320 385 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 646 392 gene locus_tag LOCUS_36330 646 392 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_36330 953 654 gene locus_tag LOCUS_36340 953 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1215 958 gene locus_tag LOCUS_36350 1215 958 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_36350 2675 1218 gene locus_tag LOCUS_36360 2675 1218 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_36360 3168 2686 gene locus_tag LOCUS_36370 3168 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 5550 3187 gene locus_tag LOCUS_36380 5550 3187 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_36380 5878 6192 gene locus_tag LOCUS_36390 5878 6192 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_36390 6196 6480 gene locus_tag LOCUS_36400 6196 6480 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_36400 6724 6521 gene locus_tag LOCUS_36410 6724 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 10156 6782 gene locus_tag LOCUS_36420 10156 6782 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_36420 10814 10149 gene locus_tag LOCUS_36430 10814 10149 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36430 11516 12271 gene locus_tag LOCUS_36440 gene bluB 11516 12271 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_36440 12383 13411 gene locus_tag LOCUS_36450 gene cobD 12383 13411 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_36450 13398 13985 gene locus_tag LOCUS_36460 gene cobO 13398 13985 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_36460 14643 15455 gene locus_tag LOCUS_36470 14643 15455 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_36470 15975 15595 gene locus_tag LOCUS_36480 15975 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 16257 16694 gene locus_tag LOCUS_36490 16257 16694 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_36490 16691 17401 gene locus_tag LOCUS_36500 16691 17401 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_36500 17583 18074 gene locus_tag LOCUS_36510 17583 18074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 >Feature sequence101 336 848 gene locus_tag LOCUS_36520 336 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 845 1801 gene locus_tag LOCUS_36530 gene miaA 845 1801 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194103.1 protein_id gnl|my_center|LOCUS_36530 2608 1805 gene locus_tag LOCUS_36540 gene fetB 2608 1805 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_36540 3210 2605 gene locus_tag LOCUS_36550 3210 2605 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_36550 4557 3295 gene locus_tag LOCUS_36560 gene ppk2 4557 3295 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819675.1 protein_id gnl|my_center|LOCUS_36560 4855 6042 gene locus_tag LOCUS_36570 4855 6042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_36570 6134 9808 gene locus_tag LOCUS_36580 6134 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 11245 9920 gene locus_tag LOCUS_36590 11245 9920 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 protein_id gnl|my_center|LOCUS_36590 12787 11345 gene locus_tag LOCUS_36600 12787 11345 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084144.1 protein_id gnl|my_center|LOCUS_36600 13036 13698 gene locus_tag LOCUS_36610 13036 13698 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_36610 13695 14534 gene locus_tag LOCUS_36620 13695 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 14531 15070 gene locus_tag LOCUS_36630 14531 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 15348 15797 gene locus_tag LOCUS_36640 15348 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 16433 15915 gene locus_tag LOCUS_36650 16433 15915 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149585.1 protein_id gnl|my_center|LOCUS_36650 16432 16629 gene locus_tag LOCUS_36660 16432 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 16626 17795 gene locus_tag LOCUS_36670 16626 17795 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_36670 >Feature sequence102 138 1205 gene locus_tag LOCUS_36680 138 1205 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086271.1 protein_id gnl|my_center|LOCUS_36680 1378 1908 gene locus_tag LOCUS_36690 1378 1908 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_36690 1911 2213 gene locus_tag LOCUS_36700 1911 2213 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_36700 2210 2530 gene locus_tag LOCUS_36710 2210 2530 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928575.1 protein_id gnl|my_center|LOCUS_36710 2578 3375 gene locus_tag LOCUS_36720 2578 3375 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_36720 7452 3442 gene locus_tag LOCUS_36730 gene purL 7452 3442 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527208.1 protein_id gnl|my_center|LOCUS_36730 7707 9209 gene locus_tag LOCUS_36740 7707 9209 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_36740 9199 10089 gene locus_tag LOCUS_36750 9199 10089 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464003.1 protein_id gnl|my_center|LOCUS_36750 11114 10086 gene locus_tag LOCUS_36760 gene pfkB 11114 10086 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256696.1 protein_id gnl|my_center|LOCUS_36760 12403 11111 gene locus_tag LOCUS_36770 12403 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 13059 12400 gene locus_tag LOCUS_36780 13059 12400 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_36780 13220 14893 gene locus_tag LOCUS_36790 13220 14893 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 protein_id gnl|my_center|LOCUS_36790 15924 14953 gene locus_tag LOCUS_36800 15924 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 16100 16573 gene locus_tag LOCUS_36810 16100 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 16738 16595 gene locus_tag LOCUS_36820 16738 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 >Feature sequence103 1770 154 gene locus_tag LOCUS_36830 1770 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 3300 1924 gene locus_tag LOCUS_36840 gene cysS 3300 1924 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_36840 3428 4381 gene locus_tag LOCUS_36850 3428 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 4529 5098 gene locus_tag LOCUS_36860 4529 5098 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36860 5095 5586 gene locus_tag LOCUS_36870 5095 5586 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_36870 5622 6359 gene locus_tag LOCUS_36880 gene lpxH 5622 6359 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 protein_id gnl|my_center|LOCUS_36880 6472 8301 gene locus_tag LOCUS_36890 gene recQ 6472 8301 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_36890 9444 8419 gene locus_tag LOCUS_36900 gene mltB 9444 8419 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_36900 11408 9441 gene locus_tag LOCUS_36910 11408 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36910 12372 11398 gene locus_tag LOCUS_36920 12372 11398 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417868.1 protein_id gnl|my_center|LOCUS_36920 13298 12372 gene locus_tag LOCUS_36930 13298 12372 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_36930 13410 14336 gene locus_tag LOCUS_36940 13410 14336 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_36940 14517 15359 gene locus_tag LOCUS_36950 gene dapA 14517 15359 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_36950 15380 16522 gene locus_tag LOCUS_36960 gene bamC 15380 16522 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_36960 16519 17289 gene locus_tag LOCUS_36970 16519 17289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_36970 >Feature sequence104 <1 788 gene locus_tag LOCUS_36980 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003702540.1:ATP-dependent chaperone ClpB 785 1021 gene locus_tag LOCUS_36990 785 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 1121 1318 gene locus_tag LOCUS_37000 1121 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 4152 1462 gene locus_tag LOCUS_37010 4152 1462 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_37010 4799 4374 gene locus_tag LOCUS_37020 4799 4374 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_37020 4889 5395 gene locus_tag LOCUS_37030 4889 5395 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_37030 6448 5396 gene locus_tag LOCUS_37040 gene mnmH 6448 5396 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_37040 7097 6477 gene locus_tag LOCUS_37050 7097 6477 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009942000.1 protein_id gnl|my_center|LOCUS_37050 7114 7782 gene locus_tag LOCUS_37060 7114 7782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_37060 9058 7703 gene locus_tag LOCUS_37070 gene hpnE 9058 7703 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_37070 9909 9055 gene locus_tag LOCUS_37080 gene hpnD 9909 9055 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_37080 10160 10792 gene locus_tag LOCUS_37090 10160 10792 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_37090 10792 12105 gene locus_tag LOCUS_37100 10792 12105 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_37100 12128 12400 gene locus_tag LOCUS_37110 12128 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 12469 13998 gene locus_tag LOCUS_37120 12469 13998 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_37120 15374 13986 gene locus_tag LOCUS_37130 gene mgtE 15374 13986 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_37130 15717 17450 gene locus_tag LOCUS_37140 15717 17450 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence105 882 742 gene locus_tag LOCUS_37150 882 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 1919 1062 gene locus_tag LOCUS_37160 gene fghA 1919 1062 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 protein_id gnl|my_center|LOCUS_37160 3037 1925 gene locus_tag LOCUS_37170 3037 1925 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266984.1 protein_id gnl|my_center|LOCUS_37170 3598 3149 gene locus_tag LOCUS_37180 3598 3149 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 protein_id gnl|my_center|LOCUS_37180 3726 3640 gene locus_tag LOCUS_t00350 3726 3640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3872 3797 gene locus_tag LOCUS_t00360 3872 3797 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4632 4054 gene locus_tag LOCUS_37190 4632 4054 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204251.1 protein_id gnl|my_center|LOCUS_37190 4771 7029 gene locus_tag LOCUS_37200 4771 7029 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524775.1 protein_id gnl|my_center|LOCUS_37200 7272 8138 gene locus_tag LOCUS_37210 7272 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 8208 8810 gene locus_tag LOCUS_37220 8208 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 8948 9877 gene locus_tag LOCUS_37230 8948 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 10033 10866 gene locus_tag LOCUS_37240 10033 10866 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090722.1 protein_id gnl|my_center|LOCUS_37240 10894 13608 gene locus_tag LOCUS_37250 10894 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 14336 13701 gene locus_tag LOCUS_37260 14336 13701 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970934.1 protein_id gnl|my_center|LOCUS_37260 15466 14333 gene locus_tag LOCUS_37270 15466 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533560.1 protein_id gnl|my_center|LOCUS_37270 >Feature sequence106 2634 2559 gene locus_tag LOCUS_t00370 2634 2559 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2719 2643 gene locus_tag LOCUS_t00380 2719 2643 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2877 2801 gene locus_tag LOCUS_t00390 2877 2801 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3137 4243 gene locus_tag LOCUS_37280 3137 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031363.1 protein_id gnl|my_center|LOCUS_37280 4699 4310 gene locus_tag LOCUS_37290 4699 4310 CDS product DUF2237 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_37290 4890 4696 gene locus_tag LOCUS_37300 gene iscX 4890 4696 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_37300 5228 4887 gene locus_tag LOCUS_37310 gene fdx 5228 4887 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_37310 7126 5225 gene locus_tag LOCUS_37320 gene hscA 7126 5225 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193590.1 protein_id gnl|my_center|LOCUS_37320 7712 7185 gene locus_tag LOCUS_37330 gene hscB 7712 7185 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_37330 8125 7802 gene locus_tag LOCUS_37340 gene iscA 8125 7802 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_37340 8550 8161 gene locus_tag LOCUS_37350 gene iscU 8550 8161 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_37350 9785 8574 gene locus_tag LOCUS_37360 9785 8574 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 protein_id gnl|my_center|LOCUS_37360 11028 9871 gene locus_tag LOCUS_37370 11028 9871 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 protein_id gnl|my_center|LOCUS_37370 11534 11043 gene locus_tag LOCUS_37380 gene iscR 11534 11043 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_37380 12344 11592 gene locus_tag LOCUS_37390 gene cysE 12344 11592 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_37390 13212 12409 gene locus_tag LOCUS_37400 gene trmJ 13212 12409 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_37400 13279 14088 gene locus_tag LOCUS_37410 13279 14088 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_37410 14619 14155 gene locus_tag LOCUS_37420 14619 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 16473 14848 gene locus_tag LOCUS_37430 16473 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 >Feature sequence107 239 697 gene locus_tag LOCUS_37440 239 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 2084 762 gene locus_tag LOCUS_37450 gene rimO 2084 762 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 protein_id gnl|my_center|LOCUS_37450 3665 2187 gene locus_tag LOCUS_37460 gene fumC 3665 2187 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083118.1 protein_id gnl|my_center|LOCUS_37460 3788 6565 gene locus_tag LOCUS_37470 3788 6565 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_37470 6814 6620 gene locus_tag LOCUS_37480 6814 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 6917 7933 gene locus_tag LOCUS_37490 6917 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 7930 10083 gene locus_tag LOCUS_37500 7930 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 11635 10124 gene locus_tag LOCUS_37510 11635 10124 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063702.1 protein_id gnl|my_center|LOCUS_37510 12079 11657 gene locus_tag LOCUS_37520 12079 11657 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309941.1 protein_id gnl|my_center|LOCUS_37520 12701 12180 gene locus_tag LOCUS_37530 12701 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 12585 13124 gene locus_tag LOCUS_37540 12585 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 13221 14189 gene locus_tag LOCUS_37550 13221 14189 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_37550 14259 15062 gene locus_tag LOCUS_37560 14259 15062 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061364.1 protein_id gnl|my_center|LOCUS_37560 15342 15560 gene locus_tag LOCUS_37570 15342 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 16702 15599 gene locus_tag LOCUS_37580 16702 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence108 358 837 gene locus_tag LOCUS_37590 gene tssJ 358 837 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525302.1 protein_id gnl|my_center|LOCUS_37590 895 2232 gene locus_tag LOCUS_37600 gene tssK 895 2232 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808316.1 protein_id gnl|my_center|LOCUS_37600 2267 3634 gene locus_tag LOCUS_37610 2267 3634 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039003.1 protein_id gnl|my_center|LOCUS_37610 3631 7194 gene locus_tag LOCUS_37620 gene tssM 3631 7194 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925954.1 protein_id gnl|my_center|LOCUS_37620 7205 7936 gene locus_tag LOCUS_37630 gene tagF 7205 7936 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 protein_id gnl|my_center|LOCUS_37630 7938 9902 gene locus_tag LOCUS_37640 7938 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 10791 10018 gene locus_tag LOCUS_37650 10791 10018 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096185.1 protein_id gnl|my_center|LOCUS_37650 12539 10821 gene locus_tag LOCUS_37660 gene tagH 12539 10821 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705456.1 protein_id gnl|my_center|LOCUS_37660 12804 13382 gene locus_tag LOCUS_37670 12804 13382 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_37670 14791 13448 gene locus_tag LOCUS_37680 14791 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 15703 14828 gene locus_tag LOCUS_37690 15703 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 <16911 15839 gene locus_tag LOCUS_37700 <16911 15839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152757444.1:pseudouridine synthase >Feature sequence109 2060 2767 gene locus_tag LOCUS_37710 2060 2767 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565042.1 protein_id gnl|my_center|LOCUS_37710 2838 3458 gene locus_tag LOCUS_37720 2838 3458 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 protein_id gnl|my_center|LOCUS_37720 3549 4400 gene locus_tag LOCUS_37730 3549 4400 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_37730 4471 5019 gene locus_tag LOCUS_37740 gene ppa 4471 5019 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930982.1 protein_id gnl|my_center|LOCUS_37740 5085 6695 gene locus_tag LOCUS_37750 5085 6695 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_37750 6757 7095 gene locus_tag LOCUS_37760 6757 7095 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_37760 7752 7183 gene locus_tag LOCUS_37770 7752 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37770 8786 7821 gene locus_tag LOCUS_37780 gene trxB 8786 7821 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_37780 8950 9657 gene locus_tag LOCUS_37790 8950 9657 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_37790 9681 12212 gene locus_tag LOCUS_37800 9681 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 12209 12829 gene locus_tag LOCUS_37810 gene lolA 12209 12829 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_37810 12917 12993 gene locus_tag LOCUS_t00400 12917 12993 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13303 13731 gene locus_tag LOCUS_37820 gene dksA 13303 13731 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807164.1 protein_id gnl|my_center|LOCUS_37820 13767 14723 gene locus_tag LOCUS_37830 13767 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 14857 14933 gene locus_tag LOCUS_t00410 14857 14933 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 1177 1947 gene locus_tag LOCUS_37840 1177 1947 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_37840 2017 2859 gene locus_tag LOCUS_37850 2017 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3069 3518 gene locus_tag LOCUS_37860 3069 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 6175 3893 gene locus_tag LOCUS_37870 6175 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 6636 6860 gene locus_tag LOCUS_37880 6636 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 6857 7264 gene locus_tag LOCUS_37890 6857 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 8450 7359 gene locus_tag LOCUS_37900 8450 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 9566 8598 gene locus_tag LOCUS_37910 9566 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 9842 12043 gene locus_tag LOCUS_37920 9842 12043 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114901.1 protein_id gnl|my_center|LOCUS_37920 12081 13580 gene locus_tag LOCUS_37930 12081 13580 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 protein_id gnl|my_center|LOCUS_37930 14219 14941 gene locus_tag LOCUS_37940 14219 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 14945 15361 gene locus_tag LOCUS_37950 14945 15361 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812950.1 protein_id gnl|my_center|LOCUS_37950 15445 15654 gene locus_tag LOCUS_37960 15445 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 >Feature sequence111 <1 1706 gene locus_tag LOCUS_37970 <1 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267157.1:FimV/HubP family polar landmark protein 1788 2384 gene locus_tag LOCUS_37980 1788 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 2388 3212 gene locus_tag LOCUS_37990 gene truA 2388 3212 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216995.1 protein_id gnl|my_center|LOCUS_37990 3209 3856 gene locus_tag LOCUS_38000 3209 3856 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_38000 4009 5214 gene locus_tag LOCUS_38010 gene trpB 4009 5214 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_38010 5216 6037 gene locus_tag LOCUS_38020 gene trpA 5216 6037 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_38020 6037 6918 gene locus_tag LOCUS_38030 gene accD 6037 6918 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_38030 6920 8254 gene locus_tag LOCUS_38040 gene folC 6920 8254 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_38040 8282 9202 gene locus_tag LOCUS_38050 8282 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 9199 9687 gene locus_tag LOCUS_38060 9199 9687 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_38060 9697 11223 gene locus_tag LOCUS_38070 gene purF 9697 11223 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 protein_id gnl|my_center|LOCUS_38070 11229 12410 gene locus_tag LOCUS_38080 11229 12410 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_38080 12712 12407 gene locus_tag LOCUS_38090 12712 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 13675 12758 gene locus_tag LOCUS_38100 13675 12758 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_38100 14535 13672 gene locus_tag LOCUS_38110 14535 13672 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 protein_id gnl|my_center|LOCUS_38110 14843 15811 gene locus_tag LOCUS_38120 14843 15811 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence112 166 1647 gene locus_tag LOCUS_38130 166 1647 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929121.1 protein_id gnl|my_center|LOCUS_38130 2322 1621 gene locus_tag LOCUS_38140 2322 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 2263 2427 gene locus_tag LOCUS_38150 2263 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 2829 2545 gene locus_tag LOCUS_38160 2829 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 4035 3001 gene locus_tag LOCUS_38170 4035 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 5630 4377 gene locus_tag LOCUS_38180 gene glcF 5630 4377 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 protein_id gnl|my_center|LOCUS_38180 6711 5644 gene locus_tag LOCUS_38190 gene glcE 6711 5644 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_38190 8183 6711 gene locus_tag LOCUS_38200 8183 6711 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538734.1 protein_id gnl|my_center|LOCUS_38200 9017 8280 gene locus_tag LOCUS_38210 9017 8280 CDS product ParB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102671.1 protein_id gnl|my_center|LOCUS_38210 9218 10690 gene locus_tag LOCUS_38220 9218 10690 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038176.1 protein_id gnl|my_center|LOCUS_38220 11151 10687 gene locus_tag LOCUS_38230 11151 10687 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023219.1 protein_id gnl|my_center|LOCUS_38230 11771 11226 gene locus_tag LOCUS_38240 gene cobU 11771 11226 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_38240 11841 12875 gene locus_tag LOCUS_38250 gene cobT 11841 12875 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_38250 14228 12975 gene locus_tag LOCUS_38260 14228 12975 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_38260 14561 14355 gene locus_tag LOCUS_38270 14561 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 15071 15406 gene locus_tag LOCUS_38280 15071 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 >Feature sequence113 718 2658 gene locus_tag LOCUS_38290 718 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 2896 3276 gene locus_tag LOCUS_38300 2896 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 3346 4470 gene locus_tag LOCUS_38310 gene rffA 3346 4470 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_38310 4821 6467 gene locus_tag LOCUS_38320 4821 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 6464 6820 gene locus_tag LOCUS_38330 6464 6820 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259618.1 protein_id gnl|my_center|LOCUS_38330 6810 7844 gene locus_tag LOCUS_38340 6810 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 8477 8022 gene locus_tag LOCUS_38350 8477 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 8437 9216 gene locus_tag LOCUS_38360 8437 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 9367 9443 gene locus_tag LOCUS_t00420 9367 9443 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9772 10665 gene locus_tag LOCUS_38370 gene rfbD 9772 10665 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112614.1 protein_id gnl|my_center|LOCUS_38370 10705 11253 gene locus_tag LOCUS_38380 gene rfbC 10705 11253 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_38380 11426 12112 gene locus_tag LOCUS_38390 11426 12112 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_38390 12161 13639 gene locus_tag LOCUS_38400 12161 13639 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 protein_id gnl|my_center|LOCUS_38400 13746 15134 gene locus_tag LOCUS_38410 gene dacB 13746 15134 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_38410 15317 15141 gene locus_tag LOCUS_38420 15317 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence114 550 2538 gene locus_tag LOCUS_38430 550 2538 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_38430 2535 3785 gene locus_tag LOCUS_38440 2535 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 3862 4950 gene locus_tag LOCUS_38450 3862 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127329.1 protein_id gnl|my_center|LOCUS_38450 4947 5456 gene locus_tag LOCUS_38460 4947 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 5453 7303 gene locus_tag LOCUS_38470 5453 7303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214431.1 protein_id gnl|my_center|LOCUS_38470 7300 7686 gene locus_tag LOCUS_38480 7300 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 7683 8723 gene locus_tag LOCUS_38490 7683 8723 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_38490 8720 12274 gene locus_tag LOCUS_38500 8720 12274 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_38500 12458 13609 gene locus_tag LOCUS_38510 12458 13609 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933903.1 protein_id gnl|my_center|LOCUS_38510 13606 14109 gene locus_tag LOCUS_38520 13606 14109 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933904.1 protein_id gnl|my_center|LOCUS_38520 14106 14339 gene locus_tag LOCUS_38530 14106 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 14339 15340 gene locus_tag LOCUS_38540 gene rhuM 14339 15340 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_38540 >Feature sequence115 <1 1037 gene locus_tag LOCUS_38550 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205154.1:dihydrolipoyllysine-residue acetyltransferase note possible pseudo, frameshifted 1052 2788 gene locus_tag LOCUS_38560 gene lpdA 1052 2788 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_38560 3106 3852 gene locus_tag LOCUS_38570 3106 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4932 4216 gene locus_tag LOCUS_38580 4932 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 5087 5425 gene locus_tag LOCUS_38590 5087 5425 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_38590 5444 5794 gene locus_tag LOCUS_38600 5444 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 5974 8667 gene locus_tag LOCUS_38610 5974 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 8937 11741 gene locus_tag LOCUS_38620 8937 11741 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_38620 11738 12961 gene locus_tag LOCUS_38630 11738 12961 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022106.1 protein_id gnl|my_center|LOCUS_38630 13099 14982 gene locus_tag LOCUS_38640 13099 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence116 495 10 gene locus_tag LOCUS_38650 495 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 1485 550 gene locus_tag LOCUS_38660 1485 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 1758 1498 gene locus_tag LOCUS_38670 1758 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 2881 1832 gene locus_tag LOCUS_38680 2881 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 5829 2890 gene locus_tag LOCUS_38690 5829 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 6806 5829 gene locus_tag LOCUS_38700 6806 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 8227 6812 gene locus_tag LOCUS_38710 8227 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 8508 10058 gene locus_tag LOCUS_38720 8508 10058 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_38720 10404 10159 gene locus_tag LOCUS_38730 10404 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 11236 10421 gene locus_tag LOCUS_38740 11236 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 11812 11384 gene locus_tag LOCUS_38750 11812 11384 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_38750 12060 11812 gene locus_tag LOCUS_38760 12060 11812 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417286.1 protein_id gnl|my_center|LOCUS_38760 12136 13221 gene locus_tag LOCUS_38770 12136 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 13178 15007 gene locus_tag LOCUS_38780 13178 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 15023 15169 gene locus_tag LOCUS_38790 15023 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence117 2564 1425 gene locus_tag LOCUS_38800 gene bamB 2564 1425 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_38800 3247 2564 gene locus_tag LOCUS_38810 3247 2564 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_38810 4545 3247 gene locus_tag LOCUS_38820 gene hisS 4545 3247 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_38820 5786 4542 gene locus_tag LOCUS_38830 gene ispG 5786 4542 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_38830 6729 5812 gene locus_tag LOCUS_38840 6729 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 7526 6726 gene locus_tag LOCUS_38850 gene pilW 7526 6726 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_38850 8638 7523 gene locus_tag LOCUS_38860 gene rlmN 8638 7523 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688948.1 protein_id gnl|my_center|LOCUS_38860 9095 8667 gene locus_tag LOCUS_38870 gene ndk 9095 8667 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_38870 9196 9486 gene locus_tag LOCUS_38880 9196 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 10718 9435 gene locus_tag LOCUS_38890 10718 9435 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_38890 11413 10715 gene locus_tag LOCUS_38900 11413 10715 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391424.1 protein_id gnl|my_center|LOCUS_38900 12510 11497 gene locus_tag LOCUS_38910 12510 11497 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_38910 12692 14683 gene locus_tag LOCUS_38920 12692 14683 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_38920 14680 15216 gene locus_tag LOCUS_38930 14680 15216 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence118 1468 545 gene locus_tag LOCUS_38940 gene ispH 1468 545 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_38940 1934 1479 gene locus_tag LOCUS_38950 1934 1479 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_38950 2481 1987 gene locus_tag LOCUS_38960 gene lspA 2481 1987 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_38960 5296 2468 gene locus_tag LOCUS_38970 gene ileS 5296 2468 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812558.1 protein_id gnl|my_center|LOCUS_38970 6228 5305 gene locus_tag LOCUS_38980 6228 5305 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_38980 6323 8779 gene locus_tag LOCUS_38990 6323 8779 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_38990 8785 8994 gene locus_tag LOCUS_39000 gene ccoS 8785 8994 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688317.1 protein_id gnl|my_center|LOCUS_39000 9285 10712 gene locus_tag LOCUS_39010 gene ccoN 9285 10712 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_39010 10726 11340 gene locus_tag LOCUS_39020 gene ccoO 10726 11340 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_39020 11345 11539 gene locus_tag LOCUS_39030 11345 11539 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351115.1 protein_id gnl|my_center|LOCUS_39030 11536 12441 gene locus_tag LOCUS_39040 gene ccoP 11536 12441 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_39040 12731 14146 gene locus_tag LOCUS_39050 gene ccoG 12731 14146 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_39050 14143 14682 gene locus_tag LOCUS_39060 14143 14682 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706148.1 protein_id gnl|my_center|LOCUS_39060 14698 14838 gene locus_tag LOCUS_39070 14698 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 >Feature sequence119 1017 91 gene locus_tag LOCUS_39080 1017 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 1280 2296 gene locus_tag LOCUS_39090 1280 2296 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_39090 2742 3533 gene locus_tag LOCUS_39100 2742 3533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_39100 3530 4411 gene locus_tag LOCUS_39110 3530 4411 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_39110 4431 5366 gene locus_tag LOCUS_39120 4431 5366 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_39120 5634 6362 gene locus_tag LOCUS_39130 5634 6362 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029967.1 protein_id gnl|my_center|LOCUS_39130 6359 6679 gene locus_tag LOCUS_39140 6359 6679 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461993.1 protein_id gnl|my_center|LOCUS_39140 7541 6720 gene locus_tag LOCUS_39150 7541 6720 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_39150 8330 7578 gene locus_tag LOCUS_39160 8330 7578 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_39160 8718 9083 gene locus_tag LOCUS_39170 8718 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 9248 10252 gene locus_tag LOCUS_39180 9248 10252 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_39180 10344 11309 gene locus_tag LOCUS_39190 gene pstC 10344 11309 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_39190 11312 12262 gene locus_tag LOCUS_39200 gene pstA 11312 12262 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_39200 12294 13091 gene locus_tag LOCUS_39210 gene pstB 12294 13091 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_39210 14050 13088 gene locus_tag LOCUS_39220 14050 13088 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_39220 14841 14050 gene locus_tag LOCUS_39230 14841 14050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence120 2026 2925 gene locus_tag LOCUS_39240 gene carH 2026 2925 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_39240 3311 4621 gene locus_tag LOCUS_39250 3311 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 5773 4664 gene locus_tag LOCUS_39260 5773 4664 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_39260 5942 9208 gene locus_tag LOCUS_39270 5942 9208 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_39270 9368 11536 gene locus_tag LOCUS_39280 9368 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 11581 12882 gene locus_tag LOCUS_39290 11581 12882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942739.1 protein_id gnl|my_center|LOCUS_39290 13447 12917 gene locus_tag LOCUS_39300 13447 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 14527 13529 gene locus_tag LOCUS_39310 14527 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence121 <1 559 gene locus_tag LOCUS_39320 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040549.1:DUF3426 domain-containing protein 650 1585 gene locus_tag LOCUS_39330 650 1585 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_39330 2232 1717 gene locus_tag LOCUS_39340 2232 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 2325 3254 gene locus_tag LOCUS_39350 2325 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224628.1 protein_id gnl|my_center|LOCUS_39350 3376 4449 gene locus_tag LOCUS_39360 3376 4449 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_39360 4587 4988 gene locus_tag LOCUS_39370 4587 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 5453 5013 gene locus_tag LOCUS_39380 5453 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 6244 5669 gene locus_tag LOCUS_39390 6244 5669 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_39390 6499 6909 gene locus_tag LOCUS_39400 6499 6909 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 protein_id gnl|my_center|LOCUS_39400 7378 7019 gene locus_tag LOCUS_39410 7378 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 7966 7547 gene locus_tag LOCUS_39420 7966 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 8870 8229 gene locus_tag LOCUS_39430 8870 8229 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_39430 11318 8877 gene locus_tag LOCUS_39440 11318 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 9798 9708 gene locus_tag LOCUS_t00430 9798 9708 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 11767 11691 gene locus_tag LOCUS_t00440 11767 11691 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12161 13522 gene locus_tag LOCUS_39450 12161 13522 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_39450 >Feature sequence122 135 728 gene locus_tag LOCUS_39460 135 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 2295 1753 gene locus_tag LOCUS_39470 2295 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 2869 2321 gene locus_tag LOCUS_39480 2869 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 5235 3244 gene locus_tag LOCUS_39490 gene asnB 5235 3244 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268959.1 protein_id gnl|my_center|LOCUS_39490 6158 5241 gene locus_tag LOCUS_39500 gene fabD 6158 5241 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060542.1 protein_id gnl|my_center|LOCUS_39500 7203 6166 gene locus_tag LOCUS_39510 7203 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 7566 7240 gene locus_tag LOCUS_39520 7566 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 7596 7832 gene locus_tag LOCUS_39530 7596 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 7829 8236 gene locus_tag LOCUS_39540 7829 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 8623 10122 gene locus_tag LOCUS_39550 8623 10122 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071251.1 protein_id gnl|my_center|LOCUS_39550 10159 11343 gene locus_tag LOCUS_39560 10159 11343 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_39560 >Feature sequence123 1803 1060 gene locus_tag LOCUS_39570 1803 1060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_39570 2174 3583 gene locus_tag LOCUS_39580 gene leuC 2174 3583 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_39580 3585 4166 gene locus_tag LOCUS_39590 gene leuD 3585 4166 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_39590 4171 5730 gene locus_tag LOCUS_39600 gene cimA 4171 5730 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_39600 5798 6859 gene locus_tag LOCUS_39610 gene leuB 5798 6859 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_39610 7294 8460 gene locus_tag LOCUS_39620 7294 8460 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974302.1 protein_id gnl|my_center|LOCUS_39620 8457 8600 gene locus_tag LOCUS_39630 8457 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39630 9582 8713 gene locus_tag LOCUS_39640 9582 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39640 10270 9602 gene locus_tag LOCUS_39650 10270 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 11355 10609 gene locus_tag LOCUS_39660 11355 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 14314 11648 gene locus_tag LOCUS_39670 14314 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence124 1228 80 gene locus_tag LOCUS_39680 1228 80 CDS product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252603.1 protein_id gnl|my_center|LOCUS_39680 1310 2107 gene locus_tag LOCUS_39690 1310 2107 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811236.1 protein_id gnl|my_center|LOCUS_39690 2100 3635 gene locus_tag LOCUS_39700 2100 3635 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811237.1 protein_id gnl|my_center|LOCUS_39700 5006 3651 gene locus_tag LOCUS_39710 5006 3651 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447772.1 protein_id gnl|my_center|LOCUS_39710 12669 4990 gene locus_tag LOCUS_39720 12669 4990 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063855.1 protein_id gnl|my_center|LOCUS_39720 13364 12756 gene locus_tag LOCUS_39730 13364 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence125 2863 380 gene locus_tag LOCUS_39740 2863 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 3835 3242 gene locus_tag LOCUS_39750 3835 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 4294 3848 gene locus_tag LOCUS_39760 4294 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 4655 5296 gene locus_tag LOCUS_39770 4655 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 5567 5491 gene locus_tag LOCUS_t00450 5567 5491 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5686 6132 gene locus_tag LOCUS_39780 5686 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39780 6562 6236 gene locus_tag LOCUS_39790 6562 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 8705 6720 gene locus_tag LOCUS_39800 8705 6720 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195888.1 protein_id gnl|my_center|LOCUS_39800 10212 8821 gene locus_tag LOCUS_39810 10212 8821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706998.1 protein_id gnl|my_center|LOCUS_39810 10874 10212 gene locus_tag LOCUS_39820 10874 10212 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_39820 11531 10875 gene locus_tag LOCUS_39830 11531 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_39830 12339 11554 gene locus_tag LOCUS_39840 12339 11554 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_39840 12995 12330 gene locus_tag LOCUS_39850 12995 12330 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_39850 <13804 12982 gene locus_tag LOCUS_39860 <13804 12982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706993.1:AMP-dependent synthetase/ligase >Feature sequence126 2219 123 gene locus_tag LOCUS_39870 2219 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 3127 2216 gene locus_tag LOCUS_39880 3127 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4218 3127 gene locus_tag LOCUS_39890 4218 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 4477 4761 gene locus_tag LOCUS_39900 4477 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 4761 5120 gene locus_tag LOCUS_39910 4761 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 5126 6154 gene locus_tag LOCUS_39920 5126 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 6637 6380 gene locus_tag LOCUS_39930 6637 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 8501 6732 gene locus_tag LOCUS_39940 gene dnaK 8501 6732 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_39940 9199 8498 gene locus_tag LOCUS_39950 9199 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 9501 9211 gene locus_tag LOCUS_39960 9501 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 10906 9494 gene locus_tag LOCUS_39970 10906 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 11952 10867 gene locus_tag LOCUS_39980 11952 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 >Feature sequence127 <1 2725 gene locus_tag LOCUS_39990 <1 2725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615508.1:mechanosensitive ion channel 3349 2783 gene locus_tag LOCUS_40000 3349 2783 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_40000 3762 3370 gene locus_tag LOCUS_40010 3762 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 4239 3793 gene locus_tag LOCUS_40020 4239 3793 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_40020 4686 4249 gene locus_tag LOCUS_40030 4686 4249 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_40030 5012 4683 gene locus_tag LOCUS_40040 5012 4683 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 protein_id gnl|my_center|LOCUS_40040 5143 6009 gene locus_tag LOCUS_40050 5143 6009 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521366.1 protein_id gnl|my_center|LOCUS_40050 6023 6844 gene locus_tag LOCUS_40060 6023 6844 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266172.1 protein_id gnl|my_center|LOCUS_40060 7726 7208 gene locus_tag LOCUS_40070 7726 7208 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940018.1 protein_id gnl|my_center|LOCUS_40070 8060 9070 gene locus_tag LOCUS_40080 8060 9070 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_40080 9244 10080 gene locus_tag LOCUS_40090 gene cysT 9244 10080 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 protein_id gnl|my_center|LOCUS_40090 10082 10981 gene locus_tag LOCUS_40100 gene cysW 10082 10981 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_40100 10978 12045 gene locus_tag LOCUS_40110 10978 12045 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821532.1 protein_id gnl|my_center|LOCUS_40110 12055 12990 gene locus_tag LOCUS_40120 12055 12990 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_40120 >Feature sequence128 432 926 gene locus_tag LOCUS_40130 432 926 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_40130 1197 2561 gene locus_tag LOCUS_40140 gene chrA 1197 2561 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_40140 7202 2772 gene locus_tag LOCUS_40150 7202 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 8123 7389 gene locus_tag LOCUS_40160 8123 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 9172 8699 gene locus_tag LOCUS_40170 9172 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 9685 9221 gene locus_tag LOCUS_40180 9685 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 11861 9873 gene locus_tag LOCUS_40190 11861 9873 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_40190 12013 12783 gene locus_tag LOCUS_40200 gene yaaA 12013 12783 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186203.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence129 <1 2356 gene locus_tag LOCUS_40210 <1 2356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046464039.1:ATP-binding protein 2353 4728 gene locus_tag LOCUS_40220 2353 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 4844 5908 gene locus_tag LOCUS_40230 4844 5908 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_40230 5927 6718 gene locus_tag LOCUS_40240 5927 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 6953 10366 gene locus_tag LOCUS_40250 6953 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 10566 11624 gene locus_tag LOCUS_40260 10566 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 12198 11752 gene locus_tag LOCUS_40270 12198 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 12994 12380 gene locus_tag LOCUS_40280 12994 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence130 1752 2627 gene locus_tag LOCUS_40290 1752 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 3286 2777 gene locus_tag LOCUS_40300 3286 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 3818 4516 gene locus_tag LOCUS_40310 3818 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 4513 5007 gene locus_tag LOCUS_40320 gene gspG 4513 5007 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_40320 5026 6222 gene locus_tag LOCUS_40330 5026 6222 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_40330 6219 7922 gene locus_tag LOCUS_40340 6219 7922 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_40340 7903 8757 gene locus_tag LOCUS_40350 7903 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 8754 9344 gene locus_tag LOCUS_40360 8754 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 9341 9967 gene locus_tag LOCUS_40370 9341 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 9964 10530 gene locus_tag LOCUS_40380 9964 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 10530 13013 gene locus_tag LOCUS_40390 10530 13013 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_40390 >Feature sequence131 1697 414 gene locus_tag LOCUS_40400 gene eno 1697 414 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_40400 2019 1726 gene locus_tag LOCUS_40410 2019 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 2855 2016 gene locus_tag LOCUS_40420 gene kdsA 2855 2016 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_40420 4495 2852 gene locus_tag LOCUS_40430 4495 2852 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_40430 4740 5009 gene locus_tag LOCUS_40440 4740 5009 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_40440 5030 6085 gene locus_tag LOCUS_40450 gene dmeF 5030 6085 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704592.1 protein_id gnl|my_center|LOCUS_40450 7196 6387 gene locus_tag LOCUS_40460 7196 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 7931 7608 gene locus_tag LOCUS_40470 gene nirC 7931 7608 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084870.1 protein_id gnl|my_center|LOCUS_40470 7930 8253 gene locus_tag LOCUS_40480 7930 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 8368 8706 gene locus_tag LOCUS_40490 8368 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 8669 9805 gene locus_tag LOCUS_40500 8669 9805 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_40500 9798 10511 gene locus_tag LOCUS_40510 9798 10511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_40510 10508 11509 gene locus_tag LOCUS_40520 10508 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_40520 11506 11724 gene locus_tag LOCUS_40530 11506 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 11726 12010 gene locus_tag LOCUS_40540 11726 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 12007 12195 gene locus_tag LOCUS_40550 12007 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 12210 12575 gene locus_tag LOCUS_40560 12210 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 >Feature sequence132 1 159 gene locus_tag LOCUS_40570 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 563 1447 gene locus_tag LOCUS_40580 563 1447 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_40580 1460 2902 gene locus_tag LOCUS_40590 1460 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 3550 2894 gene locus_tag LOCUS_40600 3550 2894 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527196.1 protein_id gnl|my_center|LOCUS_40600 4329 3547 gene locus_tag LOCUS_40610 4329 3547 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_40610 4618 4340 gene locus_tag LOCUS_40620 4618 4340 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_40620 5928 4882 gene locus_tag LOCUS_40630 5928 4882 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_40630 6554 5922 gene locus_tag LOCUS_40640 gene tmk 6554 5922 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_40640 7552 6551 gene locus_tag LOCUS_40650 gene mltG 7552 6551 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_40650 7746 8777 gene locus_tag LOCUS_40660 7746 8777 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_40660 8790 9572 gene locus_tag LOCUS_40670 8790 9572 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_40670 10024 9542 gene locus_tag LOCUS_40680 10024 9542 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_40680 10499 9999 gene locus_tag LOCUS_40690 10499 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 11685 10567 gene locus_tag LOCUS_40700 11685 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 <12283 11669 gene locus_tag LOCUS_40710 <12283 11669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390848.1:HprK-related kinase A >Feature sequence133 281 499 gene locus_tag LOCUS_40720 281 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 1209 1928 gene locus_tag LOCUS_40730 1209 1928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390558.1 protein_id gnl|my_center|LOCUS_40730 3730 1970 gene locus_tag LOCUS_40740 gene sulP 3730 1970 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 protein_id gnl|my_center|LOCUS_40740 5494 3740 gene locus_tag LOCUS_40750 5494 3740 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_40750 5919 6620 gene locus_tag LOCUS_40760 5919 6620 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_40760 7614 6739 gene locus_tag LOCUS_40770 gene rpoH 7614 6739 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 protein_id gnl|my_center|LOCUS_40770 8197 7709 gene locus_tag LOCUS_40780 8197 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 8583 9023 gene locus_tag LOCUS_40790 8583 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 9375 9881 gene locus_tag LOCUS_40800 9375 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 9950 10624 gene locus_tag LOCUS_40810 9950 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 10740 10889 gene locus_tag LOCUS_40820 10740 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 11394 11882 gene locus_tag LOCUS_40830 11394 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 >Feature sequence134 5746 4901 gene locus_tag LOCUS_40840 5746 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 8444 6240 gene locus_tag LOCUS_40850 8444 6240 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836919.1 protein_id gnl|my_center|LOCUS_40850 9080 11104 gene locus_tag LOCUS_40860 9080 11104 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552478.1 protein_id gnl|my_center|LOCUS_40860 11110 11697 gene locus_tag LOCUS_40870 11110 11697 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524888.1 protein_id gnl|my_center|LOCUS_40870 >Feature sequence135 <1 1072 gene locus_tag LOCUS_40880 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530467.1:branched-chain amino acid ABC transporter ATP-binding protein/permease 1069 1827 gene locus_tag LOCUS_40890 1069 1827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040242.1 protein_id gnl|my_center|LOCUS_40890 2352 1885 gene locus_tag LOCUS_40900 2352 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 2481 3380 gene locus_tag LOCUS_40910 2481 3380 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_40910 5128 3407 gene locus_tag LOCUS_40920 5128 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 5336 6115 gene locus_tag LOCUS_40930 5336 6115 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_40930 6376 7239 gene locus_tag LOCUS_40940 6376 7239 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_40940 7257 7802 gene locus_tag LOCUS_40950 gene ruvC 7257 7802 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_40950 7816 8391 gene locus_tag LOCUS_40960 gene ruvA 7816 8391 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_40960 8399 9478 gene locus_tag LOCUS_40970 8399 9478 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 protein_id gnl|my_center|LOCUS_40970 9475 10542 gene locus_tag LOCUS_40980 gene ruvB 9475 10542 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_40980 10612 11055 gene locus_tag LOCUS_40990 gene ybgC 10612 11055 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 protein_id gnl|my_center|LOCUS_40990 >Feature sequence136 119 616 gene locus_tag LOCUS_41000 119 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 613 825 gene locus_tag LOCUS_41010 613 825 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_41010 2652 1264 gene locus_tag LOCUS_41020 gene pssA 2652 1264 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 protein_id gnl|my_center|LOCUS_41020 3025 2837 gene locus_tag LOCUS_41030 3025 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4552 3110 gene locus_tag LOCUS_41040 4552 3110 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930897.1 protein_id gnl|my_center|LOCUS_41040 5741 4584 gene locus_tag LOCUS_41050 gene prpC 5741 4584 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_41050 6397 5909 gene locus_tag LOCUS_41060 6397 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 6632 7150 gene locus_tag LOCUS_41070 6632 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 8156 7176 gene locus_tag LOCUS_41080 gene lipA 8156 7176 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_41080 8806 8153 gene locus_tag LOCUS_41090 gene lipB 8806 8153 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_41090 9072 8803 gene locus_tag LOCUS_41100 9072 8803 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_41100 10254 9121 gene locus_tag LOCUS_41110 10254 9121 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_41110 10338 11378 gene locus_tag LOCUS_41120 10338 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 >Feature sequence137 1332 2084 gene locus_tag LOCUS_41130 1332 2084 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_41130 2154 2849 gene locus_tag LOCUS_41140 2154 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 3075 3908 gene locus_tag LOCUS_41150 3075 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 3940 5127 gene locus_tag LOCUS_41160 3940 5127 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_41160 5227 6051 gene locus_tag LOCUS_41170 gene fabG 5227 6051 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_41170 6068 7213 gene locus_tag LOCUS_41180 6068 7213 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524568.1 protein_id gnl|my_center|LOCUS_41180 7304 10231 gene locus_tag LOCUS_41190 7304 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 10465 10899 gene locus_tag LOCUS_41200 10465 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 >Feature sequence138 410 144 gene locus_tag LOCUS_41210 410 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 851 1042 gene locus_tag LOCUS_41220 851 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 1270 2868 gene locus_tag LOCUS_41230 gene ubiB 1270 2868 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_41230 2861 3502 gene locus_tag LOCUS_41240 2861 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 3884 4012 gene locus_tag LOCUS_41250 3884 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4678 4115 gene locus_tag LOCUS_41260 4678 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 5472 5065 gene locus_tag LOCUS_41270 5472 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41270 8908 5774 gene locus_tag LOCUS_41280 8908 5774 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_41280 10578 8944 gene locus_tag LOCUS_41290 10578 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 >Feature sequence139 496 1926 gene locus_tag LOCUS_41300 496 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 1933 2802 gene locus_tag LOCUS_41310 gene epsG 1933 2802 CDS product chain length determinant protein tyrosine kinase EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106760242.1 protein_id gnl|my_center|LOCUS_41310 2918 3829 gene locus_tag LOCUS_41320 gene xrt 2918 3829 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_41320 3826 4512 gene locus_tag LOCUS_41330 3826 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4772 4509 gene locus_tag LOCUS_41340 4772 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 4683 5423 gene locus_tag LOCUS_41350 4683 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 5530 6879 gene locus_tag LOCUS_41360 5530 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 6977 8233 gene locus_tag LOCUS_41370 6977 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 8372 9703 gene locus_tag LOCUS_41380 8372 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 >Feature sequence140 1256 696 gene locus_tag LOCUS_41390 1256 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 1352 5821 gene locus_tag LOCUS_41400 1352 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 6326 5901 gene locus_tag LOCUS_41410 6326 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 6595 6323 gene locus_tag LOCUS_41420 6595 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 6962 8128 gene locus_tag LOCUS_41430 6962 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 9020 8145 gene locus_tag LOCUS_41440 9020 8145 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 protein_id gnl|my_center|LOCUS_41440 9867 9079 gene locus_tag LOCUS_41450 9867 9079 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 protein_id gnl|my_center|LOCUS_41450 10233 10829 gene locus_tag LOCUS_41460 10233 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 11280 10714 gene locus_tag LOCUS_41470 11280 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 >Feature sequence141 3098 4186 gene locus_tag LOCUS_41480 3098 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 4421 5425 gene locus_tag LOCUS_41490 4421 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 6689 5484 gene locus_tag LOCUS_41500 6689 5484 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_41500 8351 6690 gene locus_tag LOCUS_41510 8351 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 9305 8754 gene locus_tag LOCUS_41520 9305 8754 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146526238.1 protein_id gnl|my_center|LOCUS_41520 <11418 10497 gene locus_tag LOCUS_41530 <11418 10497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258633.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence142 1658 831 gene locus_tag LOCUS_41540 1658 831 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_41540 2862 1957 gene locus_tag LOCUS_41550 2862 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 3278 4090 gene locus_tag LOCUS_41560 3278 4090 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_41560 4596 5903 gene locus_tag LOCUS_41570 4596 5903 CDS product DUF4424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967721.1 protein_id gnl|my_center|LOCUS_41570 6135 5890 gene locus_tag LOCUS_41580 6135 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 6553 6173 gene locus_tag LOCUS_41590 6553 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 6887 7912 gene locus_tag LOCUS_41600 6887 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 8049 8393 gene locus_tag LOCUS_41610 8049 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 8390 9268 gene locus_tag LOCUS_41620 8390 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 9265 9744 gene locus_tag LOCUS_41630 9265 9744 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_41630 9741 10358 gene locus_tag LOCUS_41640 9741 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 10511 10924 gene locus_tag LOCUS_41650 10511 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 >Feature sequence143 1338 2513 gene locus_tag LOCUS_41660 1338 2513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039061.1 protein_id gnl|my_center|LOCUS_41660 2721 2554 gene locus_tag LOCUS_41670 2721 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 2808 3911 gene locus_tag LOCUS_41680 gene aroC 2808 3911 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_41680 3991 4242 gene locus_tag LOCUS_41690 3991 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 4290 5483 gene locus_tag LOCUS_41700 4290 5483 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_41700 5493 6338 gene locus_tag LOCUS_41710 5493 6338 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_41710 6445 7863 gene locus_tag LOCUS_41720 gene leuC 6445 7863 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_41720 8032 8694 gene locus_tag LOCUS_41730 gene leuD 8032 8694 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_41730 8695 9825 gene locus_tag LOCUS_41740 gene asd 8695 9825 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_41740 >Feature sequence144 202 609 gene locus_tag LOCUS_41750 gene tolR 202 609 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_41750 621 1595 gene locus_tag LOCUS_41760 621 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 1640 2563 gene locus_tag LOCUS_41770 1640 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 4206 2785 gene locus_tag LOCUS_41780 4206 2785 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_41780 6404 4203 gene locus_tag LOCUS_41790 6404 4203 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_41790 <11201 6511 gene locus_tag LOCUS_41800 <11201 6511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969687.1:calcium-binding protein >Feature sequence145 5889 862 gene locus_tag LOCUS_41810 5889 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 6387 7130 gene locus_tag LOCUS_41820 gene surE 6387 7130 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_41820 7127 7786 gene locus_tag LOCUS_41830 7127 7786 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928874.1 protein_id gnl|my_center|LOCUS_41830 7783 8820 gene locus_tag LOCUS_41840 7783 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 8820 9779 gene locus_tag LOCUS_41850 gene rpoS 8820 9779 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_41850 10347 9817 gene locus_tag LOCUS_41860 10347 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 <10926 10366 gene locus_tag LOCUS_41870 <10926 10366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550186.1:M3 family metallopeptidase >Feature sequence146 1430 828 gene locus_tag LOCUS_41880 1430 828 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_41880 3316 1565 gene locus_tag LOCUS_41890 3316 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 3964 3341 gene locus_tag LOCUS_41900 3964 3341 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_41900 4435 3965 gene locus_tag LOCUS_41910 gene rlmH 4435 3965 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_41910 4815 4432 gene locus_tag LOCUS_41920 4815 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 5527 4823 gene locus_tag LOCUS_41930 gene nadD 5527 4823 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_41930 6269 5490 gene locus_tag LOCUS_41940 6269 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 7020 6283 gene locus_tag LOCUS_41950 7020 6283 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529044.1 protein_id gnl|my_center|LOCUS_41950 8391 7105 gene locus_tag LOCUS_41960 8391 7105 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599076.1 protein_id gnl|my_center|LOCUS_41960 9382 8381 gene locus_tag LOCUS_41970 9382 8381 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_41970 9776 9435 gene locus_tag LOCUS_41980 9776 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 >Feature sequence147 251 526 gene locus_tag LOCUS_41990 251 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 685 1092 gene locus_tag LOCUS_42000 685 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 1089 1520 gene locus_tag LOCUS_42010 1089 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 3553 1970 gene locus_tag LOCUS_42020 3553 1970 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 protein_id gnl|my_center|LOCUS_42020 3912 3619 gene locus_tag LOCUS_42030 gene tnpB 3912 3619 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967845.1 protein_id gnl|my_center|LOCUS_42030 4289 3969 gene locus_tag LOCUS_42040 4289 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 5305 4469 gene locus_tag LOCUS_42050 5305 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 5677 6114 gene locus_tag LOCUS_42060 5677 6114 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_42060 6111 7457 gene locus_tag LOCUS_42070 6111 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 7454 7879 gene locus_tag LOCUS_42080 7454 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 8257 7949 gene locus_tag LOCUS_42090 8257 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 10445 8361 gene locus_tag LOCUS_42100 10445 8361 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173640842.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence148 4005 616 gene locus_tag LOCUS_42110 gene mfd 4005 616 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_42110 4952 4203 gene locus_tag LOCUS_42120 4952 4203 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258788.1 protein_id gnl|my_center|LOCUS_42120 5160 5819 gene locus_tag LOCUS_42130 5160 5819 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_42130 5889 7214 gene locus_tag LOCUS_42140 5889 7214 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_42140 7292 7966 gene locus_tag LOCUS_42150 7292 7966 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_42150 8086 8787 gene locus_tag LOCUS_42160 8086 8787 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_42160 8780 9436 gene locus_tag LOCUS_42170 gene gph 8780 9436 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_42170 9475 9849 gene locus_tag LOCUS_42180 9475 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 >Feature sequence149 3276 1852 gene locus_tag LOCUS_42190 3276 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 6589 3425 gene locus_tag LOCUS_42200 6589 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 8785 6644 gene locus_tag LOCUS_42210 8785 6644 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060825866.1 protein_id gnl|my_center|LOCUS_42210 9615 8923 gene locus_tag LOCUS_42220 gene urtE 9615 8923 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_42220 10464 9622 gene locus_tag LOCUS_42230 gene urtD 10464 9622 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence150 8604 25 gene locus_tag LOCUS_42240 8604 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 9267 8629 gene locus_tag LOCUS_42250 9267 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 9630 9941 gene locus_tag LOCUS_42260 9630 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 >Feature sequence151 <1 1202 gene locus_tag LOCUS_42270 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929886.1:potassium transporter TrkG 2475 1228 gene locus_tag LOCUS_42280 2475 1228 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_42280 3822 2476 gene locus_tag LOCUS_42290 3822 2476 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_42290 4490 5797 gene locus_tag LOCUS_42300 4490 5797 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_42300 7694 5898 gene locus_tag LOCUS_42310 7694 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 8357 7722 gene locus_tag LOCUS_42320 8357 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 8642 10204 gene locus_tag LOCUS_42330 8642 10204 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337783.1 protein_id gnl|my_center|LOCUS_42330 >Feature sequence152 3064 965 gene locus_tag LOCUS_42340 3064 965 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044977.1 protein_id gnl|my_center|LOCUS_42340 6434 3066 gene locus_tag LOCUS_42350 6434 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 7259 6489 gene locus_tag LOCUS_42360 7259 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 8911 7334 gene locus_tag LOCUS_42370 8911 7334 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_42370 9391 8930 gene locus_tag LOCUS_42380 9391 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 10004 9669 gene locus_tag LOCUS_42390 10004 9669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 >Feature sequence153 1548 424 gene locus_tag LOCUS_42400 gene queG 1548 424 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_42400 1543 2046 gene locus_tag LOCUS_42410 1543 2046 CDS product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065018.1 protein_id gnl|my_center|LOCUS_42410 2001 3383 gene locus_tag LOCUS_42420 2001 3383 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_42420 3514 3589 gene locus_tag LOCUS_t00460 3514 3589 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4110 3748 gene locus_tag LOCUS_42430 4110 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 4358 4107 gene locus_tag LOCUS_42440 4358 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 4694 4383 gene locus_tag LOCUS_42450 4694 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 5125 4691 gene locus_tag LOCUS_42460 5125 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 5427 5122 gene locus_tag LOCUS_42470 5427 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 5632 9582 gene locus_tag LOCUS_42480 5632 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204821.1 protein_id gnl|my_center|LOCUS_42480 >Feature sequence154 581 270 gene locus_tag LOCUS_42490 581 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42490 695 838 gene locus_tag LOCUS_42500 695 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 1149 4766 gene locus_tag LOCUS_42510 1149 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 6152 4989 gene locus_tag LOCUS_42520 6152 4989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_42520 7797 6568 gene locus_tag LOCUS_42530 7797 6568 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_42530 >Feature sequence155 3030 640 gene locus_tag LOCUS_42540 3030 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 5136 3217 gene locus_tag LOCUS_42550 5136 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 5300 6598 gene locus_tag LOCUS_42560 5300 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 6700 8073 gene locus_tag LOCUS_42570 6700 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 8073 9494 gene locus_tag LOCUS_42580 8073 9494 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_42580 >Feature sequence156 725 234 gene locus_tag LOCUS_42590 725 234 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_42590 2236 722 gene locus_tag LOCUS_42600 2236 722 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338647.1 protein_id gnl|my_center|LOCUS_42600 2562 2236 gene locus_tag LOCUS_42610 2562 2236 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115033.1 protein_id gnl|my_center|LOCUS_42610 5378 2562 gene locus_tag LOCUS_42620 5378 2562 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_42620 5747 6445 gene locus_tag LOCUS_42630 gene phoU 5747 6445 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_42630 6442 7167 gene locus_tag LOCUS_42640 gene phoB 6442 7167 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_42640 7164 8522 gene locus_tag LOCUS_42650 gene phoR 7164 8522 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_42650 >Feature sequence157 1862 705 gene locus_tag LOCUS_42660 1862 705 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_42660 2388 1891 gene locus_tag LOCUS_42670 gene purE 2388 1891 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_42670 3239 2388 gene locus_tag LOCUS_42680 gene folD 3239 2388 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_42680 3946 3311 gene locus_tag LOCUS_42690 3946 3311 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389730.1 protein_id gnl|my_center|LOCUS_42690 5871 4024 gene locus_tag LOCUS_42700 5871 4024 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389731.1 protein_id gnl|my_center|LOCUS_42700 6242 8935 gene locus_tag LOCUS_42710 gene aceE 6242 8935 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 protein_id gnl|my_center|LOCUS_42710 >Feature sequence158 77 256 gene locus_tag LOCUS_42720 77 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 523 2022 gene locus_tag LOCUS_42730 523 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 2028 2375 gene locus_tag LOCUS_42740 2028 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 2438 2833 gene locus_tag LOCUS_42750 2438 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 2848 3285 gene locus_tag LOCUS_42760 2848 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 3355 3702 gene locus_tag LOCUS_42770 3355 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 3952 3656 gene locus_tag LOCUS_42780 3952 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 3891 4661 gene locus_tag LOCUS_42790 3891 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 4708 6426 gene locus_tag LOCUS_42800 4708 6426 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_42800 6423 7340 gene locus_tag LOCUS_42810 6423 7340 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_42810 7337 8260 gene locus_tag LOCUS_42820 7337 8260 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_42820 9331 8729 gene locus_tag LOCUS_42830 9331 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 >Feature sequence159 2748 88 gene locus_tag LOCUS_42840 2748 88 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459048.1 protein_id gnl|my_center|LOCUS_42840 4719 2758 gene locus_tag LOCUS_42850 4719 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 5509 4799 gene locus_tag LOCUS_42860 5509 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 8680 5561 gene locus_tag LOCUS_42870 8680 5561 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 protein_id gnl|my_center|LOCUS_42870 9100 9342 gene locus_tag LOCUS_42880 9100 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 >Feature sequence160 436 3051 gene locus_tag LOCUS_42890 gene leuS 436 3051 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_42890 3071 3583 gene locus_tag LOCUS_42900 3071 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 3595 4599 gene locus_tag LOCUS_42910 gene holA 3595 4599 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_42910 4909 4649 gene locus_tag LOCUS_42920 4909 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 5057 6313 gene locus_tag LOCUS_42930 5057 6313 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_42930 6441 7013 gene locus_tag LOCUS_42940 6441 7013 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_42940 7019 7510 gene locus_tag LOCUS_42950 7019 7510 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189321.1 protein_id gnl|my_center|LOCUS_42950 7497 8411 gene locus_tag LOCUS_42960 gene xerD 7497 8411 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 protein_id gnl|my_center|LOCUS_42960 8999 8412 gene locus_tag LOCUS_42970 gene cobC 8999 8412 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 protein_id gnl|my_center|LOCUS_42970 <9829 8984 gene locus_tag LOCUS_42980 <9829 8984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191554.1:adenosylcobinamide-GDP ribazoletransferase >Feature sequence161 433 212 gene locus_tag LOCUS_42990 433 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 990 541 gene locus_tag LOCUS_43000 990 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 1463 999 gene locus_tag LOCUS_43010 1463 999 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_43010 3025 1463 gene locus_tag LOCUS_43020 3025 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 3488 3045 gene locus_tag LOCUS_43030 3488 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 5263 3506 gene locus_tag LOCUS_43040 5263 3506 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_43040 6128 5325 gene locus_tag LOCUS_43050 6128 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 6712 6125 gene locus_tag LOCUS_43060 6712 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 7987 7661 gene locus_tag LOCUS_43070 7987 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 9655 8228 gene locus_tag LOCUS_43080 9655 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 >Feature sequence162 <1 2696 gene locus_tag LOCUS_43090 <1 2696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein 3328 4104 gene locus_tag LOCUS_43100 3328 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 4298 4726 gene locus_tag LOCUS_43110 4298 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 5137 7749 gene locus_tag LOCUS_43120 5137 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 7769 8659 gene locus_tag LOCUS_43130 7769 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 >Feature sequence163 <1 716 gene locus_tag LOCUS_43140 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391173.1:DUF3422 domain-containing protein 3444 1033 gene locus_tag LOCUS_43150 3444 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 4265 3555 gene locus_tag LOCUS_43160 4265 3555 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083849.1 protein_id gnl|my_center|LOCUS_43160 4430 5365 gene locus_tag LOCUS_43170 4430 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 5662 6747 gene locus_tag LOCUS_43180 5662 6747 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_43180 6809 7585 gene locus_tag LOCUS_43190 6809 7585 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_43190 >Feature sequence164 131 286 gene locus_tag LOCUS_43200 131 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 1125 346 gene locus_tag LOCUS_43210 gene scpB 1125 346 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816217.1 protein_id gnl|my_center|LOCUS_43210 3062 1161 gene locus_tag LOCUS_43220 3062 1161 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_43220 4744 3317 gene locus_tag LOCUS_43230 gene tilS 4744 3317 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026262905.1 protein_id gnl|my_center|LOCUS_43230 5750 4782 gene locus_tag LOCUS_43240 5750 4782 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_43240 8162 5946 gene locus_tag LOCUS_43250 8162 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 >Feature sequence165 315 1316 gene locus_tag LOCUS_43260 315 1316 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087175.1 protein_id gnl|my_center|LOCUS_43260 1366 2223 gene locus_tag LOCUS_43270 gene cysT 1366 2223 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_43270 2220 3095 gene locus_tag LOCUS_43280 gene cysW 2220 3095 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_43280 3190 4260 gene locus_tag LOCUS_43290 3190 4260 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821532.1 protein_id gnl|my_center|LOCUS_43290 4362 4832 gene locus_tag LOCUS_43300 4362 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 4807 6018 gene locus_tag LOCUS_43310 4807 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_43310 6094 8952 gene locus_tag LOCUS_43320 6094 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 >Feature sequence166 241 945 gene locus_tag LOCUS_43330 241 945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_43330 951 2159 gene locus_tag LOCUS_43340 951 2159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_43340 2220 2741 gene locus_tag LOCUS_43350 2220 2741 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_43350 2902 3201 gene locus_tag LOCUS_43360 2902 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 3203 5731 gene locus_tag LOCUS_43370 gene napA 3203 5731 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_43370 5866 6855 gene locus_tag LOCUS_43380 5866 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 6852 7754 gene locus_tag LOCUS_43390 gene napH 6852 7754 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_43390 7842 8309 gene locus_tag LOCUS_43400 7842 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 8795 8397 gene locus_tag LOCUS_43410 8795 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence167 1400 423 gene locus_tag LOCUS_43420 1400 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 1720 1397 gene locus_tag LOCUS_43430 1720 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 2054 1743 gene locus_tag LOCUS_43440 2054 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4797 2098 gene locus_tag LOCUS_43450 4797 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 7103 4797 gene locus_tag LOCUS_43460 7103 4797 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941654.1 protein_id gnl|my_center|LOCUS_43460 7504 7103 gene locus_tag LOCUS_43470 7504 7103 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_43470 8625 7504 gene locus_tag LOCUS_43480 8625 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 >Feature sequence168 591 1187 gene locus_tag LOCUS_43490 591 1187 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_43490 1358 2182 gene locus_tag LOCUS_43500 1358 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 3023 2442 gene locus_tag LOCUS_43510 3023 2442 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_43510 4178 3204 gene locus_tag LOCUS_43520 4178 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 4698 4219 gene locus_tag LOCUS_43530 4698 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 5406 4771 gene locus_tag LOCUS_43540 5406 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 6016 5423 gene locus_tag LOCUS_43550 6016 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence169 967 599 gene locus_tag LOCUS_43560 967 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 1962 1006 gene locus_tag LOCUS_43570 1962 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461155.1 protein_id gnl|my_center|LOCUS_43570 2306 1959 gene locus_tag LOCUS_43580 2306 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 2678 3088 gene locus_tag LOCUS_43590 2678 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 2988 3347 gene locus_tag LOCUS_43600 2988 3347 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_43600 3605 3997 gene locus_tag LOCUS_43610 3605 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 4773 3898 gene locus_tag LOCUS_43620 gene phnC 4773 3898 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_43620 5666 4770 gene locus_tag LOCUS_43630 5666 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 6541 5663 gene locus_tag LOCUS_43640 gene phnD 6541 5663 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061597.1 protein_id gnl|my_center|LOCUS_43640 6959 6606 gene locus_tag LOCUS_43650 6959 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 6864 7607 gene locus_tag LOCUS_43660 6864 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161491309.1 protein_id gnl|my_center|LOCUS_43660 7630 8328 gene locus_tag LOCUS_43670 7630 8328 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522113.1 protein_id gnl|my_center|LOCUS_43670 >Feature sequence170 1334 1783 gene locus_tag LOCUS_43680 1334 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 2044 2742 gene locus_tag LOCUS_43690 2044 2742 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_43690 2904 3668 gene locus_tag LOCUS_43700 2904 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 3783 4337 gene locus_tag LOCUS_43710 3783 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 4362 4718 gene locus_tag LOCUS_43720 gene ychN 4362 4718 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 protein_id gnl|my_center|LOCUS_43720 4790 5989 gene locus_tag LOCUS_43730 4790 5989 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921970.1 protein_id gnl|my_center|LOCUS_43730 6187 6636 gene locus_tag LOCUS_43740 6187 6636 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_43740 7183 7545 gene locus_tag LOCUS_43750 7183 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 >Feature sequence171 856 104 gene locus_tag LOCUS_43760 856 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 5028 934 gene locus_tag LOCUS_43770 5028 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 5915 5025 gene locus_tag LOCUS_43780 5915 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 7298 6336 gene locus_tag LOCUS_43790 7298 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 7815 7189 gene locus_tag LOCUS_43800 7815 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 >Feature sequence172 5045 3387 gene locus_tag LOCUS_43810 5045 3387 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_43810 5527 6858 gene locus_tag LOCUS_43820 5527 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 7144 7716 gene locus_tag LOCUS_43830 7144 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 >Feature sequence173 234 1868 gene locus_tag LOCUS_43840 234 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 3799 2435 gene locus_tag LOCUS_43850 3799 2435 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895624.1 protein_id gnl|my_center|LOCUS_43850 5544 3796 gene locus_tag LOCUS_43860 5544 3796 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105550.1 protein_id gnl|my_center|LOCUS_43860 6192 5569 gene locus_tag LOCUS_43870 6192 5569 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_43870 7951 6293 gene locus_tag LOCUS_43880 7951 6293 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205437.1 protein_id gnl|my_center|LOCUS_43880 >Feature sequence174 1825 413 gene locus_tag LOCUS_43890 gene trbI 1825 413 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 protein_id gnl|my_center|LOCUS_43890 2293 1832 gene locus_tag LOCUS_43900 2293 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 3186 2296 gene locus_tag LOCUS_43910 gene trbG 3186 2296 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_43910 3973 3200 gene locus_tag LOCUS_43920 3973 3200 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_43920 6528 3970 gene locus_tag LOCUS_43930 6528 3970 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_43930 6836 6525 gene locus_tag LOCUS_43940 6836 6525 CDS product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970256.1 protein_id gnl|my_center|LOCUS_43940 7261 6839 gene locus_tag LOCUS_43950 7261 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 <8087 7275 gene locus_tag LOCUS_43960 <8087 7275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970254.1:P-type conjugative transfer ATPase TrbB >Feature sequence175 502 170 gene locus_tag LOCUS_43970 502 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 2080 527 gene locus_tag LOCUS_43980 2080 527 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_43980 2528 2442 gene locus_tag LOCUS_t00470 2528 2442 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2568 4796 gene locus_tag LOCUS_43990 gene rnr 2568 4796 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695198.1 protein_id gnl|my_center|LOCUS_43990 4799 5299 gene locus_tag LOCUS_44000 gene napF 4799 5299 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172332.1 protein_id gnl|my_center|LOCUS_44000 5435 7996 gene locus_tag LOCUS_44010 5435 7996 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_44010 >Feature sequence176 607 816 gene locus_tag LOCUS_44020 607 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 1106 1411 gene locus_tag LOCUS_44030 1106 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 2052 2450 gene locus_tag LOCUS_44040 2052 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 2947 4380 gene locus_tag LOCUS_44050 2947 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 4400 4879 gene locus_tag LOCUS_44060 4400 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 5351 7060 gene locus_tag LOCUS_44070 5351 7060 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_44070 7086 7967 gene locus_tag LOCUS_44080 7086 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 >Feature sequence177 345 1766 gene locus_tag LOCUS_44090 345 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 1741 2109 gene locus_tag LOCUS_44100 1741 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 2106 2372 gene locus_tag LOCUS_44110 2106 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 2380 3057 gene locus_tag LOCUS_44120 2380 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 3064 4080 gene locus_tag LOCUS_44130 3064 4080 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 protein_id gnl|my_center|LOCUS_44130 4121 5788 gene locus_tag LOCUS_44140 4121 5788 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727643.1 protein_id gnl|my_center|LOCUS_44140 5933 6175 gene locus_tag LOCUS_44150 5933 6175 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_44150 6494 6120 gene locus_tag LOCUS_44160 6494 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 7314 6895 gene locus_tag LOCUS_44170 7314 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 7561 7770 gene locus_tag LOCUS_44180 7561 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence178 958 44 gene locus_tag LOCUS_44190 958 44 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_44190 4342 1142 gene locus_tag LOCUS_44200 gene putA 4342 1142 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_44200 5572 4475 gene locus_tag LOCUS_44210 5572 4475 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_44210 6267 5569 gene locus_tag LOCUS_44220 6267 5569 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_44220 6886 6455 gene locus_tag LOCUS_44230 6886 6455 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107978797.1 protein_id gnl|my_center|LOCUS_44230 7185 6883 gene locus_tag LOCUS_44240 7185 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 7539 7793 gene locus_tag LOCUS_44250 7539 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 >Feature sequence179 <1 790 gene locus_tag LOCUS_44260 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937352.1:LysM peptidoglycan-binding domain-containing protein 2919 865 gene locus_tag LOCUS_44270 2919 865 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257248.1 protein_id gnl|my_center|LOCUS_44270 4355 2916 gene locus_tag LOCUS_44280 4355 2916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810154.1 protein_id gnl|my_center|LOCUS_44280 5332 4355 gene locus_tag LOCUS_44290 5332 4355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_44290 7575 5410 gene locus_tag LOCUS_44300 7575 5410 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_44300 >Feature sequence180 802 2574 gene locus_tag LOCUS_44310 802 2574 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_44310 2571 3209 gene locus_tag LOCUS_44320 gene pdxH 2571 3209 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_44320 4333 3338 gene locus_tag LOCUS_44330 4333 3338 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_44330 5538 4330 gene locus_tag LOCUS_44340 5538 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 5848 6033 gene locus_tag LOCUS_44350 5848 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 7051 6512 gene locus_tag LOCUS_44360 7051 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 >Feature sequence181 77 358 gene locus_tag LOCUS_44370 77 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 389 1312 gene locus_tag LOCUS_44380 389 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 1315 1767 gene locus_tag LOCUS_44390 1315 1767 CDS product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189053.1 protein_id gnl|my_center|LOCUS_44390 2060 3880 gene locus_tag LOCUS_44400 2060 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 3861 4481 gene locus_tag LOCUS_44410 3861 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 5237 4803 gene locus_tag LOCUS_44420 5237 4803 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_44420 5482 5234 gene locus_tag LOCUS_44430 5482 5234 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_44430 5839 6591 gene locus_tag LOCUS_44440 5839 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 >Feature sequence182 4322 555 gene locus_tag LOCUS_44450 gene recB 4322 555 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103276.1 protein_id gnl|my_center|LOCUS_44450 <7266 4319 gene locus_tag LOCUS_44460 <7266 4319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010793829.1:exodeoxyribonuclease V subunit gamma >Feature sequence183 52 384 gene locus_tag LOCUS_44470 52 384 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_44470 402 2168 gene locus_tag LOCUS_44480 gene dsbD 402 2168 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_44480 3645 2176 gene locus_tag LOCUS_44490 3645 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 5572 3608 gene locus_tag LOCUS_44500 5572 3608 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_44500 5687 7063 gene locus_tag LOCUS_44510 5687 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 >Feature sequence184 1393 422 gene locus_tag LOCUS_44520 1393 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 2336 1656 gene locus_tag LOCUS_44530 2336 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 2548 3381 gene locus_tag LOCUS_44540 2548 3381 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963381.1 protein_id gnl|my_center|LOCUS_44540 3973 3422 gene locus_tag LOCUS_44550 gene pyrR 3973 3422 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965412.1 protein_id gnl|my_center|LOCUS_44550 5353 4010 gene locus_tag LOCUS_44560 5353 4010 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_44560 5952 5350 gene locus_tag LOCUS_44570 5952 5350 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_44570 6996 6196 gene locus_tag LOCUS_44580 gene fabI 6996 6196 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_44580 >Feature sequence185 600 97 gene locus_tag LOCUS_44590 600 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 815 2017 gene locus_tag LOCUS_44600 815 2017 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_44600 2049 2750 gene locus_tag LOCUS_44610 2049 2750 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209718.1 protein_id gnl|my_center|LOCUS_44610 2960 5110 gene locus_tag LOCUS_44620 2960 5110 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_44620 >Feature sequence186 2555 1284 gene locus_tag LOCUS_44630 2555 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 3070 3753 gene locus_tag LOCUS_44640 3070 3753 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_44640 3744 5186 gene locus_tag LOCUS_44650 gene pcoS 3744 5186 CDS product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 protein_id gnl|my_center|LOCUS_44650 5635 5174 gene locus_tag LOCUS_44660 5635 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 <6673 5659 gene locus_tag LOCUS_44670 <6673 5659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144156.1:efflux RND transporter permease subunit >Feature sequence187 2055 1021 gene locus_tag LOCUS_44680 2055 1021 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_44680 2782 2045 gene locus_tag LOCUS_44690 2782 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 3036 4007 gene locus_tag LOCUS_44700 3036 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 4122 5441 gene locus_tag LOCUS_44710 4122 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 >Feature sequence188 1858 425 gene locus_tag LOCUS_44720 gene trbI 1858 425 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 protein_id gnl|my_center|LOCUS_44720 2296 1865 gene locus_tag LOCUS_44730 2296 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 3189 2299 gene locus_tag LOCUS_44740 gene trbG 3189 2299 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_44740 3977 3204 gene locus_tag LOCUS_44750 3977 3204 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_44750 4068 4769 gene locus_tag LOCUS_44760 4068 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44760 >Feature sequence189 1343 681 gene locus_tag LOCUS_44770 1343 681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037424.1 protein_id gnl|my_center|LOCUS_44770 2715 1465 gene locus_tag LOCUS_44780 2715 1465 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082409.1 protein_id gnl|my_center|LOCUS_44780 3157 2765 gene locus_tag LOCUS_44790 3157 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 >Feature sequence190 570 91 gene locus_tag LOCUS_44800 570 91 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_44800 1033 677 gene locus_tag LOCUS_44810 1033 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 1203 1811 gene locus_tag LOCUS_44820 gene gmk 1203 1811 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930442.1 protein_id gnl|my_center|LOCUS_44820 1828 2034 gene locus_tag LOCUS_44830 gene rpoZ 1828 2034 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811126.1 protein_id gnl|my_center|LOCUS_44830 2104 4491 gene locus_tag LOCUS_44840 2104 4491 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_44840 4541 5776 gene locus_tag LOCUS_44850 4541 5776 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040091.1 protein_id gnl|my_center|LOCUS_44850 >Feature sequence191 1104 310 gene locus_tag LOCUS_44860 gene minC 1104 310 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_44860 2392 1238 gene locus_tag LOCUS_44870 2392 1238 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_44870 3692 2385 gene locus_tag LOCUS_44880 3692 2385 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_44880 4381 3689 gene locus_tag LOCUS_44890 4381 3689 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_44890 5421 4390 gene locus_tag LOCUS_44900 5421 4390 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_44900 >Feature sequence192 44 676 gene locus_tag LOCUS_44910 gene fixJ 44 676 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_44910 750 1637 gene locus_tag LOCUS_44920 gene folD 750 1637 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640180.1 protein_id gnl|my_center|LOCUS_44920 1809 1630 gene locus_tag LOCUS_44930 1809 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 2232 3050 gene locus_tag LOCUS_44940 2232 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 3402 3118 gene locus_tag LOCUS_44950 3402 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 3364 3687 gene locus_tag LOCUS_44960 3364 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 4306 3749 gene locus_tag LOCUS_44970 4306 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 4785 4321 gene locus_tag LOCUS_44980 4785 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 5256 4957 gene locus_tag LOCUS_44990 5256 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44990 >Feature sequence193 <1 832 gene locus_tag LOCUS_45000 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193564.1:U32 family peptidase 829 1281 gene locus_tag LOCUS_45010 829 1281 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_45010 1327 2274 gene locus_tag LOCUS_45020 1327 2274 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 protein_id gnl|my_center|LOCUS_45020 2444 3463 gene locus_tag LOCUS_45030 2444 3463 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_45030 3583 4605 gene locus_tag LOCUS_45040 gene tsaD 3583 4605 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_45040 5352 4735 gene locus_tag LOCUS_45050 gene plsY 5352 4735 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_45050 >Feature sequence194 166 5223 gene locus_tag LOCUS_45060 166 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence195 <1 1335 gene locus_tag LOCUS_45070 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229142.1:type III-B CRISPR module RAMP protein Cmr1 1332 3173 gene locus_tag LOCUS_45080 gene cas10 1332 3173 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_45080 3173 4318 gene locus_tag LOCUS_45090 3173 4318 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_45090 4336 5202 gene locus_tag LOCUS_45100 gene cmr4 4336 5202 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229141.1 protein_id gnl|my_center|LOCUS_45100 5213 5599 gene locus_tag LOCUS_45110 5213 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 >Feature sequence196 48 1688 gene locus_tag LOCUS_45120 48 1688 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_45120 2818 1805 gene locus_tag LOCUS_45130 2818 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 3760 2903 gene locus_tag LOCUS_45140 gene asd 3760 2903 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 protein_id gnl|my_center|LOCUS_45140 4018 4749 gene locus_tag LOCUS_45150 4018 4749 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_45150 5559 4810 gene locus_tag LOCUS_45160 5559 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 >Feature sequence197 91 1425 gene locus_tag LOCUS_45170 91 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 1406 3070 gene locus_tag LOCUS_45180 1406 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 3474 3755 gene locus_tag LOCUS_45190 3474 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 3752 5407 gene locus_tag LOCUS_45200 3752 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 >Feature sequence198 <1 1286 gene locus_tag LOCUS_45210 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein 1306 1554 gene locus_tag LOCUS_45220 1306 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 1581 1928 gene locus_tag LOCUS_45230 1581 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 2035 2439 gene locus_tag LOCUS_45240 2035 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 2773 3666 gene locus_tag LOCUS_45250 2773 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 4110 3886 gene locus_tag LOCUS_45260 4110 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 4385 4107 gene locus_tag LOCUS_45270 4385 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 4989 4378 gene locus_tag LOCUS_45280 4989 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 >Feature sequence199 3722 216 gene locus_tag LOCUS_45290 gene smc 3722 216 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205139.1 protein_id gnl|my_center|LOCUS_45290 3908 4327 gene locus_tag LOCUS_45300 3908 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 4332 5048 gene locus_tag LOCUS_45310 4332 5048 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 protein_id gnl|my_center|LOCUS_45310 >Feature sequence200 1990 1445 gene locus_tag LOCUS_45320 1990 1445 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_45320 2583 1966 gene locus_tag LOCUS_45330 gene rsxA 2583 1966 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_45330 2850 4409 gene locus_tag LOCUS_45340 2850 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 4406 4597 gene locus_tag LOCUS_45350 4406 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 >Feature sequence201 820 329 gene locus_tag LOCUS_45360 820 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_45360 1102 824 gene locus_tag LOCUS_45370 1102 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 2645 1113 gene locus_tag LOCUS_45380 gene nifB 2645 1113 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338307.1 protein_id gnl|my_center|LOCUS_45380 4407 2932 gene locus_tag LOCUS_45390 gene nifA 4407 2932 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388748.1 protein_id gnl|my_center|LOCUS_45390 >Feature sequence202 1794 1399 gene locus_tag LOCUS_45400 1794 1399 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_45400 2021 2266 gene locus_tag LOCUS_45410 2021 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 2263 2850 gene locus_tag LOCUS_45420 2263 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 3251 3078 gene locus_tag LOCUS_45430 3251 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 4109 3348 gene locus_tag LOCUS_45440 4109 3348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_45440 <4623 4106 gene locus_tag LOCUS_45450 <4623 4106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089318.1:ABC transporter ATP-binding protein >Feature sequence203 407 2230 gene locus_tag LOCUS_45460 407 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 2240 4387 gene locus_tag LOCUS_45470 2240 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 >Feature sequence204 <1 734 gene locus_tag LOCUS_45480 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039738.1:P-type conjugative transfer protein TrbL 748 1332 gene locus_tag LOCUS_45490 748 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 1351 1959 gene locus_tag LOCUS_45500 1351 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 3019 2705 gene locus_tag LOCUS_45510 3019 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 3503 3042 gene locus_tag LOCUS_45520 3503 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 <4540 3526 gene locus_tag LOCUS_45530 <4540 3526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142029.1:efflux RND transporter permease subunit >Feature sequence205 <1 1457 gene locus_tag LOCUS_45540 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258680.1:formylglycine-generating enzyme family protein 1653 1817 gene locus_tag LOCUS_45550 1653 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 2348 2004 gene locus_tag LOCUS_45560 2348 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 2323 3549 gene locus_tag LOCUS_45570 2323 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 3700 3900 gene locus_tag LOCUS_45580 3700 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 <4519 3933 gene locus_tag LOCUS_45590 <4519 3933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258633.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence206 18 812 gene locus_tag LOCUS_45600 18 812 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_45600 819 1610 gene locus_tag LOCUS_45610 819 1610 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928340.1 protein_id gnl|my_center|LOCUS_45610 1836 2543 gene locus_tag LOCUS_45620 gene rquA 1836 2543 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_45620 >Feature sequence207 943 1308 gene locus_tag LOCUS_45630 943 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 4292 2772 gene locus_tag LOCUS_45640 4292 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 >Feature sequence208 1356 2081 gene locus_tag LOCUS_45650 1356 2081 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 protein_id gnl|my_center|LOCUS_45650 3917 2430 gene locus_tag LOCUS_45660 3917 2430 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_45660 >Feature sequence209 207 617 gene locus_tag LOCUS_45670 207 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 627 1526 gene locus_tag LOCUS_45680 627 1526 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971533.1 protein_id gnl|my_center|LOCUS_45680 3115 1535 gene locus_tag LOCUS_45690 3115 1535 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928859.1 protein_id gnl|my_center|LOCUS_45690 <4406 3240 gene locus_tag LOCUS_45700 <4406 3240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114469.1:DUF3999 domain-containing protein >Feature sequence210 510 253 gene locus_tag LOCUS_45710 510 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 722 904 gene locus_tag LOCUS_45720 722 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 1048 1386 gene locus_tag LOCUS_45730 1048 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_45730 1349 2485 gene locus_tag LOCUS_45740 1349 2485 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_45740 2493 3185 gene locus_tag LOCUS_45750 2493 3185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_45750 3182 4183 gene locus_tag LOCUS_45760 3182 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_45760 >Feature sequence211 2 697 gene locus_tag LOCUS_45770 2 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 3710 978 gene locus_tag LOCUS_45780 3710 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 >Feature sequence212 <1 891 gene locus_tag LOCUS_45790 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192277.1:NAD(+) synthase 928 1557 gene locus_tag LOCUS_45800 gene pnuC 928 1557 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_45800 2548 1595 gene locus_tag LOCUS_45810 2548 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 >Feature sequence213 1030 434 gene locus_tag LOCUS_45820 1030 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 1354 3693 gene locus_tag LOCUS_45830 1354 3693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_45830 >Feature sequence214 >Feature sequence215 432 2072 gene locus_tag LOCUS_45840 432 2072 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770005.1 protein_id gnl|my_center|LOCUS_45840 2083 2667 gene locus_tag LOCUS_45850 2083 2667 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_45850 2726 2959 gene locus_tag LOCUS_45860 2726 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 >Feature sequence216 2399 1065 gene locus_tag LOCUS_45870 2399 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 2780 2403 gene locus_tag LOCUS_45880 2780 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 3844 2681 gene locus_tag LOCUS_45890 3844 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 >Feature sequence217 793 116 gene locus_tag LOCUS_45900 793 116 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174544.1 protein_id gnl|my_center|LOCUS_45900 1740 811 gene locus_tag LOCUS_45910 1740 811 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_45910 2525 1737 gene locus_tag LOCUS_45920 2525 1737 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 protein_id gnl|my_center|LOCUS_45920 3418 2525 gene locus_tag LOCUS_45930 3418 2525 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_45930 >Feature sequence218 885 1415 gene locus_tag LOCUS_45940 885 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 1545 2873 gene locus_tag LOCUS_45950 1545 2873 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_45950 2876 3670 gene locus_tag LOCUS_45960 2876 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 >Feature sequence219 119 3499 gene locus_tag LOCUS_45970 119 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence220 758 21 gene locus_tag LOCUS_45980 758 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 1581 784 gene locus_tag LOCUS_45990 gene cobI 1581 784 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_45990 2894 1578 gene locus_tag LOCUS_46000 2894 1578 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_46000 <3714 2875 gene locus_tag LOCUS_46010 <3714 2875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000145958.1:cobalt-precorrin-5B (C(1))-methyltransferase >Feature sequence221 366 1013 gene locus_tag LOCUS_46020 366 1013 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_46020 1524 1871 gene locus_tag LOCUS_46030 1524 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 2804 1938 gene locus_tag LOCUS_46040 2804 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 2984 3604 gene locus_tag LOCUS_46050 2984 3604 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_46050 >Feature sequence222 3218 297 gene locus_tag LOCUS_46060 3218 297 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538617.1 protein_id gnl|my_center|LOCUS_46060 >Feature sequence223 101 1576 gene locus_tag LOCUS_46070 101 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 1573 1992 gene locus_tag LOCUS_46080 1573 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 >Feature sequence224 1499 423 gene locus_tag LOCUS_46090 gene queG 1499 423 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_46090 1545 2048 gene locus_tag LOCUS_46100 1545 2048 CDS product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065018.1 protein_id gnl|my_center|LOCUS_46100 2003 3373 gene locus_tag LOCUS_46110 2003 3373 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_46110 >Feature sequence225 3443 363 gene locus_tag LOCUS_46120 3443 363 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_46120 >Feature sequence226 806 252 gene locus_tag LOCUS_46130 806 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 2886 817 gene locus_tag LOCUS_46140 2886 817 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_46140 >Feature sequence227 474 46 gene locus_tag LOCUS_46150 474 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 633 875 gene locus_tag LOCUS_46160 633 875 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402169.1 protein_id gnl|my_center|LOCUS_46160 872 1033 gene locus_tag LOCUS_46170 872 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 3208 1247 gene locus_tag LOCUS_46180 3208 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 >Feature sequence228 1172 978 gene locus_tag LOCUS_46190 1172 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 1774 3027 gene locus_tag LOCUS_46200 1774 3027 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_46200 >Feature sequence229 119 757 gene locus_tag LOCUS_46210 119 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 2772 982 gene locus_tag LOCUS_46220 2772 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 3406 2846 gene locus_tag LOCUS_46230 3406 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 >Feature sequence230 1263 259 gene locus_tag LOCUS_46240 gene arnC 1263 259 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112880.1 protein_id gnl|my_center|LOCUS_46240 2903 1260 gene locus_tag LOCUS_46250 2903 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 >Feature sequence231 540 343 gene locus_tag LOCUS_46260 540 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 645 884 gene locus_tag LOCUS_46270 645 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 1069 1371 gene locus_tag LOCUS_46280 1069 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 1418 2746 gene locus_tag LOCUS_46290 1418 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 >Feature sequence232 1981 677 gene locus_tag LOCUS_46300 1981 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 3057 1981 gene locus_tag LOCUS_46310 3057 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 3330 3234 gene locus_tag LOCUS_t00480 3330 3234 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence233 136 798 gene locus_tag LOCUS_46320 136 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 818 1687 gene locus_tag LOCUS_46330 818 1687 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525670.1 protein_id gnl|my_center|LOCUS_46330 2640 1609 gene locus_tag LOCUS_46340 gene epmB 2640 1609 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_46340 2682 3251 gene locus_tag LOCUS_46350 gene efp 2682 3251 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_46350 >Feature sequence234 825 163 gene locus_tag LOCUS_46360 gene purN 825 163 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522603.1 protein_id gnl|my_center|LOCUS_46360 1583 948 gene locus_tag LOCUS_46370 1583 948 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706279.1 protein_id gnl|my_center|LOCUS_46370 1561 2817 gene locus_tag LOCUS_46380 1561 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 >Feature sequence235 1298 429 gene locus_tag LOCUS_46390 1298 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 2489 1314 gene locus_tag LOCUS_46400 gene csx2 2489 1314 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_46400 2702 2511 gene locus_tag LOCUS_46410 2702 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 >Feature sequence236 <1 1732 gene locus_tag LOCUS_46420 <1 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930412.1:type I-U CRISPR-associated helicase/endonuclease Cas3 1723 2586 gene locus_tag LOCUS_46430 1723 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 >Feature sequence237 2236 551 gene locus_tag LOCUS_46440 2236 551 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_46440 <2769 2229 gene locus_tag LOCUS_46450 <2769 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707506.1:paraquat-inducible protein A >Feature sequence238 340 1506 gene locus_tag LOCUS_46460 340 1506 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 protein_id gnl|my_center|LOCUS_46460 2558 1524 gene locus_tag LOCUS_46470 2558 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 >Feature sequence239 1298 429 gene locus_tag LOCUS_46480 1298 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 2488 1295 gene locus_tag LOCUS_46490 gene csx2 2488 1295 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_46490 >Feature sequence240 <1 2363 gene locus_tag LOCUS_46500 <1 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105345.1:DUF2339 domain-containing protein >Feature sequence241 102 1343 gene locus_tag LOCUS_46510 102 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 1718 2371 gene locus_tag LOCUS_46520 1718 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 >Feature sequence242 209 1039 gene locus_tag LOCUS_46530 209 1039 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_46530 1057 1683 gene locus_tag LOCUS_46540 1057 1683 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_46540 1694 2347 gene locus_tag LOCUS_46550 1694 2347 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_46550 >Feature sequence243 1223 321 gene locus_tag LOCUS_46560 1223 321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686358.1 protein_id gnl|my_center|LOCUS_46560 2335 1208 gene locus_tag LOCUS_46570 2335 1208 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747555.1 protein_id gnl|my_center|LOCUS_46570 2571 2410 gene locus_tag LOCUS_46580 2571 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 >Feature sequence244 506 2290 gene locus_tag LOCUS_46590 gene mshL 506 2290 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704365.1 protein_id gnl|my_center|LOCUS_46590 2287 2526 gene locus_tag LOCUS_46600 2287 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence245