>Feature sequence01 338 1198 gene locus_tag LOCUS_00010 338 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1216 2142 gene locus_tag LOCUS_00020 1216 2142 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_00020 3579 2275 gene locus_tag LOCUS_00030 gene gltA 3579 2275 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_00030 4033 4365 gene locus_tag LOCUS_00040 4033 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4362 6962 gene locus_tag LOCUS_00050 4362 6962 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_00050 7082 10468 gene locus_tag LOCUS_00060 7082 10468 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 protein_id gnl|my_center|LOCUS_00060 10510 13068 gene locus_tag LOCUS_00070 10510 13068 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 protein_id gnl|my_center|LOCUS_00070 13065 14084 gene locus_tag LOCUS_00080 13065 14084 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_00080 14295 16232 gene locus_tag LOCUS_00090 14295 16232 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_00090 16238 17572 gene locus_tag LOCUS_00100 16238 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17569 18090 gene locus_tag LOCUS_00110 gene mobB 17569 18090 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_00110 18084 19289 gene locus_tag LOCUS_00120 18084 19289 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103964.1 protein_id gnl|my_center|LOCUS_00120 19303 19557 gene locus_tag LOCUS_00130 gene moaD 19303 19557 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_00130 19562 20011 gene locus_tag LOCUS_00140 gene moaE 19562 20011 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_00140 20282 22861 gene locus_tag LOCUS_00150 gene clpB 20282 22861 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_00150 22875 23108 gene locus_tag LOCUS_00160 22875 23108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23973 23227 gene locus_tag LOCUS_00170 23973 23227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 36763 24017 gene locus_tag LOCUS_00180 36763 24017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 37629 37826 gene locus_tag LOCUS_00190 37629 37826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 40653 37963 gene locus_tag LOCUS_00200 40653 37963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_00200 41241 40795 gene locus_tag LOCUS_00210 41241 40795 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_00210 42321 41269 gene locus_tag LOCUS_00220 gene mnmH 42321 41269 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_00220 42922 42350 gene locus_tag LOCUS_00230 42922 42350 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009942000.1 protein_id gnl|my_center|LOCUS_00230 42984 43652 gene locus_tag LOCUS_00240 42984 43652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_00240 44931 43573 gene locus_tag LOCUS_00250 gene hpnE 44931 43573 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_00250 45761 44928 gene locus_tag LOCUS_00260 gene hpnD 45761 44928 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_00260 46614 45805 gene locus_tag LOCUS_00270 gene hpnC 46614 45805 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_00270 46776 46860 gene locus_tag LOCUS_t00010 46776 46860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46901 47104 gene locus_tag LOCUS_00280 46901 47104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 47373 49898 gene locus_tag LOCUS_00290 47373 49898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 49905 50546 gene locus_tag LOCUS_00300 49905 50546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_00300 51025 50813 gene locus_tag LOCUS_00310 51025 50813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 50918 51217 gene locus_tag LOCUS_00320 50918 51217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 51350 51739 gene locus_tag LOCUS_00330 51350 51739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 52877 52020 gene locus_tag LOCUS_00340 52877 52020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 53588 56839 gene locus_tag LOCUS_00350 53588 56839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 56897 58975 gene locus_tag LOCUS_00360 56897 58975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 58997 59341 gene locus_tag LOCUS_00370 58997 59341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 59574 60842 gene locus_tag LOCUS_00380 gene urtA 59574 60842 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_00380 60899 62494 gene locus_tag LOCUS_00390 gene urtB 60899 62494 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105141.1 protein_id gnl|my_center|LOCUS_00390 62511 63659 gene locus_tag LOCUS_00400 gene urtC 62511 63659 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522271.1 protein_id gnl|my_center|LOCUS_00400 63656 64507 gene locus_tag LOCUS_00410 gene urtD 63656 64507 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_00410 64515 65207 gene locus_tag LOCUS_00420 gene urtE 64515 65207 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_00420 65204 66076 gene locus_tag LOCUS_00430 65204 66076 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 protein_id gnl|my_center|LOCUS_00430 66110 66412 gene locus_tag LOCUS_00440 gene ureA 66110 66412 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186513.1 protein_id gnl|my_center|LOCUS_00440 66424 66732 gene locus_tag LOCUS_00450 66424 66732 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391866.1 protein_id gnl|my_center|LOCUS_00450 66743 68467 gene locus_tag LOCUS_00460 gene ureC 66743 68467 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_00460 68475 69041 gene locus_tag LOCUS_00470 gene ureE 68475 69041 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205202.1 protein_id gnl|my_center|LOCUS_00470 69038 69709 gene locus_tag LOCUS_00480 69038 69709 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 protein_id gnl|my_center|LOCUS_00480 69727 70338 gene locus_tag LOCUS_00490 gene ureG 69727 70338 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_00490 70731 71327 gene locus_tag LOCUS_00500 70731 71327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 71324 72424 gene locus_tag LOCUS_00510 71324 72424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 72449 74398 gene locus_tag LOCUS_00520 72449 74398 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941642.1 protein_id gnl|my_center|LOCUS_00520 74464 74931 gene locus_tag LOCUS_00530 74464 74931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 74949 75392 gene locus_tag LOCUS_00540 74949 75392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 75417 75860 gene locus_tag LOCUS_00550 75417 75860 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_00550 75863 76054 gene locus_tag LOCUS_00560 75863 76054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 76056 76787 gene locus_tag LOCUS_00570 76056 76787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 76809 78449 gene locus_tag LOCUS_00580 76809 78449 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_00580 78510 78698 gene locus_tag LOCUS_00590 78510 78698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 78703 79119 gene locus_tag LOCUS_00600 78703 79119 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_00600 79128 79562 gene locus_tag LOCUS_00610 79128 79562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 79578 84011 gene locus_tag LOCUS_00620 79578 84011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 84041 85417 gene locus_tag LOCUS_00630 84041 85417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 85433 89698 gene locus_tag LOCUS_00640 85433 89698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 89715 91274 gene locus_tag LOCUS_00650 89715 91274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 91274 92656 gene locus_tag LOCUS_00660 91274 92656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 92653 94938 gene locus_tag LOCUS_00670 92653 94938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 95564 95776 gene locus_tag LOCUS_00680 95564 95776 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_00680 96475 96140 gene locus_tag LOCUS_00690 96475 96140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 97180 96641 gene locus_tag LOCUS_00700 97180 96641 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_00700 97850 97173 gene locus_tag LOCUS_00710 97850 97173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 97893 98093 gene locus_tag LOCUS_00720 gene thiS 97893 98093 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_00720 98121 98915 gene locus_tag LOCUS_00730 98121 98915 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_00730 98936 99661 gene locus_tag LOCUS_00740 gene trmB 98936 99661 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 protein_id gnl|my_center|LOCUS_00740 100144 99620 gene locus_tag LOCUS_00750 100144 99620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 100263 101390 gene locus_tag LOCUS_00760 100263 101390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 102690 101437 gene locus_tag LOCUS_00770 gene hemW 102690 101437 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_00770 103277 102690 gene locus_tag LOCUS_00780 gene rdgB 103277 102690 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 protein_id gnl|my_center|LOCUS_00780 103990 103274 gene locus_tag LOCUS_00790 gene rph 103990 103274 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_00790 104919 103999 gene locus_tag LOCUS_00800 104919 103999 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_00800 105887 104916 gene locus_tag LOCUS_00810 105887 104916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 105991 106857 gene locus_tag LOCUS_00820 105991 106857 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687657.1 protein_id gnl|my_center|LOCUS_00820 107241 106885 gene locus_tag LOCUS_00830 107241 106885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 107442 108053 gene locus_tag LOCUS_00840 gene gmk 107442 108053 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 protein_id gnl|my_center|LOCUS_00840 108072 108278 gene locus_tag LOCUS_00850 gene rpoZ 108072 108278 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_00850 108306 110510 gene locus_tag LOCUS_00860 108306 110510 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930440.1 protein_id gnl|my_center|LOCUS_00860 110507 111742 gene locus_tag LOCUS_00870 110507 111742 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_00870 111770 112564 gene locus_tag LOCUS_00880 111770 112564 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_00880 112574 113362 gene locus_tag LOCUS_00890 112574 113362 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_00890 113573 114319 gene locus_tag LOCUS_00900 gene rquA 113573 114319 CDS product rhodoquinone biosynthesis methyltransferase RquA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390975.1 protein_id gnl|my_center|LOCUS_00900 114415 116202 gene locus_tag LOCUS_00910 gene frdA 114415 116202 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706984.1 protein_id gnl|my_center|LOCUS_00910 116195 116950 gene locus_tag LOCUS_00920 116195 116950 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_00920 116947 117345 gene locus_tag LOCUS_00930 116947 117345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 117342 117710 gene locus_tag LOCUS_00940 gene frdD 117342 117710 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706986.1 protein_id gnl|my_center|LOCUS_00940 117910 120159 gene locus_tag LOCUS_00950 117910 120159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 121169 120276 gene locus_tag LOCUS_00960 gene ppk2 121169 120276 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705517.1 protein_id gnl|my_center|LOCUS_00960 122671 121235 gene locus_tag LOCUS_00970 122671 121235 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_00970 125861 122664 gene locus_tag LOCUS_00980 125861 122664 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_00980 127085 125868 gene locus_tag LOCUS_00990 127085 125868 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_00990 127321 128508 gene locus_tag LOCUS_01000 127321 128508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 protein_id gnl|my_center|LOCUS_01000 129469 130068 gene locus_tag LOCUS_01010 129469 130068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 132600 131101 gene locus_tag LOCUS_01020 132600 131101 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_01020 133316 133513 gene locus_tag LOCUS_01030 133316 133513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 134972 134160 gene locus_tag LOCUS_01040 134972 134160 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230430.1 protein_id gnl|my_center|LOCUS_01040 135908 134973 gene locus_tag LOCUS_01050 135908 134973 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_01050 137794 136049 gene locus_tag LOCUS_01060 137794 136049 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312313.1 protein_id gnl|my_center|LOCUS_01060 137793 137957 gene locus_tag LOCUS_01070 137793 137957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 138308 139297 gene locus_tag LOCUS_01080 138308 139297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 139453 139881 gene locus_tag LOCUS_01090 139453 139881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 140387 139893 gene locus_tag LOCUS_01100 140387 139893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 140435 141886 gene locus_tag LOCUS_01110 gene gabD 140435 141886 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_01110 141908 142561 gene locus_tag LOCUS_01120 141908 142561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114342.1 protein_id gnl|my_center|LOCUS_01120 142815 143828 gene locus_tag LOCUS_01130 142815 143828 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098363.1 protein_id gnl|my_center|LOCUS_01130 144204 144788 gene locus_tag LOCUS_01140 144204 144788 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388515.1 protein_id gnl|my_center|LOCUS_01140 145062 145952 gene locus_tag LOCUS_01150 145062 145952 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 protein_id gnl|my_center|LOCUS_01150 145949 146989 gene locus_tag LOCUS_01160 145949 146989 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814870.1 protein_id gnl|my_center|LOCUS_01160 147066 147941 gene locus_tag LOCUS_01170 147066 147941 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192732.1 protein_id gnl|my_center|LOCUS_01170 149023 148145 gene locus_tag LOCUS_01180 149023 148145 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_01180 149289 149912 gene locus_tag LOCUS_01190 149289 149912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 150090 150533 gene locus_tag LOCUS_01200 150090 150533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 151696 150629 gene locus_tag LOCUS_01210 151696 150629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 152775 152302 gene locus_tag LOCUS_01220 152775 152302 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_01220 154212 152827 gene locus_tag LOCUS_01230 154212 152827 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_01230 155048 154251 gene locus_tag LOCUS_01240 gene lgt 155048 154251 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772080.1 protein_id gnl|my_center|LOCUS_01240 155131 156987 gene locus_tag LOCUS_01250 gene ilvD 155131 156987 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_01250 157166 157471 gene locus_tag LOCUS_01260 gene nirM 157166 157471 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_01260 157561 158862 gene locus_tag LOCUS_01270 157561 158862 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_01270 159035 159958 gene locus_tag LOCUS_01280 159035 159958 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064074.1 protein_id gnl|my_center|LOCUS_01280 159955 161031 gene locus_tag LOCUS_01290 159955 161031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039587.1 protein_id gnl|my_center|LOCUS_01290 161034 161810 gene locus_tag LOCUS_01300 161034 161810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812849.1 protein_id gnl|my_center|LOCUS_01300 161827 162531 gene locus_tag LOCUS_01310 161827 162531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 protein_id gnl|my_center|LOCUS_01310 163716 162541 gene locus_tag LOCUS_01320 163716 162541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 164782 163709 gene locus_tag LOCUS_01330 164782 163709 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_01330 165028 164831 gene locus_tag LOCUS_01340 165028 164831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 164960 165730 gene locus_tag LOCUS_01350 164960 165730 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01350 165721 166137 gene locus_tag LOCUS_01360 165721 166137 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 protein_id gnl|my_center|LOCUS_01360 166160 167299 gene locus_tag LOCUS_01370 166160 167299 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040196.1 protein_id gnl|my_center|LOCUS_01370 168209 167430 gene locus_tag LOCUS_01380 168209 167430 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173807.1 protein_id gnl|my_center|LOCUS_01380 169587 168664 gene locus_tag LOCUS_01390 gene ispH 169587 168664 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_01390 170069 169596 gene locus_tag LOCUS_01400 170069 169596 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_01400 170640 170128 gene locus_tag LOCUS_01410 gene lspA 170640 170128 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_01410 173455 170627 gene locus_tag LOCUS_01420 gene ileS 173455 170627 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812558.1 protein_id gnl|my_center|LOCUS_01420 174387 173464 gene locus_tag LOCUS_01430 174387 173464 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_01430 174567 176936 gene locus_tag LOCUS_01440 174567 176936 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_01440 176943 177146 gene locus_tag LOCUS_01450 176943 177146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 177484 178911 gene locus_tag LOCUS_01460 gene ccoN 177484 178911 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216619.1 protein_id gnl|my_center|LOCUS_01460 178924 179538 gene locus_tag LOCUS_01470 gene ccoO 178924 179538 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_01470 179542 179736 gene locus_tag LOCUS_01480 179542 179736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 179733 180644 gene locus_tag LOCUS_01490 gene ccoP 179733 180644 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_01490 180879 182294 gene locus_tag LOCUS_01500 gene ccoG 180879 182294 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_01500 182291 182842 gene locus_tag LOCUS_01510 182291 182842 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706148.1 protein_id gnl|my_center|LOCUS_01510 182846 182983 gene locus_tag LOCUS_01520 182846 182983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 183276 183674 gene locus_tag LOCUS_01530 183276 183674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 184215 183652 gene locus_tag LOCUS_01540 184215 183652 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_01540 184555 185412 gene locus_tag LOCUS_01550 gene motA 184555 185412 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_01550 185443 186405 gene locus_tag LOCUS_01560 gene motB 185443 186405 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 protein_id gnl|my_center|LOCUS_01560 186531 188777 gene locus_tag LOCUS_01570 gene glgX 186531 188777 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_01570 189493 188885 gene locus_tag LOCUS_01580 189493 188885 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_01580 189616 190983 gene locus_tag LOCUS_01590 gene purB 189616 190983 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 protein_id gnl|my_center|LOCUS_01590 191571 192026 gene locus_tag LOCUS_01600 191571 192026 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_01600 192788 192096 gene locus_tag LOCUS_01610 192788 192096 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_01610 193790 192846 gene locus_tag LOCUS_01620 gene secF 193790 192846 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_01620 195680 193803 gene locus_tag LOCUS_01630 gene secD 195680 193803 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_01630 196068 195739 gene locus_tag LOCUS_01640 gene yajC 196068 195739 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_01640 197208 196276 gene locus_tag LOCUS_01650 197208 196276 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_01650 197960 197211 gene locus_tag LOCUS_01660 197960 197211 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_01660 198569 198120 gene locus_tag LOCUS_01670 198569 198120 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_01670 199798 198821 gene locus_tag LOCUS_01680 199798 198821 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_01680 201687 199933 gene locus_tag LOCUS_01690 201687 199933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 202717 201698 gene locus_tag LOCUS_01700 202717 201698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 204746 202728 gene locus_tag LOCUS_01710 204746 202728 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_01710 205930 204749 gene locus_tag LOCUS_01720 205930 204749 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 protein_id gnl|my_center|LOCUS_01720 207669 205996 gene locus_tag LOCUS_01730 207669 205996 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_01730 209163 207721 gene locus_tag LOCUS_01740 209163 207721 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_01740 210988 209876 gene locus_tag LOCUS_01750 gene tgt 210988 209876 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_01750 213930 211198 gene locus_tag LOCUS_01760 gene ppdK 213930 211198 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_01760 215716 214094 gene locus_tag LOCUS_01770 215716 214094 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_01770 216729 215716 gene locus_tag LOCUS_01780 gene porB 216729 215716 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_01780 217994 216741 gene locus_tag LOCUS_01790 gene porA 217994 216741 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_01790 218583 217987 gene locus_tag LOCUS_01800 218583 217987 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_01800 219891 218833 gene locus_tag LOCUS_01810 219891 218833 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_01810 220968 219925 gene locus_tag LOCUS_01820 220968 219925 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256084.1 protein_id gnl|my_center|LOCUS_01820 222261 221041 gene locus_tag LOCUS_01830 222261 221041 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256085.1 protein_id gnl|my_center|LOCUS_01830 223516 222287 gene locus_tag LOCUS_01840 223516 222287 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256088.1 protein_id gnl|my_center|LOCUS_01840 224882 223539 gene locus_tag LOCUS_01850 224882 223539 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256089.1 protein_id gnl|my_center|LOCUS_01850 225109 225978 gene locus_tag LOCUS_01860 225109 225978 CDS product mesaconyl-C(4)-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256090.1 protein_id gnl|my_center|LOCUS_01860 230185 225989 gene locus_tag LOCUS_01870 230185 225989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 231257 230226 gene locus_tag LOCUS_01880 gene queA 231257 230226 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538740.1 protein_id gnl|my_center|LOCUS_01880 231385 231471 gene locus_tag LOCUS_t00020 231385 231471 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 1514 1861 gene locus_tag LOCUS_01890 1514 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 1953 2543 gene locus_tag LOCUS_01900 1953 2543 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_01900 2540 3262 gene locus_tag LOCUS_01910 2540 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 3341 4132 gene locus_tag LOCUS_01920 3341 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4222 6837 gene locus_tag LOCUS_01930 gene leuS 4222 6837 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456399.1 protein_id gnl|my_center|LOCUS_01930 6857 7369 gene locus_tag LOCUS_01940 gene lptE 6857 7369 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 protein_id gnl|my_center|LOCUS_01940 7388 8392 gene locus_tag LOCUS_01950 gene holA 7388 8392 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_01950 8666 8421 gene locus_tag LOCUS_01960 8666 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8786 10042 gene locus_tag LOCUS_01970 8786 10042 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557250.1 protein_id gnl|my_center|LOCUS_01970 10103 10675 gene locus_tag LOCUS_01980 10103 10675 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_01980 10694 11182 gene locus_tag LOCUS_01990 10694 11182 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_01990 11169 12083 gene locus_tag LOCUS_02000 gene xerD 11169 12083 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 protein_id gnl|my_center|LOCUS_02000 12723 12139 gene locus_tag LOCUS_02010 gene cobC 12723 12139 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 protein_id gnl|my_center|LOCUS_02010 13460 12708 gene locus_tag LOCUS_02020 13460 12708 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_02020 13843 14499 gene locus_tag LOCUS_02030 13843 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 14717 15061 gene locus_tag LOCUS_02040 14717 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 15163 15339 gene locus_tag LOCUS_02050 15163 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 16691 15462 gene locus_tag LOCUS_02060 gene icd 16691 15462 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_02060 17000 18751 gene locus_tag LOCUS_02070 gene aceK 17000 18751 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_02070 19232 19717 gene locus_tag LOCUS_02080 19232 19717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 20552 19752 gene locus_tag LOCUS_02090 gene hyi 20552 19752 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 protein_id gnl|my_center|LOCUS_02090 21163 20636 gene locus_tag LOCUS_02100 21163 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 23239 22886 gene locus_tag LOCUS_02110 23239 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 23847 24902 gene locus_tag LOCUS_02120 23847 24902 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337841.1 protein_id gnl|my_center|LOCUS_02120 24886 26532 gene locus_tag LOCUS_02130 24886 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 26648 27298 gene locus_tag LOCUS_02140 26648 27298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 27486 28046 gene locus_tag LOCUS_02150 27486 28046 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_02150 28099 28656 gene locus_tag LOCUS_02160 28099 28656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 29877 28690 gene locus_tag LOCUS_02170 29877 28690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 30234 31595 gene locus_tag LOCUS_02180 30234 31595 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_02180 31717 32790 gene locus_tag LOCUS_02190 31717 32790 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_02190 32802 33614 gene locus_tag LOCUS_02200 gene cbiQ 32802 33614 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_02200 33611 34366 gene locus_tag LOCUS_02210 33611 34366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_02210 34872 34393 gene locus_tag LOCUS_02220 gene nikR 34872 34393 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_02220 35026 35748 gene locus_tag LOCUS_02230 gene creB 35026 35748 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873813.1 protein_id gnl|my_center|LOCUS_02230 35756 37183 gene locus_tag LOCUS_02240 gene creC 35756 37183 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 protein_id gnl|my_center|LOCUS_02240 37299 38651 gene locus_tag LOCUS_02250 gene creD 37299 38651 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_02250 39153 38842 gene locus_tag LOCUS_02260 39153 38842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 40567 39254 gene locus_tag LOCUS_02270 40567 39254 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921427.1 protein_id gnl|my_center|LOCUS_02270 40909 40586 gene locus_tag LOCUS_02280 40909 40586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 41414 42232 gene locus_tag LOCUS_02290 41414 42232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 42244 42861 gene locus_tag LOCUS_02300 42244 42861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 42886 43284 gene locus_tag LOCUS_02310 42886 43284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 43541 43816 gene locus_tag LOCUS_02320 43541 43816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 43828 44358 gene locus_tag LOCUS_02330 43828 44358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 44355 44723 gene locus_tag LOCUS_02340 44355 44723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 46514 44901 gene locus_tag LOCUS_02350 46514 44901 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_02350 51711 46807 gene locus_tag LOCUS_02360 51711 46807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 52358 51909 gene locus_tag LOCUS_02370 52358 51909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 52570 52355 gene locus_tag LOCUS_02380 52570 52355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 53335 52736 gene locus_tag LOCUS_02390 gene gstA 53335 52736 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_02390 53486 54661 gene locus_tag LOCUS_02400 53486 54661 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085748.1 protein_id gnl|my_center|LOCUS_02400 55199 54714 gene locus_tag LOCUS_02410 55199 54714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 55840 56673 gene locus_tag LOCUS_02420 55840 56673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02420 56686 57225 gene locus_tag LOCUS_02430 56686 57225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02430 57377 59140 gene locus_tag LOCUS_02440 57377 59140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 60383 59223 gene locus_tag LOCUS_02450 60383 59223 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_02450 61157 60471 gene locus_tag LOCUS_02460 gene rluA 61157 60471 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525162.1 protein_id gnl|my_center|LOCUS_02460 61300 62121 gene locus_tag LOCUS_02470 61300 62121 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_02470 62142 63080 gene locus_tag LOCUS_02480 62142 63080 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215599.1 protein_id gnl|my_center|LOCUS_02480 63740 63096 gene locus_tag LOCUS_02490 63740 63096 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528803.1 protein_id gnl|my_center|LOCUS_02490 63976 65220 gene locus_tag LOCUS_02500 63976 65220 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_02500 65280 66125 gene locus_tag LOCUS_02510 gene rlmJ 65280 66125 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_02510 66521 66144 gene locus_tag LOCUS_02520 66521 66144 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_02520 67461 66526 gene locus_tag LOCUS_02530 67461 66526 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 protein_id gnl|my_center|LOCUS_02530 68614 67628 gene locus_tag LOCUS_02540 68614 67628 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_02540 68842 69561 gene locus_tag LOCUS_02550 68842 69561 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188685.1 protein_id gnl|my_center|LOCUS_02550 69801 70073 gene locus_tag LOCUS_02560 69801 70073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 70067 70414 gene locus_tag LOCUS_02570 gene sdhD 70067 70414 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_02570 70415 72199 gene locus_tag LOCUS_02580 gene sdhA 70415 72199 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688397.1 protein_id gnl|my_center|LOCUS_02580 72218 72937 gene locus_tag LOCUS_02590 72218 72937 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221124.1 protein_id gnl|my_center|LOCUS_02590 72937 73191 gene locus_tag LOCUS_02600 72937 73191 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_02600 73261 74556 gene locus_tag LOCUS_02610 73261 74556 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_02610 74668 77508 gene locus_tag LOCUS_02620 74668 77508 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526855.1 protein_id gnl|my_center|LOCUS_02620 77521 78765 gene locus_tag LOCUS_02630 gene odhB 77521 78765 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065167.1 protein_id gnl|my_center|LOCUS_02630 78856 80292 gene locus_tag LOCUS_02640 gene lpdA 78856 80292 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191219.1 protein_id gnl|my_center|LOCUS_02640 81035 80403 gene locus_tag LOCUS_02650 gene gloC 81035 80403 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 protein_id gnl|my_center|LOCUS_02650 81478 81245 gene locus_tag LOCUS_02660 81478 81245 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_02660 81595 82185 gene locus_tag LOCUS_02670 81595 82185 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_02670 82455 82775 gene locus_tag LOCUS_02680 82455 82775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 82772 83638 gene locus_tag LOCUS_02690 82772 83638 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 protein_id gnl|my_center|LOCUS_02690 83741 84439 gene locus_tag LOCUS_02700 83741 84439 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_02700 84432 85088 gene locus_tag LOCUS_02710 gene gph 84432 85088 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190123.1 protein_id gnl|my_center|LOCUS_02710 85231 85605 gene locus_tag LOCUS_02720 85231 85605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 85693 86394 gene locus_tag LOCUS_02730 gene tsaA 85693 86394 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 protein_id gnl|my_center|LOCUS_02730 86666 87142 gene locus_tag LOCUS_02740 86666 87142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 87822 87184 gene locus_tag LOCUS_02750 gene pdxH 87822 87184 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_02750 89675 87819 gene locus_tag LOCUS_02760 89675 87819 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_02760 89951 90856 gene locus_tag LOCUS_02770 89951 90856 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_02770 90917 91657 gene locus_tag LOCUS_02780 90917 91657 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 protein_id gnl|my_center|LOCUS_02780 91659 92339 gene locus_tag LOCUS_02790 gene gltK 91659 92339 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194080.1 protein_id gnl|my_center|LOCUS_02790 92374 93102 gene locus_tag LOCUS_02800 92374 93102 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194225.1 protein_id gnl|my_center|LOCUS_02800 93267 97940 gene locus_tag LOCUS_02810 93267 97940 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_02810 98178 98693 gene locus_tag LOCUS_02820 98178 98693 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550823.1 protein_id gnl|my_center|LOCUS_02820 98750 99910 gene locus_tag LOCUS_02830 gene sucC 98750 99910 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_02830 99920 100813 gene locus_tag LOCUS_02840 gene sucD 99920 100813 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_02840 101974 101078 gene locus_tag LOCUS_02850 101974 101078 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_02850 103612 102200 gene locus_tag LOCUS_02860 103612 102200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 103875 106589 gene locus_tag LOCUS_02870 gene acnA 103875 106589 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_02870 107187 106654 gene locus_tag LOCUS_02880 107187 106654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 107670 108212 gene locus_tag LOCUS_02890 107670 108212 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_02890 110330 108252 gene locus_tag LOCUS_02900 gene uvrB 110330 108252 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_02900 110494 111699 gene locus_tag LOCUS_02910 110494 111699 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104588.1 protein_id gnl|my_center|LOCUS_02910 113694 111859 gene locus_tag LOCUS_02920 113694 111859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 114034 116385 gene locus_tag LOCUS_02930 114034 116385 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032475098.1 protein_id gnl|my_center|LOCUS_02930 116546 118480 gene locus_tag LOCUS_02940 116546 118480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 119976 118597 gene locus_tag LOCUS_02950 119976 118597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 121827 120163 gene locus_tag LOCUS_02960 gene actP 121827 120163 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 protein_id gnl|my_center|LOCUS_02960 122132 121824 gene locus_tag LOCUS_02970 122132 121824 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388394.1 protein_id gnl|my_center|LOCUS_02970 122997 122323 gene locus_tag LOCUS_02980 122997 122323 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088702.1 protein_id gnl|my_center|LOCUS_02980 123235 125193 gene locus_tag LOCUS_02990 123235 125193 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_02990 125193 125975 gene locus_tag LOCUS_03000 125193 125975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_03000 125988 126917 gene locus_tag LOCUS_03010 125988 126917 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_03010 126933 128009 gene locus_tag LOCUS_03020 126933 128009 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_03020 128093 129430 gene locus_tag LOCUS_03030 128093 129430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_03030 129510 130325 gene locus_tag LOCUS_03040 129510 130325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_03040 130464 131696 gene locus_tag LOCUS_03050 130464 131696 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_03050 131727 132893 gene locus_tag LOCUS_03060 131727 132893 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_03060 133493 133041 gene locus_tag LOCUS_03070 133493 133041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 134394 133597 gene locus_tag LOCUS_03080 134394 133597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 137990 134439 gene locus_tag LOCUS_03090 137990 134439 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_03090 138247 138331 gene locus_tag LOCUS_t00030 138247 138331 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 138383 138456 gene locus_tag LOCUS_t00040 138383 138456 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 138496 138570 gene locus_tag LOCUS_t00050 138496 138570 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 138625 139815 gene locus_tag LOCUS_03100 gene tuf 138625 139815 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_03100 139870 139945 gene locus_tag LOCUS_t00060 139870 139945 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 139969 140316 gene locus_tag LOCUS_03110 gene secE 139969 140316 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551020.1 protein_id gnl|my_center|LOCUS_03110 140319 140852 gene locus_tag LOCUS_03120 gene nusG 140319 140852 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_03120 140980 141411 gene locus_tag LOCUS_03130 gene rplK 140980 141411 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_03130 141413 142102 gene locus_tag LOCUS_03140 gene rplA 141413 142102 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_03140 142383 142880 gene locus_tag LOCUS_03150 gene rplJ 142383 142880 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_03150 142929 143297 gene locus_tag LOCUS_03160 gene rplL 142929 143297 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_03160 143557 147840 gene locus_tag LOCUS_03170 143557 147840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 147930 152144 gene locus_tag LOCUS_03180 gene rpoC 147930 152144 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_03180 152312 152689 gene locus_tag LOCUS_03190 gene rpsL 152312 152689 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_03190 152786 153256 gene locus_tag LOCUS_03200 gene rpsG 152786 153256 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_03200 153330 155423 gene locus_tag LOCUS_03210 gene fusA 153330 155423 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_03210 155447 156637 gene locus_tag LOCUS_03220 gene tuf 155447 156637 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_03220 156653 157003 gene locus_tag LOCUS_03230 gene rpsJ 156653 157003 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_03230 157114 157758 gene locus_tag LOCUS_03240 gene rplC 157114 157758 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215400.1 protein_id gnl|my_center|LOCUS_03240 157759 158379 gene locus_tag LOCUS_03250 gene rplD 157759 158379 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_03250 158376 158678 gene locus_tag LOCUS_03260 gene rplW 158376 158678 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_03260 158679 159506 gene locus_tag LOCUS_03270 gene rplB 158679 159506 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_03270 159520 159795 gene locus_tag LOCUS_03280 gene rpsS 159520 159795 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_03280 159800 160135 gene locus_tag LOCUS_03290 gene rplV 159800 160135 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199272.1 protein_id gnl|my_center|LOCUS_03290 160145 160984 gene locus_tag LOCUS_03300 gene rpsC 160145 160984 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_03300 160968 161381 gene locus_tag LOCUS_03310 gene rplP 160968 161381 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_03310 161384 161575 gene locus_tag LOCUS_03320 gene rpmC 161384 161575 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_03320 161572 161838 gene locus_tag LOCUS_03330 gene rpsQ 161572 161838 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_03330 161969 162337 gene locus_tag LOCUS_03340 gene rplN 161969 162337 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 protein_id gnl|my_center|LOCUS_03340 162347 162664 gene locus_tag LOCUS_03350 gene rplX 162347 162664 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_03350 162674 163213 gene locus_tag LOCUS_03360 gene rplE 162674 163213 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202757.1 protein_id gnl|my_center|LOCUS_03360 163220 163525 gene locus_tag LOCUS_03370 gene rpsN 163220 163525 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_03370 163541 163936 gene locus_tag LOCUS_03380 gene rpsH 163541 163936 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_03380 163946 164482 gene locus_tag LOCUS_03390 gene rplF 163946 164482 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064757.1 protein_id gnl|my_center|LOCUS_03390 164493 164849 gene locus_tag LOCUS_03400 gene rplR 164493 164849 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_03400 164877 165401 gene locus_tag LOCUS_03410 gene rpsE 164877 165401 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_03410 165405 165587 gene locus_tag LOCUS_03420 gene rpmD 165405 165587 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_03420 165589 166023 gene locus_tag LOCUS_03430 gene rplO 165589 166023 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_03430 166047 167372 gene locus_tag LOCUS_03440 gene secY 166047 167372 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_03440 167374 167592 gene locus_tag LOCUS_03450 gene infA 167374 167592 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_03450 167863 168225 gene locus_tag LOCUS_03460 gene rpsM 167863 168225 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_03460 168246 168641 gene locus_tag LOCUS_03470 gene rpsK 168246 168641 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_03470 168654 169283 gene locus_tag LOCUS_03480 gene rpsD 168654 169283 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_03480 169322 170296 gene locus_tag LOCUS_03490 gene rpoA 169322 170296 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_03490 170327 170719 gene locus_tag LOCUS_03500 gene rplQ 170327 170719 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_03500 172746 170917 gene locus_tag LOCUS_03510 172746 170917 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_03510 172949 173746 gene locus_tag LOCUS_03520 172949 173746 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 protein_id gnl|my_center|LOCUS_03520 173759 176110 gene locus_tag LOCUS_03530 173759 176110 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_03530 176198 177514 gene locus_tag LOCUS_03540 176198 177514 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 protein_id gnl|my_center|LOCUS_03540 177511 179439 gene locus_tag LOCUS_03550 177511 179439 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064156.1 protein_id gnl|my_center|LOCUS_03550 179432 179830 gene locus_tag LOCUS_03560 179432 179830 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_03560 179990 180229 gene locus_tag LOCUS_03570 179990 180229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 180226 180672 gene locus_tag LOCUS_03580 180226 180672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 181009 180683 gene locus_tag LOCUS_03590 181009 180683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 181040 182350 gene locus_tag LOCUS_03600 181040 182350 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_03600 182559 184946 gene locus_tag LOCUS_03610 182559 184946 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064157.1 protein_id gnl|my_center|LOCUS_03610 184967 186169 gene locus_tag LOCUS_03620 184967 186169 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810108.1 protein_id gnl|my_center|LOCUS_03620 186325 186939 gene locus_tag LOCUS_03630 186325 186939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 186960 187637 gene locus_tag LOCUS_03640 186960 187637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 188070 187642 gene locus_tag LOCUS_03650 188070 187642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 188054 188437 gene locus_tag LOCUS_03660 188054 188437 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_03660 188437 190488 gene locus_tag LOCUS_03670 gene recG 188437 190488 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446218.1 protein_id gnl|my_center|LOCUS_03670 190628 190894 gene locus_tag LOCUS_03680 190628 190894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 191081 192961 gene locus_tag LOCUS_03690 191081 192961 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence03 451 254 gene locus_tag LOCUS_03700 451 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 688 1524 gene locus_tag LOCUS_03710 688 1524 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_03710 2706 1813 gene locus_tag LOCUS_03720 2706 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3533 2703 gene locus_tag LOCUS_03730 3533 2703 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225730.1 protein_id gnl|my_center|LOCUS_03730 4590 3526 gene locus_tag LOCUS_03740 4590 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5303 4593 gene locus_tag LOCUS_03750 5303 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762387.1 protein_id gnl|my_center|LOCUS_03750 5931 5323 gene locus_tag LOCUS_03760 5931 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 8045 5928 gene locus_tag LOCUS_03770 8045 5928 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899536.1 protein_id gnl|my_center|LOCUS_03770 8679 8068 gene locus_tag LOCUS_03780 8679 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 8771 9496 gene locus_tag LOCUS_03790 8771 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9515 10699 gene locus_tag LOCUS_03800 9515 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 10696 10998 gene locus_tag LOCUS_03810 10696 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 11513 11046 gene locus_tag LOCUS_03820 11513 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12003 11563 gene locus_tag LOCUS_03830 12003 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 14202 12214 gene locus_tag LOCUS_03840 14202 12214 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_03840 14361 15137 gene locus_tag LOCUS_03850 gene yaaA 14361 15137 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186203.1 protein_id gnl|my_center|LOCUS_03850 15186 17000 gene locus_tag LOCUS_03860 15186 17000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_03860 18760 17468 gene locus_tag LOCUS_03870 18760 17468 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 protein_id gnl|my_center|LOCUS_03870 19083 18760 gene locus_tag LOCUS_03880 19083 18760 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925868.1 protein_id gnl|my_center|LOCUS_03880 19630 19950 gene locus_tag LOCUS_03890 19630 19950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 20035 20373 gene locus_tag LOCUS_03900 20035 20373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 20852 21079 gene locus_tag LOCUS_03910 20852 21079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 21076 21423 gene locus_tag LOCUS_03920 21076 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 21686 21943 gene locus_tag LOCUS_03930 21686 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21943 22338 gene locus_tag LOCUS_03940 21943 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 22788 22504 gene locus_tag LOCUS_03950 22788 22504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 23830 22799 gene locus_tag LOCUS_03960 gene cas1 23830 22799 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_03960 24134 23847 gene locus_tag LOCUS_03970 24134 23847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 24285 25441 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatccctttgttttcagggctggttactgac 26478 25447 gene locus_tag LOCUS_03980 gene cas6 26478 25447 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_03980 27744 26674 gene locus_tag LOCUS_03990 gene csx2 27744 26674 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_03990 28993 27830 gene locus_tag LOCUS_04000 28993 27830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 29352 28993 gene locus_tag LOCUS_04010 29352 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 30266 29349 gene locus_tag LOCUS_04020 gene cmr4 30266 29349 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880204.1 protein_id gnl|my_center|LOCUS_04020 31499 30336 gene locus_tag LOCUS_04030 31499 30336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 34390 31496 gene locus_tag LOCUS_04040 34390 31496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 35499 34387 gene locus_tag LOCUS_04050 35499 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 35917 35663 gene locus_tag LOCUS_04060 35917 35663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 37232 36057 gene locus_tag LOCUS_04070 gene csx2 37232 36057 CDS product TIGR02221 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582979.1 protein_id gnl|my_center|LOCUS_04070 38413 37229 gene locus_tag LOCUS_04080 38413 37229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 40122 39166 gene locus_tag LOCUS_04090 40122 39166 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190691.1 protein_id gnl|my_center|LOCUS_04090 40403 40143 gene locus_tag LOCUS_04100 40403 40143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 42828 40471 gene locus_tag LOCUS_04110 gene katE 42828 40471 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 protein_id gnl|my_center|LOCUS_04110 43436 42873 gene locus_tag LOCUS_04120 43436 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 43832 44104 gene locus_tag LOCUS_04130 43832 44104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 44521 44000 gene locus_tag LOCUS_04140 44521 44000 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_04140 45651 44674 gene locus_tag LOCUS_04150 45651 44674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_04150 46342 46494 gene locus_tag LOCUS_04160 46342 46494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 46515 47351 gene locus_tag LOCUS_04170 46515 47351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 47460 48740 gene locus_tag LOCUS_04180 47460 48740 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 protein_id gnl|my_center|LOCUS_04180 48966 50129 gene locus_tag LOCUS_04190 48966 50129 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_04190 50218 50574 gene locus_tag LOCUS_04200 50218 50574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 50798 51310 gene locus_tag LOCUS_04210 50798 51310 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811345.1 protein_id gnl|my_center|LOCUS_04210 51307 52086 gene locus_tag LOCUS_04220 51307 52086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 52083 52682 gene locus_tag LOCUS_04230 52083 52682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04230 52876 53286 gene locus_tag LOCUS_04240 52876 53286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 54933 53386 gene locus_tag LOCUS_04250 54933 53386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 55581 55084 gene locus_tag LOCUS_04260 55581 55084 CDS product alternative oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261331.1 protein_id gnl|my_center|LOCUS_04260 56454 55633 gene locus_tag LOCUS_04270 56454 55633 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_04270 57549 56596 gene locus_tag LOCUS_04280 57549 56596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 57728 57489 gene locus_tag LOCUS_04290 57728 57489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 58204 57938 gene locus_tag LOCUS_04300 58204 57938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 59042 58605 gene locus_tag LOCUS_04310 59042 58605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 59437 59039 gene locus_tag LOCUS_04320 59437 59039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 59914 59543 gene locus_tag LOCUS_04330 59914 59543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 60305 60511 gene locus_tag LOCUS_04340 60305 60511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 60894 61490 gene locus_tag LOCUS_04350 60894 61490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 61465 61656 gene locus_tag LOCUS_04360 61465 61656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 62386 61793 gene locus_tag LOCUS_04370 62386 61793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 62970 63710 gene locus_tag LOCUS_04380 62970 63710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 63818 64258 gene locus_tag LOCUS_04390 63818 64258 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092588120.1 protein_id gnl|my_center|LOCUS_04390 65040 64546 gene locus_tag LOCUS_04400 65040 64546 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236777.1 protein_id gnl|my_center|LOCUS_04400 65628 65128 gene locus_tag LOCUS_04410 65628 65128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 66684 65878 gene locus_tag LOCUS_04420 gene pstB 66684 65878 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_04420 67582 66767 gene locus_tag LOCUS_04430 gene pstB 67582 66767 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_04430 68466 67576 gene locus_tag LOCUS_04440 gene pstA 68466 67576 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_04440 69420 68470 gene locus_tag LOCUS_04450 69420 68470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 70483 69422 gene locus_tag LOCUS_04460 70483 69422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 71438 70563 gene locus_tag LOCUS_04470 71438 70563 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939747.1 protein_id gnl|my_center|LOCUS_04470 71705 73288 gene locus_tag LOCUS_04480 71705 73288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 73299 73901 gene locus_tag LOCUS_04490 gene fixJ 73299 73901 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 protein_id gnl|my_center|LOCUS_04490 74058 75998 gene locus_tag LOCUS_04500 74058 75998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085303.1 protein_id gnl|my_center|LOCUS_04500 76010 77671 gene locus_tag LOCUS_04510 76010 77671 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085302.1 protein_id gnl|my_center|LOCUS_04510 78439 77819 gene locus_tag LOCUS_04520 gene cobC 78439 77819 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_04520 79149 78472 gene locus_tag LOCUS_04530 gene can 79149 78472 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_04530 81301 79409 gene locus_tag LOCUS_04540 81301 79409 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_04540 81897 81391 gene locus_tag LOCUS_04550 81897 81391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 82877 81894 gene locus_tag LOCUS_04560 82877 81894 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947898.1 protein_id gnl|my_center|LOCUS_04560 83300 82944 gene locus_tag LOCUS_04570 83300 82944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 83417 84328 gene locus_tag LOCUS_04580 gene nhaR 83417 84328 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_04580 84966 85763 gene locus_tag LOCUS_04590 84966 85763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929178.1 protein_id gnl|my_center|LOCUS_04590 86085 86609 gene locus_tag LOCUS_04600 86085 86609 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351315.1 protein_id gnl|my_center|LOCUS_04600 87603 86686 gene locus_tag LOCUS_04610 87603 86686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 88520 87624 gene locus_tag LOCUS_04620 88520 87624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 90352 88658 gene locus_tag LOCUS_04630 90352 88658 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_04630 90915 90367 gene locus_tag LOCUS_04640 90915 90367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 91095 90946 gene locus_tag LOCUS_04650 91095 90946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 91446 92441 gene locus_tag LOCUS_04660 91446 92441 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969128.1 protein_id gnl|my_center|LOCUS_04660 92441 93364 gene locus_tag LOCUS_04670 92441 93364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 93794 93444 gene locus_tag LOCUS_04680 gene erpA 93794 93444 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_04680 95266 94238 gene locus_tag LOCUS_04690 gene argC 95266 94238 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_04690 95756 95364 gene locus_tag LOCUS_04700 gene rpsI 95756 95364 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_04700 96194 95766 gene locus_tag LOCUS_04710 gene rplM 96194 95766 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_04710 96706 97179 gene locus_tag LOCUS_04720 96706 97179 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943286.1 protein_id gnl|my_center|LOCUS_04720 97477 98037 gene locus_tag LOCUS_04730 97477 98037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 98340 99344 gene locus_tag LOCUS_04740 98340 99344 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_04740 99475 100395 gene locus_tag LOCUS_04750 99475 100395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 100659 102332 gene locus_tag LOCUS_04760 100659 102332 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_04760 103717 102458 gene locus_tag LOCUS_04770 103717 102458 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_04770 105305 103854 gene locus_tag LOCUS_04780 105305 103854 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 protein_id gnl|my_center|LOCUS_04780 108076 105560 gene locus_tag LOCUS_04790 108076 105560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 108311 108628 gene locus_tag LOCUS_04800 108311 108628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 108625 110019 gene locus_tag LOCUS_04810 108625 110019 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_04810 110090 111202 gene locus_tag LOCUS_04820 110090 111202 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965440.1 protein_id gnl|my_center|LOCUS_04820 111199 114273 gene locus_tag LOCUS_04830 111199 114273 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090047.1 protein_id gnl|my_center|LOCUS_04830 114398 114904 gene locus_tag LOCUS_04840 114398 114904 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_04840 114897 115193 gene locus_tag LOCUS_04850 114897 115193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 115190 115483 gene locus_tag LOCUS_04860 115190 115483 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_04860 115536 116549 gene locus_tag LOCUS_04870 115536 116549 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_04870 116546 116866 gene locus_tag LOCUS_04880 116546 116866 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_04880 116882 118639 gene locus_tag LOCUS_04890 116882 118639 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_04890 118847 120289 gene locus_tag LOCUS_04900 118847 120289 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_04900 120374 121654 gene locus_tag LOCUS_04910 120374 121654 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809776.1 protein_id gnl|my_center|LOCUS_04910 122162 121755 gene locus_tag LOCUS_04920 122162 121755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 122421 122924 gene locus_tag LOCUS_04930 122421 122924 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_04930 123021 123275 gene locus_tag LOCUS_04940 123021 123275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 123447 124310 gene locus_tag LOCUS_04950 123447 124310 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807491.1 protein_id gnl|my_center|LOCUS_04950 124344 124793 gene locus_tag LOCUS_04960 124344 124793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 124824 126059 gene locus_tag LOCUS_04970 124824 126059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 126074 127486 gene locus_tag LOCUS_04980 126074 127486 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_04980 127503 129077 gene locus_tag LOCUS_04990 127503 129077 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817405.1 protein_id gnl|my_center|LOCUS_04990 129858 129115 gene locus_tag LOCUS_05000 129858 129115 CDS product DUF2894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198086.1 protein_id gnl|my_center|LOCUS_05000 130495 129851 gene locus_tag LOCUS_05010 130495 129851 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064407.1 protein_id gnl|my_center|LOCUS_05010 132429 130495 gene locus_tag LOCUS_05020 132429 130495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 132875 132426 gene locus_tag LOCUS_05030 132875 132426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 133035 133370 gene locus_tag LOCUS_05040 133035 133370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 133832 133497 gene locus_tag LOCUS_05050 133832 133497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 134174 135352 gene locus_tag LOCUS_05060 134174 135352 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_05060 135349 138426 gene locus_tag LOCUS_05070 135349 138426 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_05070 138565 138948 gene locus_tag LOCUS_05080 138565 138948 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_05080 138962 140686 gene locus_tag LOCUS_05090 138962 140686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 142988 140784 gene locus_tag LOCUS_05100 gene plpD 142988 140784 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_05100 143218 142985 gene locus_tag LOCUS_05110 143218 142985 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 protein_id gnl|my_center|LOCUS_05110 144844 143291 gene locus_tag LOCUS_05120 144844 143291 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_05120 145901 144918 gene locus_tag LOCUS_05130 145901 144918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 147421 146105 gene locus_tag LOCUS_05140 147421 146105 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039169.1 protein_id gnl|my_center|LOCUS_05140 148164 147418 gene locus_tag LOCUS_05150 148164 147418 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814239.1 protein_id gnl|my_center|LOCUS_05150 148331 148837 gene locus_tag LOCUS_05160 148331 148837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 149134 149059 gene locus_tag LOCUS_t00070 149134 149059 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 149219 149143 gene locus_tag LOCUS_t00080 149219 149143 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 149192 150715 gene locus_tag LOCUS_05170 149192 150715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 149371 149295 gene locus_tag LOCUS_t00090 149371 149295 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 152145 150970 gene locus_tag LOCUS_05180 152145 150970 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039217.1 protein_id gnl|my_center|LOCUS_05180 153066 152200 gene locus_tag LOCUS_05190 153066 152200 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553932.1 protein_id gnl|my_center|LOCUS_05190 153511 156084 gene locus_tag LOCUS_05200 153511 156084 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057914.1 protein_id gnl|my_center|LOCUS_05200 158133 156175 gene locus_tag LOCUS_05210 158133 156175 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389479.1 protein_id gnl|my_center|LOCUS_05210 159353 158145 gene locus_tag LOCUS_05220 gene glgA 159353 158145 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_05220 159583 160260 gene locus_tag LOCUS_05230 gene tsaB 159583 160260 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 protein_id gnl|my_center|LOCUS_05230 160257 160733 gene locus_tag LOCUS_05240 gene rimI 160257 160733 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_05240 160730 161587 gene locus_tag LOCUS_05250 160730 161587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 161675 162319 gene locus_tag LOCUS_05260 161675 162319 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_05260 162322 163203 gene locus_tag LOCUS_05270 162322 163203 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_05270 163203 163700 gene locus_tag LOCUS_05280 163203 163700 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_05280 164383 163859 gene locus_tag LOCUS_05290 164383 163859 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195800.1 protein_id gnl|my_center|LOCUS_05290 165731 164469 gene locus_tag LOCUS_05300 gene lplT 165731 164469 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_05300 165890 166792 gene locus_tag LOCUS_05310 165890 166792 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_05310 166792 167898 gene locus_tag LOCUS_05320 gene alr 166792 167898 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191260.1 protein_id gnl|my_center|LOCUS_05320 167901 169280 gene locus_tag LOCUS_05330 gene radA 167901 169280 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_05330 170079 169465 gene locus_tag LOCUS_05340 170079 169465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 170445 172985 gene locus_tag LOCUS_05350 170445 172985 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_05350 173133 174104 gene locus_tag LOCUS_05360 173133 174104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 174444 174286 gene locus_tag LOCUS_05370 174444 174286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 175784 174612 gene locus_tag LOCUS_05380 175784 174612 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_05380 176956 175841 gene locus_tag LOCUS_05390 176956 175841 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence04 890 732 gene locus_tag LOCUS_05400 890 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 883 1131 gene locus_tag LOCUS_05410 883 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 1217 2632 gene locus_tag LOCUS_05420 1217 2632 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_05420 3722 2787 gene locus_tag LOCUS_05430 3722 2787 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_05430 4808 3732 gene locus_tag LOCUS_05440 4808 3732 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926819.1 protein_id gnl|my_center|LOCUS_05440 5704 4805 gene locus_tag LOCUS_05450 gene cysW 5704 4805 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118746.1 protein_id gnl|my_center|LOCUS_05450 6540 5704 gene locus_tag LOCUS_05460 gene cysT 6540 5704 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 protein_id gnl|my_center|LOCUS_05460 7550 6540 gene locus_tag LOCUS_05470 7550 6540 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522973.1 protein_id gnl|my_center|LOCUS_05470 8716 7709 gene locus_tag LOCUS_05480 8716 7709 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_05480 8830 9012 gene locus_tag LOCUS_05490 8830 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 8975 9145 gene locus_tag LOCUS_05500 8975 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 9188 10153 gene locus_tag LOCUS_05510 9188 10153 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_05510 10864 10262 gene locus_tag LOCUS_05520 10864 10262 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970934.1 protein_id gnl|my_center|LOCUS_05520 12029 10893 gene locus_tag LOCUS_05530 12029 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533560.1 protein_id gnl|my_center|LOCUS_05530 14744 12051 gene locus_tag LOCUS_05540 14744 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 15147 15854 gene locus_tag LOCUS_05550 15147 15854 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926772.1 protein_id gnl|my_center|LOCUS_05550 16237 17910 gene locus_tag LOCUS_05560 16237 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 18736 17966 gene locus_tag LOCUS_05570 18736 17966 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_05570 19448 18714 gene locus_tag LOCUS_05580 gene aat 19448 18714 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521636.1 protein_id gnl|my_center|LOCUS_05580 20554 19445 gene locus_tag LOCUS_05590 20554 19445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_05590 20678 22312 gene locus_tag LOCUS_05600 20678 22312 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_05600 23386 22361 gene locus_tag LOCUS_05610 23386 22361 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_05610 24041 23532 gene locus_tag LOCUS_05620 24041 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 24389 25384 gene locus_tag LOCUS_05630 24389 25384 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_05630 25416 26558 gene locus_tag LOCUS_05640 25416 26558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 26602 28500 gene locus_tag LOCUS_05650 26602 28500 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_05650 28650 29456 gene locus_tag LOCUS_05660 28650 29456 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_05660 29523 31442 gene locus_tag LOCUS_05670 29523 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 32377 31514 gene locus_tag LOCUS_05680 gene fghA 32377 31514 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 protein_id gnl|my_center|LOCUS_05680 33490 32378 gene locus_tag LOCUS_05690 33490 32378 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766009.1 protein_id gnl|my_center|LOCUS_05690 34050 33577 gene locus_tag LOCUS_05700 34050 33577 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 protein_id gnl|my_center|LOCUS_05700 34147 34061 gene locus_tag LOCUS_t00100 34147 34061 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34294 34219 gene locus_tag LOCUS_t00110 34294 34219 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34930 34397 gene locus_tag LOCUS_05710 34930 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 36613 35108 gene locus_tag LOCUS_05720 36613 35108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096548.1 protein_id gnl|my_center|LOCUS_05720 37317 37063 gene locus_tag LOCUS_05730 37317 37063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 37660 38151 gene locus_tag LOCUS_05740 37660 38151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 38167 38550 gene locus_tag LOCUS_05750 38167 38550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 38608 38970 gene locus_tag LOCUS_05760 38608 38970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05760 39087 39344 gene locus_tag LOCUS_05770 39087 39344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05770 40496 39570 gene locus_tag LOCUS_05780 40496 39570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 41045 40497 gene locus_tag LOCUS_05790 41045 40497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 41345 41929 gene locus_tag LOCUS_05800 41345 41929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 41871 42302 gene locus_tag LOCUS_05810 41871 42302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 42755 42381 gene locus_tag LOCUS_05820 42755 42381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 42953 42825 gene locus_tag LOCUS_05830 42953 42825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 44091 43525 gene locus_tag LOCUS_05840 44091 43525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 44557 44123 gene locus_tag LOCUS_05850 44557 44123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 44594 44917 gene locus_tag LOCUS_05860 44594 44917 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806936.1 protein_id gnl|my_center|LOCUS_05860 44937 46700 gene locus_tag LOCUS_05870 gene dsbD 44937 46700 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931570.1 protein_id gnl|my_center|LOCUS_05870 48035 46707 gene locus_tag LOCUS_05880 48035 46707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 50031 48127 gene locus_tag LOCUS_05890 50031 48127 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_05890 52066 50165 gene locus_tag LOCUS_05900 52066 50165 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_05900 52413 53783 gene locus_tag LOCUS_05910 52413 53783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 55090 53810 gene locus_tag LOCUS_05920 gene hemL 55090 53810 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_05920 55730 55062 gene locus_tag LOCUS_05930 gene thiE 55730 55062 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_05930 56559 55723 gene locus_tag LOCUS_05940 56559 55723 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_05940 56667 56864 gene locus_tag LOCUS_05950 56667 56864 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_05950 56965 57360 gene locus_tag LOCUS_05960 gene pilG 56965 57360 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_05960 57406 57768 gene locus_tag LOCUS_05970 gene pilH 57406 57768 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_05970 57783 58292 gene locus_tag LOCUS_05980 57783 58292 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_05980 58365 60530 gene locus_tag LOCUS_05990 gene pilJ 58365 60530 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_05990 60557 65923 gene locus_tag LOCUS_06000 60557 65923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 67358 65901 gene locus_tag LOCUS_06010 67358 65901 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_06010 67406 67966 gene locus_tag LOCUS_06020 67406 67966 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_06020 67959 68465 gene locus_tag LOCUS_06030 gene ruvX 67959 68465 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 protein_id gnl|my_center|LOCUS_06030 68437 68958 gene locus_tag LOCUS_06040 gene pyrR 68437 68958 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_06040 68951 69910 gene locus_tag LOCUS_06050 68951 69910 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_06050 69914 71314 gene locus_tag LOCUS_06060 69914 71314 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_06060 71621 71331 gene locus_tag LOCUS_06070 71621 71331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 72164 71625 gene locus_tag LOCUS_06080 72164 71625 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814933.1 protein_id gnl|my_center|LOCUS_06080 72979 72164 gene locus_tag LOCUS_06090 gene proC 72979 72164 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_06090 73659 72976 gene locus_tag LOCUS_06100 73659 72976 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_06100 73728 74774 gene locus_tag LOCUS_06110 73728 74774 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_06110 74802 75938 gene locus_tag LOCUS_06120 74802 75938 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_06120 76861 75944 gene locus_tag LOCUS_06130 76861 75944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 77051 77557 gene locus_tag LOCUS_06140 77051 77557 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_06140 77551 78165 gene locus_tag LOCUS_06150 77551 78165 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266582.1 protein_id gnl|my_center|LOCUS_06150 78153 78677 gene locus_tag LOCUS_06160 78153 78677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 78681 79727 gene locus_tag LOCUS_06170 78681 79727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 79715 80377 gene locus_tag LOCUS_06180 79715 80377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 80393 83794 gene locus_tag LOCUS_06190 80393 83794 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213223.1 protein_id gnl|my_center|LOCUS_06190 83805 84170 gene locus_tag LOCUS_06200 83805 84170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 84615 85517 gene locus_tag LOCUS_06210 84615 85517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 85627 86790 gene locus_tag LOCUS_06220 85627 86790 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_06220 86798 89905 gene locus_tag LOCUS_06230 86798 89905 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_06230 89977 90594 gene locus_tag LOCUS_06240 89977 90594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 92358 90682 gene locus_tag LOCUS_06250 gene fadD 92358 90682 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_06250 93001 92678 gene locus_tag LOCUS_06260 93001 92678 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_06260 93191 93517 gene locus_tag LOCUS_06270 gene trxA 93191 93517 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_06270 93766 94974 gene locus_tag LOCUS_06280 gene rho 93766 94974 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_06280 95161 95376 gene locus_tag LOCUS_06290 gene rpmE 95161 95376 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_06290 95505 97124 gene locus_tag LOCUS_06300 95505 97124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063980.1 protein_id gnl|my_center|LOCUS_06300 97701 97156 gene locus_tag LOCUS_06310 gene orn 97701 97156 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271546.1 protein_id gnl|my_center|LOCUS_06310 97745 98983 gene locus_tag LOCUS_06320 97745 98983 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189931.1 protein_id gnl|my_center|LOCUS_06320 99008 99352 gene locus_tag LOCUS_06330 99008 99352 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_06330 99349 100215 gene locus_tag LOCUS_06340 gene rsgA 99349 100215 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_06340 100233 100511 gene locus_tag LOCUS_06350 100233 100511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 100805 100545 gene locus_tag LOCUS_06360 100805 100545 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_06360 100884 102407 gene locus_tag LOCUS_06370 100884 102407 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_06370 103278 102505 gene locus_tag LOCUS_06380 103278 102505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706124.1 protein_id gnl|my_center|LOCUS_06380 103973 103326 gene locus_tag LOCUS_06390 103973 103326 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_06390 105301 104084 gene locus_tag LOCUS_06400 105301 104084 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_06400 106113 105544 gene locus_tag LOCUS_06410 106113 105544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 106274 108259 gene locus_tag LOCUS_06420 106274 108259 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 protein_id gnl|my_center|LOCUS_06420 108377 108796 gene locus_tag LOCUS_06430 108377 108796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 108841 109401 gene locus_tag LOCUS_06440 108841 109401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 109546 109881 gene locus_tag LOCUS_06450 gene rpsO 109546 109881 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_06450 110067 112181 gene locus_tag LOCUS_06460 gene pnp 110067 112181 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_06460 112708 112283 gene locus_tag LOCUS_06470 gene dksA 112708 112283 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095632.1 protein_id gnl|my_center|LOCUS_06470 113418 112798 gene locus_tag LOCUS_06480 113418 112798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 114162 113422 gene locus_tag LOCUS_06490 114162 113422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 116285 114282 gene locus_tag LOCUS_06500 116285 114282 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_06500 116762 116376 gene locus_tag LOCUS_06510 116762 116376 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_06510 117884 116856 gene locus_tag LOCUS_06520 117884 116856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 118277 118492 gene locus_tag LOCUS_06530 118277 118492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 118606 119454 gene locus_tag LOCUS_06540 gene fabI 118606 119454 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_06540 120664 119480 gene locus_tag LOCUS_06550 120664 119480 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061605.1 protein_id gnl|my_center|LOCUS_06550 122078 120666 gene locus_tag LOCUS_06560 122078 120666 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 protein_id gnl|my_center|LOCUS_06560 122317 122886 gene locus_tag LOCUS_06570 122317 122886 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931004.1 protein_id gnl|my_center|LOCUS_06570 124124 122988 gene locus_tag LOCUS_06580 124124 122988 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329385.1 protein_id gnl|my_center|LOCUS_06580 124884 124267 gene locus_tag LOCUS_06590 124884 124267 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_06590 125804 124908 gene locus_tag LOCUS_06600 125804 124908 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_06600 126865 125918 gene locus_tag LOCUS_06610 gene cbiB 126865 125918 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 protein_id gnl|my_center|LOCUS_06610 126909 128387 gene locus_tag LOCUS_06620 126909 128387 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038176.1 protein_id gnl|my_center|LOCUS_06620 128934 128470 gene locus_tag LOCUS_06630 128934 128470 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023219.1 protein_id gnl|my_center|LOCUS_06630 129647 129015 gene locus_tag LOCUS_06640 gene cobU 129647 129015 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_06640 129626 130660 gene locus_tag LOCUS_06650 gene cobT 129626 130660 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_06650 130755 131075 gene locus_tag LOCUS_06660 130755 131075 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943418.1 protein_id gnl|my_center|LOCUS_06660 132001 131189 gene locus_tag LOCUS_06670 132001 131189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 133624 132377 gene locus_tag LOCUS_06680 133624 132377 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_06680 134157 133753 gene locus_tag LOCUS_06690 134157 133753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 134418 134753 gene locus_tag LOCUS_06700 134418 134753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 135582 134812 gene locus_tag LOCUS_06710 135582 134812 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_06710 136721 135579 gene locus_tag LOCUS_06720 gene bamC 136721 135579 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_06720 137579 136737 gene locus_tag LOCUS_06730 gene dapA 137579 136737 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_06730 138659 137733 gene locus_tag LOCUS_06740 138659 137733 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_06740 138770 139696 gene locus_tag LOCUS_06750 138770 139696 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_06750 139696 140670 gene locus_tag LOCUS_06760 139696 140670 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_06760 140699 142639 gene locus_tag LOCUS_06770 gene tgpA 140699 142639 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_06770 142636 143637 gene locus_tag LOCUS_06780 gene mltB 142636 143637 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_06780 144590 143634 gene locus_tag LOCUS_06790 gene rpoS 144590 143634 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_06790 145570 144593 gene locus_tag LOCUS_06800 145570 144593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 146226 145567 gene locus_tag LOCUS_06810 146226 145567 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928874.1 protein_id gnl|my_center|LOCUS_06810 146966 146223 gene locus_tag LOCUS_06820 gene surE 146966 146223 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_06820 147481 148971 gene locus_tag LOCUS_06830 147481 148971 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_06830 149059 149430 gene locus_tag LOCUS_06840 149059 149430 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073120.1 protein_id gnl|my_center|LOCUS_06840 149470 150876 gene locus_tag LOCUS_06850 gene fliD 149470 150876 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 protein_id gnl|my_center|LOCUS_06850 150886 151299 gene locus_tag LOCUS_06860 gene fliS 150886 151299 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 protein_id gnl|my_center|LOCUS_06860 151296 151619 gene locus_tag LOCUS_06870 151296 151619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 151616 152776 gene locus_tag LOCUS_06880 151616 152776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 152835 153158 gene locus_tag LOCUS_06890 152835 153158 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930342.1 protein_id gnl|my_center|LOCUS_06890 153235 154038 gene locus_tag LOCUS_06900 153235 154038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence05 385 636 gene locus_tag LOCUS_06910 385 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 626 1075 gene locus_tag LOCUS_06920 626 1075 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_06920 1089 3488 gene locus_tag LOCUS_06930 1089 3488 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_06930 4776 6809 gene locus_tag LOCUS_06940 4776 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7506 8069 gene locus_tag LOCUS_06950 7506 8069 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245797.1 protein_id gnl|my_center|LOCUS_06950 8202 9452 gene locus_tag LOCUS_06960 gene purT 8202 9452 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186479.1 protein_id gnl|my_center|LOCUS_06960 9705 9511 gene locus_tag LOCUS_06970 9705 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 10095 10676 gene locus_tag LOCUS_06980 10095 10676 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_06980 10695 11117 gene locus_tag LOCUS_06990 10695 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11223 11693 gene locus_tag LOCUS_07000 11223 11693 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 protein_id gnl|my_center|LOCUS_07000 11872 11708 gene locus_tag LOCUS_07010 11872 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 12001 12732 gene locus_tag LOCUS_07020 12001 12732 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_07020 12838 13188 gene locus_tag LOCUS_07030 12838 13188 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_07030 13190 13909 gene locus_tag LOCUS_07040 13190 13909 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_07040 13918 14817 gene locus_tag LOCUS_07050 13918 14817 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_07050 14942 16321 gene locus_tag LOCUS_07060 14942 16321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 16348 16902 gene locus_tag LOCUS_07070 16348 16902 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_07070 18978 17062 gene locus_tag LOCUS_07080 18978 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 19572 19075 gene locus_tag LOCUS_07090 19572 19075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 21136 19565 gene locus_tag LOCUS_07100 21136 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 21330 23570 gene locus_tag LOCUS_07110 21330 23570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07110 24231 24416 gene locus_tag LOCUS_07120 24231 24416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 24477 24800 gene locus_tag LOCUS_07130 24477 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 24837 25208 gene locus_tag LOCUS_07140 24837 25208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 25384 26517 gene locus_tag LOCUS_07150 25384 26517 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 protein_id gnl|my_center|LOCUS_07150 26522 28087 gene locus_tag LOCUS_07160 26522 28087 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462727.1 protein_id gnl|my_center|LOCUS_07160 28084 29217 gene locus_tag LOCUS_07170 28084 29217 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970506.1 protein_id gnl|my_center|LOCUS_07170 29225 30256 gene locus_tag LOCUS_07180 29225 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 30273 30713 gene locus_tag LOCUS_07190 30273 30713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 32210 31410 gene locus_tag LOCUS_07200 gene fabI 32210 31410 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_07200 32385 34547 gene locus_tag LOCUS_07210 32385 34547 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_07210 34608 35585 gene locus_tag LOCUS_07220 34608 35585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_07220 35585 37033 gene locus_tag LOCUS_07230 35585 37033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810154.1 protein_id gnl|my_center|LOCUS_07230 37030 39051 gene locus_tag LOCUS_07240 37030 39051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_07240 41158 39125 gene locus_tag LOCUS_07250 41158 39125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 41506 41430 gene locus_tag LOCUS_t00120 41506 41430 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 42680 41733 gene locus_tag LOCUS_07260 42680 41733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 43263 42835 gene locus_tag LOCUS_07270 gene dksA 43263 42835 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807164.1 protein_id gnl|my_center|LOCUS_07270 43651 43575 gene locus_tag LOCUS_t00130 43651 43575 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 44379 43765 gene locus_tag LOCUS_07280 gene lolA 44379 43765 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 protein_id gnl|my_center|LOCUS_07280 46793 44376 gene locus_tag LOCUS_07290 46793 44376 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_07290 47483 46818 gene locus_tag LOCUS_07300 47483 46818 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_07300 47692 48657 gene locus_tag LOCUS_07310 gene trxB 47692 48657 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_07310 48719 49288 gene locus_tag LOCUS_07320 48719 49288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07320 49661 49323 gene locus_tag LOCUS_07330 49661 49323 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_07330 51333 49723 gene locus_tag LOCUS_07340 51333 49723 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526341.1 protein_id gnl|my_center|LOCUS_07340 51947 51399 gene locus_tag LOCUS_07350 gene ppa 51947 51399 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_07350 52470 52060 gene locus_tag LOCUS_07360 52470 52060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 53223 52654 gene locus_tag LOCUS_07370 53223 52654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 53755 55089 gene locus_tag LOCUS_07380 53755 55089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 55554 55183 gene locus_tag LOCUS_07390 55554 55183 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_07390 56469 55624 gene locus_tag LOCUS_07400 gene panC 56469 55624 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815051.1 protein_id gnl|my_center|LOCUS_07400 57434 56622 gene locus_tag LOCUS_07410 gene panB 57434 56622 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_07410 58092 57439 gene locus_tag LOCUS_07420 58092 57439 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_07420 59231 58116 gene locus_tag LOCUS_07430 59231 58116 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_07430 59978 59484 gene locus_tag LOCUS_07440 59978 59484 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814348.1 protein_id gnl|my_center|LOCUS_07440 61478 60123 gene locus_tag LOCUS_07450 gene pcnB 61478 60123 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929702.1 protein_id gnl|my_center|LOCUS_07450 62236 61571 gene locus_tag LOCUS_07460 62236 61571 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_07460 62913 62257 gene locus_tag LOCUS_07470 gene hda 62913 62257 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065012.1 protein_id gnl|my_center|LOCUS_07470 63003 64100 gene locus_tag LOCUS_07480 gene purM 63003 64100 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_07480 64193 65032 gene locus_tag LOCUS_07490 64193 65032 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_07490 65214 66041 gene locus_tag LOCUS_07500 gene fabG 65214 66041 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_07500 66590 66141 gene locus_tag LOCUS_07510 66590 66141 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_07510 67728 66595 gene locus_tag LOCUS_07520 67728 66595 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_07520 67895 68476 gene locus_tag LOCUS_07530 67895 68476 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926460.1 protein_id gnl|my_center|LOCUS_07530 68484 68900 gene locus_tag LOCUS_07540 gene arfB 68484 68900 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_07540 68956 69504 gene locus_tag LOCUS_07550 68956 69504 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 protein_id gnl|my_center|LOCUS_07550 69527 69940 gene locus_tag LOCUS_07560 69527 69940 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_07560 71230 70010 gene locus_tag LOCUS_07570 gene chrA 71230 70010 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_07570 71401 72279 gene locus_tag LOCUS_07580 gene glxR 71401 72279 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392230.1 protein_id gnl|my_center|LOCUS_07580 72279 73154 gene locus_tag LOCUS_07590 72279 73154 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616194.1 protein_id gnl|my_center|LOCUS_07590 73151 73645 gene locus_tag LOCUS_07600 73151 73645 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112629.1 protein_id gnl|my_center|LOCUS_07600 73995 73777 gene locus_tag LOCUS_07610 73995 73777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 76903 74126 gene locus_tag LOCUS_07620 76903 74126 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_07620 78164 77076 gene locus_tag LOCUS_07630 78164 77076 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976857.1 protein_id gnl|my_center|LOCUS_07630 78637 78861 gene locus_tag LOCUS_07640 78637 78861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 79408 80127 gene locus_tag LOCUS_07650 79408 80127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 80214 80705 gene locus_tag LOCUS_07660 80214 80705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 82132 80786 gene locus_tag LOCUS_07670 82132 80786 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 protein_id gnl|my_center|LOCUS_07670 83904 82147 gene locus_tag LOCUS_07680 83904 82147 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105550.1 protein_id gnl|my_center|LOCUS_07680 84552 83929 gene locus_tag LOCUS_07690 84552 83929 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_07690 85107 84793 gene locus_tag LOCUS_07700 85107 84793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 86467 85001 gene locus_tag LOCUS_07710 86467 85001 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205437.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 86775 87860 gene locus_tag LOCUS_07720 gene mtnA 86775 87860 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_07720 87853 88497 gene locus_tag LOCUS_07730 87853 88497 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_07730 88530 90146 gene locus_tag LOCUS_07740 88530 90146 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_07740 90322 90537 gene locus_tag LOCUS_07750 90322 90537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 90548 91003 gene locus_tag LOCUS_07760 90548 91003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 91607 91071 gene locus_tag LOCUS_07770 91607 91071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 91899 92573 gene locus_tag LOCUS_07780 91899 92573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 92808 93122 gene locus_tag LOCUS_07790 gene soxZ 92808 93122 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881177.1 protein_id gnl|my_center|LOCUS_07790 93172 93483 gene locus_tag LOCUS_07800 93172 93483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 93495 94799 gene locus_tag LOCUS_07810 93495 94799 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_07810 94811 95341 gene locus_tag LOCUS_07820 94811 95341 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 protein_id gnl|my_center|LOCUS_07820 95670 96641 gene locus_tag LOCUS_07830 95670 96641 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114494.1 protein_id gnl|my_center|LOCUS_07830 96654 97484 gene locus_tag LOCUS_07840 96654 97484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402718.1 protein_id gnl|my_center|LOCUS_07840 97496 98314 gene locus_tag LOCUS_07850 97496 98314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203323.1 protein_id gnl|my_center|LOCUS_07850 99262 98477 gene locus_tag LOCUS_07860 99262 98477 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_07860 100251 99259 gene locus_tag LOCUS_07870 100251 99259 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_07870 100731 100264 gene locus_tag LOCUS_07880 100731 100264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 101379 100903 gene locus_tag LOCUS_07890 101379 100903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 102211 101381 gene locus_tag LOCUS_07900 102211 101381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 103090 102305 gene locus_tag LOCUS_07910 103090 102305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530488.1 protein_id gnl|my_center|LOCUS_07910 104112 103090 gene locus_tag LOCUS_07920 104112 103090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 104343 104861 gene locus_tag LOCUS_07930 104343 104861 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_07930 104883 105848 gene locus_tag LOCUS_07940 104883 105848 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184599.1 protein_id gnl|my_center|LOCUS_07940 105845 106066 gene locus_tag LOCUS_07950 105845 106066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 106219 107145 gene locus_tag LOCUS_07960 106219 107145 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184450.1 protein_id gnl|my_center|LOCUS_07960 107120 108946 gene locus_tag LOCUS_07970 107120 108946 CDS product family 2A encapsulin nanocompartment cargo protein cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536863.1 protein_id gnl|my_center|LOCUS_07970 110276 109071 gene locus_tag LOCUS_07980 110276 109071 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_07980 111775 110627 gene locus_tag LOCUS_07990 gene metX 111775 110627 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_07990 113097 111772 gene locus_tag LOCUS_08000 113097 111772 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_08000 113622 114356 gene locus_tag LOCUS_08010 113622 114356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08010 115213 114785 gene locus_tag LOCUS_08020 115213 114785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 115414 116226 gene locus_tag LOCUS_08030 115414 116226 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_08030 116246 116992 gene locus_tag LOCUS_08040 gene modA 116246 116992 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_08040 117156 117992 gene locus_tag LOCUS_08050 gene modD 117156 117992 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389418.1 protein_id gnl|my_center|LOCUS_08050 117998 118678 gene locus_tag LOCUS_08060 gene modB 117998 118678 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_08060 118675 119754 gene locus_tag LOCUS_08070 gene modC 118675 119754 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_08070 120123 120347 gene locus_tag LOCUS_08080 120123 120347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 120344 120640 gene locus_tag LOCUS_08090 120344 120640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 120637 121095 gene locus_tag LOCUS_08100 120637 121095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 121385 121167 gene locus_tag LOCUS_08110 121385 121167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08110 122452 121580 gene locus_tag LOCUS_08120 gene tauD 122452 121580 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530602.1 protein_id gnl|my_center|LOCUS_08120 123698 122826 gene locus_tag LOCUS_08130 123698 122826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 125540 123807 gene locus_tag LOCUS_08140 gene xsc 125540 123807 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 protein_id gnl|my_center|LOCUS_08140 126493 125750 gene locus_tag LOCUS_08150 126493 125750 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114714.1 protein_id gnl|my_center|LOCUS_08150 127188 126490 gene locus_tag LOCUS_08160 127188 126490 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114715.1 protein_id gnl|my_center|LOCUS_08160 127883 127185 gene locus_tag LOCUS_08170 127883 127185 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101388.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence06 498 1616 gene locus_tag LOCUS_08180 498 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2130 1849 gene locus_tag LOCUS_08190 2130 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2402 3481 gene locus_tag LOCUS_08200 gene moaA 2402 3481 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_08200 3570 5096 gene locus_tag LOCUS_08210 3570 5096 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_08210 6223 5117 gene locus_tag LOCUS_08220 6223 5117 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_08220 8745 6235 gene locus_tag LOCUS_08230 8745 6235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_08230 9404 8742 gene locus_tag LOCUS_08240 9404 8742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193988.1 protein_id gnl|my_center|LOCUS_08240 10737 9433 gene locus_tag LOCUS_08250 10737 9433 CDS product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 protein_id gnl|my_center|LOCUS_08250 11950 10742 gene locus_tag LOCUS_08260 11950 10742 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082409.1 protein_id gnl|my_center|LOCUS_08260 12488 12090 gene locus_tag LOCUS_08270 12488 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12725 12734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13569 12838 gene locus_tag LOCUS_08280 13569 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706121.1 protein_id gnl|my_center|LOCUS_08280 13680 15098 gene locus_tag LOCUS_08290 13680 15098 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198974.1 protein_id gnl|my_center|LOCUS_08290 15095 15598 gene locus_tag LOCUS_08300 15095 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084486.1 protein_id gnl|my_center|LOCUS_08300 15598 17205 gene locus_tag LOCUS_08310 15598 17205 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_08310 17219 18157 gene locus_tag LOCUS_08320 17219 18157 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817216.1 protein_id gnl|my_center|LOCUS_08320 18165 18902 gene locus_tag LOCUS_08330 18165 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 19094 19771 gene locus_tag LOCUS_08340 19094 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 22665 19876 gene locus_tag LOCUS_08350 gene ppc 22665 19876 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_08350 23206 24588 gene locus_tag LOCUS_08360 23206 24588 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_08360 24796 26325 gene locus_tag LOCUS_08370 24796 26325 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900746.1 protein_id gnl|my_center|LOCUS_08370 26341 27132 gene locus_tag LOCUS_08380 26341 27132 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 protein_id gnl|my_center|LOCUS_08380 27175 28140 gene locus_tag LOCUS_08390 27175 28140 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_08390 29173 28376 gene locus_tag LOCUS_08400 gene pstB 29173 28376 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941757.1 protein_id gnl|my_center|LOCUS_08400 30149 29205 gene locus_tag LOCUS_08410 gene pstA 30149 29205 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_08410 31117 30152 gene locus_tag LOCUS_08420 gene pstC 31117 30152 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140013.1 protein_id gnl|my_center|LOCUS_08420 32213 31209 gene locus_tag LOCUS_08430 32213 31209 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_08430 32806 32453 gene locus_tag LOCUS_08440 32806 32453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 33877 32849 gene locus_tag LOCUS_08450 33877 32849 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_08450 34152 34904 gene locus_tag LOCUS_08460 34152 34904 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_08460 34938 35759 gene locus_tag LOCUS_08470 34938 35759 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_08470 36127 35828 gene locus_tag LOCUS_08480 36127 35828 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605630.1 protein_id gnl|my_center|LOCUS_08480 36828 36145 gene locus_tag LOCUS_08490 36828 36145 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_08490 37266 39095 gene locus_tag LOCUS_08500 37266 39095 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_08500 40440 39499 gene locus_tag LOCUS_08510 40440 39499 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_08510 41341 40460 gene locus_tag LOCUS_08520 41341 40460 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_08520 42117 41338 gene locus_tag LOCUS_08530 42117 41338 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_08530 42359 42132 gene locus_tag LOCUS_08540 42359 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 42458 44395 gene locus_tag LOCUS_08550 42458 44395 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_08550 44662 44453 gene locus_tag LOCUS_08560 44662 44453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 45306 44659 gene locus_tag LOCUS_08570 45306 44659 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_08570 45655 46773 gene locus_tag LOCUS_08580 gene ald 45655 46773 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 protein_id gnl|my_center|LOCUS_08580 46886 47791 gene locus_tag LOCUS_08590 gene ubiA 46886 47791 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_08590 47788 48216 gene locus_tag LOCUS_08600 47788 48216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 48236 49699 gene locus_tag LOCUS_08610 gene ubiD 48236 49699 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_08610 49760 50161 gene locus_tag LOCUS_08620 49760 50161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 50253 51575 gene locus_tag LOCUS_08630 50253 51575 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_08630 51682 55893 gene locus_tag LOCUS_08640 51682 55893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 57292 55949 gene locus_tag LOCUS_08650 gene dacB 57292 55949 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_08650 58959 57481 gene locus_tag LOCUS_08660 58959 57481 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 protein_id gnl|my_center|LOCUS_08660 59746 59000 gene locus_tag LOCUS_08670 59746 59000 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_08670 61866 59797 gene locus_tag LOCUS_08680 61866 59797 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_08680 62580 61945 gene locus_tag LOCUS_08690 62580 61945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 62888 62577 gene locus_tag LOCUS_08700 62888 62577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 63379 62888 gene locus_tag LOCUS_08710 63379 62888 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_08710 65162 63459 gene locus_tag LOCUS_08720 gene hybC 65162 63459 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706347.1 protein_id gnl|my_center|LOCUS_08720 66355 65186 gene locus_tag LOCUS_08730 gene hybB 66355 65186 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 protein_id gnl|my_center|LOCUS_08730 67383 66358 gene locus_tag LOCUS_08740 gene hybA 67383 66358 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706349.1 protein_id gnl|my_center|LOCUS_08740 68557 67385 gene locus_tag LOCUS_08750 gene hybO 68557 67385 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706350.1 protein_id gnl|my_center|LOCUS_08750 69033 70466 gene locus_tag LOCUS_08760 69033 70466 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_08760 70517 70888 gene locus_tag LOCUS_08770 70517 70888 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_08770 72052 70934 gene locus_tag LOCUS_08780 72052 70934 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_08780 73039 72341 gene locus_tag LOCUS_08790 gene kdpE 73039 72341 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814052.1 protein_id gnl|my_center|LOCUS_08790 74514 73036 gene locus_tag LOCUS_08800 74514 73036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 74718 75176 gene locus_tag LOCUS_08810 74718 75176 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 protein_id gnl|my_center|LOCUS_08810 75553 75281 gene locus_tag LOCUS_08820 75553 75281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 77023 75797 gene locus_tag LOCUS_08830 77023 75797 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 protein_id gnl|my_center|LOCUS_08830 78714 77050 gene locus_tag LOCUS_08840 gene ettA 78714 77050 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_08840 79677 78889 gene locus_tag LOCUS_08850 gene fpr 79677 78889 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_08850 79764 80690 gene locus_tag LOCUS_08860 79764 80690 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_08860 80900 82201 gene locus_tag LOCUS_08870 80900 82201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 82223 83788 gene locus_tag LOCUS_08880 82223 83788 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_08880 83831 86758 gene locus_tag LOCUS_08890 83831 86758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 86890 87501 gene locus_tag LOCUS_08900 86890 87501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_08900 87645 87872 gene locus_tag LOCUS_08910 87645 87872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 87890 88540 gene locus_tag LOCUS_08920 87890 88540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 88512 90911 gene locus_tag LOCUS_08930 88512 90911 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188327.1 protein_id gnl|my_center|LOCUS_08930 91166 90879 gene locus_tag LOCUS_08940 91166 90879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 92455 91229 gene locus_tag LOCUS_08950 92455 91229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 92742 92494 gene locus_tag LOCUS_08960 92742 92494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 92713 92898 gene locus_tag LOCUS_08970 92713 92898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 93678 92848 gene locus_tag LOCUS_08980 93678 92848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 94573 93758 gene locus_tag LOCUS_08990 94573 93758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_08990 96700 94631 gene locus_tag LOCUS_09000 96700 94631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 99345 96763 gene locus_tag LOCUS_09010 99345 96763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 99869 99468 gene locus_tag LOCUS_09020 99869 99468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 100522 99920 gene locus_tag LOCUS_09030 100522 99920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 100670 100539 gene locus_tag LOCUS_09040 100670 100539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 100945 100739 gene locus_tag LOCUS_09050 100945 100739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 101273 100953 gene locus_tag LOCUS_09060 101273 100953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 102110 101292 gene locus_tag LOCUS_09070 102110 101292 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_09070 103297 102263 gene locus_tag LOCUS_09080 103297 102263 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930475.1 protein_id gnl|my_center|LOCUS_09080 105091 103418 gene locus_tag LOCUS_09090 105091 103418 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087509.1 protein_id gnl|my_center|LOCUS_09090 105923 105279 gene locus_tag LOCUS_09100 105923 105279 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967892.1 protein_id gnl|my_center|LOCUS_09100 107764 105920 gene locus_tag LOCUS_09110 107764 105920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 108185 107958 gene locus_tag LOCUS_09120 108185 107958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 108087 108458 gene locus_tag LOCUS_09130 108087 108458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 108667 109149 gene locus_tag LOCUS_09140 108667 109149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 109643 109176 gene locus_tag LOCUS_09150 109643 109176 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809250.1 protein_id gnl|my_center|LOCUS_09150 110903 109818 gene locus_tag LOCUS_09160 110903 109818 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_09160 111438 111025 gene locus_tag LOCUS_09170 111438 111025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 112333 111503 gene locus_tag LOCUS_09180 112333 111503 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 protein_id gnl|my_center|LOCUS_09180 112557 112243 gene locus_tag LOCUS_09190 112557 112243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 113063 112554 gene locus_tag LOCUS_09200 113063 112554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 113407 113589 gene locus_tag LOCUS_09210 113407 113589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 113601 116264 gene locus_tag LOCUS_09220 113601 116264 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_09220 116569 117003 gene locus_tag LOCUS_09230 116569 117003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 117018 118295 gene locus_tag LOCUS_09240 117018 118295 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_09240 119881 118427 gene locus_tag LOCUS_09250 119881 118427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 120753 120103 gene locus_tag LOCUS_09260 120753 120103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_09260 121319 120750 gene locus_tag LOCUS_09270 gene fabR 121319 120750 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368907.1 protein_id gnl|my_center|LOCUS_09270 121501 121848 gene locus_tag LOCUS_09280 121501 121848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence07 622 125 gene locus_tag LOCUS_09290 622 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1641 1444 gene locus_tag LOCUS_09300 1641 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1684 1980 gene locus_tag LOCUS_09310 1684 1980 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329228.1 protein_id gnl|my_center|LOCUS_09310 2751 2191 gene locus_tag LOCUS_09320 2751 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4620 3100 gene locus_tag LOCUS_09330 4620 3100 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_09330 4741 5376 gene locus_tag LOCUS_09340 4741 5376 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_09340 5518 5778 gene locus_tag LOCUS_09350 5518 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7429 6674 gene locus_tag LOCUS_09360 7429 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 7335 7640 gene locus_tag LOCUS_09370 7335 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7900 8994 gene locus_tag LOCUS_09380 7900 8994 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243015.1 protein_id gnl|my_center|LOCUS_09380 9127 9837 gene locus_tag LOCUS_09390 9127 9837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_09390 9840 10355 gene locus_tag LOCUS_09400 9840 10355 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098855.1 protein_id gnl|my_center|LOCUS_09400 10466 11230 gene locus_tag LOCUS_09410 10466 11230 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_09410 12432 11224 gene locus_tag LOCUS_09420 12432 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 12741 13907 gene locus_tag LOCUS_09430 12741 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 14265 16463 gene locus_tag LOCUS_09440 14265 16463 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_09440 17575 16460 gene locus_tag LOCUS_09450 gene hisC 17575 16460 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_09450 17727 18314 gene locus_tag LOCUS_09460 gene hisB 17727 18314 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_09460 18314 18973 gene locus_tag LOCUS_09470 gene hisH 18314 18973 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_09470 19024 19767 gene locus_tag LOCUS_09480 gene hisA 19024 19767 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_09480 19808 20569 gene locus_tag LOCUS_09490 gene hisF 19808 20569 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_09490 20566 20970 gene locus_tag LOCUS_09500 gene hisI 20566 20970 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815804.1 protein_id gnl|my_center|LOCUS_09500 20967 21287 gene locus_tag LOCUS_09510 20967 21287 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_09510 21291 21641 gene locus_tag LOCUS_09520 21291 21641 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_09520 21724 21969 gene locus_tag LOCUS_09530 gene tatA 21724 21969 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_09530 22092 22511 gene locus_tag LOCUS_09540 gene tatB 22092 22511 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931646.1 protein_id gnl|my_center|LOCUS_09540 22528 23391 gene locus_tag LOCUS_09550 gene tatC 22528 23391 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_09550 24212 23406 gene locus_tag LOCUS_09560 24212 23406 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_09560 25401 24229 gene locus_tag LOCUS_09570 25401 24229 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_09570 25426 26172 gene locus_tag LOCUS_09580 25426 26172 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 protein_id gnl|my_center|LOCUS_09580 26192 26875 gene locus_tag LOCUS_09590 26192 26875 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_09590 27141 27536 gene locus_tag LOCUS_09600 27141 27536 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940053.1 protein_id gnl|my_center|LOCUS_09600 27586 28134 gene locus_tag LOCUS_09610 gene eetB 27586 28134 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_09610 28127 28744 gene locus_tag LOCUS_09620 28127 28744 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073576.1 protein_id gnl|my_center|LOCUS_09620 28741 28911 gene locus_tag LOCUS_09630 28741 28911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 28974 30128 gene locus_tag LOCUS_09640 28974 30128 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965724.1 protein_id gnl|my_center|LOCUS_09640 30308 33163 gene locus_tag LOCUS_09650 30308 33163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 34249 33176 gene locus_tag LOCUS_09660 gene mutY 34249 33176 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_09660 34471 35061 gene locus_tag LOCUS_09670 34471 35061 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088836.1 protein_id gnl|my_center|LOCUS_09670 35270 35590 gene locus_tag LOCUS_09680 35270 35590 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195767.1 protein_id gnl|my_center|LOCUS_09680 35717 36721 gene locus_tag LOCUS_09690 gene galE 35717 36721 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_09690 36731 37591 gene locus_tag LOCUS_09700 36731 37591 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522249.1 protein_id gnl|my_center|LOCUS_09700 37706 42862 gene locus_tag LOCUS_09710 37706 42862 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812871.1 protein_id gnl|my_center|LOCUS_09710 42862 45156 gene locus_tag LOCUS_09720 gene pbpC 42862 45156 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 protein_id gnl|my_center|LOCUS_09720 48987 45883 gene locus_tag LOCUS_09730 48987 45883 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_09730 49727 49047 gene locus_tag LOCUS_09740 49727 49047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 50838 49729 gene locus_tag LOCUS_09750 50838 49729 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_09750 52280 50835 gene locus_tag LOCUS_09760 52280 50835 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_09760 54009 52303 gene locus_tag LOCUS_09770 54009 52303 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 protein_id gnl|my_center|LOCUS_09770 55106 54006 gene locus_tag LOCUS_09780 55106 54006 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_09780 55534 55797 gene locus_tag LOCUS_09790 55534 55797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 56234 56710 gene locus_tag LOCUS_09800 gene trmL 56234 56710 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703791.1 protein_id gnl|my_center|LOCUS_09800 57728 56742 gene locus_tag LOCUS_09810 57728 56742 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_09810 58381 57710 gene locus_tag LOCUS_09820 58381 57710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 58850 58407 gene locus_tag LOCUS_09830 58850 58407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 59160 58915 gene locus_tag LOCUS_09840 59160 58915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 59105 59377 gene locus_tag LOCUS_09850 59105 59377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 61020 59431 gene locus_tag LOCUS_09860 61020 59431 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_09860 62213 61017 gene locus_tag LOCUS_09870 gene nirJ 62213 61017 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_09870 62462 63283 gene locus_tag LOCUS_09880 62462 63283 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942204.1 protein_id gnl|my_center|LOCUS_09880 63427 64587 gene locus_tag LOCUS_09890 gene clsB 63427 64587 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_09890 65438 64569 gene locus_tag LOCUS_09900 gene gluQRS 65438 64569 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 protein_id gnl|my_center|LOCUS_09900 65640 66527 gene locus_tag LOCUS_09910 gene argB 65640 66527 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929778.1 protein_id gnl|my_center|LOCUS_09910 66535 67185 gene locus_tag LOCUS_09920 66535 67185 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_09920 67296 70904 gene locus_tag LOCUS_09930 67296 70904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 70897 71994 gene locus_tag LOCUS_09940 70897 71994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 72994 71978 gene locus_tag LOCUS_09950 gene hemB 72994 71978 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 protein_id gnl|my_center|LOCUS_09950 73887 73180 gene locus_tag LOCUS_09960 gene yihA 73887 73180 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687358.1 protein_id gnl|my_center|LOCUS_09960 74011 74646 gene locus_tag LOCUS_09970 74011 74646 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_09970 74775 75206 gene locus_tag LOCUS_09980 74775 75206 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_09980 75519 76490 gene locus_tag LOCUS_09990 75519 76490 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_09990 76567 77766 gene locus_tag LOCUS_10000 76567 77766 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178900.1 protein_id gnl|my_center|LOCUS_10000 79086 77830 gene locus_tag LOCUS_10010 79086 77830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 80627 79083 gene locus_tag LOCUS_10020 gene ppx 80627 79083 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_10020 83044 81029 gene locus_tag LOCUS_10030 83044 81029 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815335.1 protein_id gnl|my_center|LOCUS_10030 84453 83377 gene locus_tag LOCUS_10040 gene hemE 84453 83377 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_10040 85968 84514 gene locus_tag LOCUS_10050 85968 84514 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_10050 87411 85981 gene locus_tag LOCUS_10060 gene trkA 87411 85981 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401453.1 protein_id gnl|my_center|LOCUS_10060 88718 87456 gene locus_tag LOCUS_10070 88718 87456 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_10070 90874 88721 gene locus_tag LOCUS_10080 90874 88721 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_10080 91497 90871 gene locus_tag LOCUS_10090 91497 90871 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_10090 92695 91472 gene locus_tag LOCUS_10100 gene rsmB 92695 91472 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 protein_id gnl|my_center|LOCUS_10100 93089 94084 gene locus_tag LOCUS_10110 93089 94084 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_10110 95023 94097 gene locus_tag LOCUS_10120 gene fmt 95023 94097 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_10120 95523 95020 gene locus_tag LOCUS_10130 gene def 95523 95020 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_10130 95720 96736 gene locus_tag LOCUS_10140 95720 96736 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266133.1 protein_id gnl|my_center|LOCUS_10140 96739 97827 gene locus_tag LOCUS_10150 gene dprA 96739 97827 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_10150 97839 98288 gene locus_tag LOCUS_10160 97839 98288 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_10160 98596 101187 gene locus_tag LOCUS_10170 98596 101187 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_10170 102243 101278 gene locus_tag LOCUS_10180 102243 101278 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769579.1 protein_id gnl|my_center|LOCUS_10180 103165 102434 gene locus_tag LOCUS_10190 103165 102434 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_10190 103251 103592 gene locus_tag LOCUS_10200 103251 103592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 105795 103879 gene locus_tag LOCUS_10210 gene thiC 105795 103879 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_10210 105817 106038 gene locus_tag LOCUS_10220 105817 106038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 106289 106214 gene locus_tag LOCUS_t00140 106289 106214 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 106389 106314 gene locus_tag LOCUS_t00150 106389 106314 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 107021 106416 gene locus_tag LOCUS_10230 107021 106416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762975.1 protein_id gnl|my_center|LOCUS_10230 107162 107983 gene locus_tag LOCUS_10240 gene pyrF 107162 107983 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_10240 110464 107996 gene locus_tag LOCUS_10250 gene gyrB 110464 107996 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_10250 111577 110528 gene locus_tag LOCUS_10260 gene dnaN 111577 110528 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_10260 113271 111871 gene locus_tag LOCUS_10270 gene dnaA 113271 111871 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040794.1 protein_id gnl|my_center|LOCUS_10270 114345 116027 gene locus_tag LOCUS_10280 gene yidC 114345 116027 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_10280 115993 117354 gene locus_tag LOCUS_10290 gene mnmE 115993 117354 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence08 4267 3083 gene locus_tag LOCUS_10300 4267 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4832 4260 gene locus_tag LOCUS_10310 4832 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6055 4829 gene locus_tag LOCUS_10320 6055 4829 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_10320 6537 8330 gene locus_tag LOCUS_10330 6537 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10330 8427 8723 gene locus_tag LOCUS_10340 8427 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10340 8744 8923 gene locus_tag LOCUS_10350 8744 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 9163 9420 gene locus_tag LOCUS_10360 9163 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 9544 9471 gene locus_tag LOCUS_t00160 9544 9471 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9684 9609 gene locus_tag LOCUS_t00170 9684 9609 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10333 9755 gene locus_tag LOCUS_10370 gene pgsA 10333 9755 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 protein_id gnl|my_center|LOCUS_10370 12219 10333 gene locus_tag LOCUS_10380 gene uvrC 12219 10333 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 protein_id gnl|my_center|LOCUS_10380 12464 12234 gene locus_tag LOCUS_10390 12464 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 12345 13382 gene locus_tag LOCUS_10400 gene earP 12345 13382 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_10400 13459 13977 gene locus_tag LOCUS_10410 gene efp 13459 13977 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_10410 15164 14136 gene locus_tag LOCUS_10420 gene nagZ 15164 14136 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193430.1 protein_id gnl|my_center|LOCUS_10420 15538 15161 gene locus_tag LOCUS_10430 gene acpS 15538 15161 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_10430 16308 15535 gene locus_tag LOCUS_10440 16308 15535 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922652.1 protein_id gnl|my_center|LOCUS_10440 17021 16305 gene locus_tag LOCUS_10450 gene recO 17021 16305 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_10450 17944 17060 gene locus_tag LOCUS_10460 gene era 17944 17060 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_10460 18612 17941 gene locus_tag LOCUS_10470 gene rnc 18612 17941 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_10470 18974 18609 gene locus_tag LOCUS_10480 18974 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 19775 18987 gene locus_tag LOCUS_10490 gene lepB 19775 18987 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_10490 21584 19788 gene locus_tag LOCUS_10500 gene lepA 21584 19788 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_10500 21922 21671 gene locus_tag LOCUS_10510 21922 21671 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524616.1 protein_id gnl|my_center|LOCUS_10510 23361 21919 gene locus_tag LOCUS_10520 23361 21919 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_10520 23894 23442 gene locus_tag LOCUS_10530 23894 23442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 24496 23897 gene locus_tag LOCUS_10540 gene rpoE 24496 23897 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_10540 28298 24936 gene locus_tag LOCUS_10550 28298 24936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 28751 28936 gene locus_tag LOCUS_10560 28751 28936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 30047 29031 gene locus_tag LOCUS_10570 gene lpxD 30047 29031 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_10570 30641 31642 gene locus_tag LOCUS_10580 30641 31642 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_10580 32598 31720 gene locus_tag LOCUS_10590 gene htpX 32598 31720 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_10590 33169 32783 gene locus_tag LOCUS_10600 33169 32783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 33282 34307 gene locus_tag LOCUS_10610 gene nhaR 33282 34307 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_10610 34426 35337 gene locus_tag LOCUS_10620 34426 35337 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_10620 36136 35453 gene locus_tag LOCUS_10630 36136 35453 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_10630 36288 37043 gene locus_tag LOCUS_10640 36288 37043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 37067 38758 gene locus_tag LOCUS_10650 37067 38758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 38779 39576 gene locus_tag LOCUS_10660 gene tauC 38779 39576 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 protein_id gnl|my_center|LOCUS_10660 39573 40448 gene locus_tag LOCUS_10670 39573 40448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206686.1 protein_id gnl|my_center|LOCUS_10670 40451 41335 gene locus_tag LOCUS_10680 40451 41335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 41444 42154 gene locus_tag LOCUS_10690 41444 42154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 42204 44135 gene locus_tag LOCUS_10700 42204 44135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 44146 44598 gene locus_tag LOCUS_10710 44146 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 45718 44918 gene locus_tag LOCUS_10720 45718 44918 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 protein_id gnl|my_center|LOCUS_10720 45761 46408 gene locus_tag LOCUS_10730 gene pyrE 45761 46408 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_10730 46392 47018 gene locus_tag LOCUS_10740 46392 47018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 48525 47074 gene locus_tag LOCUS_10750 gene gatB 48525 47074 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_10750 50099 48630 gene locus_tag LOCUS_10760 gene gatA 50099 48630 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_10760 50392 50096 gene locus_tag LOCUS_10770 gene gatC 50392 50096 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_10770 50496 51539 gene locus_tag LOCUS_10780 50496 51539 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_10780 51588 52520 gene locus_tag LOCUS_10790 gene mreC 51588 52520 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_10790 52526 53047 gene locus_tag LOCUS_10800 gene mreD 52526 53047 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_10800 53150 55045 gene locus_tag LOCUS_10810 gene mrdA 53150 55045 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_10810 55049 56155 gene locus_tag LOCUS_10820 gene rodA 55049 56155 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_10820 56155 57231 gene locus_tag LOCUS_10830 56155 57231 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_10830 58296 57313 gene locus_tag LOCUS_10840 58296 57313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 58703 58293 gene locus_tag LOCUS_10850 58703 58293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 58963 59415 gene locus_tag LOCUS_10860 58963 59415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 59488 60171 gene locus_tag LOCUS_10870 59488 60171 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_10870 61068 60271 gene locus_tag LOCUS_10880 61068 60271 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_10880 61299 61484 gene locus_tag LOCUS_10890 61299 61484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 61481 62137 gene locus_tag LOCUS_10900 61481 62137 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_10900 62497 63096 gene locus_tag LOCUS_10910 62497 63096 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383280.1 protein_id gnl|my_center|LOCUS_10910 64390 63134 gene locus_tag LOCUS_10920 64390 63134 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_10920 65944 64406 gene locus_tag LOCUS_10930 65944 64406 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_10930 66451 66954 gene locus_tag LOCUS_10940 66451 66954 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_10940 66980 68773 gene locus_tag LOCUS_10950 66980 68773 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_10950 69965 68910 gene locus_tag LOCUS_10960 69965 68910 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_10960 71805 69967 gene locus_tag LOCUS_10970 71805 69967 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_10970 73664 71820 gene locus_tag LOCUS_10980 73664 71820 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_10980 73871 74317 gene locus_tag LOCUS_10990 73871 74317 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_10990 74877 74359 gene locus_tag LOCUS_11000 74877 74359 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_11000 75326 74967 gene locus_tag LOCUS_11010 75326 74967 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_11010 75864 76163 gene locus_tag LOCUS_11020 75864 76163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 76499 77341 gene locus_tag LOCUS_11030 76499 77341 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941377.1 protein_id gnl|my_center|LOCUS_11030 77538 77924 gene locus_tag LOCUS_11040 gene rpsF 77538 77924 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_11040 77954 78268 gene locus_tag LOCUS_11050 gene priB 77954 78268 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_11050 78240 78515 gene locus_tag LOCUS_11060 gene rpsR 78240 78515 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 protein_id gnl|my_center|LOCUS_11060 78530 78988 gene locus_tag LOCUS_11070 gene rplI 78530 78988 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_11070 79127 80572 gene locus_tag LOCUS_11080 79127 80572 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_11080 81646 80597 gene locus_tag LOCUS_11090 81646 80597 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967012.1 protein_id gnl|my_center|LOCUS_11090 83440 82013 gene locus_tag LOCUS_11100 83440 82013 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_11100 83934 83479 gene locus_tag LOCUS_11110 83934 83479 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_11110 84095 84700 gene locus_tag LOCUS_11120 gene lexA 84095 84700 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704201.1 protein_id gnl|my_center|LOCUS_11120 84734 85441 gene locus_tag LOCUS_11130 gene imuA 84734 85441 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_11130 85374 86858 gene locus_tag LOCUS_11140 85374 86858 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550915.1 protein_id gnl|my_center|LOCUS_11140 86947 87384 gene locus_tag LOCUS_11150 86947 87384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 87676 89310 gene locus_tag LOCUS_11160 gene pgi 87676 89310 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225136.1 protein_id gnl|my_center|LOCUS_11160 89365 91008 gene locus_tag LOCUS_11170 89365 91008 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057811.1 protein_id gnl|my_center|LOCUS_11170 91082 92350 gene locus_tag LOCUS_11180 gene glgC 91082 92350 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533906.1 protein_id gnl|my_center|LOCUS_11180 92373 93815 gene locus_tag LOCUS_11190 gene glgA 92373 93815 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020156.1 protein_id gnl|my_center|LOCUS_11190 94139 93828 gene locus_tag LOCUS_11200 94139 93828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 94059 95240 gene locus_tag LOCUS_11210 94059 95240 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_11210 96383 95271 gene locus_tag LOCUS_11220 gene selD 96383 95271 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_11220 96662 96447 gene locus_tag LOCUS_11230 96662 96447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 99137 96711 gene locus_tag LOCUS_11240 gene copA1 99137 96711 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_11240 99879 99199 gene locus_tag LOCUS_11250 99879 99199 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_11250 101354 99957 gene locus_tag LOCUS_11260 gene hemN 101354 99957 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689506.1 protein_id gnl|my_center|LOCUS_11260 101452 102195 gene locus_tag LOCUS_11270 gene fnr 101452 102195 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_11270 102621 102226 gene locus_tag LOCUS_11280 102621 102226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 103934 102615 gene locus_tag LOCUS_11290 103934 102615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_11290 104170 103934 gene locus_tag LOCUS_11300 104170 103934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 104628 104167 gene locus_tag LOCUS_11310 104628 104167 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_11310 104777 105220 gene locus_tag LOCUS_11320 104777 105220 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_11320 105533 106216 gene locus_tag LOCUS_11330 105533 106216 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_11330 106229 106489 gene locus_tag LOCUS_11340 106229 106489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 106476 107114 gene locus_tag LOCUS_11350 106476 107114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 107491 107111 gene locus_tag LOCUS_11360 107491 107111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 107740 108108 gene locus_tag LOCUS_11370 107740 108108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11370 108399 108668 gene locus_tag LOCUS_11380 108399 108668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 108693 109874 gene locus_tag LOCUS_11390 108693 109874 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_11390 113181 110002 gene locus_tag LOCUS_11400 113181 110002 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_11400 113888 113178 gene locus_tag LOCUS_11410 113888 113178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_11410 114430 113885 gene locus_tag LOCUS_11420 114430 113885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_11420 116807 114717 gene locus_tag LOCUS_11430 116807 114717 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203121.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence09 452 1870 gene locus_tag LOCUS_11440 452 1870 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_11440 1890 2825 gene locus_tag LOCUS_11450 1890 2825 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174267.1 protein_id gnl|my_center|LOCUS_11450 3112 3186 gene locus_tag LOCUS_t00180 3112 3186 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3543 3851 gene locus_tag LOCUS_11460 3543 3851 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_11460 5139 3871 gene locus_tag LOCUS_11470 gene murA 5139 3871 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_11470 5368 5123 gene locus_tag LOCUS_11480 5368 5123 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951370.1 protein_id gnl|my_center|LOCUS_11480 6127 5372 gene locus_tag LOCUS_11490 6127 5372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_11490 7047 6124 gene locus_tag LOCUS_11500 7047 6124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_11500 7376 7083 gene locus_tag LOCUS_11510 7376 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 7987 7373 gene locus_tag LOCUS_11520 7987 7373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_11520 8719 8045 gene locus_tag LOCUS_11530 8719 8045 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931638.1 protein_id gnl|my_center|LOCUS_11530 9256 8786 gene locus_tag LOCUS_11540 gene mlaD 9256 8786 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_11540 10068 9256 gene locus_tag LOCUS_11550 gene mlaE 10068 9256 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 protein_id gnl|my_center|LOCUS_11550 10891 10055 gene locus_tag LOCUS_11560 10891 10055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_11560 11006 12463 gene locus_tag LOCUS_11570 gene prsR 11006 12463 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_11570 12460 13902 gene locus_tag LOCUS_11580 12460 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 14015 15793 gene locus_tag LOCUS_11590 14015 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 15790 17043 gene locus_tag LOCUS_11600 15790 17043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 17095 18807 gene locus_tag LOCUS_11610 17095 18807 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_11610 18813 20015 gene locus_tag LOCUS_11620 18813 20015 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_11620 20020 21561 gene locus_tag LOCUS_11630 20020 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 21558 22160 gene locus_tag LOCUS_11640 21558 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 22186 22653 gene locus_tag LOCUS_11650 22186 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 22657 23643 gene locus_tag LOCUS_11660 22657 23643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 24037 24786 gene locus_tag LOCUS_11670 24037 24786 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390516.1 protein_id gnl|my_center|LOCUS_11670 24975 26261 gene locus_tag LOCUS_11680 24975 26261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 27997 26258 gene locus_tag LOCUS_11690 27997 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 28155 28859 gene locus_tag LOCUS_11700 28155 28859 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_11700 29169 30152 gene locus_tag LOCUS_11710 29169 30152 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_11710 30152 30706 gene locus_tag LOCUS_11720 30152 30706 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413390.1 protein_id gnl|my_center|LOCUS_11720 30703 31290 gene locus_tag LOCUS_11730 30703 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 31293 31901 gene locus_tag LOCUS_11740 gene lptA 31293 31901 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_11740 32299 32850 gene locus_tag LOCUS_11750 32299 32850 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_11750 33078 33626 gene locus_tag LOCUS_11760 33078 33626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 34458 33703 gene locus_tag LOCUS_11770 34458 33703 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_11770 35207 34455 gene locus_tag LOCUS_11780 35207 34455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 36153 36365 gene locus_tag LOCUS_11790 gene rpsU 36153 36365 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_11790 36633 38384 gene locus_tag LOCUS_11800 36633 38384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 38430 40382 gene locus_tag LOCUS_11810 gene rpoD 38430 40382 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 protein_id gnl|my_center|LOCUS_11810 41315 40548 gene locus_tag LOCUS_11820 gene tpiA 41315 40548 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_11820 42647 41391 gene locus_tag LOCUS_11830 42647 41391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11830 44465 42870 gene locus_tag LOCUS_11840 44465 42870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 46051 44546 gene locus_tag LOCUS_11850 46051 44546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 47847 46063 gene locus_tag LOCUS_11860 47847 46063 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_11860 48869 47994 gene locus_tag LOCUS_11870 48869 47994 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 protein_id gnl|my_center|LOCUS_11870 49255 49482 gene locus_tag LOCUS_11880 49255 49482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 49479 49916 gene locus_tag LOCUS_11890 49479 49916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 50080 50217 gene locus_tag LOCUS_11900 50080 50217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 51670 50360 gene locus_tag LOCUS_11910 51670 50360 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039535.1 protein_id gnl|my_center|LOCUS_11910 52969 51737 gene locus_tag LOCUS_11920 52969 51737 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_11920 54163 52979 gene locus_tag LOCUS_11930 gene alaC 54163 52979 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_11930 54314 54703 gene locus_tag LOCUS_11940 54314 54703 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_11940 54761 55636 gene locus_tag LOCUS_11950 54761 55636 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539670.1 protein_id gnl|my_center|LOCUS_11950 56380 55688 gene locus_tag LOCUS_11960 56380 55688 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 protein_id gnl|my_center|LOCUS_11960 56597 56684 gene locus_tag LOCUS_t00190 56597 56684 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58997 57021 gene locus_tag LOCUS_11970 58997 57021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 60039 59332 gene locus_tag LOCUS_11980 60039 59332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 60909 60106 gene locus_tag LOCUS_11990 60909 60106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 61276 60896 gene locus_tag LOCUS_12000 61276 60896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 63540 61273 gene locus_tag LOCUS_12010 63540 61273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 64967 63609 gene locus_tag LOCUS_12020 64967 63609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 65403 64939 gene locus_tag LOCUS_12030 65403 64939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 65658 65416 gene locus_tag LOCUS_12040 65658 65416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 66495 65764 gene locus_tag LOCUS_12050 66495 65764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 66697 66933 gene locus_tag LOCUS_12060 66697 66933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 66930 69677 gene locus_tag LOCUS_12070 66930 69677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 69677 71026 gene locus_tag LOCUS_12080 69677 71026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 71023 72057 gene locus_tag LOCUS_12090 71023 72057 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_12090 72054 72248 gene locus_tag LOCUS_12100 72054 72248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 72245 72880 gene locus_tag LOCUS_12110 72245 72880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 72877 74877 gene locus_tag LOCUS_12120 gene dndD 72877 74877 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_12120 74870 76399 gene locus_tag LOCUS_12130 74870 76399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 77739 76477 gene locus_tag LOCUS_12140 77739 76477 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_12140 79335 77992 gene locus_tag LOCUS_12150 79335 77992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 80232 79369 gene locus_tag LOCUS_12160 80232 79369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 81419 80373 gene locus_tag LOCUS_12170 81419 80373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12170 82289 81726 gene locus_tag LOCUS_12180 82289 81726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 82657 84708 gene locus_tag LOCUS_12190 82657 84708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 87334 84752 gene locus_tag LOCUS_12200 gene cphA 87334 84752 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_12200 89577 87406 gene locus_tag LOCUS_12210 gene cphA 89577 87406 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_12210 90202 89729 gene locus_tag LOCUS_12220 90202 89729 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_12220 92523 90199 gene locus_tag LOCUS_12230 92523 90199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_12230 93502 92633 gene locus_tag LOCUS_12240 93502 92633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 93696 94088 gene locus_tag LOCUS_12250 93696 94088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 94316 94663 gene locus_tag LOCUS_12260 94316 94663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 94647 94973 gene locus_tag LOCUS_12270 94647 94973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 95694 95368 gene locus_tag LOCUS_12280 95694 95368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 97038 95830 gene locus_tag LOCUS_12290 gene nifS 97038 95830 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_12290 97946 97062 gene locus_tag LOCUS_12300 gene nifU 97946 97062 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_12300 98283 97957 gene locus_tag LOCUS_12310 98283 97957 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565964.1 protein_id gnl|my_center|LOCUS_12310 98778 98479 gene locus_tag LOCUS_12320 gene fdxB 98778 98479 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_12320 98992 98783 gene locus_tag LOCUS_12330 98992 98783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 99488 99003 gene locus_tag LOCUS_12340 99488 99003 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_12340 99922 99485 gene locus_tag LOCUS_12350 99922 99485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 100338 99919 gene locus_tag LOCUS_12360 gene nifX 100338 99919 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545689.1 protein_id gnl|my_center|LOCUS_12360 101758 100352 gene locus_tag LOCUS_12370 gene nifN 101758 100352 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338301.1 protein_id gnl|my_center|LOCUS_12370 103175 101751 gene locus_tag LOCUS_12380 gene nifE 103175 101751 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_12380 103390 103971 gene locus_tag LOCUS_12390 103390 103971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 104161 105288 gene locus_tag LOCUS_12400 gene nifV 104161 105288 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_12400 105312 105839 gene locus_tag LOCUS_12410 105312 105839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 105854 106168 gene locus_tag LOCUS_12420 105854 106168 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_12420 106173 106634 gene locus_tag LOCUS_12430 106173 106634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 106627 107475 gene locus_tag LOCUS_12440 106627 107475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence10 527 847 gene locus_tag LOCUS_12450 527 847 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533578.1 protein_id gnl|my_center|LOCUS_12450 865 1275 gene locus_tag LOCUS_12460 865 1275 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040315.1 protein_id gnl|my_center|LOCUS_12460 1256 1597 gene locus_tag LOCUS_12470 1256 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2383 1652 gene locus_tag LOCUS_12480 2383 1652 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_12480 3609 2350 gene locus_tag LOCUS_12490 3609 2350 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_12490 4232 3609 gene locus_tag LOCUS_12500 gene metW 4232 3609 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225324.1 protein_id gnl|my_center|LOCUS_12500 5326 4229 gene locus_tag LOCUS_12510 5326 4229 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_12510 7266 5518 gene locus_tag LOCUS_12520 gene ptsP 7266 5518 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_12520 7543 7274 gene locus_tag LOCUS_12530 7543 7274 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_12530 7961 7569 gene locus_tag LOCUS_12540 7961 7569 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_12540 9069 8032 gene locus_tag LOCUS_12550 9069 8032 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527101.1 protein_id gnl|my_center|LOCUS_12550 10004 9051 gene locus_tag LOCUS_12560 gene gshB 10004 9051 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198015.1 protein_id gnl|my_center|LOCUS_12560 11305 9995 gene locus_tag LOCUS_12570 gene gshA 11305 9995 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_12570 12641 11391 gene locus_tag LOCUS_12580 12641 11391 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611273.1 protein_id gnl|my_center|LOCUS_12580 13254 12772 gene locus_tag LOCUS_12590 13254 12772 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792825.1 protein_id gnl|my_center|LOCUS_12590 15662 13299 gene locus_tag LOCUS_12600 gene parC 15662 13299 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 protein_id gnl|my_center|LOCUS_12600 17625 15676 gene locus_tag LOCUS_12610 17625 15676 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451799.1 protein_id gnl|my_center|LOCUS_12610 18809 17886 gene locus_tag LOCUS_12620 18809 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224628.1 protein_id gnl|my_center|LOCUS_12620 22393 18941 gene locus_tag LOCUS_12630 22393 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 23874 22390 gene locus_tag LOCUS_12640 23874 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 25531 24275 gene locus_tag LOCUS_12650 25531 24275 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786453.1 protein_id gnl|my_center|LOCUS_12650 27062 26793 gene locus_tag LOCUS_12660 27062 26793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 28282 27878 gene locus_tag LOCUS_12670 28282 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 29423 28290 gene locus_tag LOCUS_12680 29423 28290 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_12680 29560 29799 gene locus_tag LOCUS_12690 29560 29799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 30445 30200 gene locus_tag LOCUS_12700 30445 30200 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_12700 30773 31150 gene locus_tag LOCUS_12710 gene hisI 30773 31150 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942178.1 protein_id gnl|my_center|LOCUS_12710 31147 32037 gene locus_tag LOCUS_12720 gene hisG 31147 32037 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_12720 32321 34918 gene locus_tag LOCUS_12730 gene mutS 32321 34918 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_12730 34915 35859 gene locus_tag LOCUS_12740 34915 35859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_12740 35944 37083 gene locus_tag LOCUS_12750 35944 37083 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_12750 39231 37156 gene locus_tag LOCUS_12760 gene feoB 39231 37156 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545132.1 protein_id gnl|my_center|LOCUS_12760 39880 39374 gene locus_tag LOCUS_12770 39880 39374 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_12770 40347 39877 gene locus_tag LOCUS_12780 40347 39877 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_12780 40587 41252 gene locus_tag LOCUS_12790 40587 41252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 41632 41279 gene locus_tag LOCUS_12800 41632 41279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 42943 41660 gene locus_tag LOCUS_12810 gene eno 42943 41660 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_12810 43264 42968 gene locus_tag LOCUS_12820 43264 42968 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_12820 44100 43264 gene locus_tag LOCUS_12830 gene kdsA 44100 43264 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065134.1 protein_id gnl|my_center|LOCUS_12830 45740 44097 gene locus_tag LOCUS_12840 45740 44097 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_12840 45941 46210 gene locus_tag LOCUS_12850 45941 46210 CDS product nickel-sensing transcriptional repressor NcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196355.1 protein_id gnl|my_center|LOCUS_12850 46231 47274 gene locus_tag LOCUS_12860 gene dmeF 46231 47274 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039045.1 protein_id gnl|my_center|LOCUS_12860 47859 49469 gene locus_tag LOCUS_12870 47859 49469 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268416.1 protein_id gnl|my_center|LOCUS_12870 49975 49541 gene locus_tag LOCUS_12880 gene trxC 49975 49541 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_12880 50577 50092 gene locus_tag LOCUS_12890 50577 50092 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_12890 51053 50574 gene locus_tag LOCUS_12900 51053 50574 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_12900 52035 51046 gene locus_tag LOCUS_12910 52035 51046 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_12910 53198 52035 gene locus_tag LOCUS_12920 gene nirF 53198 52035 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_12920 54041 53301 gene locus_tag LOCUS_12930 54041 53301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 54311 54778 gene locus_tag LOCUS_12940 54311 54778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 54816 55427 gene locus_tag LOCUS_12950 54816 55427 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_12950 55476 55766 gene locus_tag LOCUS_12960 55476 55766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 55889 56284 gene locus_tag LOCUS_12970 55889 56284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 57766 56735 gene locus_tag LOCUS_12980 57766 56735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 58593 57784 gene locus_tag LOCUS_12990 58593 57784 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_12990 59450 58674 gene locus_tag LOCUS_13000 59450 58674 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_13000 68415 59485 gene locus_tag LOCUS_13010 68415 59485 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_13010 69655 68474 gene locus_tag LOCUS_13020 69655 68474 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626611.1 protein_id gnl|my_center|LOCUS_13020 70053 69739 gene locus_tag LOCUS_13030 70053 69739 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_13030 72894 70384 gene locus_tag LOCUS_13040 72894 70384 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_13040 73115 72903 gene locus_tag LOCUS_13050 73115 72903 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_13050 74290 73802 gene locus_tag LOCUS_13060 74290 73802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 76311 74497 gene locus_tag LOCUS_13070 76311 74497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 79446 76369 gene locus_tag LOCUS_13080 79446 76369 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_13080 80020 79688 gene locus_tag LOCUS_13090 80020 79688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 80549 80707 gene locus_tag LOCUS_13100 80549 80707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 82224 81940 gene locus_tag LOCUS_13110 82224 81940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 82622 82425 gene locus_tag LOCUS_13120 82622 82425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 82972 82757 gene locus_tag LOCUS_13130 82972 82757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 83646 83035 gene locus_tag LOCUS_13140 83646 83035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 84799 84023 gene locus_tag LOCUS_13150 84799 84023 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_13150 85644 84823 gene locus_tag LOCUS_13160 85644 84823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 87662 85644 gene locus_tag LOCUS_13170 87662 85644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 88103 87678 gene locus_tag LOCUS_13180 88103 87678 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_13180 90454 88100 gene locus_tag LOCUS_13190 90454 88100 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_13190 91050 90451 gene locus_tag LOCUS_13200 91050 90451 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_13200 94255 91097 gene locus_tag LOCUS_13210 94255 91097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 94904 94326 gene locus_tag LOCUS_13220 94904 94326 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376387.1 protein_id gnl|my_center|LOCUS_13220 95192 94995 gene locus_tag LOCUS_13230 95192 94995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 95386 95237 gene locus_tag LOCUS_13240 95386 95237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 96073 95648 gene locus_tag LOCUS_13250 96073 95648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 96773 96255 gene locus_tag LOCUS_13260 96773 96255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 97420 97704 gene locus_tag LOCUS_13270 97420 97704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 99715 98012 gene locus_tag LOCUS_13280 99715 98012 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_13280 100303 99809 gene locus_tag LOCUS_13290 100303 99809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 101004 100519 gene locus_tag LOCUS_13300 101004 100519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 101475 101143 gene locus_tag LOCUS_13310 101475 101143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 101936 102565 gene locus_tag LOCUS_13320 101936 102565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 103113 102487 gene locus_tag LOCUS_13330 103113 102487 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_13330 103307 103113 gene locus_tag LOCUS_13340 103307 103113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 104215 103304 gene locus_tag LOCUS_13350 104215 103304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207718.1 protein_id gnl|my_center|LOCUS_13350 105003 104329 gene locus_tag LOCUS_13360 105003 104329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence11 929 645 gene locus_tag LOCUS_13370 929 645 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140834.1 protein_id gnl|my_center|LOCUS_13370 4132 1235 gene locus_tag LOCUS_13380 gene uvrA 4132 1235 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_13380 4204 5409 gene locus_tag LOCUS_13390 4204 5409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195190.1 protein_id gnl|my_center|LOCUS_13390 5465 5944 gene locus_tag LOCUS_13400 5465 5944 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534302.1 protein_id gnl|my_center|LOCUS_13400 6726 6139 gene locus_tag LOCUS_13410 gene sodB 6726 6139 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064087.1 protein_id gnl|my_center|LOCUS_13410 8163 6817 gene locus_tag LOCUS_13420 gene xseA 8163 6817 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_13420 8519 9127 gene locus_tag LOCUS_13430 8519 9127 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_13430 9141 9560 gene locus_tag LOCUS_13440 9141 9560 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_13440 9571 10617 gene locus_tag LOCUS_13450 gene lpxK 9571 10617 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_13450 10598 10774 gene locus_tag LOCUS_13460 10598 10774 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812895.1 protein_id gnl|my_center|LOCUS_13460 10797 11567 gene locus_tag LOCUS_13470 gene kdsB 10797 11567 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_13470 11699 12352 gene locus_tag LOCUS_13480 gene adk 11699 12352 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_13480 12712 15126 gene locus_tag LOCUS_13490 12712 15126 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_13490 15867 15238 gene locus_tag LOCUS_13500 15867 15238 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_13500 17425 15887 gene locus_tag LOCUS_13510 gene murJ 17425 15887 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211214.1 protein_id gnl|my_center|LOCUS_13510 17956 17657 gene locus_tag LOCUS_13520 17956 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 18246 17962 gene locus_tag LOCUS_13530 18246 17962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 22548 18319 gene locus_tag LOCUS_13540 22548 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 24220 22661 gene locus_tag LOCUS_13550 24220 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 22680 22779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24510 25469 gene locus_tag LOCUS_13560 24510 25469 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268927.1 protein_id gnl|my_center|LOCUS_13560 26750 25560 gene locus_tag LOCUS_13570 26750 25560 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_13570 27781 26747 gene locus_tag LOCUS_13580 27781 26747 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_13580 28599 27778 gene locus_tag LOCUS_13590 28599 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 28863 28612 gene locus_tag LOCUS_13600 28863 28612 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_13600 29103 29501 gene locus_tag LOCUS_13610 29103 29501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13610 29961 29674 gene locus_tag LOCUS_13620 29961 29674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 29915 31234 gene locus_tag LOCUS_13630 29915 31234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 32362 31250 gene locus_tag LOCUS_13640 32362 31250 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_13640 32531 35797 gene locus_tag LOCUS_13650 32531 35797 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_13650 35925 37226 gene locus_tag LOCUS_13660 35925 37226 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_13660 37407 39584 gene locus_tag LOCUS_13670 37407 39584 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090030.1 protein_id gnl|my_center|LOCUS_13670 39660 40967 gene locus_tag LOCUS_13680 39660 40967 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947610.1 protein_id gnl|my_center|LOCUS_13680 41594 41061 gene locus_tag LOCUS_13690 41594 41061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 43872 41764 gene locus_tag LOCUS_13700 gene tkt 43872 41764 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098601.1 protein_id gnl|my_center|LOCUS_13700 44765 43890 gene locus_tag LOCUS_13710 44765 43890 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_13710 45902 44820 gene locus_tag LOCUS_13720 45902 44820 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_13720 46019 46930 gene locus_tag LOCUS_13730 46019 46930 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_13730 48496 47003 gene locus_tag LOCUS_13740 48496 47003 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_13740 49145 48465 gene locus_tag LOCUS_13750 49145 48465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_13750 50597 49422 gene locus_tag LOCUS_13760 50597 49422 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_13760 50669 51562 gene locus_tag LOCUS_13770 gene rapZ 50669 51562 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195227.1 protein_id gnl|my_center|LOCUS_13770 51559 51936 gene locus_tag LOCUS_13780 51559 51936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 52160 53572 gene locus_tag LOCUS_13790 gene ahcY 52160 53572 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 protein_id gnl|my_center|LOCUS_13790 53609 53962 gene locus_tag LOCUS_13800 53609 53962 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_13800 53985 54824 gene locus_tag LOCUS_13810 gene metF 53985 54824 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_13810 54821 55099 gene locus_tag LOCUS_13820 54821 55099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 55096 55659 gene locus_tag LOCUS_13830 55096 55659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 55659 56384 gene locus_tag LOCUS_13840 55659 56384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 56455 57654 gene locus_tag LOCUS_13850 56455 57654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 58965 57679 gene locus_tag LOCUS_13860 58965 57679 CDS product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104033.1 protein_id gnl|my_center|LOCUS_13860 59184 59447 gene locus_tag LOCUS_13870 59184 59447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 59777 60007 gene locus_tag LOCUS_13880 59777 60007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 60459 60217 gene locus_tag LOCUS_13890 60459 60217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 61549 61061 gene locus_tag LOCUS_13900 61549 61061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 61919 61551 gene locus_tag LOCUS_13910 61919 61551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 62929 61919 gene locus_tag LOCUS_13920 62929 61919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 63097 63714 gene locus_tag LOCUS_13930 63097 63714 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_13930 65062 63785 gene locus_tag LOCUS_13940 65062 63785 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_13940 65380 65075 gene locus_tag LOCUS_13950 65380 65075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 65713 67062 gene locus_tag LOCUS_13960 gene soxC 65713 67062 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_13960 67046 68104 gene locus_tag LOCUS_13970 67046 68104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 68127 68594 gene locus_tag LOCUS_13980 gene soxY 68127 68594 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_13980 68631 68945 gene locus_tag LOCUS_13990 gene soxZ 68631 68945 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_13990 68961 69848 gene locus_tag LOCUS_14000 gene soxA 68961 69848 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_14000 69861 70511 gene locus_tag LOCUS_14010 69861 70511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 70565 72289 gene locus_tag LOCUS_14020 gene soxB 70565 72289 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_14020 72286 72915 gene locus_tag LOCUS_14030 72286 72915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 72953 73519 gene locus_tag LOCUS_14040 72953 73519 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_14040 74722 74288 gene locus_tag LOCUS_14050 74722 74288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 75230 74775 gene locus_tag LOCUS_14060 75230 74775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 76330 75227 gene locus_tag LOCUS_14070 76330 75227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_14070 77655 76339 gene locus_tag LOCUS_14080 gene yegQ 77655 76339 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_14080 77728 79182 gene locus_tag LOCUS_14090 gene rng 77728 79182 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_14090 79265 80278 gene locus_tag LOCUS_14100 79265 80278 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_14100 80711 80499 gene locus_tag LOCUS_14110 80711 80499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 80714 81763 gene locus_tag LOCUS_14120 80714 81763 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941981.1 protein_id gnl|my_center|LOCUS_14120 83396 81756 gene locus_tag LOCUS_14130 gene gpmI 83396 81756 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_14130 84733 83693 gene locus_tag LOCUS_14140 84733 83693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 84936 87614 gene locus_tag LOCUS_14150 84936 87614 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_14150 88152 87715 gene locus_tag LOCUS_14160 88152 87715 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_14160 88931 88164 gene locus_tag LOCUS_14170 88931 88164 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384380.1 protein_id gnl|my_center|LOCUS_14170 89478 88936 gene locus_tag LOCUS_14180 89478 88936 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_14180 90755 89478 gene locus_tag LOCUS_14190 90755 89478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_14190 91282 90758 gene locus_tag LOCUS_14200 91282 90758 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104050.1 protein_id gnl|my_center|LOCUS_14200 92511 91279 gene locus_tag LOCUS_14210 92511 91279 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 protein_id gnl|my_center|LOCUS_14210 93290 92508 gene locus_tag LOCUS_14220 93290 92508 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_14220 94618 93287 gene locus_tag LOCUS_14230 94618 93287 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163651105.1 protein_id gnl|my_center|LOCUS_14230 95475 94636 gene locus_tag LOCUS_14240 gene folE2 95475 94636 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_14240 96049 95807 gene locus_tag LOCUS_14250 96049 95807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 95930 96808 gene locus_tag LOCUS_14260 gene carH 95930 96808 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_14260 97373 96942 gene locus_tag LOCUS_14270 97373 96942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 <98219 97527 gene locus_tag LOCUS_14280 <98219 97527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077173108.1:Hpt domain-containing protein >Feature sequence12 410 2080 gene locus_tag LOCUS_14290 410 2080 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_14290 2210 4873 gene locus_tag LOCUS_14300 2210 4873 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940229.1 protein_id gnl|my_center|LOCUS_14300 6165 4924 gene locus_tag LOCUS_14310 6165 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7589 6351 gene locus_tag LOCUS_14320 7589 6351 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_14320 8453 8058 gene locus_tag LOCUS_14330 8453 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 9142 8477 gene locus_tag LOCUS_14340 9142 8477 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 protein_id gnl|my_center|LOCUS_14340 10891 9266 gene locus_tag LOCUS_14350 10891 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 11270 14077 gene locus_tag LOCUS_14360 11270 14077 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 protein_id gnl|my_center|LOCUS_14360 14074 15477 gene locus_tag LOCUS_14370 14074 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 15776 16408 gene locus_tag LOCUS_14380 15776 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 16684 17502 gene locus_tag LOCUS_14390 16684 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 17577 18416 gene locus_tag LOCUS_14400 17577 18416 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_14400 18985 18557 gene locus_tag LOCUS_14410 18985 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 19629 19453 gene locus_tag LOCUS_14420 19629 19453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 20682 19702 gene locus_tag LOCUS_14430 20682 19702 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_14430 21991 20702 gene locus_tag LOCUS_14440 21991 20702 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_14440 22302 21988 gene locus_tag LOCUS_14450 22302 21988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 23563 22484 gene locus_tag LOCUS_14460 23563 22484 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 protein_id gnl|my_center|LOCUS_14460 23901 23560 gene locus_tag LOCUS_14470 23901 23560 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642555.1 protein_id gnl|my_center|LOCUS_14470 23818 24057 gene locus_tag LOCUS_14480 23818 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 24300 26402 gene locus_tag LOCUS_14490 24300 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 26399 27706 gene locus_tag LOCUS_14500 26399 27706 CDS product IQ calmodulin-binding- domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368619.1 protein_id gnl|my_center|LOCUS_14500 27703 28458 gene locus_tag LOCUS_14510 27703 28458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 28486 28794 gene locus_tag LOCUS_14520 28486 28794 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227980.1 protein_id gnl|my_center|LOCUS_14520 28781 29023 gene locus_tag LOCUS_14530 28781 29023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 29956 29276 gene locus_tag LOCUS_14540 29956 29276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 29880 30680 gene locus_tag LOCUS_14550 29880 30680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 30780 31259 gene locus_tag LOCUS_14560 30780 31259 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_14560 31256 31849 gene locus_tag LOCUS_14570 31256 31849 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_14570 32351 32010 gene locus_tag LOCUS_14580 32351 32010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 33627 32848 gene locus_tag LOCUS_14590 33627 32848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 35125 33791 gene locus_tag LOCUS_14600 gene gltA 35125 33791 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969265.1 protein_id gnl|my_center|LOCUS_14600 35435 35815 gene locus_tag LOCUS_14610 35435 35815 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 protein_id gnl|my_center|LOCUS_14610 35775 36500 gene locus_tag LOCUS_14620 35775 36500 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992241.1 protein_id gnl|my_center|LOCUS_14620 37039 36620 gene locus_tag LOCUS_14630 37039 36620 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770968.1 protein_id gnl|my_center|LOCUS_14630 37308 37039 gene locus_tag LOCUS_14640 37308 37039 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_14640 39112 37478 gene locus_tag LOCUS_14650 39112 37478 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_14650 39921 39145 gene locus_tag LOCUS_14660 39921 39145 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971533.1 protein_id gnl|my_center|LOCUS_14660 40754 39897 gene locus_tag LOCUS_14670 40754 39897 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_14670 41485 40859 gene locus_tag LOCUS_14680 41485 40859 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 protein_id gnl|my_center|LOCUS_14680 42258 41551 gene locus_tag LOCUS_14690 42258 41551 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_14690 42525 45098 gene locus_tag LOCUS_14700 42525 45098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 45944 45168 gene locus_tag LOCUS_14710 45944 45168 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_14710 47651 46185 gene locus_tag LOCUS_14720 47651 46185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 48120 49658 gene locus_tag LOCUS_14730 48120 49658 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_14730 51840 49813 gene locus_tag LOCUS_14740 51840 49813 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_14740 52360 53127 gene locus_tag LOCUS_14750 52360 53127 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_14750 53190 54371 gene locus_tag LOCUS_14760 53190 54371 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_14760 54430 54870 gene locus_tag LOCUS_14770 54430 54870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 54881 55300 gene locus_tag LOCUS_14780 54881 55300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 55444 56517 gene locus_tag LOCUS_14790 55444 56517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 56580 57686 gene locus_tag LOCUS_14800 56580 57686 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_14800 57804 59078 gene locus_tag LOCUS_14810 57804 59078 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_14810 60641 59127 gene locus_tag LOCUS_14820 gene glpK 60641 59127 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_14820 61284 60682 gene locus_tag LOCUS_14830 61284 60682 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_14830 61505 62254 gene locus_tag LOCUS_14840 61505 62254 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_14840 62257 63189 gene locus_tag LOCUS_14850 62257 63189 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_14850 63214 63879 gene locus_tag LOCUS_14860 63214 63879 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_14860 63923 65689 gene locus_tag LOCUS_14870 63923 65689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 65717 67510 gene locus_tag LOCUS_14880 65717 67510 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_14880 67683 68033 gene locus_tag LOCUS_14890 67683 68033 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_14890 68055 70031 gene locus_tag LOCUS_14900 68055 70031 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_14900 70166 70882 gene locus_tag LOCUS_14910 70166 70882 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_14910 71089 71973 gene locus_tag LOCUS_14920 71089 71973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_14920 72071 73519 gene locus_tag LOCUS_14930 72071 73519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 74167 73511 gene locus_tag LOCUS_14940 74167 73511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 74946 74164 gene locus_tag LOCUS_14950 74946 74164 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_14950 75337 74957 gene locus_tag LOCUS_14960 75337 74957 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_14960 76385 75345 gene locus_tag LOCUS_14970 76385 75345 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_14970 77017 76382 gene locus_tag LOCUS_14980 gene tmk 77017 76382 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_14980 78015 77014 gene locus_tag LOCUS_14990 gene mltG 78015 77014 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_14990 78223 79254 gene locus_tag LOCUS_15000 78223 79254 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_15000 79267 80049 gene locus_tag LOCUS_15010 79267 80049 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_15010 80507 80019 gene locus_tag LOCUS_15020 80507 80019 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_15020 80965 80504 gene locus_tag LOCUS_15030 gene tadA 80965 80504 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552523.1 protein_id gnl|my_center|LOCUS_15030 81292 81774 gene locus_tag LOCUS_15040 81292 81774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 82147 81782 gene locus_tag LOCUS_15050 82147 81782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 82947 82417 gene locus_tag LOCUS_15060 82947 82417 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_15060 83420 83019 gene locus_tag LOCUS_15070 83420 83019 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_15070 84616 83882 gene locus_tag LOCUS_15080 84616 83882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 85107 84739 gene locus_tag LOCUS_15090 85107 84739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 85584 85270 gene locus_tag LOCUS_15100 85584 85270 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_15100 86342 85761 gene locus_tag LOCUS_15110 86342 85761 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 protein_id gnl|my_center|LOCUS_15110 87218 88372 gene locus_tag LOCUS_15120 87218 88372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 88974 89486 gene locus_tag LOCUS_15130 gene tnpA 88974 89486 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_15130 89539 92685 gene locus_tag LOCUS_15140 89539 92685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 94543 93146 gene locus_tag LOCUS_15150 94543 93146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531638.1 protein_id gnl|my_center|LOCUS_15150 95289 94966 gene locus_tag LOCUS_15160 95289 94966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 96157 95393 gene locus_tag LOCUS_15170 96157 95393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 96738 96184 gene locus_tag LOCUS_15180 96738 96184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence13 464 1423 gene locus_tag LOCUS_15190 464 1423 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869118.1 protein_id gnl|my_center|LOCUS_15190 1457 2293 gene locus_tag LOCUS_15200 1457 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2308 2988 gene locus_tag LOCUS_15210 2308 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3149 3853 gene locus_tag LOCUS_15220 3149 3853 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_15220 3862 6231 gene locus_tag LOCUS_15230 3862 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 6456 6641 gene locus_tag LOCUS_15240 6456 6641 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049786599.1 protein_id gnl|my_center|LOCUS_15240 6906 7088 gene locus_tag LOCUS_15250 6906 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 7131 7511 gene locus_tag LOCUS_15260 7131 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 7577 8380 gene locus_tag LOCUS_15270 7577 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 8380 9219 gene locus_tag LOCUS_15280 8380 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 9216 10118 gene locus_tag LOCUS_15290 9216 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 10115 12061 gene locus_tag LOCUS_15300 10115 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 12124 13905 gene locus_tag LOCUS_15310 12124 13905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 13863 14477 gene locus_tag LOCUS_15320 13863 14477 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696151.1 protein_id gnl|my_center|LOCUS_15320 14474 15982 gene locus_tag LOCUS_15330 14474 15982 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218639.1 protein_id gnl|my_center|LOCUS_15330 16164 17075 gene locus_tag LOCUS_15340 16164 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 18713 17232 gene locus_tag LOCUS_15350 18713 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 19105 18800 gene locus_tag LOCUS_15360 19105 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214185133.1 protein_id gnl|my_center|LOCUS_15360 20828 19401 gene locus_tag LOCUS_15370 20828 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 21501 20974 gene locus_tag LOCUS_15380 21501 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 23934 21613 gene locus_tag LOCUS_15390 23934 21613 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_15390 24312 24764 gene locus_tag LOCUS_15400 24312 24764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 24761 25351 gene locus_tag LOCUS_15410 24761 25351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 25416 27380 gene locus_tag LOCUS_15420 25416 27380 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_15420 27464 29161 gene locus_tag LOCUS_15430 27464 29161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 29282 30253 gene locus_tag LOCUS_15440 29282 30253 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098100.1 protein_id gnl|my_center|LOCUS_15440 30280 31218 gene locus_tag LOCUS_15450 30280 31218 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315817.1 protein_id gnl|my_center|LOCUS_15450 31240 31629 gene locus_tag LOCUS_15460 gene cheY 31240 31629 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811911.1 protein_id gnl|my_center|LOCUS_15460 31631 32491 gene locus_tag LOCUS_15470 31631 32491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 32502 34445 gene locus_tag LOCUS_15480 32502 34445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 34618 35757 gene locus_tag LOCUS_15490 gene flhB 34618 35757 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 protein_id gnl|my_center|LOCUS_15490 35750 37837 gene locus_tag LOCUS_15500 gene flhA 35750 37837 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_15500 37834 39171 gene locus_tag LOCUS_15510 37834 39171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 39164 40048 gene locus_tag LOCUS_15520 39164 40048 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420320.1 protein_id gnl|my_center|LOCUS_15520 40066 40812 gene locus_tag LOCUS_15530 40066 40812 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_15530 40805 41545 gene locus_tag LOCUS_15540 40805 41545 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_15540 41549 42364 gene locus_tag LOCUS_15550 gene motD 41549 42364 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_15550 42851 42375 gene locus_tag LOCUS_15560 42851 42375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 43195 42866 gene locus_tag LOCUS_15570 43195 42866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 43948 43244 gene locus_tag LOCUS_15580 gene flgA 43948 43244 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_15580 44167 44580 gene locus_tag LOCUS_15590 gene flgB 44167 44580 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_15590 44583 44987 gene locus_tag LOCUS_15600 gene flgC 44583 44987 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 protein_id gnl|my_center|LOCUS_15600 45013 45702 gene locus_tag LOCUS_15610 gene flgD 45013 45702 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_15610 45712 46968 gene locus_tag LOCUS_15620 gene flgE 45712 46968 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_15620 47004 47753 gene locus_tag LOCUS_15630 gene flgF 47004 47753 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_15630 47764 48546 gene locus_tag LOCUS_15640 gene flgG 47764 48546 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_15640 48557 49243 gene locus_tag LOCUS_15650 48557 49243 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_15650 49255 50391 gene locus_tag LOCUS_15660 49255 50391 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 protein_id gnl|my_center|LOCUS_15660 50427 51362 gene locus_tag LOCUS_15670 gene flgJ 50427 51362 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160623692.1 protein_id gnl|my_center|LOCUS_15670 51453 53483 gene locus_tag LOCUS_15680 gene flgK 51453 53483 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_15680 53494 54798 gene locus_tag LOCUS_15690 gene flgL 53494 54798 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_15690 54817 55359 gene locus_tag LOCUS_15700 54817 55359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 56131 55346 gene locus_tag LOCUS_15710 gene fliR 56131 55346 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_15710 56408 56139 gene locus_tag LOCUS_15720 gene fliQ 56408 56139 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 protein_id gnl|my_center|LOCUS_15720 57151 56405 gene locus_tag LOCUS_15730 gene fliP 57151 56405 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253450.1 protein_id gnl|my_center|LOCUS_15730 57464 57144 gene locus_tag LOCUS_15740 57464 57144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 58141 57704 gene locus_tag LOCUS_15750 58141 57704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 59138 58134 gene locus_tag LOCUS_15760 gene fliM 59138 58134 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_15760 59696 59145 gene locus_tag LOCUS_15770 59696 59145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 60803 59757 gene locus_tag LOCUS_15780 60803 59757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 61309 60863 gene locus_tag LOCUS_15790 61309 60863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 62785 61367 gene locus_tag LOCUS_15800 gene fliI 62785 61367 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_15800 63495 62782 gene locus_tag LOCUS_15810 gene fliH 63495 62782 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556525.1 protein_id gnl|my_center|LOCUS_15810 64507 63509 gene locus_tag LOCUS_15820 gene fliG 64507 63509 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_15820 66230 64497 gene locus_tag LOCUS_15830 gene fliF 66230 64497 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_15830 66336 67514 gene locus_tag LOCUS_15840 gene fleS 66336 67514 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_15840 67530 68900 gene locus_tag LOCUS_15850 67530 68900 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 protein_id gnl|my_center|LOCUS_15850 68977 69300 gene locus_tag LOCUS_15860 gene fliE 68977 69300 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_15860 70091 69726 gene locus_tag LOCUS_15870 70091 69726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 72136 70637 gene locus_tag LOCUS_15880 72136 70637 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_15880 74818 72140 gene locus_tag LOCUS_15890 74818 72140 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_15890 75707 75186 gene locus_tag LOCUS_15900 75707 75186 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 protein_id gnl|my_center|LOCUS_15900 75899 76144 gene locus_tag LOCUS_15910 75899 76144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 76141 76536 gene locus_tag LOCUS_15920 76141 76536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 77514 77284 gene locus_tag LOCUS_15930 77514 77284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 77798 78082 gene locus_tag LOCUS_15940 77798 78082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 78158 78439 gene locus_tag LOCUS_15950 78158 78439 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_15950 78441 78785 gene locus_tag LOCUS_15960 78441 78785 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_15960 79760 78894 gene locus_tag LOCUS_15970 79760 78894 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 protein_id gnl|my_center|LOCUS_15970 79939 80847 gene locus_tag LOCUS_15980 gene nifH 79939 80847 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_15980 80854 80766 gene locus_tag LOCUS_t00200 80854 80766 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 80929 82431 gene locus_tag LOCUS_15990 gene nifD 80929 82431 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_15990 82495 84063 gene locus_tag LOCUS_16000 gene nifK 82495 84063 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_16000 84128 84352 gene locus_tag LOCUS_16010 84128 84352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 84376 84573 gene locus_tag LOCUS_16020 84376 84573 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723758.1 protein_id gnl|my_center|LOCUS_16020 84591 85316 gene locus_tag LOCUS_16030 84591 85316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 85329 86303 gene locus_tag LOCUS_16040 85329 86303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 86465 87217 gene locus_tag LOCUS_16050 gene modA 86465 87217 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_16050 87219 87887 gene locus_tag LOCUS_16060 gene modB 87219 87887 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_16060 87884 88954 gene locus_tag LOCUS_16070 gene modC 87884 88954 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_16070 89093 90238 gene locus_tag LOCUS_16080 gene dauA 89093 90238 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_16080 90508 91011 gene locus_tag LOCUS_16090 90508 91011 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_16090 92148 91054 gene locus_tag LOCUS_16100 92148 91054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 93841 92438 gene locus_tag LOCUS_16110 gene fumC 93841 92438 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532308.1 protein_id gnl|my_center|LOCUS_16110 94119 93889 gene locus_tag LOCUS_16120 94119 93889 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_16120 94507 94908 gene locus_tag LOCUS_16130 94507 94908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 94938 95147 gene locus_tag LOCUS_16140 94938 95147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence14 2913 1588 gene locus_tag LOCUS_16150 gene paaF 2913 1588 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064014.1 protein_id gnl|my_center|LOCUS_16150 3105 4439 gene locus_tag LOCUS_16160 3105 4439 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930260.1 protein_id gnl|my_center|LOCUS_16160 4607 6745 gene locus_tag LOCUS_16170 gene cirA 4607 6745 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 protein_id gnl|my_center|LOCUS_16170 6817 7356 gene locus_tag LOCUS_16180 6817 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 7459 10287 gene locus_tag LOCUS_16190 7459 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 10274 12400 gene locus_tag LOCUS_16200 10274 12400 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044977.1 protein_id gnl|my_center|LOCUS_16200 12466 13518 gene locus_tag LOCUS_16210 12466 13518 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_16210 13543 15048 gene locus_tag LOCUS_16220 13543 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 15481 15158 gene locus_tag LOCUS_16230 15481 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 15761 16678 gene locus_tag LOCUS_16240 15761 16678 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_16240 16729 18390 gene locus_tag LOCUS_16250 16729 18390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 18576 18914 gene locus_tag LOCUS_16260 18576 18914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 20979 18991 gene locus_tag LOCUS_16270 20979 18991 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_16270 22531 20999 gene locus_tag LOCUS_16280 22531 20999 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_16280 23607 22603 gene locus_tag LOCUS_16290 gene meaB 23607 22603 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_16290 25804 23633 gene locus_tag LOCUS_16300 gene scpA 25804 23633 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_16300 26002 26673 gene locus_tag LOCUS_16310 26002 26673 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039419.1 protein_id gnl|my_center|LOCUS_16310 26670 27449 gene locus_tag LOCUS_16320 26670 27449 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928184.1 protein_id gnl|my_center|LOCUS_16320 28259 27459 gene locus_tag LOCUS_16330 28259 27459 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_16330 29095 28370 gene locus_tag LOCUS_16340 gene rfbD 29095 28370 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706708.1 protein_id gnl|my_center|LOCUS_16340 29072 29284 gene locus_tag LOCUS_16350 29072 29284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 30330 29263 gene locus_tag LOCUS_16360 gene rfbB 30330 29263 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_16360 31843 30422 gene locus_tag LOCUS_16370 31843 30422 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_16370 31962 32915 gene locus_tag LOCUS_16380 gene waaC 31962 32915 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530067.1 protein_id gnl|my_center|LOCUS_16380 32915 34189 gene locus_tag LOCUS_16390 gene waaA 32915 34189 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_16390 35519 34164 gene locus_tag LOCUS_16400 35519 34164 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_16400 36221 35556 gene locus_tag LOCUS_16410 36221 35556 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_16410 36423 37496 gene locus_tag LOCUS_16420 36423 37496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 37535 37750 gene locus_tag LOCUS_16430 37535 37750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 40076 37791 gene locus_tag LOCUS_16440 40076 37791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 40506 40177 gene locus_tag LOCUS_16450 40506 40177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 41037 40768 gene locus_tag LOCUS_16460 gene rpsT 41037 40768 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_16460 42408 41248 gene locus_tag LOCUS_16470 42408 41248 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 protein_id gnl|my_center|LOCUS_16470 44001 42907 gene locus_tag LOCUS_16480 44001 42907 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198441.1 protein_id gnl|my_center|LOCUS_16480 44323 44571 gene locus_tag LOCUS_16490 44323 44571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 44568 44981 gene locus_tag LOCUS_16500 44568 44981 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 protein_id gnl|my_center|LOCUS_16500 45910 45122 gene locus_tag LOCUS_16510 gene trpC 45910 45122 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_16510 46509 45907 gene locus_tag LOCUS_16520 46509 45907 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_16520 47562 46537 gene locus_tag LOCUS_16530 gene trpD 47562 46537 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_16530 48131 47559 gene locus_tag LOCUS_16540 48131 47559 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217367.1 protein_id gnl|my_center|LOCUS_16540 48644 49021 gene locus_tag LOCUS_16550 48644 49021 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088914.1 protein_id gnl|my_center|LOCUS_16550 49033 51378 gene locus_tag LOCUS_16560 gene lon 49033 51378 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_16560 51478 52899 gene locus_tag LOCUS_16570 51478 52899 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090487.1 protein_id gnl|my_center|LOCUS_16570 53064 53567 gene locus_tag LOCUS_16580 53064 53567 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_16580 53684 54358 gene locus_tag LOCUS_16590 53684 54358 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_16590 55843 54371 gene locus_tag LOCUS_16600 gene trpE 55843 54371 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_16600 56685 56002 gene locus_tag LOCUS_16610 56685 56002 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_16610 57374 56685 gene locus_tag LOCUS_16620 gene rpe 57374 56685 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186923.1 protein_id gnl|my_center|LOCUS_16620 59502 57487 gene locus_tag LOCUS_16630 gene glgX 59502 57487 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_16630 61673 59490 gene locus_tag LOCUS_16640 gene glgB 61673 59490 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283713.1 protein_id gnl|my_center|LOCUS_16640 64138 61685 gene locus_tag LOCUS_16650 gene glgP 64138 61685 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209497.1 protein_id gnl|my_center|LOCUS_16650 65126 64161 gene locus_tag LOCUS_16660 65126 64161 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 protein_id gnl|my_center|LOCUS_16660 65484 66893 gene locus_tag LOCUS_16670 65484 66893 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 protein_id gnl|my_center|LOCUS_16670 67800 66931 gene locus_tag LOCUS_16680 gene hslO 67800 66931 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_16680 68894 67797 gene locus_tag LOCUS_16690 gene nadA 68894 67797 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_16690 69396 68947 gene locus_tag LOCUS_16700 69396 68947 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_16700 69690 71105 gene locus_tag LOCUS_16710 gene glnA 69690 71105 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_16710 71281 71766 gene locus_tag LOCUS_16720 71281 71766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 71799 72872 gene locus_tag LOCUS_16730 gene glnL 71799 72872 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_16730 72943 74373 gene locus_tag LOCUS_16740 gene ntrC 72943 74373 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 protein_id gnl|my_center|LOCUS_16740 74412 75218 gene locus_tag LOCUS_16750 gene birA 74412 75218 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115072.1 protein_id gnl|my_center|LOCUS_16750 75215 75934 gene locus_tag LOCUS_16760 75215 75934 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196311.1 protein_id gnl|my_center|LOCUS_16760 75971 76375 gene locus_tag LOCUS_16770 75971 76375 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267180.1 protein_id gnl|my_center|LOCUS_16770 76442 77452 gene locus_tag LOCUS_16780 76442 77452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 77542 79410 gene locus_tag LOCUS_16790 77542 79410 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891790.1 protein_id gnl|my_center|LOCUS_16790 79412 79558 gene locus_tag LOCUS_16800 79412 79558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 79686 80099 gene locus_tag LOCUS_16810 79686 80099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 81243 80116 gene locus_tag LOCUS_16820 81243 80116 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_16820 82822 81263 gene locus_tag LOCUS_16830 gene ubiB 82822 81263 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_16830 82935 84707 gene locus_tag LOCUS_16840 gene argS 82935 84707 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_16840 84728 85462 gene locus_tag LOCUS_16850 84728 85462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 85478 86125 gene locus_tag LOCUS_16860 gene dsbA 85478 86125 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190112.1 protein_id gnl|my_center|LOCUS_16860 86227 86994 gene locus_tag LOCUS_16870 86227 86994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_16870 87713 87084 gene locus_tag LOCUS_16880 87713 87084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_16880 87636 87806 gene locus_tag LOCUS_16890 87636 87806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 87847 88650 gene locus_tag LOCUS_16900 87847 88650 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_16900 89412 88738 gene locus_tag LOCUS_16910 89412 88738 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_16910 90397 89471 gene locus_tag LOCUS_16920 90397 89471 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_16920 92180 91188 gene locus_tag LOCUS_16930 92180 91188 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_16930 92472 93971 gene locus_tag LOCUS_16940 92472 93971 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112138.1 protein_id gnl|my_center|LOCUS_16940 94995 94483 gene locus_tag LOCUS_16950 94995 94483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence15 340 1545 gene locus_tag LOCUS_16960 340 1545 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202275.1 protein_id gnl|my_center|LOCUS_16960 2257 1682 gene locus_tag LOCUS_16970 gene phaR 2257 1682 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 protein_id gnl|my_center|LOCUS_16970 3143 2400 gene locus_tag LOCUS_16980 3143 2400 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_16980 3490 3200 gene locus_tag LOCUS_16990 3490 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3485 3718 gene locus_tag LOCUS_17000 3485 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4572 3715 gene locus_tag LOCUS_17010 gene pgeF 4572 3715 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_17010 5539 4553 gene locus_tag LOCUS_17020 5539 4553 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_17020 5673 6467 gene locus_tag LOCUS_17030 5673 6467 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937181.1 protein_id gnl|my_center|LOCUS_17030 8955 6541 gene locus_tag LOCUS_17040 8955 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 10301 8952 gene locus_tag LOCUS_17050 gene rmuC 10301 8952 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193862.1 protein_id gnl|my_center|LOCUS_17050 13653 10354 gene locus_tag LOCUS_17060 13653 10354 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931090.1 protein_id gnl|my_center|LOCUS_17060 13879 14277 gene locus_tag LOCUS_17070 13879 14277 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_17070 15047 14286 gene locus_tag LOCUS_17080 gene gloB 15047 14286 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192690.1 protein_id gnl|my_center|LOCUS_17080 15075 15797 gene locus_tag LOCUS_17090 15075 15797 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_17090 15787 16248 gene locus_tag LOCUS_17100 gene rnhA 15787 16248 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_17100 16270 16989 gene locus_tag LOCUS_17110 gene dnaQ 16270 16989 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_17110 18060 17776 gene locus_tag LOCUS_17120 18060 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 18252 20180 gene locus_tag LOCUS_17130 18252 20180 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073569.1 protein_id gnl|my_center|LOCUS_17130 20430 20227 gene locus_tag LOCUS_17140 20430 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 21911 20451 gene locus_tag LOCUS_17150 21911 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 22522 21908 gene locus_tag LOCUS_17160 22522 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 23855 22593 gene locus_tag LOCUS_17170 23855 22593 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_17170 24645 23965 gene locus_tag LOCUS_17180 24645 23965 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 protein_id gnl|my_center|LOCUS_17180 25459 24974 gene locus_tag LOCUS_17190 25459 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 27284 25524 gene locus_tag LOCUS_17200 27284 25524 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_17200 27934 27329 gene locus_tag LOCUS_17210 27934 27329 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_17210 29263 27968 gene locus_tag LOCUS_17220 29263 27968 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_17220 30989 29256 gene locus_tag LOCUS_17230 30989 29256 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_17230 31584 30997 gene locus_tag LOCUS_17240 31584 30997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 32319 31603 gene locus_tag LOCUS_17250 32319 31603 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655964.1 protein_id gnl|my_center|LOCUS_17250 32661 33086 gene locus_tag LOCUS_17260 32661 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 33877 33242 gene locus_tag LOCUS_17270 33877 33242 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_17270 34997 33984 gene locus_tag LOCUS_17280 34997 33984 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_17280 35649 35011 gene locus_tag LOCUS_17290 35649 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 36649 35840 gene locus_tag LOCUS_17300 36649 35840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 37314 36649 gene locus_tag LOCUS_17310 gene parA 37314 36649 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_17310 40275 37582 gene locus_tag LOCUS_17320 40275 37582 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_17320 41332 40430 gene locus_tag LOCUS_17330 41332 40430 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_17330 42293 41355 gene locus_tag LOCUS_17340 gene ylqF 42293 41355 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_17340 42422 43246 gene locus_tag LOCUS_17350 42422 43246 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521971.1 protein_id gnl|my_center|LOCUS_17350 43307 43624 gene locus_tag LOCUS_17360 43307 43624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 43807 44706 gene locus_tag LOCUS_17370 gene galU 43807 44706 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_17370 45075 46664 gene locus_tag LOCUS_17380 gene nadB 45075 46664 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_17380 47064 46630 gene locus_tag LOCUS_17390 47064 46630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 48356 47094 gene locus_tag LOCUS_17400 gene fabF 48356 47094 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_17400 48680 48444 gene locus_tag LOCUS_17410 gene acpP 48680 48444 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_17410 49539 48799 gene locus_tag LOCUS_17420 gene fabG 49539 48799 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_17420 50486 49533 gene locus_tag LOCUS_17430 gene fabD 50486 49533 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_17430 51457 50498 gene locus_tag LOCUS_17440 51457 50498 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524613.1 protein_id gnl|my_center|LOCUS_17440 52472 51459 gene locus_tag LOCUS_17450 gene plsX 52472 51459 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_17450 52721 52542 gene locus_tag LOCUS_17460 gene rpmF 52721 52542 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_17460 53237 52746 gene locus_tag LOCUS_17470 53237 52746 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_17470 53354 53950 gene locus_tag LOCUS_17480 53354 53950 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_17480 53972 54682 gene locus_tag LOCUS_17490 53972 54682 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_17490 55659 54706 gene locus_tag LOCUS_17500 55659 54706 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_17500 56015 55656 gene locus_tag LOCUS_17510 56015 55656 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_17510 56650 55994 gene locus_tag LOCUS_17520 56650 55994 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_17520 57623 56634 gene locus_tag LOCUS_17530 57623 56634 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_17530 58025 60847 gene locus_tag LOCUS_17540 58025 60847 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192715.1 protein_id gnl|my_center|LOCUS_17540 60970 61575 gene locus_tag LOCUS_17550 60970 61575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 63620 61650 gene locus_tag LOCUS_17560 63620 61650 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_17560 64457 63681 gene locus_tag LOCUS_17570 gene mutM 64457 63681 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 protein_id gnl|my_center|LOCUS_17570 64605 66347 gene locus_tag LOCUS_17580 64605 66347 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_17580 66377 66985 gene locus_tag LOCUS_17590 gene lolB 66377 66985 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818921.1 protein_id gnl|my_center|LOCUS_17590 66982 67848 gene locus_tag LOCUS_17600 gene ispE 66982 67848 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_17600 67956 68032 gene locus_tag LOCUS_t00210 67956 68032 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 68122 69072 gene locus_tag LOCUS_17610 68122 69072 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_17610 69153 69755 gene locus_tag LOCUS_17620 69153 69755 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 protein_id gnl|my_center|LOCUS_17620 69839 70408 gene locus_tag LOCUS_17630 gene pth 69839 70408 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_17630 70425 71516 gene locus_tag LOCUS_17640 gene ychF 70425 71516 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_17640 71563 71865 gene locus_tag LOCUS_17650 71563 71865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 71869 72072 gene locus_tag LOCUS_17660 71869 72072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 75361 72536 gene locus_tag LOCUS_17670 75361 72536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 75636 75890 gene locus_tag LOCUS_17680 75636 75890 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703741.1 protein_id gnl|my_center|LOCUS_17680 75887 76222 gene locus_tag LOCUS_17690 75887 76222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 77240 76389 gene locus_tag LOCUS_17700 77240 76389 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110402348.1 protein_id gnl|my_center|LOCUS_17700 78337 77309 gene locus_tag LOCUS_17710 gene epmB 78337 77309 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_17710 78378 78947 gene locus_tag LOCUS_17720 gene efp 78378 78947 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_17720 79014 79961 gene locus_tag LOCUS_17730 gene epmA 79014 79961 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175550.1 protein_id gnl|my_center|LOCUS_17730 80326 80763 gene locus_tag LOCUS_17740 80326 80763 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236777.1 protein_id gnl|my_center|LOCUS_17740 81156 80956 gene locus_tag LOCUS_17750 81156 80956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 81130 81333 gene locus_tag LOCUS_17760 81130 81333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 82132 81512 gene locus_tag LOCUS_17770 82132 81512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 83562 83059 gene locus_tag LOCUS_17780 83562 83059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 83951 83763 gene locus_tag LOCUS_17790 83951 83763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 86763 84073 gene locus_tag LOCUS_17800 gene acnB 86763 84073 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence16 503 1189 gene locus_tag LOCUS_17810 503 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1605 1808 gene locus_tag LOCUS_17820 1605 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1986 2714 gene locus_tag LOCUS_17830 1986 2714 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_17830 2818 3909 gene locus_tag LOCUS_17840 2818 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4122 3805 gene locus_tag LOCUS_17850 4122 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4215 4463 gene locus_tag LOCUS_17860 4215 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17860 4460 4696 gene locus_tag LOCUS_17870 4460 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4847 5197 gene locus_tag LOCUS_17880 4847 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17880 5506 6036 gene locus_tag LOCUS_17890 5506 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5958 7112 gene locus_tag LOCUS_17900 5958 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17900 7569 9089 gene locus_tag LOCUS_17910 7569 9089 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388686.1 protein_id gnl|my_center|LOCUS_17910 9157 9519 gene locus_tag LOCUS_17920 9157 9519 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_17920 12802 9971 gene locus_tag LOCUS_17930 12802 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 13092 13391 gene locus_tag LOCUS_17940 13092 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 15149 13527 gene locus_tag LOCUS_17950 15149 13527 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_17950 17106 15265 gene locus_tag LOCUS_17960 gene typA 17106 15265 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688609.1 protein_id gnl|my_center|LOCUS_17960 17591 17205 gene locus_tag LOCUS_17970 17591 17205 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_17970 17906 18235 gene locus_tag LOCUS_17980 17906 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 18363 18638 gene locus_tag LOCUS_17990 18363 18638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 20177 18729 gene locus_tag LOCUS_18000 20177 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 20596 20222 gene locus_tag LOCUS_18010 20596 20222 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_18010 20862 20593 gene locus_tag LOCUS_18020 20862 20593 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_18020 21344 20856 gene locus_tag LOCUS_18030 21344 20856 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_18030 22861 21344 gene locus_tag LOCUS_18040 22861 21344 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_18040 23184 22858 gene locus_tag LOCUS_18050 23184 22858 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_18050 26000 23184 gene locus_tag LOCUS_18060 26000 23184 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_18060 26170 26868 gene locus_tag LOCUS_18070 gene phoU 26170 26868 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 protein_id gnl|my_center|LOCUS_18070 26865 27590 gene locus_tag LOCUS_18080 gene phoB 26865 27590 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_18080 27587 28897 gene locus_tag LOCUS_18090 gene phoR 27587 28897 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_18090 29118 30758 gene locus_tag LOCUS_18100 29118 30758 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 protein_id gnl|my_center|LOCUS_18100 31960 30821 gene locus_tag LOCUS_18110 gene queG 31960 30821 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_18110 31955 32440 gene locus_tag LOCUS_18120 31955 32440 CDS product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065018.1 protein_id gnl|my_center|LOCUS_18120 32413 33768 gene locus_tag LOCUS_18130 32413 33768 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_18130 33852 33927 gene locus_tag LOCUS_t00220 33852 33927 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 34785 35717 gene locus_tag LOCUS_18140 34785 35717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 35704 36615 gene locus_tag LOCUS_18150 35704 36615 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703829.1 protein_id gnl|my_center|LOCUS_18150 38006 37263 gene locus_tag LOCUS_18160 38006 37263 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_18160 41167 38006 gene locus_tag LOCUS_18170 41167 38006 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_18170 43116 41164 gene locus_tag LOCUS_18180 43116 41164 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870222.1 protein_id gnl|my_center|LOCUS_18180 44279 43113 gene locus_tag LOCUS_18190 44279 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 44431 44270 gene locus_tag LOCUS_18200 44431 44270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 46736 44370 gene locus_tag LOCUS_18210 46736 44370 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 protein_id gnl|my_center|LOCUS_18210 47720 47052 gene locus_tag LOCUS_18220 47720 47052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 48238 47717 gene locus_tag LOCUS_18230 48238 47717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 50979 48442 gene locus_tag LOCUS_18240 50979 48442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 51412 51185 gene locus_tag LOCUS_18250 51412 51185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 52335 51619 gene locus_tag LOCUS_18260 52335 51619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968616.1 protein_id gnl|my_center|LOCUS_18260 52676 52446 gene locus_tag LOCUS_18270 52676 52446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 52994 52734 gene locus_tag LOCUS_18280 52994 52734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 53257 53000 gene locus_tag LOCUS_18290 53257 53000 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_18290 54480 53260 gene locus_tag LOCUS_18300 54480 53260 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 protein_id gnl|my_center|LOCUS_18300 55019 56344 gene locus_tag LOCUS_18310 gene rimO 55019 56344 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 protein_id gnl|my_center|LOCUS_18310 59484 56359 gene locus_tag LOCUS_18320 59484 56359 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 protein_id gnl|my_center|LOCUS_18320 60780 59671 gene locus_tag LOCUS_18330 60780 59671 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_18330 61724 60777 gene locus_tag LOCUS_18340 61724 60777 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_18340 61960 61721 gene locus_tag LOCUS_18350 61960 61721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 62399 62016 gene locus_tag LOCUS_18360 62399 62016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 65341 62750 gene locus_tag LOCUS_18370 65341 62750 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_18370 66099 65338 gene locus_tag LOCUS_18380 gene map 66099 65338 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_18380 66491 67222 gene locus_tag LOCUS_18390 gene rpsB 66491 67222 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_18390 67360 68253 gene locus_tag LOCUS_18400 gene tsf 67360 68253 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_18400 68301 69023 gene locus_tag LOCUS_18410 gene pyrH 68301 69023 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_18410 69036 69596 gene locus_tag LOCUS_18420 gene frr 69036 69596 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_18420 69621 70415 gene locus_tag LOCUS_18430 gene uppS 69621 70415 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_18430 70408 71244 gene locus_tag LOCUS_18440 70408 71244 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002239446.1 protein_id gnl|my_center|LOCUS_18440 71244 72449 gene locus_tag LOCUS_18450 71244 72449 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 protein_id gnl|my_center|LOCUS_18450 72446 73813 gene locus_tag LOCUS_18460 gene rseP 72446 73813 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_18460 73818 76103 gene locus_tag LOCUS_18470 gene bamA 73818 76103 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_18470 76119 76637 gene locus_tag LOCUS_18480 76119 76637 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_18480 76662 77045 gene locus_tag LOCUS_18490 76662 77045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 77154 77600 gene locus_tag LOCUS_18500 gene fabZ 77154 77600 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_18500 77620 78390 gene locus_tag LOCUS_18510 gene lpxA 77620 78390 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_18510 78387 79574 gene locus_tag LOCUS_18520 gene lpxB 78387 79574 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192608.1 protein_id gnl|my_center|LOCUS_18520 79552 80151 gene locus_tag LOCUS_18530 gene rnhB 79552 80151 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569419.1 protein_id gnl|my_center|LOCUS_18530 80148 80960 gene locus_tag LOCUS_18540 80148 80960 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_18540 81046 81642 gene locus_tag LOCUS_18550 81046 81642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 82618 81653 gene locus_tag LOCUS_18560 82618 81653 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437216.1 protein_id gnl|my_center|LOCUS_18560 82863 82615 gene locus_tag LOCUS_18570 82863 82615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 84241 82823 gene locus_tag LOCUS_18580 84241 82823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 85425 84574 gene locus_tag LOCUS_18590 85425 84574 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_18590 85560 86495 gene locus_tag LOCUS_18600 gene pfkB 85560 86495 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence17 1199 1633 gene locus_tag LOCUS_18610 1199 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1637 2257 gene locus_tag LOCUS_18620 1637 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4215 2377 gene locus_tag LOCUS_18630 gene glsA 4215 2377 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086712.1 protein_id gnl|my_center|LOCUS_18630 4534 4445 gene locus_tag LOCUS_t00230 4534 4445 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5941 4658 gene locus_tag LOCUS_18640 gene serS 5941 4658 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_18640 7365 6049 gene locus_tag LOCUS_18650 7365 6049 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_18650 7670 7876 gene locus_tag LOCUS_18660 7670 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 9560 8163 gene locus_tag LOCUS_18670 9560 8163 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420440.1 protein_id gnl|my_center|LOCUS_18670 9890 10369 gene locus_tag LOCUS_18680 9890 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18680 11463 10504 gene locus_tag LOCUS_18690 gene gcvA 11463 10504 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 protein_id gnl|my_center|LOCUS_18690 11579 11758 gene locus_tag LOCUS_18700 11579 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 12055 12489 gene locus_tag LOCUS_18710 12055 12489 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_18710 13983 12520 gene locus_tag LOCUS_18720 13983 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 16159 13964 gene locus_tag LOCUS_18730 16159 13964 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_18730 16531 16163 gene locus_tag LOCUS_18740 16531 16163 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_18740 19334 16569 gene locus_tag LOCUS_18750 19334 16569 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_18750 19544 19344 gene locus_tag LOCUS_18760 19544 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 19827 21926 gene locus_tag LOCUS_18770 19827 21926 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968192.1 protein_id gnl|my_center|LOCUS_18770 22186 22452 gene locus_tag LOCUS_18780 22186 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 22494 23678 gene locus_tag LOCUS_18790 22494 23678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 24923 23712 gene locus_tag LOCUS_18800 24923 23712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517213.1 protein_id gnl|my_center|LOCUS_18800 26171 24951 gene locus_tag LOCUS_18810 26171 24951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_18810 26365 28026 gene locus_tag LOCUS_18820 26365 28026 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_18820 29250 28261 gene locus_tag LOCUS_18830 29250 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 30379 29531 gene locus_tag LOCUS_18840 30379 29531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 32012 30621 gene locus_tag LOCUS_18850 32012 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 33509 32409 gene locus_tag LOCUS_18860 gene mnmA 33509 32409 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_18860 34163 33522 gene locus_tag LOCUS_18870 34163 33522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 34639 34151 gene locus_tag LOCUS_18880 34639 34151 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_18880 34712 35632 gene locus_tag LOCUS_18890 34712 35632 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_18890 35659 35856 gene locus_tag LOCUS_18900 35659 35856 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_18900 35895 36911 gene locus_tag LOCUS_18910 gene waaF 35895 36911 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_18910 36908 37351 gene locus_tag LOCUS_18920 36908 37351 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_18920 37348 38319 gene locus_tag LOCUS_18930 37348 38319 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_18930 38321 39700 gene locus_tag LOCUS_18940 38321 39700 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_18940 39746 40999 gene locus_tag LOCUS_18950 39746 40999 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_18950 42444 41080 gene locus_tag LOCUS_18960 42444 41080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 44404 42452 gene locus_tag LOCUS_18970 44404 42452 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_18970 44977 47988 gene locus_tag LOCUS_18980 44977 47988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 49129 48095 gene locus_tag LOCUS_18990 49129 48095 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_18990 49340 49825 gene locus_tag LOCUS_19000 49340 49825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 50077 50796 gene locus_tag LOCUS_19010 50077 50796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 51447 50899 gene locus_tag LOCUS_19020 51447 50899 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_19020 51812 53509 gene locus_tag LOCUS_19030 51812 53509 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_19030 53571 55412 gene locus_tag LOCUS_19040 gene sulP 53571 55412 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 protein_id gnl|my_center|LOCUS_19040 55570 56466 gene locus_tag LOCUS_19050 55570 56466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 56463 57710 gene locus_tag LOCUS_19060 56463 57710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 58442 57825 gene locus_tag LOCUS_19070 58442 57825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 59058 58552 gene locus_tag LOCUS_19080 59058 58552 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_19080 61500 59290 gene locus_tag LOCUS_19090 61500 59290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 62481 61765 gene locus_tag LOCUS_19100 62481 61765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 63234 62584 gene locus_tag LOCUS_19110 63234 62584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 63675 63884 gene locus_tag LOCUS_19120 63675 63884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 64985 63930 gene locus_tag LOCUS_19130 64985 63930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 66205 65549 gene locus_tag LOCUS_19140 66205 65549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 67248 66208 gene locus_tag LOCUS_19150 67248 66208 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_19150 69354 67924 gene locus_tag LOCUS_19160 69354 67924 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_19160 71937 69355 gene locus_tag LOCUS_19170 71937 69355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 75786 72214 gene locus_tag LOCUS_19180 75786 72214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 76466 75834 gene locus_tag LOCUS_19190 76466 75834 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_19190 76635 77486 gene locus_tag LOCUS_19200 76635 77486 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_19200 78014 78316 gene locus_tag LOCUS_19210 78014 78316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 79506 78454 gene locus_tag LOCUS_19220 79506 78454 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038708004.1 protein_id gnl|my_center|LOCUS_19220 79890 79507 gene locus_tag LOCUS_19230 79890 79507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 80023 81456 gene locus_tag LOCUS_19240 80023 81456 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_19240 82117 81476 gene locus_tag LOCUS_19250 82117 81476 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542505.1 protein_id gnl|my_center|LOCUS_19250 83016 82375 gene locus_tag LOCUS_19260 83016 82375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 <85029 83262 gene locus_tag LOCUS_19270 <85029 83262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028173455.1:ABC transporter ATP-binding protein/permease >Feature sequence18 716 1840 gene locus_tag LOCUS_19280 716 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1847 4189 gene locus_tag LOCUS_19290 1847 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 4372 5865 gene locus_tag LOCUS_19300 4372 5865 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261952.1 protein_id gnl|my_center|LOCUS_19300 7053 6271 gene locus_tag LOCUS_19310 gene aotP 7053 6271 CDS product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085940.1 protein_id gnl|my_center|LOCUS_19310 7805 7068 gene locus_tag LOCUS_19320 7805 7068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_19320 8507 7815 gene locus_tag LOCUS_19330 8507 7815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207230.1 protein_id gnl|my_center|LOCUS_19330 9395 8604 gene locus_tag LOCUS_19340 9395 8604 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404105.1 protein_id gnl|my_center|LOCUS_19340 10470 9643 gene locus_tag LOCUS_19350 10470 9643 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_19350 10883 10485 gene locus_tag LOCUS_19360 10883 10485 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_19360 11634 10894 gene locus_tag LOCUS_19370 11634 10894 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_19370 13183 11636 gene locus_tag LOCUS_19380 13183 11636 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_19380 14247 13183 gene locus_tag LOCUS_19390 14247 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_19390 15331 14294 gene locus_tag LOCUS_19400 gene kdd 15331 14294 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_19400 16604 15423 gene locus_tag LOCUS_19410 gene ablA 16604 15423 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023873.1 protein_id gnl|my_center|LOCUS_19410 16766 17209 gene locus_tag LOCUS_19420 16766 17209 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719143.1 protein_id gnl|my_center|LOCUS_19420 17908 19719 gene locus_tag LOCUS_19430 gene kdpA 17908 19719 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550718.1 protein_id gnl|my_center|LOCUS_19430 19736 21802 gene locus_tag LOCUS_19440 gene kdpB 19736 21802 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_19440 21813 22388 gene locus_tag LOCUS_19450 gene kdpC 21813 22388 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_19450 22475 23440 gene locus_tag LOCUS_19460 gene corA 22475 23440 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521393.1 protein_id gnl|my_center|LOCUS_19460 23437 26148 gene locus_tag LOCUS_19470 23437 26148 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_19470 26205 26897 gene locus_tag LOCUS_19480 gene kdpE 26205 26897 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517659.1 protein_id gnl|my_center|LOCUS_19480 27103 28737 gene locus_tag LOCUS_19490 27103 28737 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_19490 28865 29563 gene locus_tag LOCUS_19500 28865 29563 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528683.1 protein_id gnl|my_center|LOCUS_19500 30849 29692 gene locus_tag LOCUS_19510 30849 29692 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_19510 35213 30867 gene locus_tag LOCUS_19520 35213 30867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 35933 35373 gene locus_tag LOCUS_19530 35933 35373 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063992.1 protein_id gnl|my_center|LOCUS_19530 37483 35996 gene locus_tag LOCUS_19540 gene nuoN 37483 35996 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_19540 38980 37496 gene locus_tag LOCUS_19550 38980 37496 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_19550 41094 39004 gene locus_tag LOCUS_19560 gene nuoL 41094 39004 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208277753.1 protein_id gnl|my_center|LOCUS_19560 41402 41097 gene locus_tag LOCUS_19570 gene nuoK 41402 41097 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_19570 42096 41494 gene locus_tag LOCUS_19580 42096 41494 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_19580 42597 42109 gene locus_tag LOCUS_19590 gene nuoI 42597 42109 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_19590 43660 42608 gene locus_tag LOCUS_19600 gene nuoH 43660 42608 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196426.1 protein_id gnl|my_center|LOCUS_19600 45984 43657 gene locus_tag LOCUS_19610 gene nuoG 45984 43657 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_19610 47324 45996 gene locus_tag LOCUS_19620 gene nuoF 47324 45996 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_19620 47797 47324 gene locus_tag LOCUS_19630 gene nuoE 47797 47324 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_19630 49050 47797 gene locus_tag LOCUS_19640 49050 47797 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_19640 49648 49043 gene locus_tag LOCUS_19650 49648 49043 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_19650 50153 49677 gene locus_tag LOCUS_19660 50153 49677 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_19660 50543 50157 gene locus_tag LOCUS_19670 50543 50157 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_19670 50675 50591 gene locus_tag LOCUS_t00240 50675 50591 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51114 50743 gene locus_tag LOCUS_19680 gene secG 51114 50743 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_19680 51574 53739 gene locus_tag LOCUS_19690 51574 53739 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_19690 54357 54941 gene locus_tag LOCUS_19700 54357 54941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 55612 55088 gene locus_tag LOCUS_19710 55612 55088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 55967 55842 gene locus_tag LOCUS_19720 55967 55842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 56428 56159 gene locus_tag LOCUS_19730 56428 56159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 56984 56502 gene locus_tag LOCUS_19740 gene bfr 56984 56502 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 protein_id gnl|my_center|LOCUS_19740 57482 56997 gene locus_tag LOCUS_19750 gene bfr 57482 56997 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_19750 61576 57713 gene locus_tag LOCUS_19760 gene hrpA 61576 57713 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_19760 62928 61909 gene locus_tag LOCUS_19770 62928 61909 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_19770 63040 63738 gene locus_tag LOCUS_19780 63040 63738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 63869 64597 gene locus_tag LOCUS_19790 63869 64597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 65013 65519 gene locus_tag LOCUS_19800 65013 65519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 65639 66622 gene locus_tag LOCUS_19810 65639 66622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 66825 67151 gene locus_tag LOCUS_19820 66825 67151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 67173 67508 gene locus_tag LOCUS_19830 67173 67508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 67655 67882 gene locus_tag LOCUS_19840 67655 67882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 67994 68416 gene locus_tag LOCUS_19850 67994 68416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 69958 68945 gene locus_tag LOCUS_19860 69958 68945 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_19860 70483 70797 gene locus_tag LOCUS_19870 70483 70797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 71199 70876 gene locus_tag LOCUS_19880 71199 70876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 73730 72099 gene locus_tag LOCUS_19890 73730 72099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 73947 74387 gene locus_tag LOCUS_19900 73947 74387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 74470 75099 gene locus_tag LOCUS_19910 74470 75099 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_19910 75787 76269 gene locus_tag LOCUS_19920 75787 76269 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971093.1 protein_id gnl|my_center|LOCUS_19920 76366 76602 gene locus_tag LOCUS_19930 76366 76602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 76697 77227 gene locus_tag LOCUS_19940 76697 77227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 77357 78685 gene locus_tag LOCUS_19950 77357 78685 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_19950 78688 79482 gene locus_tag LOCUS_19960 78688 79482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 79479 79685 gene locus_tag LOCUS_19970 79479 79685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 79827 80027 gene locus_tag LOCUS_19980 79827 80027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 80206 80847 gene locus_tag LOCUS_19990 80206 80847 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_19990 81590 83185 gene locus_tag LOCUS_20000 81590 83185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 83199 83423 gene locus_tag LOCUS_20010 83199 83423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 83489 84289 gene locus_tag LOCUS_20020 83489 84289 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence19 527 120 gene locus_tag LOCUS_20030 527 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2879 603 gene locus_tag LOCUS_20040 2879 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 3613 3924 gene locus_tag LOCUS_20050 3613 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3993 4169 gene locus_tag LOCUS_20060 3993 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4343 4942 gene locus_tag LOCUS_20070 gene msrA 4343 4942 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_20070 5925 4972 gene locus_tag LOCUS_20080 5925 4972 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109658674.1 protein_id gnl|my_center|LOCUS_20080 6077 7405 gene locus_tag LOCUS_20090 6077 7405 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_20090 7486 7965 gene locus_tag LOCUS_20100 7486 7965 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 protein_id gnl|my_center|LOCUS_20100 8462 9004 gene locus_tag LOCUS_20110 8462 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 9508 9278 gene locus_tag LOCUS_20120 9508 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 9729 9499 gene locus_tag LOCUS_20130 9729 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 10852 10217 gene locus_tag LOCUS_20140 10852 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 11928 10840 gene locus_tag LOCUS_20150 11928 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 12738 11932 gene locus_tag LOCUS_20160 12738 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 14321 12735 gene locus_tag LOCUS_20170 14321 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 15727 14318 gene locus_tag LOCUS_20180 15727 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 17298 15832 gene locus_tag LOCUS_20190 17298 15832 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_20190 20700 17317 gene locus_tag LOCUS_20200 gene hsdR 20700 17317 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_20200 21752 20754 gene locus_tag LOCUS_20210 21752 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 21733 22947 gene locus_tag LOCUS_20220 21733 22947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 23932 22982 gene locus_tag LOCUS_20230 gene egtD 23932 22982 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_20230 25418 24006 gene locus_tag LOCUS_20240 25418 24006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 25680 26348 gene locus_tag LOCUS_20250 25680 26348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 26345 28051 gene locus_tag LOCUS_20260 26345 28051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 29667 28006 gene locus_tag LOCUS_20270 29667 28006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 29772 32513 gene locus_tag LOCUS_20280 gene ndvB 29772 32513 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_20280 32846 32622 gene locus_tag LOCUS_20290 32846 32622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 35354 33159 gene locus_tag LOCUS_20300 gene katG 35354 33159 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_20300 36056 36745 gene locus_tag LOCUS_20310 36056 36745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 37049 37243 gene locus_tag LOCUS_20320 37049 37243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 40839 37273 gene locus_tag LOCUS_20330 40839 37273 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706045.1 protein_id gnl|my_center|LOCUS_20330 41384 40836 gene locus_tag LOCUS_20340 41384 40836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20340 41732 41418 gene locus_tag LOCUS_20350 41732 41418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20350 42718 41726 gene locus_tag LOCUS_20360 42718 41726 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057677989.1 protein_id gnl|my_center|LOCUS_20360 43064 42783 gene locus_tag LOCUS_20370 43064 42783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 43467 44276 gene locus_tag LOCUS_20380 43467 44276 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_20380 45277 44453 gene locus_tag LOCUS_20390 45277 44453 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_20390 47427 45283 gene locus_tag LOCUS_20400 47427 45283 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_20400 47782 49047 gene locus_tag LOCUS_20410 47782 49047 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_20410 49044 52556 gene locus_tag LOCUS_20420 49044 52556 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_20420 53338 52739 gene locus_tag LOCUS_20430 gene thpR 53338 52739 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_20430 53732 53328 gene locus_tag LOCUS_20440 53732 53328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 54626 53937 gene locus_tag LOCUS_20450 54626 53937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 54651 54818 gene locus_tag LOCUS_20460 54651 54818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 55695 54868 gene locus_tag LOCUS_20470 gene phnC 55695 54868 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_20470 56585 55692 gene locus_tag LOCUS_20480 56585 55692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 57451 56585 gene locus_tag LOCUS_20490 gene phnD 57451 56585 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061597.1 protein_id gnl|my_center|LOCUS_20490 58190 58266 gene locus_tag LOCUS_t00250 58190 58266 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 59222 58623 gene locus_tag LOCUS_20500 59222 58623 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 protein_id gnl|my_center|LOCUS_20500 59285 60049 gene locus_tag LOCUS_20510 59285 60049 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 protein_id gnl|my_center|LOCUS_20510 60784 60146 gene locus_tag LOCUS_20520 60784 60146 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_20520 60877 61947 gene locus_tag LOCUS_20530 60877 61947 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_20530 61959 62279 gene locus_tag LOCUS_20540 61959 62279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 64082 62427 gene locus_tag LOCUS_20550 64082 62427 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_20550 65586 64087 gene locus_tag LOCUS_20560 65586 64087 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_20560 65555 65722 gene locus_tag LOCUS_20570 65555 65722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 65969 67090 gene locus_tag LOCUS_20580 gene ydiK 65969 67090 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_20580 67155 67754 gene locus_tag LOCUS_20590 67155 67754 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_20590 68026 68373 gene locus_tag LOCUS_20600 68026 68373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 68385 68909 gene locus_tag LOCUS_20610 68385 68909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 70156 69176 gene locus_tag LOCUS_20620 70156 69176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 72922 70175 gene locus_tag LOCUS_20630 72922 70175 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_20630 73899 72919 gene locus_tag LOCUS_20640 73899 72919 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_20640 75560 73896 gene locus_tag LOCUS_20650 75560 73896 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_20650 77538 76135 gene locus_tag LOCUS_20660 77538 76135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 80646 77656 gene locus_tag LOCUS_20670 80646 77656 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035772.1 protein_id gnl|my_center|LOCUS_20670 81082 80693 gene locus_tag LOCUS_20680 81082 80693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 81432 81085 gene locus_tag LOCUS_20690 81432 81085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 81723 81433 gene locus_tag LOCUS_20700 81723 81433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 82112 81822 gene locus_tag LOCUS_20710 82112 81822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 82273 83712 gene locus_tag LOCUS_20720 82273 83712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence20 1344 697 gene locus_tag LOCUS_20730 1344 697 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_20730 2773 1448 gene locus_tag LOCUS_20740 2773 1448 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_20740 3506 2844 gene locus_tag LOCUS_20750 3506 2844 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_20750 3799 3930 gene locus_tag LOCUS_20760 3799 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4003 4557 gene locus_tag LOCUS_20770 4003 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20770 4720 8148 gene locus_tag LOCUS_20780 gene mfd 4720 8148 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_20780 8145 9218 gene locus_tag LOCUS_20790 8145 9218 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_20790 11032 9323 gene locus_tag LOCUS_20800 11032 9323 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_20800 11375 12763 gene locus_tag LOCUS_20810 gene mgtE 11375 12763 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_20810 14318 12849 gene locus_tag LOCUS_20820 14318 12849 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 protein_id gnl|my_center|LOCUS_20820 14756 14550 gene locus_tag LOCUS_20830 14756 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 14685 15170 gene locus_tag LOCUS_20840 14685 15170 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_20840 15235 15894 gene locus_tag LOCUS_20850 15235 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 16041 17513 gene locus_tag LOCUS_20860 16041 17513 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 protein_id gnl|my_center|LOCUS_20860 18408 17608 gene locus_tag LOCUS_20870 18408 17608 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_20870 19057 18437 gene locus_tag LOCUS_20880 19057 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 19992 19054 gene locus_tag LOCUS_20890 19992 19054 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189757.1 protein_id gnl|my_center|LOCUS_20890 20780 19995 gene locus_tag LOCUS_20900 20780 19995 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 protein_id gnl|my_center|LOCUS_20900 21902 20790 gene locus_tag LOCUS_20910 21902 20790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522941.1 protein_id gnl|my_center|LOCUS_20910 23582 22050 gene locus_tag LOCUS_20920 gene ppx 23582 22050 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_20920 23795 25915 gene locus_tag LOCUS_20930 gene ppk1 23795 25915 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521820.1 protein_id gnl|my_center|LOCUS_20930 28189 25964 gene locus_tag LOCUS_20940 28189 25964 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193103.1 protein_id gnl|my_center|LOCUS_20940 28255 29160 gene locus_tag LOCUS_20950 28255 29160 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_20950 29157 29945 gene locus_tag LOCUS_20960 29157 29945 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_20960 30721 30158 gene locus_tag LOCUS_20970 30721 30158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 31158 30751 gene locus_tag LOCUS_20980 31158 30751 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_20980 34181 31419 gene locus_tag LOCUS_20990 gene polA 34181 31419 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_20990 34416 34757 gene locus_tag LOCUS_21000 34416 34757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 34949 36232 gene locus_tag LOCUS_21010 34949 36232 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599076.1 protein_id gnl|my_center|LOCUS_21010 36366 37103 gene locus_tag LOCUS_21020 36366 37103 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190835.1 protein_id gnl|my_center|LOCUS_21020 37117 37893 gene locus_tag LOCUS_21030 37117 37893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 37886 38560 gene locus_tag LOCUS_21040 gene nadD 37886 38560 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_21040 38568 38945 gene locus_tag LOCUS_21050 38568 38945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 38942 39412 gene locus_tag LOCUS_21060 gene rlmH 38942 39412 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_21060 39412 40035 gene locus_tag LOCUS_21070 39412 40035 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813200.1 protein_id gnl|my_center|LOCUS_21070 40157 40759 gene locus_tag LOCUS_21080 40157 40759 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_21080 40756 42279 gene locus_tag LOCUS_21090 40756 42279 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_21090 42266 42931 gene locus_tag LOCUS_21100 42266 42931 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_21100 42922 43707 gene locus_tag LOCUS_21110 42922 43707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_21110 43731 44387 gene locus_tag LOCUS_21120 43731 44387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_21120 44388 45050 gene locus_tag LOCUS_21130 44388 45050 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_21130 45050 46429 gene locus_tag LOCUS_21140 gene qseC 45050 46429 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779337.1 protein_id gnl|my_center|LOCUS_21140 46917 46465 gene locus_tag LOCUS_21150 46917 46465 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809189.1 protein_id gnl|my_center|LOCUS_21150 47183 48292 gene locus_tag LOCUS_21160 gene ada 47183 48292 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_21160 48391 50496 gene locus_tag LOCUS_21170 gene metG 48391 50496 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203868.1 protein_id gnl|my_center|LOCUS_21170 50503 50757 gene locus_tag LOCUS_21180 50503 50757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 51407 50814 gene locus_tag LOCUS_21190 51407 50814 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811907.1 protein_id gnl|my_center|LOCUS_21190 51954 51655 gene locus_tag LOCUS_21200 51954 51655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 53951 52440 gene locus_tag LOCUS_21210 53951 52440 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063702.1 protein_id gnl|my_center|LOCUS_21210 54467 53973 gene locus_tag LOCUS_21220 54467 53973 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814615.1 protein_id gnl|my_center|LOCUS_21220 55052 54495 gene locus_tag LOCUS_21230 55052 54495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 54936 55439 gene locus_tag LOCUS_21240 54936 55439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 55536 56504 gene locus_tag LOCUS_21250 55536 56504 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_21250 56588 57394 gene locus_tag LOCUS_21260 56588 57394 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526186.1 protein_id gnl|my_center|LOCUS_21260 58582 58271 gene locus_tag LOCUS_21270 58582 58271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 58607 59083 gene locus_tag LOCUS_21280 58607 59083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 60798 59302 gene locus_tag LOCUS_21290 60798 59302 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_21290 62296 60791 gene locus_tag LOCUS_21300 62296 60791 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_21300 63851 62301 gene locus_tag LOCUS_21310 63851 62301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 67015 63848 gene locus_tag LOCUS_21320 67015 63848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 68632 67073 gene locus_tag LOCUS_21330 68632 67073 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_21330 68661 68954 gene locus_tag LOCUS_21340 68661 68954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 69121 69483 gene locus_tag LOCUS_21350 69121 69483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 69615 70544 gene locus_tag LOCUS_21360 69615 70544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 70623 72020 gene locus_tag LOCUS_21370 70623 72020 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_21370 72031 72852 gene locus_tag LOCUS_21380 72031 72852 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927689.1 protein_id gnl|my_center|LOCUS_21380 73299 74612 gene locus_tag LOCUS_21390 73299 74612 CDS product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407714.1 protein_id gnl|my_center|LOCUS_21390 74693 75022 gene locus_tag LOCUS_21400 74693 75022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 75019 75498 gene locus_tag LOCUS_21410 gene radC 75019 75498 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878135.1 protein_id gnl|my_center|LOCUS_21410 75495 75917 gene locus_tag LOCUS_21420 75495 75917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 76029 76643 gene locus_tag LOCUS_21430 76029 76643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 76747 76956 gene locus_tag LOCUS_21440 76747 76956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 76953 77282 gene locus_tag LOCUS_21450 76953 77282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 77279 77506 gene locus_tag LOCUS_21460 77279 77506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 77511 78362 gene locus_tag LOCUS_21470 77511 78362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21470 78346 79596 gene locus_tag LOCUS_21480 78346 79596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 79640 79963 gene locus_tag LOCUS_21490 79640 79963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 80041 80505 gene locus_tag LOCUS_21500 80041 80505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 80502 80801 gene locus_tag LOCUS_21510 80502 80801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 80860 81180 gene locus_tag LOCUS_21520 80860 81180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 81375 81887 gene locus_tag LOCUS_21530 81375 81887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 81891 82505 gene locus_tag LOCUS_21540 81891 82505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 82740 82665 gene locus_tag LOCUS_t00260 82740 82665 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 83136 82828 gene locus_tag LOCUS_21550 83136 82828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence21 1923 1222 gene locus_tag LOCUS_21560 1923 1222 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_21560 2521 1952 gene locus_tag LOCUS_21570 2521 1952 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_21570 3103 2552 gene locus_tag LOCUS_21580 3103 2552 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_21580 3647 3105 gene locus_tag LOCUS_21590 3647 3105 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_21590 4453 3644 gene locus_tag LOCUS_21600 4453 3644 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_21600 4549 5436 gene locus_tag LOCUS_21610 4549 5436 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_21610 6024 5593 gene locus_tag LOCUS_21620 6024 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 6433 8016 gene locus_tag LOCUS_21630 6433 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 8229 8834 gene locus_tag LOCUS_21640 8229 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 9878 8979 gene locus_tag LOCUS_21650 9878 8979 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_21650 10104 10976 gene locus_tag LOCUS_21660 10104 10976 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_21660 10993 11619 gene locus_tag LOCUS_21670 10993 11619 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_21670 11629 12282 gene locus_tag LOCUS_21680 11629 12282 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_21680 12300 13502 gene locus_tag LOCUS_21690 12300 13502 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_21690 13529 14371 gene locus_tag LOCUS_21700 13529 14371 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_21700 14349 14936 gene locus_tag LOCUS_21710 14349 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 15175 15894 gene locus_tag LOCUS_21720 15175 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 16023 16490 gene locus_tag LOCUS_21730 gene rimP 16023 16490 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_21730 16505 17977 gene locus_tag LOCUS_21740 gene nusA 16505 17977 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_21740 17998 20838 gene locus_tag LOCUS_21750 gene infB 17998 20838 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526850.1 protein_id gnl|my_center|LOCUS_21750 20839 21225 gene locus_tag LOCUS_21760 gene rbfA 20839 21225 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220822.1 protein_id gnl|my_center|LOCUS_21760 21227 22132 gene locus_tag LOCUS_21770 gene truB 21227 22132 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_21770 22235 22660 gene locus_tag LOCUS_21780 22235 22660 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_21780 22840 23877 gene locus_tag LOCUS_21790 22840 23877 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534868.1 protein_id gnl|my_center|LOCUS_21790 23975 24559 gene locus_tag LOCUS_21800 gene rsxA 23975 24559 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_21800 24556 25098 gene locus_tag LOCUS_21810 gene rsxB 24556 25098 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650033.1 protein_id gnl|my_center|LOCUS_21810 25109 26869 gene locus_tag LOCUS_21820 25109 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 26866 27891 gene locus_tag LOCUS_21830 26866 27891 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_21830 27888 28559 gene locus_tag LOCUS_21840 gene rsxG 27888 28559 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_21840 28556 29254 gene locus_tag LOCUS_21850 28556 29254 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_21850 29274 29933 gene locus_tag LOCUS_21860 gene nth 29274 29933 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_21860 29930 31036 gene locus_tag LOCUS_21870 29930 31036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 31029 31466 gene locus_tag LOCUS_21880 31029 31466 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_21880 31570 32412 gene locus_tag LOCUS_21890 31570 32412 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_21890 32432 33601 gene locus_tag LOCUS_21900 32432 33601 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_21900 35492 33624 gene locus_tag LOCUS_21910 gene nadN 35492 33624 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_21910 35915 36427 gene locus_tag LOCUS_21920 gene lysM 35915 36427 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_21920 36504 36806 gene locus_tag LOCUS_21930 36504 36806 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_21930 38107 36845 gene locus_tag LOCUS_21940 38107 36845 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_21940 38191 39348 gene locus_tag LOCUS_21950 38191 39348 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_21950 40579 39371 gene locus_tag LOCUS_21960 40579 39371 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209648948.1 protein_id gnl|my_center|LOCUS_21960 40961 41395 gene locus_tag LOCUS_21970 gene mscL 40961 41395 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 protein_id gnl|my_center|LOCUS_21970 44238 41497 gene locus_tag LOCUS_21980 44238 41497 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_21980 44686 44958 gene locus_tag LOCUS_21990 44686 44958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 46755 45007 gene locus_tag LOCUS_22000 46755 45007 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114602.1 protein_id gnl|my_center|LOCUS_22000 48005 47730 gene locus_tag LOCUS_22010 48005 47730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 47985 48413 gene locus_tag LOCUS_22020 47985 48413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 48893 52357 gene locus_tag LOCUS_22030 48893 52357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 52230 52329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52389 54584 gene locus_tag LOCUS_22040 52389 54584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 55227 55994 gene locus_tag LOCUS_22050 55227 55994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 56194 56622 gene locus_tag LOCUS_22060 56194 56622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 57106 57843 gene locus_tag LOCUS_22070 57106 57843 CDS product ParB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193730.1 protein_id gnl|my_center|LOCUS_22070 57999 58571 gene locus_tag LOCUS_22080 57999 58571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 58568 59980 gene locus_tag LOCUS_22090 58568 59980 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_22090 60056 60829 gene locus_tag LOCUS_22100 60056 60829 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972532.1 protein_id gnl|my_center|LOCUS_22100 60887 62368 gene locus_tag LOCUS_22110 60887 62368 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931193.1 protein_id gnl|my_center|LOCUS_22110 62368 63435 gene locus_tag LOCUS_22120 gene glcE 62368 63435 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_22120 63449 64702 gene locus_tag LOCUS_22130 gene glcF 63449 64702 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_22130 64765 65751 gene locus_tag LOCUS_22140 64765 65751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 65892 66194 gene locus_tag LOCUS_22150 65892 66194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 66464 66300 gene locus_tag LOCUS_22160 66464 66300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 66417 67049 gene locus_tag LOCUS_22170 66417 67049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 68549 67074 gene locus_tag LOCUS_22180 68549 67074 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_22180 68752 69789 gene locus_tag LOCUS_22190 68752 69789 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192786.1 protein_id gnl|my_center|LOCUS_22190 70211 69810 gene locus_tag LOCUS_22200 70211 69810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 70366 71658 gene locus_tag LOCUS_22210 gene ugpB 70366 71658 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211520.1 protein_id gnl|my_center|LOCUS_22210 71655 72398 gene locus_tag LOCUS_22220 gene ugpQ 71655 72398 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073552.1 protein_id gnl|my_center|LOCUS_22220 72526 75141 gene locus_tag LOCUS_22230 gene alaS 72526 75141 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_22230 75317 75724 gene locus_tag LOCUS_22240 75317 75724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 75783 76817 gene locus_tag LOCUS_22250 75783 76817 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_22250 76814 77305 gene locus_tag LOCUS_22260 76814 77305 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_22260 77733 77353 gene locus_tag LOCUS_22270 77733 77353 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223286.1 protein_id gnl|my_center|LOCUS_22270 78480 77761 gene locus_tag LOCUS_22280 78480 77761 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771783.1 protein_id gnl|my_center|LOCUS_22280 79418 78477 gene locus_tag LOCUS_22290 79418 78477 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_22290 80265 79438 gene locus_tag LOCUS_22300 80265 79438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_22300 81394 80249 gene locus_tag LOCUS_22310 81394 80249 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_22310 81625 81942 gene locus_tag LOCUS_22320 81625 81942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 82154 83038 gene locus_tag LOCUS_22330 82154 83038 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence22 522 190 gene locus_tag LOCUS_22340 522 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2102 549 gene locus_tag LOCUS_22350 2102 549 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_22350 2673 2587 gene locus_tag LOCUS_t00270 2673 2587 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2713 4884 gene locus_tag LOCUS_22360 gene rnr 2713 4884 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695198.1 protein_id gnl|my_center|LOCUS_22360 5298 8129 gene locus_tag LOCUS_22370 5298 8129 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_22370 8346 10094 gene locus_tag LOCUS_22380 8346 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 10601 10137 gene locus_tag LOCUS_22390 10601 10137 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_22390 11254 10733 gene locus_tag LOCUS_22400 11254 10733 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_22400 12525 11305 gene locus_tag LOCUS_22410 12525 11305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_22410 13235 12519 gene locus_tag LOCUS_22420 13235 12519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_22420 14476 13235 gene locus_tag LOCUS_22430 14476 13235 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_22430 15912 14473 gene locus_tag LOCUS_22440 15912 14473 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113001.1 protein_id gnl|my_center|LOCUS_22440 16155 16508 gene locus_tag LOCUS_22450 16155 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 16537 17061 gene locus_tag LOCUS_22460 gene nusG 16537 17061 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_22460 17162 18571 gene locus_tag LOCUS_22470 17162 18571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_22470 18626 19072 gene locus_tag LOCUS_22480 18626 19072 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_22480 19347 19685 gene locus_tag LOCUS_22490 19347 19685 CDS product MarR family EPS-associated transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340715.1 protein_id gnl|my_center|LOCUS_22490 20017 21162 gene locus_tag LOCUS_22500 gene gmd 20017 21162 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_22500 21175 22254 gene locus_tag LOCUS_22510 21175 22254 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301811.1 protein_id gnl|my_center|LOCUS_22510 22379 23284 gene locus_tag LOCUS_22520 gene rfbA 22379 23284 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_22520 23376 23915 gene locus_tag LOCUS_22530 gene rfbC 23376 23915 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_22530 24268 25275 gene locus_tag LOCUS_22540 24268 25275 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_22540 25470 26069 gene locus_tag LOCUS_22550 25470 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 26758 27195 gene locus_tag LOCUS_22560 26758 27195 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_22560 27681 28271 gene locus_tag LOCUS_22570 27681 28271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 28249 28668 gene locus_tag LOCUS_22580 28249 28668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 28975 29166 gene locus_tag LOCUS_22590 28975 29166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22590 29177 29431 gene locus_tag LOCUS_22600 29177 29431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 30232 30489 gene locus_tag LOCUS_22610 30232 30489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 30486 30974 gene locus_tag LOCUS_22620 30486 30974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 31349 31537 gene locus_tag LOCUS_22630 31349 31537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 33053 33577 gene locus_tag LOCUS_22640 33053 33577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 34824 35003 gene locus_tag LOCUS_22650 34824 35003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22650 34997 35554 gene locus_tag LOCUS_22660 34997 35554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22660 35551 35883 gene locus_tag LOCUS_22670 35551 35883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22670 37378 37974 gene locus_tag LOCUS_22680 37378 37974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 38405 39070 gene locus_tag LOCUS_22690 38405 39070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 39822 40256 gene locus_tag LOCUS_22700 39822 40256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 40253 41152 gene locus_tag LOCUS_22710 40253 41152 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938171.1 protein_id gnl|my_center|LOCUS_22710 41155 41895 gene locus_tag LOCUS_22720 41155 41895 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331386.1 protein_id gnl|my_center|LOCUS_22720 42489 43496 gene locus_tag LOCUS_22730 42489 43496 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_22730 43515 44843 gene locus_tag LOCUS_22740 43515 44843 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189214.1 protein_id gnl|my_center|LOCUS_22740 45548 45796 gene locus_tag LOCUS_22750 45548 45796 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_22750 45793 46212 gene locus_tag LOCUS_22760 45793 46212 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 protein_id gnl|my_center|LOCUS_22760 46465 47097 gene locus_tag LOCUS_22770 46465 47097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 48554 47532 gene locus_tag LOCUS_22780 48554 47532 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_22780 49026 48706 gene locus_tag LOCUS_22790 49026 48706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 49400 49600 gene locus_tag LOCUS_22800 49400 49600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 49752 49961 gene locus_tag LOCUS_22810 49752 49961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 50043 50672 gene locus_tag LOCUS_22820 50043 50672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22820 50674 51405 gene locus_tag LOCUS_22830 50674 51405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 51729 52859 gene locus_tag LOCUS_22840 51729 52859 CDS product ISAs1-like element ISBthe4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108038.1 protein_id gnl|my_center|LOCUS_22840 52917 54167 gene locus_tag LOCUS_22850 52917 54167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 54394 54609 gene locus_tag LOCUS_22860 54394 54609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 54905 55186 gene locus_tag LOCUS_22870 54905 55186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 55183 55524 gene locus_tag LOCUS_22880 55183 55524 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 protein_id gnl|my_center|LOCUS_22880 55976 56647 gene locus_tag LOCUS_22890 55976 56647 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_22890 57389 56679 gene locus_tag LOCUS_22900 57389 56679 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 protein_id gnl|my_center|LOCUS_22900 57634 57957 gene locus_tag LOCUS_22910 57634 57957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 58787 58062 gene locus_tag LOCUS_22920 58787 58062 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 protein_id gnl|my_center|LOCUS_22920 58929 60452 gene locus_tag LOCUS_22930 58929 60452 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298776.1 protein_id gnl|my_center|LOCUS_22930 60558 61838 gene locus_tag LOCUS_22940 60558 61838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 62703 61891 gene locus_tag LOCUS_22950 62703 61891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 63266 62700 gene locus_tag LOCUS_22960 63266 62700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 64161 63268 gene locus_tag LOCUS_22970 64161 63268 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_22970 65641 64226 gene locus_tag LOCUS_22980 65641 64226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478317.1 protein_id gnl|my_center|LOCUS_22980 65993 65712 gene locus_tag LOCUS_22990 65993 65712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 66320 67654 gene locus_tag LOCUS_23000 66320 67654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 68742 67717 gene locus_tag LOCUS_23010 68742 67717 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202932.1 protein_id gnl|my_center|LOCUS_23010 70046 68739 gene locus_tag LOCUS_23020 70046 68739 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 protein_id gnl|my_center|LOCUS_23020 70828 70043 gene locus_tag LOCUS_23030 gene murI 70828 70043 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_23030 71292 70948 gene locus_tag LOCUS_23040 71292 70948 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704159.1 protein_id gnl|my_center|LOCUS_23040 72880 71360 gene locus_tag LOCUS_23050 72880 71360 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_23050 73489 72932 gene locus_tag LOCUS_23060 73489 72932 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 protein_id gnl|my_center|LOCUS_23060 73747 75714 gene locus_tag LOCUS_23070 gene acs 73747 75714 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_23070 75920 77830 gene locus_tag LOCUS_23080 75920 77830 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 protein_id gnl|my_center|LOCUS_23080 77833 78549 gene locus_tag LOCUS_23090 77833 78549 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258583.1 protein_id gnl|my_center|LOCUS_23090 78568 80607 gene locus_tag LOCUS_23100 78568 80607 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence23 <1 1254 gene locus_tag LOCUS_23110 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001219360.1:Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha 1262 2683 gene locus_tag LOCUS_23120 gene pntB 1262 2683 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014056.1 protein_id gnl|my_center|LOCUS_23120 2908 3369 gene locus_tag LOCUS_23130 2908 3369 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_23130 4719 3580 gene locus_tag LOCUS_23140 4719 3580 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_23140 5782 4694 gene locus_tag LOCUS_23150 gene aroB 5782 4694 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_23150 6306 5770 gene locus_tag LOCUS_23160 6306 5770 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_23160 8506 6395 gene locus_tag LOCUS_23170 gene pilQ 8506 6395 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_23170 9004 8507 gene locus_tag LOCUS_23180 9004 8507 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214522.1 protein_id gnl|my_center|LOCUS_23180 9696 9019 gene locus_tag LOCUS_23190 9696 9019 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_23190 10262 9693 gene locus_tag LOCUS_23200 gene pilN 10262 9693 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_23200 11338 10259 gene locus_tag LOCUS_23210 11338 10259 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_23210 11658 13880 gene locus_tag LOCUS_23220 11658 13880 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_23220 14409 13864 gene locus_tag LOCUS_23230 14409 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 15889 14411 gene locus_tag LOCUS_23240 15889 14411 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_23240 16466 15912 gene locus_tag LOCUS_23250 16466 15912 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_23250 17199 16474 gene locus_tag LOCUS_23260 17199 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 19048 17210 gene locus_tag LOCUS_23270 19048 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 19404 20822 gene locus_tag LOCUS_23280 19404 20822 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 protein_id gnl|my_center|LOCUS_23280 21025 23910 gene locus_tag LOCUS_23290 21025 23910 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 protein_id gnl|my_center|LOCUS_23290 24103 24771 gene locus_tag LOCUS_23300 24103 24771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 25078 24683 gene locus_tag LOCUS_23310 25078 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 25071 25505 gene locus_tag LOCUS_23320 25071 25505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 26321 25407 gene locus_tag LOCUS_23330 26321 25407 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_23330 27354 26392 gene locus_tag LOCUS_23340 27354 26392 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_23340 27568 28647 gene locus_tag LOCUS_23350 27568 28647 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_23350 28824 30026 gene locus_tag LOCUS_23360 28824 30026 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_23360 30767 30168 gene locus_tag LOCUS_23370 30767 30168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 32275 30875 gene locus_tag LOCUS_23380 32275 30875 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 protein_id gnl|my_center|LOCUS_23380 33220 32324 gene locus_tag LOCUS_23390 33220 32324 CDS product antimicrobial resistance protein Mig-14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114550.1 protein_id gnl|my_center|LOCUS_23390 33498 34475 gene locus_tag LOCUS_23400 33498 34475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 34508 35956 gene locus_tag LOCUS_23410 34508 35956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 36257 37111 gene locus_tag LOCUS_23420 36257 37111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 37492 38202 gene locus_tag LOCUS_23430 37492 38202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 38225 39058 gene locus_tag LOCUS_23440 38225 39058 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_23440 39536 39102 gene locus_tag LOCUS_23450 39536 39102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 40015 39548 gene locus_tag LOCUS_23460 gene secB 40015 39548 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_23460 40354 40079 gene locus_tag LOCUS_23470 gene grxC 40354 40079 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_23470 40770 40351 gene locus_tag LOCUS_23480 40770 40351 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198006.1 protein_id gnl|my_center|LOCUS_23480 41168 40860 gene locus_tag LOCUS_23490 41168 40860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 41501 42817 gene locus_tag LOCUS_23500 41501 42817 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_23500 42840 44249 gene locus_tag LOCUS_23510 gene cptA 42840 44249 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446625.1 protein_id gnl|my_center|LOCUS_23510 44263 44691 gene locus_tag LOCUS_23520 44263 44691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 44702 45478 gene locus_tag LOCUS_23530 gene moeB 44702 45478 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_23530 46571 45471 gene locus_tag LOCUS_23540 gene ribD 46571 45471 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_23540 47041 46571 gene locus_tag LOCUS_23550 gene nrdR 47041 46571 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_23550 48297 47047 gene locus_tag LOCUS_23560 48297 47047 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_23560 50339 48510 gene locus_tag LOCUS_23570 gene glmS 50339 48510 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815700.1 protein_id gnl|my_center|LOCUS_23570 51705 50347 gene locus_tag LOCUS_23580 gene glmU 51705 50347 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_23580 53515 52073 gene locus_tag LOCUS_23590 53515 52073 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_23590 58233 53518 gene locus_tag LOCUS_23600 58233 53518 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_23600 59349 59576 gene locus_tag LOCUS_23610 59349 59576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 59576 59803 gene locus_tag LOCUS_23620 59576 59803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 60350 60054 gene locus_tag LOCUS_23630 60350 60054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 60642 60340 gene locus_tag LOCUS_23640 60642 60340 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_23640 61348 60878 gene locus_tag LOCUS_23650 61348 60878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 61737 61345 gene locus_tag LOCUS_23660 61737 61345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 76412 61947 gene locus_tag LOCUS_23670 76412 61947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 77371 76739 gene locus_tag LOCUS_23680 77371 76739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 78759 78418 gene locus_tag LOCUS_23690 78759 78418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 <79455 78770 gene locus_tag LOCUS_23700 <79455 78770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein >Feature sequence24 1369 1157 gene locus_tag LOCUS_23710 1369 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1259 2176 gene locus_tag LOCUS_23720 1259 2176 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_23720 2181 5396 gene locus_tag LOCUS_23730 2181 5396 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_23730 5393 5620 gene locus_tag LOCUS_23740 5393 5620 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_23740 6431 5799 gene locus_tag LOCUS_23750 6431 5799 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524369.1 protein_id gnl|my_center|LOCUS_23750 8767 6464 gene locus_tag LOCUS_23760 8767 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 9587 8784 gene locus_tag LOCUS_23770 9587 8784 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_23770 11073 9694 gene locus_tag LOCUS_23780 11073 9694 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_23780 11410 13395 gene locus_tag LOCUS_23790 gene tkt 11410 13395 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098658.1 protein_id gnl|my_center|LOCUS_23790 13416 14414 gene locus_tag LOCUS_23800 gene gap 13416 14414 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_23800 14682 16121 gene locus_tag LOCUS_23810 gene pyk 14682 16121 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_23810 16241 17305 gene locus_tag LOCUS_23820 gene fba 16241 17305 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_23820 17361 18683 gene locus_tag LOCUS_23830 17361 18683 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_23830 18794 19732 gene locus_tag LOCUS_23840 18794 19732 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_23840 19793 20566 gene locus_tag LOCUS_23850 19793 20566 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329369.1 protein_id gnl|my_center|LOCUS_23850 20610 22715 gene locus_tag LOCUS_23860 20610 22715 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_23860 22734 23261 gene locus_tag LOCUS_23870 22734 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 25201 23474 gene locus_tag LOCUS_23880 25201 23474 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339077.1 protein_id gnl|my_center|LOCUS_23880 25515 25198 gene locus_tag LOCUS_23890 25515 25198 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_23890 26569 25670 gene locus_tag LOCUS_23900 26569 25670 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_23900 27701 26589 gene locus_tag LOCUS_23910 gene zapE 27701 26589 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_23910 28633 27824 gene locus_tag LOCUS_23920 28633 27824 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 protein_id gnl|my_center|LOCUS_23920 29703 28633 gene locus_tag LOCUS_23930 29703 28633 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389259.1 protein_id gnl|my_center|LOCUS_23930 30467 29700 gene locus_tag LOCUS_23940 gene pxpB 30467 29700 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389260.1 protein_id gnl|my_center|LOCUS_23940 31006 30563 gene locus_tag LOCUS_23950 gene queD 31006 30563 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 protein_id gnl|my_center|LOCUS_23950 31824 31126 gene locus_tag LOCUS_23960 31824 31126 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814000.1 protein_id gnl|my_center|LOCUS_23960 33321 31897 gene locus_tag LOCUS_23970 33321 31897 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530004.1 protein_id gnl|my_center|LOCUS_23970 33886 33368 gene locus_tag LOCUS_23980 33886 33368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 34891 34028 gene locus_tag LOCUS_23990 34891 34028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 35156 35767 gene locus_tag LOCUS_24000 35156 35767 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389278.1 protein_id gnl|my_center|LOCUS_24000 35882 36112 gene locus_tag LOCUS_24010 35882 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 36109 36531 gene locus_tag LOCUS_24020 36109 36531 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_24020 36988 36638 gene locus_tag LOCUS_24030 36988 36638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 37798 37058 gene locus_tag LOCUS_24040 37798 37058 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_24040 39017 38463 gene locus_tag LOCUS_24050 39017 38463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 40429 39014 gene locus_tag LOCUS_24060 40429 39014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 41259 40426 gene locus_tag LOCUS_24070 41259 40426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 42523 41267 gene locus_tag LOCUS_24080 42523 41267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 44667 42553 gene locus_tag LOCUS_24090 44667 42553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 45705 44983 gene locus_tag LOCUS_24100 45705 44983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 46348 45779 gene locus_tag LOCUS_24110 46348 45779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 48518 46698 gene locus_tag LOCUS_24120 48518 46698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 49131 50954 gene locus_tag LOCUS_24130 49131 50954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 51624 50959 gene locus_tag LOCUS_24140 51624 50959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_24140 53800 51785 gene locus_tag LOCUS_24150 53800 51785 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_24150 55565 53925 gene locus_tag LOCUS_24160 55565 53925 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446174.1 protein_id gnl|my_center|LOCUS_24160 57173 55722 gene locus_tag LOCUS_24170 gene tldD 57173 55722 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_24170 58054 57209 gene locus_tag LOCUS_24180 58054 57209 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_24180 62039 58038 gene locus_tag LOCUS_24190 62039 58038 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550020.1 protein_id gnl|my_center|LOCUS_24190 62172 64916 gene locus_tag LOCUS_24200 gene glnE 62172 64916 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_24200 65537 64989 gene locus_tag LOCUS_24210 65537 64989 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_24210 65865 66980 gene locus_tag LOCUS_24220 65865 66980 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085825.1 protein_id gnl|my_center|LOCUS_24220 67089 68153 gene locus_tag LOCUS_24230 67089 68153 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763415.1 protein_id gnl|my_center|LOCUS_24230 69037 68711 gene locus_tag LOCUS_24240 69037 68711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 69301 69603 gene locus_tag LOCUS_24250 69301 69603 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_24250 69606 70034 gene locus_tag LOCUS_24260 gene higA 69606 70034 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_24260 70640 70395 gene locus_tag LOCUS_24270 70640 70395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 71365 72369 gene locus_tag LOCUS_24280 71365 72369 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_24280 72399 73085 gene locus_tag LOCUS_24290 72399 73085 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_24290 73082 73972 gene locus_tag LOCUS_24300 gene rarD 73082 73972 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704249.1 protein_id gnl|my_center|LOCUS_24300 74482 74051 gene locus_tag LOCUS_24310 74482 74051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 75178 74570 gene locus_tag LOCUS_24320 75178 74570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 76057 76314 gene locus_tag LOCUS_24330 76057 76314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence25 390 1451 gene locus_tag LOCUS_24340 390 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1783 1523 gene locus_tag LOCUS_24350 1783 1523 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_24350 2300 1797 gene locus_tag LOCUS_24360 gene coaD 2300 1797 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_24360 2628 2287 gene locus_tag LOCUS_24370 2628 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 4141 2846 gene locus_tag LOCUS_24380 4141 2846 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_24380 5564 4152 gene locus_tag LOCUS_24390 5564 4152 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_24390 5612 6604 gene locus_tag LOCUS_24400 5612 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 6601 7290 gene locus_tag LOCUS_24410 gene ftsE 6601 7290 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225752.1 protein_id gnl|my_center|LOCUS_24410 7287 8186 gene locus_tag LOCUS_24420 gene ftsX 7287 8186 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084508.1 protein_id gnl|my_center|LOCUS_24420 8651 8277 gene locus_tag LOCUS_24430 8651 8277 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_24430 8802 9464 gene locus_tag LOCUS_24440 gene rpiA 8802 9464 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163342.1 protein_id gnl|my_center|LOCUS_24440 9765 9493 gene locus_tag LOCUS_24450 9765 9493 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_24450 11181 9862 gene locus_tag LOCUS_24460 gene argA 11181 9862 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_24460 12883 11183 gene locus_tag LOCUS_24470 gene pap 12883 11183 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_24470 13610 12876 gene locus_tag LOCUS_24480 13610 12876 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_24480 13694 14245 gene locus_tag LOCUS_24490 13694 14245 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_24490 14252 15103 gene locus_tag LOCUS_24500 14252 15103 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_24500 16203 15109 gene locus_tag LOCUS_24510 16203 15109 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112514.1 protein_id gnl|my_center|LOCUS_24510 16385 17476 gene locus_tag LOCUS_24520 gene apbC 16385 17476 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_24520 17625 18158 gene locus_tag LOCUS_24530 gene dcd 17625 18158 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687863.1 protein_id gnl|my_center|LOCUS_24530 18261 20498 gene locus_tag LOCUS_24540 18261 20498 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_24540 22028 20592 gene locus_tag LOCUS_24550 22028 20592 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_24550 22417 23061 gene locus_tag LOCUS_24560 gene hisG 22417 23061 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_24560 23058 24371 gene locus_tag LOCUS_24570 gene hisD 23058 24371 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527888.1 protein_id gnl|my_center|LOCUS_24570 24660 26648 gene locus_tag LOCUS_24580 24660 26648 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212784779.1 protein_id gnl|my_center|LOCUS_24580 27966 26743 gene locus_tag LOCUS_24590 27966 26743 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_24590 29282 28317 gene locus_tag LOCUS_24600 29282 28317 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_24600 30999 29323 gene locus_tag LOCUS_24610 30999 29323 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197235.1 protein_id gnl|my_center|LOCUS_24610 31012 31287 gene locus_tag LOCUS_24620 31012 31287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 31393 31935 gene locus_tag LOCUS_24630 31393 31935 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_24630 32875 32033 gene locus_tag LOCUS_24640 32875 32033 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 protein_id gnl|my_center|LOCUS_24640 33130 35301 gene locus_tag LOCUS_24650 33130 35301 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_24650 35500 36474 gene locus_tag LOCUS_24660 35500 36474 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_24660 36474 37817 gene locus_tag LOCUS_24670 36474 37817 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116611749.1 protein_id gnl|my_center|LOCUS_24670 37814 38437 gene locus_tag LOCUS_24680 37814 38437 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_24680 38607 42077 gene locus_tag LOCUS_24690 gene dnaE 38607 42077 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_24690 43465 42209 gene locus_tag LOCUS_24700 gene lysA 43465 42209 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_24700 43687 44007 gene locus_tag LOCUS_24710 gene cyaY 43687 44007 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806945.1 protein_id gnl|my_center|LOCUS_24710 44457 44233 gene locus_tag LOCUS_24720 44457 44233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 46475 44835 gene locus_tag LOCUS_24730 46475 44835 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_24730 46715 46542 gene locus_tag LOCUS_24740 46715 46542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24740 47008 46712 gene locus_tag LOCUS_24750 47008 46712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 48088 47297 gene locus_tag LOCUS_24760 48088 47297 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24760 48718 50010 gene locus_tag LOCUS_24770 48718 50010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_24770 50016 50582 gene locus_tag LOCUS_24780 50016 50582 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_24780 50585 50989 gene locus_tag LOCUS_24790 50585 50989 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_24790 51059 51478 gene locus_tag LOCUS_24800 51059 51478 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_24800 52470 51556 gene locus_tag LOCUS_24810 gene xerC 52470 51556 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523080.1 protein_id gnl|my_center|LOCUS_24810 53134 52481 gene locus_tag LOCUS_24820 53134 52481 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 protein_id gnl|my_center|LOCUS_24820 53967 53131 gene locus_tag LOCUS_24830 gene dapF 53967 53131 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064712.1 protein_id gnl|my_center|LOCUS_24830 54477 53968 gene locus_tag LOCUS_24840 54477 53968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 55988 54576 gene locus_tag LOCUS_24850 gene pyk 55988 54576 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_24850 56152 56079 gene locus_tag LOCUS_t00280 56152 56079 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 56411 58198 gene locus_tag LOCUS_24860 56411 58198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 59028 58246 gene locus_tag LOCUS_24870 gene tcdA 59028 58246 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_24870 59261 59605 gene locus_tag LOCUS_24880 59261 59605 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_24880 59864 60565 gene locus_tag LOCUS_24890 59864 60565 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_24890 61644 60607 gene locus_tag LOCUS_24900 gene murB 61644 60607 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_24900 65371 61664 gene locus_tag LOCUS_24910 gene metH 65371 61664 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_24910 65991 65602 gene locus_tag LOCUS_24920 65991 65602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 66611 66066 gene locus_tag LOCUS_24930 gene petA 66611 66066 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707597.1 protein_id gnl|my_center|LOCUS_24930 67148 66888 gene locus_tag LOCUS_24940 67148 66888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 67795 67202 gene locus_tag LOCUS_24950 67795 67202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24950 68399 68004 gene locus_tag LOCUS_24960 68399 68004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 68527 69576 gene locus_tag LOCUS_24970 68527 69576 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_24970 70550 69648 gene locus_tag LOCUS_24980 70550 69648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 71146 71373 gene locus_tag LOCUS_24990 71146 71373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 71367 71837 gene locus_tag LOCUS_25000 71367 71837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 71844 72005 gene locus_tag LOCUS_25010 71844 72005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 72002 72472 gene locus_tag LOCUS_25020 72002 72472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 72622 73365 gene locus_tag LOCUS_25030 72622 73365 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_25030 74338 73688 gene locus_tag LOCUS_25040 74338 73688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence26 2 640 gene locus_tag LOCUS_25050 2 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1011 1688 gene locus_tag LOCUS_25060 1011 1688 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108306299.1 protein_id gnl|my_center|LOCUS_25060 1685 2026 gene locus_tag LOCUS_25070 1685 2026 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030566.1 protein_id gnl|my_center|LOCUS_25070 2016 2759 gene locus_tag LOCUS_25080 gene cbiQ 2016 2759 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_25080 2759 3652 gene locus_tag LOCUS_25090 2759 3652 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_25090 3652 4440 gene locus_tag LOCUS_25100 gene cobM 3652 4440 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_25100 4437 5363 gene locus_tag LOCUS_25110 4437 5363 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_25110 5379 6056 gene locus_tag LOCUS_25120 5379 6056 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174544.1 protein_id gnl|my_center|LOCUS_25120 6053 7195 gene locus_tag LOCUS_25130 6053 7195 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_25130 7182 8492 gene locus_tag LOCUS_25140 7182 8492 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_25140 8489 9286 gene locus_tag LOCUS_25150 gene cobI 8489 9286 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_25150 9288 10052 gene locus_tag LOCUS_25160 9288 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25160 10049 10471 gene locus_tag LOCUS_25170 10049 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25170 10510 11457 gene locus_tag LOCUS_25180 10510 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 13180 11705 gene locus_tag LOCUS_25190 13180 11705 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_25190 13698 13522 gene locus_tag LOCUS_25200 13698 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 14854 13703 gene locus_tag LOCUS_25210 14854 13703 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_25210 15165 16130 gene locus_tag LOCUS_25220 15165 16130 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706409.1 protein_id gnl|my_center|LOCUS_25220 17097 16150 gene locus_tag LOCUS_25230 17097 16150 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_25230 17202 17978 gene locus_tag LOCUS_25240 17202 17978 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_25240 18034 19743 gene locus_tag LOCUS_25250 18034 19743 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_25250 19736 20257 gene locus_tag LOCUS_25260 19736 20257 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_25260 20260 20985 gene locus_tag LOCUS_25270 20260 20985 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_25270 21064 21981 gene locus_tag LOCUS_25280 gene cysD 21064 21981 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_25280 21981 23270 gene locus_tag LOCUS_25290 21981 23270 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_25290 23297 24568 gene locus_tag LOCUS_25300 23297 24568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 24617 25375 gene locus_tag LOCUS_25310 gene rlmB 24617 25375 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812973.1 protein_id gnl|my_center|LOCUS_25310 27651 25396 gene locus_tag LOCUS_25320 27651 25396 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 protein_id gnl|my_center|LOCUS_25320 28969 27770 gene locus_tag LOCUS_25330 28969 27770 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706680.1 protein_id gnl|my_center|LOCUS_25330 29750 29310 gene locus_tag LOCUS_25340 29750 29310 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 protein_id gnl|my_center|LOCUS_25340 31295 29760 gene locus_tag LOCUS_25350 31295 29760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 32288 31431 gene locus_tag LOCUS_25360 32288 31431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 33073 32603 gene locus_tag LOCUS_25370 33073 32603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 33147 34187 gene locus_tag LOCUS_25380 gene gcvT 33147 34187 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_25380 34237 34620 gene locus_tag LOCUS_25390 gene gcvH 34237 34620 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_25390 34625 37552 gene locus_tag LOCUS_25400 gene gcvP 34625 37552 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705609.1 protein_id gnl|my_center|LOCUS_25400 37658 38140 gene locus_tag LOCUS_25410 37658 38140 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_25410 38223 38813 gene locus_tag LOCUS_25420 38223 38813 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189390.1 protein_id gnl|my_center|LOCUS_25420 38810 39601 gene locus_tag LOCUS_25430 38810 39601 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040174.1 protein_id gnl|my_center|LOCUS_25430 39662 40855 gene locus_tag LOCUS_25440 39662 40855 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_25440 41039 42040 gene locus_tag LOCUS_25450 gene clpX 41039 42040 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_25450 42048 42917 gene locus_tag LOCUS_25460 42048 42917 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_25460 43219 44424 gene locus_tag LOCUS_25470 43219 44424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 44502 45149 gene locus_tag LOCUS_25480 44502 45149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 45455 45808 gene locus_tag LOCUS_25490 45455 45808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 45977 48832 gene locus_tag LOCUS_25500 45977 48832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 48833 51352 gene locus_tag LOCUS_25510 48833 51352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 51349 55461 gene locus_tag LOCUS_25520 51349 55461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098509933.1 protein_id gnl|my_center|LOCUS_25520 55479 57260 gene locus_tag LOCUS_25530 55479 57260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 57280 59277 gene locus_tag LOCUS_25540 57280 59277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 59415 61088 gene locus_tag LOCUS_25550 59415 61088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 62716 61277 gene locus_tag LOCUS_25560 62716 61277 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_25560 63384 62713 gene locus_tag LOCUS_25570 63384 62713 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_25570 64163 63381 gene locus_tag LOCUS_25580 64163 63381 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939071.1 protein_id gnl|my_center|LOCUS_25580 64379 65131 gene locus_tag LOCUS_25590 64379 65131 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_25590 65664 65218 gene locus_tag LOCUS_25600 gene smpB 65664 65218 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_25600 65743 66186 gene locus_tag LOCUS_25610 65743 66186 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_25610 66179 66499 gene locus_tag LOCUS_25620 66179 66499 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_25620 66952 66506 gene locus_tag LOCUS_25630 66952 66506 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770496.1 protein_id gnl|my_center|LOCUS_25630 67009 68466 gene locus_tag LOCUS_25640 gene guaB 67009 68466 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 protein_id gnl|my_center|LOCUS_25640 68525 70090 gene locus_tag LOCUS_25650 gene guaA 68525 70090 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_25650 70316 70930 gene locus_tag LOCUS_25660 70316 70930 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_25660 70927 71778 gene locus_tag LOCUS_25670 70927 71778 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 protein_id gnl|my_center|LOCUS_25670 72287 72679 gene locus_tag LOCUS_25680 72287 72679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 72822 73748 gene locus_tag LOCUS_25690 72822 73748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence27 148 3030 gene locus_tag LOCUS_25700 148 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 3130 4392 gene locus_tag LOCUS_25710 gene hemA 3130 4392 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_25710 4463 5545 gene locus_tag LOCUS_25720 gene prfA 4463 5545 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186862.1 protein_id gnl|my_center|LOCUS_25720 5634 6461 gene locus_tag LOCUS_25730 gene prmC 5634 6461 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 protein_id gnl|my_center|LOCUS_25730 6533 6856 gene locus_tag LOCUS_25740 gene grxD 6533 6856 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_25740 7386 7018 gene locus_tag LOCUS_25750 7386 7018 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_25750 7516 8049 gene locus_tag LOCUS_25760 7516 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 9377 8091 gene locus_tag LOCUS_25770 9377 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 10783 9398 gene locus_tag LOCUS_25780 gene argH 10783 9398 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_25780 10908 11879 gene locus_tag LOCUS_25790 10908 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 11900 12658 gene locus_tag LOCUS_25800 11900 12658 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_25800 12887 13864 gene locus_tag LOCUS_25810 gene hemC 12887 13864 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_25810 13861 14634 gene locus_tag LOCUS_25820 13861 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 14961 15716 gene locus_tag LOCUS_25830 14961 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25830 15713 16027 gene locus_tag LOCUS_25840 15713 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 16178 16873 gene locus_tag LOCUS_25850 16178 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25850 17817 16900 gene locus_tag LOCUS_25860 gene hemF 17817 16900 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_25860 19155 17875 gene locus_tag LOCUS_25870 gene purD 19155 17875 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_25870 20854 19289 gene locus_tag LOCUS_25880 gene purH 20854 19289 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_25880 21155 20904 gene locus_tag LOCUS_25890 21155 20904 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_25890 22204 21152 gene locus_tag LOCUS_25900 gene dusB 22204 21152 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_25900 22680 22408 gene locus_tag LOCUS_25910 gene minE 22680 22408 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186076.1 protein_id gnl|my_center|LOCUS_25910 23498 22677 gene locus_tag LOCUS_25920 gene minD 23498 22677 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814250.1 protein_id gnl|my_center|LOCUS_25920 24410 23601 gene locus_tag LOCUS_25930 gene minC 24410 23601 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_25930 25704 24550 gene locus_tag LOCUS_25940 25704 24550 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_25940 27004 25697 gene locus_tag LOCUS_25950 27004 25697 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931462.1 protein_id gnl|my_center|LOCUS_25950 27683 27009 gene locus_tag LOCUS_25960 27683 27009 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_25960 28723 27692 gene locus_tag LOCUS_25970 28723 27692 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_25970 28836 31751 gene locus_tag LOCUS_25980 28836 31751 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_25980 31760 33064 gene locus_tag LOCUS_25990 31760 33064 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_25990 33069 34070 gene locus_tag LOCUS_26000 gene pdxA 33069 34070 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221872.1 protein_id gnl|my_center|LOCUS_26000 34075 34854 gene locus_tag LOCUS_26010 gene rsmA 34075 34854 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931413.1 protein_id gnl|my_center|LOCUS_26010 35098 34901 gene locus_tag LOCUS_26020 35098 34901 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_26020 35876 35196 gene locus_tag LOCUS_26030 35876 35196 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_26030 36640 35873 gene locus_tag LOCUS_26040 gene xth 36640 35873 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_26040 37061 37693 gene locus_tag LOCUS_26050 37061 37693 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_26050 37850 39340 gene locus_tag LOCUS_26060 37850 39340 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_26060 39350 40306 gene locus_tag LOCUS_26070 39350 40306 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_26070 40311 41909 gene locus_tag LOCUS_26080 40311 41909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 41919 43013 gene locus_tag LOCUS_26090 41919 43013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 43026 44195 gene locus_tag LOCUS_26100 gene wecB 43026 44195 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_26100 44215 45081 gene locus_tag LOCUS_26110 44215 45081 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_26110 45078 46163 gene locus_tag LOCUS_26120 45078 46163 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_26120 46226 47806 gene locus_tag LOCUS_26130 gene xrtA 46226 47806 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_26130 47803 48990 gene locus_tag LOCUS_26140 47803 48990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 49030 50970 gene locus_tag LOCUS_26150 49030 50970 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_26150 50987 52180 gene locus_tag LOCUS_26160 50987 52180 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_26160 52260 53483 gene locus_tag LOCUS_26170 52260 53483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 53663 55018 gene locus_tag LOCUS_26180 53663 55018 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_26180 55260 56573 gene locus_tag LOCUS_26190 55260 56573 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_26190 56570 57547 gene locus_tag LOCUS_26200 56570 57547 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_26200 57608 58801 gene locus_tag LOCUS_26210 57608 58801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 59363 59869 gene locus_tag LOCUS_26220 59363 59869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 60290 61132 gene locus_tag LOCUS_26230 60290 61132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 61228 62367 gene locus_tag LOCUS_26240 61228 62367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 62467 63798 gene locus_tag LOCUS_26250 62467 63798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 65572 64097 gene locus_tag LOCUS_26260 65572 64097 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_26260 66627 65662 gene locus_tag LOCUS_26270 66627 65662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 66872 66642 gene locus_tag LOCUS_26280 66872 66642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 67852 66890 gene locus_tag LOCUS_26290 67852 66890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 68611 67901 gene locus_tag LOCUS_26300 68611 67901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 70485 69130 gene locus_tag LOCUS_26310 70485 69130 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189214.1 protein_id gnl|my_center|LOCUS_26310 71510 70503 gene locus_tag LOCUS_26320 71510 70503 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_26320 71918 71529 gene locus_tag LOCUS_26330 71918 71529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 72039 72323 gene locus_tag LOCUS_26340 72039 72323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 72393 72542 gene locus_tag LOCUS_26350 72393 72542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 73333 72839 gene locus_tag LOCUS_26360 73333 72839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence28 450 374 gene locus_tag LOCUS_t00290 450 374 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2221 1190 gene locus_tag LOCUS_26370 2221 1190 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_26370 2495 3739 gene locus_tag LOCUS_26380 2495 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 4549 4839 gene locus_tag LOCUS_26390 gene groES 4549 4839 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_26390 4933 6585 gene locus_tag LOCUS_26400 gene groL 4933 6585 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_26400 8572 6665 gene locus_tag LOCUS_26410 8572 6665 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527215.1 protein_id gnl|my_center|LOCUS_26410 8718 8642 gene locus_tag LOCUS_t00300 8718 8642 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8826 8751 gene locus_tag LOCUS_t00310 8826 8751 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11381 8967 gene locus_tag LOCUS_26420 gene lon 11381 8967 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_26420 12738 11467 gene locus_tag LOCUS_26430 gene clpX 12738 11467 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_26430 13417 12788 gene locus_tag LOCUS_26440 gene clpP 13417 12788 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_26440 14769 13450 gene locus_tag LOCUS_26450 gene tig 14769 13450 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_26450 15436 16446 gene locus_tag LOCUS_26460 gene arsS 15436 16446 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_26460 16519 17271 gene locus_tag LOCUS_26470 16519 17271 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_26470 18717 17389 gene locus_tag LOCUS_26480 18717 17389 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 protein_id gnl|my_center|LOCUS_26480 20105 18720 gene locus_tag LOCUS_26490 20105 18720 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_26490 21903 20122 gene locus_tag LOCUS_26500 gene aprD 21903 20122 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_26500 22661 22434 gene locus_tag LOCUS_26510 22661 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 23033 23830 gene locus_tag LOCUS_26520 23033 23830 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967317.1 protein_id gnl|my_center|LOCUS_26520 24717 23857 gene locus_tag LOCUS_26530 24717 23857 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_26530 24929 25936 gene locus_tag LOCUS_26540 24929 25936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 26775 25984 gene locus_tag LOCUS_26550 26775 25984 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_26550 27684 26785 gene locus_tag LOCUS_26560 gene cysM 27684 26785 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_26560 28687 27677 gene locus_tag LOCUS_26570 gene rfaD 28687 27677 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190173.1 protein_id gnl|my_center|LOCUS_26570 29629 28697 gene locus_tag LOCUS_26580 gene rfaE1 29629 28697 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_26580 30882 29713 gene locus_tag LOCUS_26590 gene lapB 30882 29713 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_26590 31630 31337 gene locus_tag LOCUS_26600 31630 31337 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_26600 33337 31640 gene locus_tag LOCUS_26610 gene rpsA 33337 31640 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_26610 35498 33528 gene locus_tag LOCUS_26620 35498 33528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26620 36382 35495 gene locus_tag LOCUS_26630 36382 35495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26630 37496 36408 gene locus_tag LOCUS_26640 gene hisC 37496 36408 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_26640 38638 37547 gene locus_tag LOCUS_26650 gene pheA 38638 37547 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_26650 41390 38766 gene locus_tag LOCUS_26660 gene gyrA 41390 38766 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_26660 42211 41567 gene locus_tag LOCUS_26670 42211 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 43257 42232 gene locus_tag LOCUS_26680 43257 42232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 44080 43268 gene locus_tag LOCUS_26690 44080 43268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 44458 44150 gene locus_tag LOCUS_26700 44458 44150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 44661 45767 gene locus_tag LOCUS_26710 44661 45767 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 protein_id gnl|my_center|LOCUS_26710 46812 45778 gene locus_tag LOCUS_26720 gene dnaJ 46812 45778 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071368.1 protein_id gnl|my_center|LOCUS_26720 47492 47085 gene locus_tag LOCUS_26730 47492 47085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 47382 47681 gene locus_tag LOCUS_26740 47382 47681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 47853 48794 gene locus_tag LOCUS_26750 47853 48794 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_26750 49719 48988 gene locus_tag LOCUS_26760 49719 48988 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_26760 49868 50176 gene locus_tag LOCUS_26770 49868 50176 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_26770 50199 50837 gene locus_tag LOCUS_26780 50199 50837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_26780 50825 51790 gene locus_tag LOCUS_26790 50825 51790 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568579.1 protein_id gnl|my_center|LOCUS_26790 51795 52580 gene locus_tag LOCUS_26800 51795 52580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_26800 53460 52654 gene locus_tag LOCUS_26810 53460 52654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 54050 53613 gene locus_tag LOCUS_26820 54050 53613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 54459 54064 gene locus_tag LOCUS_26830 54459 54064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 54877 54530 gene locus_tag LOCUS_26840 54877 54530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 56376 54874 gene locus_tag LOCUS_26850 56376 54874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 57962 56715 gene locus_tag LOCUS_26860 57962 56715 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_26860 59390 57963 gene locus_tag LOCUS_26870 59390 57963 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_26870 61484 59991 gene locus_tag LOCUS_26880 61484 59991 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207211.1 protein_id gnl|my_center|LOCUS_26880 62653 61616 gene locus_tag LOCUS_26890 62653 61616 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_26890 63030 63998 gene locus_tag LOCUS_26900 63030 63998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 64061 65098 gene locus_tag LOCUS_26910 64061 65098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 65590 65111 gene locus_tag LOCUS_26920 gene ispF 65590 65111 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951155.1 protein_id gnl|my_center|LOCUS_26920 66285 65587 gene locus_tag LOCUS_26930 gene ispD 66285 65587 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_26930 66322 67140 gene locus_tag LOCUS_26940 gene amrB 66322 67140 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_26940 67130 67678 gene locus_tag LOCUS_26950 67130 67678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 67663 68772 gene locus_tag LOCUS_26960 gene amrS 67663 68772 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_26960 68769 69434 gene locus_tag LOCUS_26970 68769 69434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 69763 69431 gene locus_tag LOCUS_26980 69763 69431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 70149 70712 gene locus_tag LOCUS_26990 70149 70712 CDS product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524145.1 protein_id gnl|my_center|LOCUS_26990 70709 72556 gene locus_tag LOCUS_27000 70709 72556 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence29 362 1873 gene locus_tag LOCUS_27010 362 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2017 2613 gene locus_tag LOCUS_27020 gene wrbA 2017 2613 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 protein_id gnl|my_center|LOCUS_27020 2610 2954 gene locus_tag LOCUS_27030 2610 2954 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812700.1 protein_id gnl|my_center|LOCUS_27030 4548 3010 gene locus_tag LOCUS_27040 4548 3010 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_27040 5584 4823 gene locus_tag LOCUS_27050 gene pssA 5584 4823 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522420.1 protein_id gnl|my_center|LOCUS_27050 6798 5782 gene locus_tag LOCUS_27060 gene ilvC 6798 5782 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689683.1 protein_id gnl|my_center|LOCUS_27060 7319 6828 gene locus_tag LOCUS_27070 gene ilvN 7319 6828 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_27070 9035 7332 gene locus_tag LOCUS_27080 9035 7332 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_27080 9247 9744 gene locus_tag LOCUS_27090 9247 9744 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_27090 9741 10118 gene locus_tag LOCUS_27100 9741 10118 CDS product DUF3619 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185907.1 protein_id gnl|my_center|LOCUS_27100 10091 10726 gene locus_tag LOCUS_27110 10091 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 10726 11151 gene locus_tag LOCUS_27120 10726 11151 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 protein_id gnl|my_center|LOCUS_27120 12229 11159 gene locus_tag LOCUS_27130 gene lptG 12229 11159 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212823.1 protein_id gnl|my_center|LOCUS_27130 13305 12226 gene locus_tag LOCUS_27140 gene lptF 13305 12226 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_27140 13380 14876 gene locus_tag LOCUS_27150 gene pepA 13380 14876 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_27150 14873 15298 gene locus_tag LOCUS_27160 14873 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 15298 15792 gene locus_tag LOCUS_27170 15298 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 15858 18677 gene locus_tag LOCUS_27180 15858 18677 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_27180 20495 18717 gene locus_tag LOCUS_27190 gene pabB 20495 18717 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927074.1 protein_id gnl|my_center|LOCUS_27190 20834 20562 gene locus_tag LOCUS_27200 20834 20562 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_27200 22275 20824 gene locus_tag LOCUS_27210 22275 20824 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_27210 22411 22893 gene locus_tag LOCUS_27220 gene moaC 22411 22893 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_27220 22898 23392 gene locus_tag LOCUS_27230 gene soxY 22898 23392 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_27230 23409 23729 gene locus_tag LOCUS_27240 gene soxZ 23409 23729 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_27240 24014 23811 gene locus_tag LOCUS_27250 24014 23811 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_27250 24275 24583 gene locus_tag LOCUS_27260 gene clpS 24275 24583 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_27260 24584 26842 gene locus_tag LOCUS_27270 gene clpA 24584 26842 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_27270 26913 27407 gene locus_tag LOCUS_27280 gene rraA 26913 27407 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_27280 27481 27987 gene locus_tag LOCUS_27290 27481 27987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 28186 30336 gene locus_tag LOCUS_27300 28186 30336 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_27300 30836 30465 gene locus_tag LOCUS_27310 30836 30465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 32098 30836 gene locus_tag LOCUS_27320 32098 30836 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_27320 32407 32108 gene locus_tag LOCUS_27330 32407 32108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 33759 32458 gene locus_tag LOCUS_27340 33759 32458 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_27340 35048 33885 gene locus_tag LOCUS_27350 gene arsB 35048 33885 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_27350 35534 35199 gene locus_tag LOCUS_27360 35534 35199 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_27360 35702 36187 gene locus_tag LOCUS_27370 35702 36187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 36964 37974 gene locus_tag LOCUS_27380 36964 37974 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_27380 38067 39365 gene locus_tag LOCUS_27390 gene arsJ 38067 39365 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255925.1 protein_id gnl|my_center|LOCUS_27390 40946 39543 gene locus_tag LOCUS_27400 gene eno 40946 39543 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682247.1 protein_id gnl|my_center|LOCUS_27400 42360 41197 gene locus_tag LOCUS_27410 42360 41197 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_27410 44325 42889 gene locus_tag LOCUS_27420 44325 42889 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_27420 45724 44408 gene locus_tag LOCUS_27430 45724 44408 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_27430 46383 45724 gene locus_tag LOCUS_27440 46383 45724 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_27440 46749 47375 gene locus_tag LOCUS_27450 gene thrH 46749 47375 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_27450 47382 48254 gene locus_tag LOCUS_27460 gene purU 47382 48254 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_27460 48337 50289 gene locus_tag LOCUS_27470 48337 50289 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_27470 50329 50748 gene locus_tag LOCUS_27480 50329 50748 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941703.1 protein_id gnl|my_center|LOCUS_27480 51050 52795 gene locus_tag LOCUS_27490 51050 52795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 53635 52856 gene locus_tag LOCUS_27500 53635 52856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_27500 54626 53637 gene locus_tag LOCUS_27510 54626 53637 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_27510 56506 54635 gene locus_tag LOCUS_27520 56506 54635 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 protein_id gnl|my_center|LOCUS_27520 56992 57192 gene locus_tag LOCUS_27530 56992 57192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 57206 57538 gene locus_tag LOCUS_27540 57206 57538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 58664 57861 gene locus_tag LOCUS_27550 58664 57861 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_27550 59845 58910 gene locus_tag LOCUS_27560 59845 58910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 60607 59996 gene locus_tag LOCUS_27570 60607 59996 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_27570 61006 60683 gene locus_tag LOCUS_27580 61006 60683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 61506 61198 gene locus_tag LOCUS_27590 61506 61198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 62464 61511 gene locus_tag LOCUS_27600 62464 61511 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_27600 62617 63051 gene locus_tag LOCUS_27610 62617 63051 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194168.1 protein_id gnl|my_center|LOCUS_27610 63064 63438 gene locus_tag LOCUS_27620 63064 63438 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194251.1 protein_id gnl|my_center|LOCUS_27620 63644 64738 gene locus_tag LOCUS_27630 63644 64738 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114162.1 protein_id gnl|my_center|LOCUS_27630 64735 65604 gene locus_tag LOCUS_27640 64735 65604 CDS product DUF4824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114161.1 protein_id gnl|my_center|LOCUS_27640 65719 66342 gene locus_tag LOCUS_27650 65719 66342 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_27650 66644 66868 gene locus_tag LOCUS_27660 66644 66868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 66965 67264 gene locus_tag LOCUS_27670 66965 67264 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_27670 67268 67555 gene locus_tag LOCUS_27680 67268 67555 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_27680 68095 68604 gene locus_tag LOCUS_27690 68095 68604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 68719 69342 gene locus_tag LOCUS_27700 68719 69342 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_27700 69574 69867 gene locus_tag LOCUS_27710 69574 69867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 69864 70148 gene locus_tag LOCUS_27720 69864 70148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 70274 70567 gene locus_tag LOCUS_27730 70274 70567 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801912.1 protein_id gnl|my_center|LOCUS_27730 70564 71061 gene locus_tag LOCUS_27740 70564 71061 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405248.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence30 <1 791 gene locus_tag LOCUS_27750 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162494103.1:efflux RND transporter periplasmic adaptor subunit 803 2029 gene locus_tag LOCUS_27760 803 2029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_27760 2114 2818 gene locus_tag LOCUS_27770 2114 2818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918816.1 protein_id gnl|my_center|LOCUS_27770 3020 3988 gene locus_tag LOCUS_27780 3020 3988 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_27780 4053 5369 gene locus_tag LOCUS_27790 gene tilS 4053 5369 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026262905.1 protein_id gnl|my_center|LOCUS_27790 5989 5390 gene locus_tag LOCUS_27800 5989 5390 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_27800 7989 5986 gene locus_tag LOCUS_27810 7989 5986 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_27810 8224 9237 gene locus_tag LOCUS_27820 8224 9237 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_27820 9266 10024 gene locus_tag LOCUS_27830 9266 10024 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391424.1 protein_id gnl|my_center|LOCUS_27830 10021 11304 gene locus_tag LOCUS_27840 10021 11304 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_27840 11486 11914 gene locus_tag LOCUS_27850 gene ndk 11486 11914 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_27850 11934 13052 gene locus_tag LOCUS_27860 gene rlmN 11934 13052 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 protein_id gnl|my_center|LOCUS_27860 13049 13852 gene locus_tag LOCUS_27870 gene pilW 13049 13852 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227268.1 protein_id gnl|my_center|LOCUS_27870 13860 14774 gene locus_tag LOCUS_27880 13860 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 14791 16044 gene locus_tag LOCUS_27890 gene ispG 14791 16044 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_27890 16041 17339 gene locus_tag LOCUS_27900 gene hisS 16041 17339 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_27900 17339 18016 gene locus_tag LOCUS_27910 17339 18016 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_27910 18016 19158 gene locus_tag LOCUS_27920 gene bamB 18016 19158 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_27920 19155 20597 gene locus_tag LOCUS_27930 gene der 19155 20597 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_27930 20815 21345 gene locus_tag LOCUS_27940 20815 21345 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_27940 22010 21372 gene locus_tag LOCUS_27950 22010 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 26647 22025 gene locus_tag LOCUS_27960 26647 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 27767 26943 gene locus_tag LOCUS_27970 27767 26943 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_27970 28420 28031 gene locus_tag LOCUS_27980 28420 28031 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_27980 28611 28417 gene locus_tag LOCUS_27990 gene iscX 28611 28417 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_27990 28949 28608 gene locus_tag LOCUS_28000 gene fdx 28949 28608 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_28000 30847 28946 gene locus_tag LOCUS_28010 gene hscA 30847 28946 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_28010 31468 30926 gene locus_tag LOCUS_28020 gene hscB 31468 30926 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_28020 31844 31521 gene locus_tag LOCUS_28030 gene iscA 31844 31521 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_28030 32268 31873 gene locus_tag LOCUS_28040 gene iscU 32268 31873 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_28040 33503 32292 gene locus_tag LOCUS_28050 33503 32292 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 protein_id gnl|my_center|LOCUS_28050 34726 33569 gene locus_tag LOCUS_28060 34726 33569 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_28060 35238 34747 gene locus_tag LOCUS_28070 gene iscR 35238 34747 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_28070 36047 35295 gene locus_tag LOCUS_28080 gene cysE 36047 35295 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771032.1 protein_id gnl|my_center|LOCUS_28080 36914 36108 gene locus_tag LOCUS_28090 gene trmJ 36914 36108 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_28090 36981 37790 gene locus_tag LOCUS_28100 36981 37790 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_28100 37991 38389 gene locus_tag LOCUS_28110 37991 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 38399 39112 gene locus_tag LOCUS_28120 38399 39112 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186399.1 protein_id gnl|my_center|LOCUS_28120 39200 39844 gene locus_tag LOCUS_28130 39200 39844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 39993 39796 gene locus_tag LOCUS_28140 39993 39796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 39977 40783 gene locus_tag LOCUS_28150 39977 40783 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943315.1 protein_id gnl|my_center|LOCUS_28150 41638 40763 gene locus_tag LOCUS_28160 41638 40763 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_28160 41834 41625 gene locus_tag LOCUS_28170 41834 41625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 42209 41865 gene locus_tag LOCUS_28180 42209 41865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 42276 42596 gene locus_tag LOCUS_28190 42276 42596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 42743 43309 gene locus_tag LOCUS_28200 gene greB 42743 43309 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_28200 43475 45394 gene locus_tag LOCUS_28210 gene htpG 43475 45394 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_28210 45408 45920 gene locus_tag LOCUS_28220 45408 45920 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_28220 46011 47804 gene locus_tag LOCUS_28230 46011 47804 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_28230 48105 49742 gene locus_tag LOCUS_28240 48105 49742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 49736 51031 gene locus_tag LOCUS_28250 49736 51031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 51071 51517 gene locus_tag LOCUS_28260 51071 51517 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_28260 51530 51670 gene locus_tag LOCUS_28270 51530 51670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 51713 53038 gene locus_tag LOCUS_28280 51713 53038 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389343.1 protein_id gnl|my_center|LOCUS_28280 53122 56097 gene locus_tag LOCUS_28290 53122 56097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 56338 56168 gene locus_tag LOCUS_28300 56338 56168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 58371 56497 gene locus_tag LOCUS_28310 gene recD 58371 56497 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775929.1 protein_id gnl|my_center|LOCUS_28310 62099 58368 gene locus_tag LOCUS_28320 gene recB 62099 58368 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_28320 65437 62096 gene locus_tag LOCUS_28330 gene recC 65437 62096 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110527488.1 protein_id gnl|my_center|LOCUS_28330 66573 65470 gene locus_tag LOCUS_28340 66573 65470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 68348 66810 gene locus_tag LOCUS_28350 68348 66810 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_28350 68630 69214 gene locus_tag LOCUS_28360 68630 69214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 69648 69202 gene locus_tag LOCUS_28370 69648 69202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence31 1514 1783 gene locus_tag LOCUS_28380 1514 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1780 2058 gene locus_tag LOCUS_28390 1780 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 5218 2000 gene locus_tag LOCUS_28400 5218 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 5421 5215 gene locus_tag LOCUS_28410 5421 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 5622 7031 gene locus_tag LOCUS_28420 gene leuC 5622 7031 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_28420 7033 7614 gene locus_tag LOCUS_28430 gene leuD 7033 7614 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_28430 7619 9178 gene locus_tag LOCUS_28440 gene cimA 7619 9178 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_28440 9246 10304 gene locus_tag LOCUS_28450 gene leuB 9246 10304 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_28450 10576 11130 gene locus_tag LOCUS_28460 10576 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 11787 11377 gene locus_tag LOCUS_28470 11787 11377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 12155 11949 gene locus_tag LOCUS_28480 12155 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 13680 12253 gene locus_tag LOCUS_28490 13680 12253 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_28490 14351 13689 gene locus_tag LOCUS_28500 14351 13689 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_28500 14824 14351 gene locus_tag LOCUS_28510 14824 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 14882 15304 gene locus_tag LOCUS_28520 14882 15304 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337164.1 protein_id gnl|my_center|LOCUS_28520 15331 15822 gene locus_tag LOCUS_28530 15331 15822 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390931.1 protein_id gnl|my_center|LOCUS_28530 16037 17365 gene locus_tag LOCUS_28540 16037 17365 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_28540 17440 17943 gene locus_tag LOCUS_28550 17440 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 18926 18213 gene locus_tag LOCUS_28560 18926 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28560 19453 18923 gene locus_tag LOCUS_28570 19453 18923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28570 20887 19607 gene locus_tag LOCUS_28580 20887 19607 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_28580 21684 20884 gene locus_tag LOCUS_28590 21684 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 22165 21668 gene locus_tag LOCUS_28600 22165 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 23383 22214 gene locus_tag LOCUS_28610 23383 22214 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_28610 23635 24096 gene locus_tag LOCUS_28620 23635 24096 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819239.1 protein_id gnl|my_center|LOCUS_28620 24214 24504 gene locus_tag LOCUS_28630 24214 24504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 25012 24557 gene locus_tag LOCUS_28640 25012 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 25380 25204 gene locus_tag LOCUS_28650 25380 25204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28650 25666 25454 gene locus_tag LOCUS_28660 25666 25454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 25864 27261 gene locus_tag LOCUS_28670 25864 27261 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084144.1 protein_id gnl|my_center|LOCUS_28670 27360 28685 gene locus_tag LOCUS_28680 27360 28685 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 protein_id gnl|my_center|LOCUS_28680 30284 28752 gene locus_tag LOCUS_28690 30284 28752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 34050 30289 gene locus_tag LOCUS_28700 34050 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 35334 34102 gene locus_tag LOCUS_28710 35334 34102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_28710 35562 36827 gene locus_tag LOCUS_28720 gene ppk2 35562 36827 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819675.1 protein_id gnl|my_center|LOCUS_28720 36941 37591 gene locus_tag LOCUS_28730 36941 37591 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_28730 37588 38391 gene locus_tag LOCUS_28740 gene fetB 37588 38391 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_28740 39416 38460 gene locus_tag LOCUS_28750 gene miaA 39416 38460 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105239.1 protein_id gnl|my_center|LOCUS_28750 41263 39413 gene locus_tag LOCUS_28760 gene mutL 41263 39413 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065015.1 protein_id gnl|my_center|LOCUS_28760 41332 41967 gene locus_tag LOCUS_28770 41332 41967 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 protein_id gnl|my_center|LOCUS_28770 41971 42624 gene locus_tag LOCUS_28780 gene purN 41971 42624 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522603.1 protein_id gnl|my_center|LOCUS_28780 42637 43659 gene locus_tag LOCUS_28790 42637 43659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 43662 44918 gene locus_tag LOCUS_28800 43662 44918 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_28800 44915 46216 gene locus_tag LOCUS_28810 44915 46216 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_28810 46539 46345 gene locus_tag LOCUS_28820 46539 46345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 46694 46536 gene locus_tag LOCUS_28830 46694 46536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 48178 46772 gene locus_tag LOCUS_28840 gene parS 48178 46772 CDS product sensor histidine kinase ParS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113589.1 protein_id gnl|my_center|LOCUS_28840 48887 48165 gene locus_tag LOCUS_28850 48887 48165 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184573.1 protein_id gnl|my_center|LOCUS_28850 49064 50227 gene locus_tag LOCUS_28860 49064 50227 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_28860 50240 50731 gene locus_tag LOCUS_28870 50240 50731 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_28870 51256 50792 gene locus_tag LOCUS_28880 gene dut 51256 50792 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_28880 52449 51253 gene locus_tag LOCUS_28890 gene coaBC 52449 51253 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_28890 52510 53187 gene locus_tag LOCUS_28900 gene radC 52510 53187 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_28900 53859 53269 gene locus_tag LOCUS_28910 53859 53269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 54586 54819 gene locus_tag LOCUS_28920 gene rpmB 54586 54819 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_28920 54834 54989 gene locus_tag LOCUS_28930 gene rpmG 54834 54989 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_28930 56151 55072 gene locus_tag LOCUS_28940 gene aroG 56151 55072 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_28940 56503 56578 gene locus_tag LOCUS_t00320 56503 56578 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 57118 57672 gene locus_tag LOCUS_28950 57118 57672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 57837 58349 gene locus_tag LOCUS_28960 57837 58349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 59780 60493 gene locus_tag LOCUS_28970 59780 60493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 60698 60537 gene locus_tag LOCUS_28980 60698 60537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 61316 60852 gene locus_tag LOCUS_28990 61316 60852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 62108 63817 gene locus_tag LOCUS_29000 62108 63817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 64722 66176 gene locus_tag LOCUS_29010 64722 66176 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_29010 66173 67300 gene locus_tag LOCUS_29020 66173 67300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence32 <1 962 gene locus_tag LOCUS_29030 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477817.1:OmpA family protein 959 1378 gene locus_tag LOCUS_29040 959 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 1813 3636 gene locus_tag LOCUS_29050 1813 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3617 4237 gene locus_tag LOCUS_29060 3617 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 4297 4986 gene locus_tag LOCUS_29070 4297 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 5407 6072 gene locus_tag LOCUS_29080 5407 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7444 6446 gene locus_tag LOCUS_29090 7444 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 7786 8844 gene locus_tag LOCUS_29100 7786 8844 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183337994.1 protein_id gnl|my_center|LOCUS_29100 9964 9062 gene locus_tag LOCUS_29110 9964 9062 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_29110 10696 9968 gene locus_tag LOCUS_29120 10696 9968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 protein_id gnl|my_center|LOCUS_29120 11532 10693 gene locus_tag LOCUS_29130 11532 10693 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389502.1 protein_id gnl|my_center|LOCUS_29130 12827 11529 gene locus_tag LOCUS_29140 gene livM 12827 11529 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389503.1 protein_id gnl|my_center|LOCUS_29140 13741 12827 gene locus_tag LOCUS_29150 13741 12827 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_29150 14137 13850 gene locus_tag LOCUS_29160 14137 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 17518 14375 gene locus_tag LOCUS_29170 gene putA 17518 14375 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_29170 18779 17682 gene locus_tag LOCUS_29180 18779 17682 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_29180 19567 18776 gene locus_tag LOCUS_29190 19567 18776 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_29190 19701 21935 gene locus_tag LOCUS_29200 19701 21935 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_29200 23394 22069 gene locus_tag LOCUS_29210 23394 22069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 27441 23605 gene locus_tag LOCUS_29220 27441 23605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 27961 28131 gene locus_tag LOCUS_29230 27961 28131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 28531 30642 gene locus_tag LOCUS_29240 28531 30642 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975516.1 protein_id gnl|my_center|LOCUS_29240 30790 32385 gene locus_tag LOCUS_29250 30790 32385 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927161.1 protein_id gnl|my_center|LOCUS_29250 32400 33302 gene locus_tag LOCUS_29260 32400 33302 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941869.1 protein_id gnl|my_center|LOCUS_29260 34790 33468 gene locus_tag LOCUS_29270 34790 33468 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704861.1 protein_id gnl|my_center|LOCUS_29270 35791 34880 gene locus_tag LOCUS_29280 35791 34880 CDS product DUF6268 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073159.1 protein_id gnl|my_center|LOCUS_29280 36186 37154 gene locus_tag LOCUS_29290 36186 37154 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706465.1 protein_id gnl|my_center|LOCUS_29290 37678 37346 gene locus_tag LOCUS_29300 37678 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 38021 37800 gene locus_tag LOCUS_29310 38021 37800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 38453 38034 gene locus_tag LOCUS_29320 38453 38034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 39144 38767 gene locus_tag LOCUS_29330 39144 38767 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169809.1 protein_id gnl|my_center|LOCUS_29330 39674 39450 gene locus_tag LOCUS_29340 39674 39450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 39867 39685 gene locus_tag LOCUS_29350 39867 39685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 41052 39952 gene locus_tag LOCUS_29360 41052 39952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 41913 43034 gene locus_tag LOCUS_29370 41913 43034 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 protein_id gnl|my_center|LOCUS_29370 43165 44325 gene locus_tag LOCUS_29380 43165 44325 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480234.1 protein_id gnl|my_center|LOCUS_29380 44937 44596 gene locus_tag LOCUS_29390 44937 44596 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_29390 46810 45041 gene locus_tag LOCUS_29400 46810 45041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 48352 46847 gene locus_tag LOCUS_29410 48352 46847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 48817 49473 gene locus_tag LOCUS_29420 48817 49473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 50121 51302 gene locus_tag LOCUS_29430 50121 51302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29430 51339 51872 gene locus_tag LOCUS_29440 51339 51872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 52479 52282 gene locus_tag LOCUS_29450 52479 52282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 53027 52836 gene locus_tag LOCUS_29460 53027 52836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 53447 53079 gene locus_tag LOCUS_29470 53447 53079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 54510 53533 gene locus_tag LOCUS_29480 54510 53533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 56884 55253 gene locus_tag LOCUS_29490 56884 55253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 57538 57200 gene locus_tag LOCUS_29500 57538 57200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence33 941 660 gene locus_tag LOCUS_29510 941 660 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948127.1 protein_id gnl|my_center|LOCUS_29510 2043 1060 gene locus_tag LOCUS_29520 2043 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2846 2058 gene locus_tag LOCUS_29530 gene ssuC 2846 2058 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_29530 3193 2903 gene locus_tag LOCUS_29540 3193 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3513 4490 gene locus_tag LOCUS_29550 gene cysK 3513 4490 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 protein_id gnl|my_center|LOCUS_29550 4690 6249 gene locus_tag LOCUS_29560 4690 6249 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814809.1 protein_id gnl|my_center|LOCUS_29560 6246 7562 gene locus_tag LOCUS_29570 6246 7562 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039185890.1 protein_id gnl|my_center|LOCUS_29570 7686 8684 gene locus_tag LOCUS_29580 gene tauA 7686 8684 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105422.1 protein_id gnl|my_center|LOCUS_29580 8714 9502 gene locus_tag LOCUS_29590 gene tauB 8714 9502 CDS product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767098.1 protein_id gnl|my_center|LOCUS_29590 9499 10371 gene locus_tag LOCUS_29600 gene tauC 9499 10371 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 protein_id gnl|my_center|LOCUS_29600 10879 10430 gene locus_tag LOCUS_29610 10879 10430 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_29610 11333 10881 gene locus_tag LOCUS_29620 11333 10881 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 protein_id gnl|my_center|LOCUS_29620 11897 11676 gene locus_tag LOCUS_29630 11897 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 11784 12527 gene locus_tag LOCUS_29640 11784 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 12524 12850 gene locus_tag LOCUS_29650 12524 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 13003 12866 gene locus_tag LOCUS_29660 13003 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 13639 14058 gene locus_tag LOCUS_29670 13639 14058 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_29670 14845 14222 gene locus_tag LOCUS_29680 gene coq7 14845 14222 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 protein_id gnl|my_center|LOCUS_29680 15298 14891 gene locus_tag LOCUS_29690 15298 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 16008 15463 gene locus_tag LOCUS_29700 16008 15463 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_29700 16299 17948 gene locus_tag LOCUS_29710 16299 17948 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_29710 17936 18538 gene locus_tag LOCUS_29720 17936 18538 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 protein_id gnl|my_center|LOCUS_29720 19955 18558 gene locus_tag LOCUS_29730 gene ffh 19955 18558 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_29730 19945 20784 gene locus_tag LOCUS_29740 gene ccsA 19945 20784 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194227.1 protein_id gnl|my_center|LOCUS_29740 21066 22796 gene locus_tag LOCUS_29750 21066 22796 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_29750 22793 26863 gene locus_tag LOCUS_29760 22793 26863 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193490.1 protein_id gnl|my_center|LOCUS_29760 27897 26860 gene locus_tag LOCUS_29770 27897 26860 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_29770 29017 27887 gene locus_tag LOCUS_29780 29017 27887 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930406.1 protein_id gnl|my_center|LOCUS_29780 29584 29087 gene locus_tag LOCUS_29790 gene purE 29584 29087 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_29790 30438 29584 gene locus_tag LOCUS_29800 gene folD 30438 29584 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_29800 30594 30782 gene locus_tag LOCUS_29810 30594 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 31211 30984 gene locus_tag LOCUS_29820 31211 30984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 31907 31479 gene locus_tag LOCUS_29830 gene higA 31907 31479 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_29830 32212 31910 gene locus_tag LOCUS_29840 32212 31910 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_29840 32476 32802 gene locus_tag LOCUS_29850 32476 32802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 33632 33201 gene locus_tag LOCUS_29860 33632 33201 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_29860 33932 33639 gene locus_tag LOCUS_29870 33932 33639 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140282.1 protein_id gnl|my_center|LOCUS_29870 34322 34636 gene locus_tag LOCUS_29880 34322 34636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 35208 35384 gene locus_tag LOCUS_29890 35208 35384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 35444 35698 gene locus_tag LOCUS_29900 35444 35698 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_29900 35695 36111 gene locus_tag LOCUS_29910 35695 36111 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_29910 36829 36191 gene locus_tag LOCUS_29920 36829 36191 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389730.1 protein_id gnl|my_center|LOCUS_29920 38818 36914 gene locus_tag LOCUS_29930 38818 36914 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389731.1 protein_id gnl|my_center|LOCUS_29930 39177 39950 gene locus_tag LOCUS_29940 39177 39950 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_29940 40234 42927 gene locus_tag LOCUS_29950 gene aceE 40234 42927 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 protein_id gnl|my_center|LOCUS_29950 42940 44280 gene locus_tag LOCUS_29960 gene aceF 42940 44280 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_29960 44294 46036 gene locus_tag LOCUS_29970 gene lpdA 44294 46036 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_29970 47145 46288 gene locus_tag LOCUS_29980 47145 46288 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190245.1 protein_id gnl|my_center|LOCUS_29980 47893 47267 gene locus_tag LOCUS_29990 gene paaY 47893 47267 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_29990 48169 50547 gene locus_tag LOCUS_30000 48169 50547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536019.1 protein_id gnl|my_center|LOCUS_30000 50730 51827 gene locus_tag LOCUS_30010 50730 51827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 52902 51886 gene locus_tag LOCUS_30020 52902 51886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 53275 53826 gene locus_tag LOCUS_30030 53275 53826 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence34 846 1487 gene locus_tag LOCUS_30040 846 1487 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_30040 2600 2986 gene locus_tag LOCUS_30050 gene gloA 2600 2986 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_30050 3183 4172 gene locus_tag LOCUS_30060 3183 4172 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192001.1 protein_id gnl|my_center|LOCUS_30060 4169 4927 gene locus_tag LOCUS_30070 4169 4927 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 protein_id gnl|my_center|LOCUS_30070 4924 5946 gene locus_tag LOCUS_30080 4924 5946 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524705.1 protein_id gnl|my_center|LOCUS_30080 5936 6427 gene locus_tag LOCUS_30090 5936 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 6431 7051 gene locus_tag LOCUS_30100 gene leuE 6431 7051 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705795.1 protein_id gnl|my_center|LOCUS_30100 7250 8872 gene locus_tag LOCUS_30110 7250 8872 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538238.1 protein_id gnl|my_center|LOCUS_30110 9556 8966 gene locus_tag LOCUS_30120 9556 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 10635 9775 gene locus_tag LOCUS_30130 10635 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30130 11097 10651 gene locus_tag LOCUS_30140 11097 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30140 11221 11385 gene locus_tag LOCUS_30150 11221 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 11503 11664 gene locus_tag LOCUS_30160 11503 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 12383 11763 gene locus_tag LOCUS_30170 12383 11763 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033468060.1 protein_id gnl|my_center|LOCUS_30170 12642 13709 gene locus_tag LOCUS_30180 12642 13709 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_30180 17833 13922 gene locus_tag LOCUS_30190 17833 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 19041 17896 gene locus_tag LOCUS_30200 19041 17896 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_30200 19256 19038 gene locus_tag LOCUS_30210 19256 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 19547 19846 gene locus_tag LOCUS_30220 19547 19846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 20016 22940 gene locus_tag LOCUS_30230 20016 22940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 23452 23874 gene locus_tag LOCUS_30240 23452 23874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 23892 24119 gene locus_tag LOCUS_30250 23892 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 24263 25003 gene locus_tag LOCUS_30260 24263 25003 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_30260 24981 25988 gene locus_tag LOCUS_30270 24981 25988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 25997 26725 gene locus_tag LOCUS_30280 25997 26725 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112760.1 protein_id gnl|my_center|LOCUS_30280 27923 26832 gene locus_tag LOCUS_30290 27923 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 28494 28033 gene locus_tag LOCUS_30300 28494 28033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 29820 28837 gene locus_tag LOCUS_30310 gene ybiB 29820 28837 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210242.1 protein_id gnl|my_center|LOCUS_30310 30786 31736 gene locus_tag LOCUS_30320 30786 31736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 33760 32054 gene locus_tag LOCUS_30330 33760 32054 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_30330 35708 34050 gene locus_tag LOCUS_30340 35708 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 35942 35712 gene locus_tag LOCUS_30350 35942 35712 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_30350 37026 35974 gene locus_tag LOCUS_30360 37026 35974 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 protein_id gnl|my_center|LOCUS_30360 37599 37153 gene locus_tag LOCUS_30370 37599 37153 CDS product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189053.1 protein_id gnl|my_center|LOCUS_30370 38704 37853 gene locus_tag LOCUS_30380 gene rlmA 38704 37853 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_30380 39062 39319 gene locus_tag LOCUS_30390 39062 39319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 39912 39819 gene locus_tag LOCUS_t00330 39912 39819 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41192 39912 gene locus_tag LOCUS_30400 41192 39912 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_30400 41436 41741 gene locus_tag LOCUS_30410 41436 41741 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215072.1 protein_id gnl|my_center|LOCUS_30410 43703 42048 gene locus_tag LOCUS_30420 gene recN 43703 42048 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_30420 44530 43739 gene locus_tag LOCUS_30430 44530 43739 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_30430 44742 45770 gene locus_tag LOCUS_30440 gene hrcA 44742 45770 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_30440 45764 46873 gene locus_tag LOCUS_30450 gene hemH 45764 46873 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_30450 48629 47031 gene locus_tag LOCUS_30460 gene aceB 48629 47031 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193967.1 protein_id gnl|my_center|LOCUS_30460 48747 49652 gene locus_tag LOCUS_30470 48747 49652 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_30470 49886 49686 gene locus_tag LOCUS_30480 49886 49686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 53330 50397 gene locus_tag LOCUS_30490 53330 50397 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196173418.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence35 1306 1992 gene locus_tag LOCUS_30500 1306 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1893 2300 gene locus_tag LOCUS_30510 1893 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 2604 3191 gene locus_tag LOCUS_30520 2604 3191 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 protein_id gnl|my_center|LOCUS_30520 3191 4690 gene locus_tag LOCUS_30530 3191 4690 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616429.1 protein_id gnl|my_center|LOCUS_30530 5907 4828 gene locus_tag LOCUS_30540 5907 4828 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039627.1 protein_id gnl|my_center|LOCUS_30540 7479 6085 gene locus_tag LOCUS_30550 gene pmbA 7479 6085 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_30550 7576 8115 gene locus_tag LOCUS_30560 gene yjgA 7576 8115 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189393.1 protein_id gnl|my_center|LOCUS_30560 8120 8701 gene locus_tag LOCUS_30570 gene mog 8120 8701 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094677.1 protein_id gnl|my_center|LOCUS_30570 10237 8714 gene locus_tag LOCUS_30580 10237 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 10410 11231 gene locus_tag LOCUS_30590 10410 11231 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_30590 11280 11786 gene locus_tag LOCUS_30600 gene folA 11280 11786 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_30600 11890 12324 gene locus_tag LOCUS_30610 11890 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 12499 12311 gene locus_tag LOCUS_30620 12499 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 13433 12504 gene locus_tag LOCUS_30630 gene lpxC 13433 12504 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522022.1 protein_id gnl|my_center|LOCUS_30630 14698 13529 gene locus_tag LOCUS_30640 gene ftsZ 14698 13529 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_30640 15993 14764 gene locus_tag LOCUS_30650 gene ftsA 15993 14764 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_30650 16742 15990 gene locus_tag LOCUS_30660 16742 15990 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_30660 17672 16746 gene locus_tag LOCUS_30670 17672 16746 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194254.1 protein_id gnl|my_center|LOCUS_30670 19071 17683 gene locus_tag LOCUS_30680 gene murC 19071 17683 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_30680 20123 19068 gene locus_tag LOCUS_30690 gene murG 20123 19068 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_30690 21280 20120 gene locus_tag LOCUS_30700 gene ftsW 21280 20120 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_30700 22647 21280 gene locus_tag LOCUS_30710 gene murD 22647 21280 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_30710 23737 22649 gene locus_tag LOCUS_30720 gene mraY 23737 22649 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_30720 25116 23737 gene locus_tag LOCUS_30730 gene murF 25116 23737 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_30730 26621 25113 gene locus_tag LOCUS_30740 26621 25113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 28375 26618 gene locus_tag LOCUS_30750 28375 26618 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_30750 28650 28372 gene locus_tag LOCUS_30760 gene ftsL 28650 28372 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527786.1 protein_id gnl|my_center|LOCUS_30760 29602 28652 gene locus_tag LOCUS_30770 gene rsmH 29602 28652 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 protein_id gnl|my_center|LOCUS_30770 30048 29599 gene locus_tag LOCUS_30780 gene mraZ 30048 29599 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 protein_id gnl|my_center|LOCUS_30780 31571 30789 gene locus_tag LOCUS_30790 31571 30789 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_30790 32017 31568 gene locus_tag LOCUS_30800 32017 31568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 33092 32058 gene locus_tag LOCUS_30810 gene pyrC 33092 32058 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_30810 34017 33178 gene locus_tag LOCUS_30820 gene rsmI 34017 33178 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_30820 34034 34411 gene locus_tag LOCUS_30830 34034 34411 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_30830 34392 34766 gene locus_tag LOCUS_30840 34392 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 34808 35401 gene locus_tag LOCUS_30850 34808 35401 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692028.1 protein_id gnl|my_center|LOCUS_30850 35398 36051 gene locus_tag LOCUS_30860 35398 36051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 36438 36196 gene locus_tag LOCUS_30870 36438 36196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 37028 36405 gene locus_tag LOCUS_30880 37028 36405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30880 37454 37089 gene locus_tag LOCUS_30890 37454 37089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30890 38041 37418 gene locus_tag LOCUS_30900 38041 37418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 38381 38025 gene locus_tag LOCUS_30910 gene folB 38381 38025 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174138.1 protein_id gnl|my_center|LOCUS_30910 38500 39114 gene locus_tag LOCUS_30920 gene plsY 38500 39114 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_30920 40166 39147 gene locus_tag LOCUS_30930 gene tsaD 40166 39147 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_30930 42442 40241 gene locus_tag LOCUS_30940 42442 40241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 43698 42439 gene locus_tag LOCUS_30950 43698 42439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 43932 46010 gene locus_tag LOCUS_30960 43932 46010 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_30960 46101 47336 gene locus_tag LOCUS_30970 46101 47336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 48396 47614 gene locus_tag LOCUS_30980 48396 47614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 48996 49538 gene locus_tag LOCUS_30990 48996 49538 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926072.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence36 179 1363 gene locus_tag LOCUS_31000 179 1363 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_31000 1384 1647 gene locus_tag LOCUS_31010 1384 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3146 1857 gene locus_tag LOCUS_31020 3146 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3742 3197 gene locus_tag LOCUS_31030 3742 3197 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 protein_id gnl|my_center|LOCUS_31030 3868 4767 gene locus_tag LOCUS_31040 3868 4767 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974932.1 protein_id gnl|my_center|LOCUS_31040 6288 4813 gene locus_tag LOCUS_31050 6288 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 7816 6299 gene locus_tag LOCUS_31060 7816 6299 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857747.1 protein_id gnl|my_center|LOCUS_31060 10013 7839 gene locus_tag LOCUS_31070 10013 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 10941 10051 gene locus_tag LOCUS_31080 10941 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 13573 10961 gene locus_tag LOCUS_31090 13573 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 13910 15904 gene locus_tag LOCUS_31100 13910 15904 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_31100 16070 16423 gene locus_tag LOCUS_31110 16070 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 16961 16515 gene locus_tag LOCUS_31120 16961 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 17077 17153 gene locus_tag LOCUS_t00340 17077 17153 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17885 17088 gene locus_tag LOCUS_31130 17885 17088 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908611.1 protein_id gnl|my_center|LOCUS_31130 19096 17885 gene locus_tag LOCUS_31140 19096 17885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_31140 20070 19315 gene locus_tag LOCUS_31150 gene zapD 20070 19315 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_31150 20754 20131 gene locus_tag LOCUS_31160 gene coaE 20754 20131 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_31160 21437 20751 gene locus_tag LOCUS_31170 21437 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 22810 21446 gene locus_tag LOCUS_31180 22810 21446 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_31180 23280 22870 gene locus_tag LOCUS_31190 gene speD 23280 22870 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_31190 24039 23479 gene locus_tag LOCUS_31200 24039 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 24146 25435 gene locus_tag LOCUS_31210 24146 25435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_31210 27018 25519 gene locus_tag LOCUS_31220 27018 25519 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224914.1 protein_id gnl|my_center|LOCUS_31220 27348 27094 gene locus_tag LOCUS_31230 27348 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 27607 27969 gene locus_tag LOCUS_31240 27607 27969 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_31240 27980 29461 gene locus_tag LOCUS_31250 gene amt 27980 29461 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_31250 29757 29832 gene locus_tag LOCUS_t00350 29757 29832 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29872 29947 gene locus_tag LOCUS_t00360 29872 29947 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 31256 30183 gene locus_tag LOCUS_31260 31256 30183 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517778.1 protein_id gnl|my_center|LOCUS_31260 32447 31260 gene locus_tag LOCUS_31270 32447 31260 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_31270 33042 32461 gene locus_tag LOCUS_31280 33042 32461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 33168 33413 gene locus_tag LOCUS_31290 33168 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 33423 33737 gene locus_tag LOCUS_31300 33423 33737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 33809 36025 gene locus_tag LOCUS_31310 33809 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 36018 36308 gene locus_tag LOCUS_31320 36018 36308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 39095 36339 gene locus_tag LOCUS_31330 39095 36339 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 protein_id gnl|my_center|LOCUS_31330 39647 39159 gene locus_tag LOCUS_31340 39647 39159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 39894 39640 gene locus_tag LOCUS_31350 39894 39640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 43204 39980 gene locus_tag LOCUS_31360 43204 39980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 43840 43220 gene locus_tag LOCUS_31370 43840 43220 CDS product DUF3780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117920.1 protein_id gnl|my_center|LOCUS_31370 46944 43840 gene locus_tag LOCUS_31380 46944 43840 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 protein_id gnl|my_center|LOCUS_31380 47492 48307 gene locus_tag LOCUS_31390 47492 48307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 48428 48706 gene locus_tag LOCUS_31400 48428 48706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 48669 48896 gene locus_tag LOCUS_31410 48669 48896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence37 3 701 gene locus_tag LOCUS_31420 3 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 938 1567 gene locus_tag LOCUS_31430 938 1567 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_31430 2279 1839 gene locus_tag LOCUS_31440 2279 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 2521 2814 gene locus_tag LOCUS_31450 2521 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 2811 3995 gene locus_tag LOCUS_31460 2811 3995 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_31460 4235 5338 gene locus_tag LOCUS_31470 gene aroC 4235 5338 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_31470 5412 5669 gene locus_tag LOCUS_31480 5412 5669 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 protein_id gnl|my_center|LOCUS_31480 5716 6912 gene locus_tag LOCUS_31490 5716 6912 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_31490 6924 7766 gene locus_tag LOCUS_31500 6924 7766 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_31500 8061 8189 gene locus_tag LOCUS_31510 8061 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 8304 9434 gene locus_tag LOCUS_31520 gene asd 8304 9434 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_31520 9779 12631 gene locus_tag LOCUS_31530 gene fimV 9779 12631 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_31530 12748 13308 gene locus_tag LOCUS_31540 12748 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 13497 13216 gene locus_tag LOCUS_31550 13497 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 13411 14130 gene locus_tag LOCUS_31560 gene truA 13411 14130 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_31560 14127 14747 gene locus_tag LOCUS_31570 14127 14747 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_31570 14923 16122 gene locus_tag LOCUS_31580 gene trpB 14923 16122 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_31580 16125 16934 gene locus_tag LOCUS_31590 gene trpA 16125 16934 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_31590 16946 17818 gene locus_tag LOCUS_31600 gene accD 16946 17818 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_31600 17829 19166 gene locus_tag LOCUS_31610 gene folC 17829 19166 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_31610 19198 20124 gene locus_tag LOCUS_31620 19198 20124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 20121 20609 gene locus_tag LOCUS_31630 20121 20609 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817223.1 protein_id gnl|my_center|LOCUS_31630 20619 22145 gene locus_tag LOCUS_31640 gene purF 20619 22145 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 protein_id gnl|my_center|LOCUS_31640 22151 23332 gene locus_tag LOCUS_31650 22151 23332 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_31650 23625 23329 gene locus_tag LOCUS_31660 23625 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 24726 23872 gene locus_tag LOCUS_31670 24726 23872 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_31670 25609 24749 gene locus_tag LOCUS_31680 25609 24749 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 protein_id gnl|my_center|LOCUS_31680 25821 26864 gene locus_tag LOCUS_31690 25821 26864 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_31690 26880 27533 gene locus_tag LOCUS_31700 26880 27533 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_31700 27621 27752 gene locus_tag LOCUS_31710 27621 27752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 27930 29120 gene locus_tag LOCUS_31720 gene rlmI 27930 29120 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_31720 29738 29127 gene locus_tag LOCUS_31730 gene msrA 29738 29127 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947811.1 protein_id gnl|my_center|LOCUS_31730 30247 29735 gene locus_tag LOCUS_31740 gene msrB 30247 29735 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404837.1 protein_id gnl|my_center|LOCUS_31740 30578 31030 gene locus_tag LOCUS_31750 30578 31030 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 protein_id gnl|my_center|LOCUS_31750 31107 32168 gene locus_tag LOCUS_31760 31107 32168 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_31760 32335 32916 gene locus_tag LOCUS_31770 32335 32916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 32928 34139 gene locus_tag LOCUS_31780 32928 34139 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_31780 35607 34210 gene locus_tag LOCUS_31790 gene glmM 35607 34210 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_31790 36517 35678 gene locus_tag LOCUS_31800 gene folP 36517 35678 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_31800 38466 36583 gene locus_tag LOCUS_31810 gene ftsH 38466 36583 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_31810 39150 38587 gene locus_tag LOCUS_31820 gene rlmE 39150 38587 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438562.1 protein_id gnl|my_center|LOCUS_31820 39253 39612 gene locus_tag LOCUS_31830 39253 39612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 40121 39657 gene locus_tag LOCUS_31840 40121 39657 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688914.1 protein_id gnl|my_center|LOCUS_31840 40607 40131 gene locus_tag LOCUS_31850 gene greA 40607 40131 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_31850 43884 40675 gene locus_tag LOCUS_31860 gene carB 43884 40675 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_31860 44905 43868 gene locus_tag LOCUS_31870 gene carA 44905 43868 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_31870 46055 45249 gene locus_tag LOCUS_31880 gene dapB 46055 45249 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_31880 46539 46057 gene locus_tag LOCUS_31890 46539 46057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 46716 47183 gene locus_tag LOCUS_31900 gene fur 46716 47183 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence38 36 1067 gene locus_tag LOCUS_31910 36 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 1064 1828 gene locus_tag LOCUS_31920 1064 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3531 2392 gene locus_tag LOCUS_31930 3531 2392 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_31930 4269 4042 gene locus_tag LOCUS_31940 4269 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 4999 4730 gene locus_tag LOCUS_31950 4999 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 6922 5006 gene locus_tag LOCUS_31960 6922 5006 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_31960 7173 7245 gene locus_tag LOCUS_t00370 7173 7245 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7603 8178 gene locus_tag LOCUS_31970 7603 8178 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_31970 9373 9023 gene locus_tag LOCUS_31980 9373 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 9601 9984 gene locus_tag LOCUS_31990 gene crcB 9601 9984 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_31990 9995 10318 gene locus_tag LOCUS_32000 9995 10318 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 protein_id gnl|my_center|LOCUS_32000 10315 10524 gene locus_tag LOCUS_32010 10315 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 10557 10940 gene locus_tag LOCUS_32020 10557 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32020 11076 11570 gene locus_tag LOCUS_32030 11076 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 11627 12397 gene locus_tag LOCUS_32040 11627 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32040 12547 13737 gene locus_tag LOCUS_32050 12547 13737 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706487.1 protein_id gnl|my_center|LOCUS_32050 14246 13821 gene locus_tag LOCUS_32060 14246 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32060 14546 14286 gene locus_tag LOCUS_32070 14546 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 14714 14547 gene locus_tag LOCUS_32080 14714 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 14935 14711 gene locus_tag LOCUS_32090 14935 14711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 16674 15280 gene locus_tag LOCUS_32100 gene glrR 16674 15280 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_32100 17243 16674 gene locus_tag LOCUS_32110 17243 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 18662 17253 gene locus_tag LOCUS_32120 gene qseE 18662 17253 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311037.1 protein_id gnl|my_center|LOCUS_32120 19135 19830 gene locus_tag LOCUS_32130 19135 19830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 19833 20627 gene locus_tag LOCUS_32140 19833 20627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 20624 20995 gene locus_tag LOCUS_32150 20624 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 21259 21429 gene locus_tag LOCUS_32160 21259 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 21437 21895 gene locus_tag LOCUS_32170 21437 21895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 21892 23103 gene locus_tag LOCUS_32180 gene dinB 21892 23103 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_32180 23915 23232 gene locus_tag LOCUS_32190 23915 23232 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_32190 26210 23919 gene locus_tag LOCUS_32200 26210 23919 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_32200 26800 26231 gene locus_tag LOCUS_32210 26800 26231 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 protein_id gnl|my_center|LOCUS_32210 27465 31394 gene locus_tag LOCUS_32220 27465 31394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 31474 33645 gene locus_tag LOCUS_32230 gene glgB 31474 33645 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_32230 34192 33974 gene locus_tag LOCUS_32240 34192 33974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 36413 34389 gene locus_tag LOCUS_32250 36413 34389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 36939 36406 gene locus_tag LOCUS_32260 36939 36406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 37493 36942 gene locus_tag LOCUS_32270 37493 36942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 38233 38823 gene locus_tag LOCUS_32280 38233 38823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 39033 40301 gene locus_tag LOCUS_32290 39033 40301 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_32290 40404 41447 gene locus_tag LOCUS_32300 40404 41447 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_32300 41663 42151 gene locus_tag LOCUS_32310 41663 42151 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_32310 43181 42171 gene locus_tag LOCUS_32320 43181 42171 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_32320 43510 44364 gene locus_tag LOCUS_32330 gene asd 43510 44364 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 protein_id gnl|my_center|LOCUS_32330 44511 45506 gene locus_tag LOCUS_32340 44511 45506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 45916 45665 gene locus_tag LOCUS_32350 45916 45665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 46213 45926 gene locus_tag LOCUS_32360 46213 45926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence39 1608 259 gene locus_tag LOCUS_32370 1608 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1788 2363 gene locus_tag LOCUS_32380 gene grpE 1788 2363 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_32380 2447 4375 gene locus_tag LOCUS_32390 gene dnaK 2447 4375 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_32390 4442 5560 gene locus_tag LOCUS_32400 gene dnaJ 4442 5560 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_32400 5731 6873 gene locus_tag LOCUS_32410 5731 6873 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_32410 8327 6942 gene locus_tag LOCUS_32420 gene cysS 8327 6942 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_32420 8508 9461 gene locus_tag LOCUS_32430 8508 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 9607 10173 gene locus_tag LOCUS_32440 9607 10173 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_32440 10170 10661 gene locus_tag LOCUS_32450 10170 10661 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_32450 10693 11424 gene locus_tag LOCUS_32460 gene lpxH 10693 11424 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 protein_id gnl|my_center|LOCUS_32460 11519 13336 gene locus_tag LOCUS_32470 gene recQ 11519 13336 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_32470 14814 13339 gene locus_tag LOCUS_32480 14814 13339 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_32480 14873 15730 gene locus_tag LOCUS_32490 gene nadC 14873 15730 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770545.1 protein_id gnl|my_center|LOCUS_32490 15900 16040 gene locus_tag LOCUS_32500 15900 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 17577 16093 gene locus_tag LOCUS_32510 gene thrC 17577 16093 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_32510 18283 17681 gene locus_tag LOCUS_32520 18283 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 19679 18540 gene locus_tag LOCUS_32530 19679 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 20049 19792 gene locus_tag LOCUS_32540 20049 19792 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_32540 20374 20832 gene locus_tag LOCUS_32550 20374 20832 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706585.1 protein_id gnl|my_center|LOCUS_32550 21433 20951 gene locus_tag LOCUS_32560 21433 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 22149 21547 gene locus_tag LOCUS_32570 22149 21547 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194061.1 protein_id gnl|my_center|LOCUS_32570 23604 22387 gene locus_tag LOCUS_32580 gene ccmI 23604 22387 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_32580 24086 23601 gene locus_tag LOCUS_32590 gene ccmH 24086 23601 CDS product cytochrome c maturation protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114292.1 protein_id gnl|my_center|LOCUS_32590 24667 24083 gene locus_tag LOCUS_32600 24667 24083 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036835.1 protein_id gnl|my_center|LOCUS_32600 26681 24678 gene locus_tag LOCUS_32610 26681 24678 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_32610 27177 26698 gene locus_tag LOCUS_32620 gene ccmE 27177 26698 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_32620 27392 27174 gene locus_tag LOCUS_32630 27392 27174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 28146 27397 gene locus_tag LOCUS_32640 gene ccmC 28146 27397 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_32640 28815 28147 gene locus_tag LOCUS_32650 gene ccmB 28815 28147 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815897.1 protein_id gnl|my_center|LOCUS_32650 29465 28824 gene locus_tag LOCUS_32660 gene ccmA 29465 28824 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 protein_id gnl|my_center|LOCUS_32660 29605 30594 gene locus_tag LOCUS_32670 29605 30594 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089671.1 protein_id gnl|my_center|LOCUS_32670 30587 30928 gene locus_tag LOCUS_32680 gene hypA 30587 30928 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_32680 30946 31992 gene locus_tag LOCUS_32690 30946 31992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 31994 34294 gene locus_tag LOCUS_32700 gene hypF 31994 34294 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089668.1 protein_id gnl|my_center|LOCUS_32700 34306 34554 gene locus_tag LOCUS_32710 34306 34554 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_32710 35433 35017 gene locus_tag LOCUS_32720 35433 35017 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_32720 35681 35433 gene locus_tag LOCUS_32730 35681 35433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 38430 36103 gene locus_tag LOCUS_32740 38430 36103 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_32740 38754 39923 gene locus_tag LOCUS_32750 gene hypD 38754 39923 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_32750 39920 40969 gene locus_tag LOCUS_32760 gene hypE 39920 40969 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089665.1 protein_id gnl|my_center|LOCUS_32760 40995 42713 gene locus_tag LOCUS_32770 40995 42713 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_32770 42710 44170 gene locus_tag LOCUS_32780 42710 44170 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_32780 44167 45165 gene locus_tag LOCUS_32790 44167 45165 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence40 1013 171 gene locus_tag LOCUS_32800 1013 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 1234 1010 gene locus_tag LOCUS_32810 1234 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1289 1513 gene locus_tag LOCUS_32820 1289 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1787 2644 gene locus_tag LOCUS_32830 1787 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3578 2661 gene locus_tag LOCUS_32840 gene draG 3578 2661 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_32840 3958 3584 gene locus_tag LOCUS_32850 3958 3584 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563670.1 protein_id gnl|my_center|LOCUS_32850 4283 3996 gene locus_tag LOCUS_32860 gene fdxC 4283 3996 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_32860 5585 4311 gene locus_tag LOCUS_32870 5585 4311 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_32870 5994 5716 gene locus_tag LOCUS_32880 5994 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 7522 6005 gene locus_tag LOCUS_32890 gene nifB 7522 6005 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_32890 7863 9227 gene locus_tag LOCUS_32900 7863 9227 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088379.1 protein_id gnl|my_center|LOCUS_32900 10156 9362 gene locus_tag LOCUS_32910 10156 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 10550 10158 gene locus_tag LOCUS_32920 10550 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 10459 10851 gene locus_tag LOCUS_32930 10459 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 12505 10901 gene locus_tag LOCUS_32940 12505 10901 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_32940 14061 12502 gene locus_tag LOCUS_32950 14061 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 14327 14908 gene locus_tag LOCUS_32960 gene rsxA 14327 14908 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_32960 14920 15465 gene locus_tag LOCUS_32970 14920 15465 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_32970 15505 17031 gene locus_tag LOCUS_32980 gene rsxC 15505 17031 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_32980 17028 18110 gene locus_tag LOCUS_32990 17028 18110 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_32990 18107 18736 gene locus_tag LOCUS_33000 gene rsxG 18107 18736 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_33000 18733 19407 gene locus_tag LOCUS_33010 18733 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 19439 19723 gene locus_tag LOCUS_33020 19439 19723 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 protein_id gnl|my_center|LOCUS_33020 20156 19824 gene locus_tag LOCUS_33030 20156 19824 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_33030 20617 20153 gene locus_tag LOCUS_33040 20617 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 20751 20906 gene locus_tag LOCUS_33050 20751 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 21050 21496 gene locus_tag LOCUS_33060 21050 21496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 22054 23067 gene locus_tag LOCUS_33070 22054 23067 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_33070 23081 24013 gene locus_tag LOCUS_33080 23081 24013 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 protein_id gnl|my_center|LOCUS_33080 24010 24462 gene locus_tag LOCUS_33090 24010 24462 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_33090 24487 25455 gene locus_tag LOCUS_33100 24487 25455 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623287.1 protein_id gnl|my_center|LOCUS_33100 25788 26786 gene locus_tag LOCUS_33110 25788 26786 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_33110 28370 26799 gene locus_tag LOCUS_33120 28370 26799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 29166 28354 gene locus_tag LOCUS_33130 29166 28354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_33130 29221 30018 gene locus_tag LOCUS_33140 29221 30018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 30484 32697 gene locus_tag LOCUS_33150 30484 32697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 32700 34901 gene locus_tag LOCUS_33160 32700 34901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 35097 35600 gene locus_tag LOCUS_33170 gene tpx 35097 35600 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_33170 35618 36499 gene locus_tag LOCUS_33180 35618 36499 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 protein_id gnl|my_center|LOCUS_33180 36784 37608 gene locus_tag LOCUS_33190 36784 37608 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_33190 37610 38182 gene locus_tag LOCUS_33200 37610 38182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194143.1 protein_id gnl|my_center|LOCUS_33200 38191 40107 gene locus_tag LOCUS_33210 38191 40107 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931245.1 protein_id gnl|my_center|LOCUS_33210 40109 40999 gene locus_tag LOCUS_33220 40109 40999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 40996 41835 gene locus_tag LOCUS_33230 gene aroE 40996 41835 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_33230 41832 42524 gene locus_tag LOCUS_33240 gene mtgA 41832 42524 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_33240 42655 43176 gene locus_tag LOCUS_33250 42655 43176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228841.1 protein_id gnl|my_center|LOCUS_33250 44745 43330 gene locus_tag LOCUS_33260 44745 43330 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192408.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence41 1651 122 gene locus_tag LOCUS_33270 1651 122 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_33270 1845 2834 gene locus_tag LOCUS_33280 1845 2834 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_33280 2842 3513 gene locus_tag LOCUS_33290 2842 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 3638 3711 gene locus_tag LOCUS_t00380 3638 3711 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3982 3758 gene locus_tag LOCUS_33300 3982 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3896 4108 gene locus_tag LOCUS_33310 3896 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 4693 4250 gene locus_tag LOCUS_33320 4693 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 5581 7326 gene locus_tag LOCUS_33330 5581 7326 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_33330 7695 8399 gene locus_tag LOCUS_33340 7695 8399 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967308.1 protein_id gnl|my_center|LOCUS_33340 8420 8896 gene locus_tag LOCUS_33350 8420 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 10462 9032 gene locus_tag LOCUS_33360 gene cls 10462 9032 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 protein_id gnl|my_center|LOCUS_33360 10774 11436 gene locus_tag LOCUS_33370 gene marC 10774 11436 CDS product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 protein_id gnl|my_center|LOCUS_33370 12389 11913 gene locus_tag LOCUS_33380 12389 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 13172 12402 gene locus_tag LOCUS_33390 13172 12402 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980063.1 protein_id gnl|my_center|LOCUS_33390 14508 13495 gene locus_tag LOCUS_33400 14508 13495 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416068.1 protein_id gnl|my_center|LOCUS_33400 14749 17247 gene locus_tag LOCUS_33410 14749 17247 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085450.1 protein_id gnl|my_center|LOCUS_33410 17336 17686 gene locus_tag LOCUS_33420 17336 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034793228.1 protein_id gnl|my_center|LOCUS_33420 17882 18061 gene locus_tag LOCUS_33430 17882 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 19075 18098 gene locus_tag LOCUS_33440 19075 18098 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_33440 19189 20682 gene locus_tag LOCUS_33450 19189 20682 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_33450 21846 20806 gene locus_tag LOCUS_33460 gene sphR 21846 20806 CDS product AraC family transcriptional regulator SphR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114360.1 protein_id gnl|my_center|LOCUS_33460 22169 23029 gene locus_tag LOCUS_33470 22169 23029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 23065 25593 gene locus_tag LOCUS_33480 23065 25593 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965877.1 protein_id gnl|my_center|LOCUS_33480 25655 26071 gene locus_tag LOCUS_33490 25655 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 26158 26724 gene locus_tag LOCUS_33500 26158 26724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 26755 27051 gene locus_tag LOCUS_33510 26755 27051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 27048 27929 gene locus_tag LOCUS_33520 27048 27929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 27944 28558 gene locus_tag LOCUS_33530 27944 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 29017 28640 gene locus_tag LOCUS_33540 29017 28640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 29283 29840 gene locus_tag LOCUS_33550 29283 29840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 29940 30830 gene locus_tag LOCUS_33560 29940 30830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 30938 33535 gene locus_tag LOCUS_33570 30938 33535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 33809 33579 gene locus_tag LOCUS_33580 33809 33579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 33780 36614 gene locus_tag LOCUS_33590 33780 36614 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_33590 36784 37203 gene locus_tag LOCUS_33600 36784 37203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 37452 38204 gene locus_tag LOCUS_33610 37452 38204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 39297 38371 gene locus_tag LOCUS_33620 39297 38371 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407991.1 protein_id gnl|my_center|LOCUS_33620 39501 40145 gene locus_tag LOCUS_33630 39501 40145 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070520.1 protein_id gnl|my_center|LOCUS_33630 40150 41301 gene locus_tag LOCUS_33640 40150 41301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 41585 42226 gene locus_tag LOCUS_33650 41585 42226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 42420 42701 gene locus_tag LOCUS_33660 42420 42701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 >Feature sequence42 748 278 gene locus_tag LOCUS_33670 748 278 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_33670 924 2621 gene locus_tag LOCUS_33680 gene leuA 924 2621 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_33680 3698 2718 gene locus_tag LOCUS_33690 3698 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 4374 3850 gene locus_tag LOCUS_33700 4374 3850 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_33700 5936 4374 gene locus_tag LOCUS_33710 5936 4374 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_33710 7362 5941 gene locus_tag LOCUS_33720 7362 5941 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_33720 8056 7397 gene locus_tag LOCUS_33730 8056 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_33730 9005 8058 gene locus_tag LOCUS_33740 9005 8058 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_33740 11032 9002 gene locus_tag LOCUS_33750 gene hyfB 11032 9002 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_33750 11301 11501 gene locus_tag LOCUS_33760 11301 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 11696 12979 gene locus_tag LOCUS_33770 11696 12979 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_33770 13086 13997 gene locus_tag LOCUS_33780 13086 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 14203 14586 gene locus_tag LOCUS_33790 gene apaG 14203 14586 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_33790 14597 15190 gene locus_tag LOCUS_33800 14597 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 16425 15187 gene locus_tag LOCUS_33810 gene argJ 16425 15187 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815023.1 protein_id gnl|my_center|LOCUS_33810 19253 16536 gene locus_tag LOCUS_33820 gene secA 19253 16536 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064961.1 protein_id gnl|my_center|LOCUS_33820 19539 19721 gene locus_tag LOCUS_33830 19539 19721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 19819 20496 gene locus_tag LOCUS_33840 19819 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 20604 21602 gene locus_tag LOCUS_33850 20604 21602 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_33850 22047 23771 gene locus_tag LOCUS_33860 gene asnB 22047 23771 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_33860 26279 23862 gene locus_tag LOCUS_33870 26279 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 27170 28801 gene locus_tag LOCUS_33880 27170 28801 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_33880 28885 30045 gene locus_tag LOCUS_33890 28885 30045 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_33890 30155 31099 gene locus_tag LOCUS_33900 gene rfbA 30155 31099 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783975.1 protein_id gnl|my_center|LOCUS_33900 31636 32592 gene locus_tag LOCUS_33910 31636 32592 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_33910 32589 33245 gene locus_tag LOCUS_33920 32589 33245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 33350 34216 gene locus_tag LOCUS_33930 33350 34216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 34213 34923 gene locus_tag LOCUS_33940 34213 34923 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407623.1 protein_id gnl|my_center|LOCUS_33940 35079 35453 gene locus_tag LOCUS_33950 35079 35453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 35457 36074 gene locus_tag LOCUS_33960 35457 36074 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256807.1 protein_id gnl|my_center|LOCUS_33960 36071 37207 gene locus_tag LOCUS_33970 gene rffA 36071 37207 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950550.1 protein_id gnl|my_center|LOCUS_33970 39354 39112 gene locus_tag LOCUS_33980 39354 39112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence43 1179 670 gene locus_tag LOCUS_33990 1179 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33990 1562 3232 gene locus_tag LOCUS_34000 1562 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3436 5136 gene locus_tag LOCUS_34010 gene asnB 3436 5136 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_34010 5652 5164 gene locus_tag LOCUS_34020 5652 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 5929 6264 gene locus_tag LOCUS_34030 5929 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 6524 8350 gene locus_tag LOCUS_34040 6524 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 8971 9843 gene locus_tag LOCUS_34050 8971 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 9970 11859 gene locus_tag LOCUS_34060 gene asnB 9970 11859 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_34060 11934 13004 gene locus_tag LOCUS_34070 11934 13004 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929975.1 protein_id gnl|my_center|LOCUS_34070 12997 14286 gene locus_tag LOCUS_34080 12997 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 14367 15107 gene locus_tag LOCUS_34090 gene wbbL 14367 15107 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase WbbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262539.1 protein_id gnl|my_center|LOCUS_34090 15272 16054 gene locus_tag LOCUS_34100 15272 16054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550079.1 protein_id gnl|my_center|LOCUS_34100 16051 16611 gene locus_tag LOCUS_34110 16051 16611 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_34110 16725 18593 gene locus_tag LOCUS_34120 16725 18593 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_34120 18844 19752 gene locus_tag LOCUS_34130 18844 19752 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_34130 21253 19868 gene locus_tag LOCUS_34140 gene pssA 21253 19868 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561723.1 protein_id gnl|my_center|LOCUS_34140 21543 21358 gene locus_tag LOCUS_34150 21543 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 23075 21633 gene locus_tag LOCUS_34160 23075 21633 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930897.1 protein_id gnl|my_center|LOCUS_34160 24305 23148 gene locus_tag LOCUS_34170 gene prpC 24305 23148 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_34170 24946 24458 gene locus_tag LOCUS_34180 24946 24458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 25391 25909 gene locus_tag LOCUS_34190 25391 25909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 26922 25927 gene locus_tag LOCUS_34200 gene lipA 26922 25927 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_34200 27614 26919 gene locus_tag LOCUS_34210 gene lipB 27614 26919 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553813.1 protein_id gnl|my_center|LOCUS_34210 27880 27611 gene locus_tag LOCUS_34220 27880 27611 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_34220 29130 27958 gene locus_tag LOCUS_34230 29130 27958 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_34230 29285 30208 gene locus_tag LOCUS_34240 29285 30208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 30421 30281 gene locus_tag LOCUS_34250 30421 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 31193 30588 gene locus_tag LOCUS_34260 gene mobA 31193 30588 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192903.1 protein_id gnl|my_center|LOCUS_34260 32041 31829 gene locus_tag LOCUS_34270 32041 31829 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_34270 32431 33216 gene locus_tag LOCUS_34280 32431 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 33788 33372 gene locus_tag LOCUS_34290 33788 33372 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194258.1 protein_id gnl|my_center|LOCUS_34290 34535 33801 gene locus_tag LOCUS_34300 34535 33801 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039565.1 protein_id gnl|my_center|LOCUS_34300 35301 34549 gene locus_tag LOCUS_34310 35301 34549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 36429 35515 gene locus_tag LOCUS_34320 36429 35515 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807275.1 protein_id gnl|my_center|LOCUS_34320 36525 37124 gene locus_tag LOCUS_34330 gene lysE 36525 37124 CDS product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726966.1 protein_id gnl|my_center|LOCUS_34330 37479 37210 gene locus_tag LOCUS_34340 37479 37210 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence44 149 658 gene locus_tag LOCUS_34350 gene rfaE2 149 658 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_34350 1656 808 gene locus_tag LOCUS_34360 1656 808 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_34360 2058 1681 gene locus_tag LOCUS_34370 2058 1681 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_34370 3285 2116 gene locus_tag LOCUS_34380 3285 2116 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_34380 4430 3363 gene locus_tag LOCUS_34390 4430 3363 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_34390 4591 5046 gene locus_tag LOCUS_34400 4591 5046 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_34400 5063 6226 gene locus_tag LOCUS_34410 5063 6226 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267707.1 protein_id gnl|my_center|LOCUS_34410 6326 7468 gene locus_tag LOCUS_34420 6326 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 7565 8509 gene locus_tag LOCUS_34430 7565 8509 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_34430 8506 9642 gene locus_tag LOCUS_34440 8506 9642 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_34440 9644 9859 gene locus_tag LOCUS_34450 9644 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 10254 10901 gene locus_tag LOCUS_34460 10254 10901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 11320 11147 gene locus_tag LOCUS_34470 11320 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 11658 12260 gene locus_tag LOCUS_34480 11658 12260 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_34480 12260 13879 gene locus_tag LOCUS_34490 12260 13879 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035500.1 protein_id gnl|my_center|LOCUS_34490 13889 14683 gene locus_tag LOCUS_34500 13889 14683 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_34500 14813 16849 gene locus_tag LOCUS_34510 14813 16849 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_34510 16846 17769 gene locus_tag LOCUS_34520 gene liuE 16846 17769 CDS product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 protein_id gnl|my_center|LOCUS_34520 17795 18019 gene locus_tag LOCUS_34530 17795 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 18022 18213 gene locus_tag LOCUS_34540 18022 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 18213 19127 gene locus_tag LOCUS_34550 18213 19127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 19149 20381 gene locus_tag LOCUS_34560 19149 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 20569 21744 gene locus_tag LOCUS_34570 20569 21744 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931526.1 protein_id gnl|my_center|LOCUS_34570 21754 22731 gene locus_tag LOCUS_34580 gene argF 21754 22731 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_34580 22728 23957 gene locus_tag LOCUS_34590 22728 23957 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_34590 23976 24185 gene locus_tag LOCUS_34600 23976 24185 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_34600 24190 24501 gene locus_tag LOCUS_34610 24190 24501 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_34610 24617 25078 gene locus_tag LOCUS_34620 24617 25078 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_34620 25312 28323 gene locus_tag LOCUS_34630 25312 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 28320 28748 gene locus_tag LOCUS_34640 28320 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 28726 30642 gene locus_tag LOCUS_34650 gene thrS 28726 30642 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_34650 30735 31190 gene locus_tag LOCUS_34660 gene infC 30735 31190 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_34660 31299 31496 gene locus_tag LOCUS_34670 gene rpmI 31299 31496 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191477.1 protein_id gnl|my_center|LOCUS_34670 31508 31867 gene locus_tag LOCUS_34680 gene rplT 31508 31867 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_34680 31920 32966 gene locus_tag LOCUS_34690 gene pheS 31920 32966 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_34690 32995 35370 gene locus_tag LOCUS_34700 gene pheT 32995 35370 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_34700 35380 35682 gene locus_tag LOCUS_34710 35380 35682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 35663 36031 gene locus_tag LOCUS_34720 35663 36031 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 protein_id gnl|my_center|LOCUS_34720 36064 36140 gene locus_tag LOCUS_t00390 36064 36140 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 36420 36142 gene locus_tag LOCUS_34730 36420 36142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 36355 37323 gene locus_tag LOCUS_34740 36355 37323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence45 810 238 gene locus_tag LOCUS_34750 810 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1412 807 gene locus_tag LOCUS_34760 1412 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1990 1409 gene locus_tag LOCUS_34770 1990 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2850 1996 gene locus_tag LOCUS_34780 2850 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 4531 2831 gene locus_tag LOCUS_34790 4531 2831 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_34790 5730 4528 gene locus_tag LOCUS_34800 5730 4528 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_34800 6270 5749 gene locus_tag LOCUS_34810 gene gspG 6270 5749 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_34810 7779 6559 gene locus_tag LOCUS_34820 7779 6559 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_34820 7702 7914 gene locus_tag LOCUS_34830 7702 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 8431 9423 gene locus_tag LOCUS_34840 8431 9423 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_34840 9496 10212 gene locus_tag LOCUS_34850 9496 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 10233 11408 gene locus_tag LOCUS_34860 10233 11408 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_34860 12650 11457 gene locus_tag LOCUS_34870 12650 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 12819 13397 gene locus_tag LOCUS_34880 12819 13397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 13421 13687 gene locus_tag LOCUS_34890 13421 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 14231 14674 gene locus_tag LOCUS_34900 14231 14674 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970313.1 protein_id gnl|my_center|LOCUS_34900 15405 17042 gene locus_tag LOCUS_34910 15405 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 17110 17835 gene locus_tag LOCUS_34920 17110 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 18185 19795 gene locus_tag LOCUS_34930 18185 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 19862 20581 gene locus_tag LOCUS_34940 19862 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 20928 22634 gene locus_tag LOCUS_34950 20928 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 22702 23430 gene locus_tag LOCUS_34960 22702 23430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 23518 24222 gene locus_tag LOCUS_34970 23518 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 24608 24919 gene locus_tag LOCUS_34980 24608 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 24906 25709 gene locus_tag LOCUS_34990 24906 25709 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_34990 25685 26812 gene locus_tag LOCUS_35000 gene eboE 25685 26812 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_35000 26790 28160 gene locus_tag LOCUS_35010 26790 28160 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_35010 28164 28871 gene locus_tag LOCUS_35020 28164 28871 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176762490.1 protein_id gnl|my_center|LOCUS_35020 29029 30021 gene locus_tag LOCUS_35030 29029 30021 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_35030 30026 30928 gene locus_tag LOCUS_35040 30026 30928 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_35040 30931 31509 gene locus_tag LOCUS_35050 30931 31509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 31509 32528 gene locus_tag LOCUS_35060 31509 32528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 32530 33501 gene locus_tag LOCUS_35070 32530 33501 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_35070 33501 34307 gene locus_tag LOCUS_35080 33501 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 34348 35706 gene locus_tag LOCUS_35090 34348 35706 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986875.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence46 309 1169 gene locus_tag LOCUS_35100 309 1169 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_35100 1169 1735 gene locus_tag LOCUS_35110 gene ruvC 1169 1735 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_35110 1749 2324 gene locus_tag LOCUS_35120 gene ruvA 1749 2324 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_35120 2332 3411 gene locus_tag LOCUS_35130 2332 3411 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 protein_id gnl|my_center|LOCUS_35130 3408 4472 gene locus_tag LOCUS_35140 gene ruvB 3408 4472 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_35140 4450 4983 gene locus_tag LOCUS_35150 gene ybgC 4450 4983 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 protein_id gnl|my_center|LOCUS_35150 4980 5657 gene locus_tag LOCUS_35160 gene tolQ 4980 5657 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_35160 5662 6066 gene locus_tag LOCUS_35170 gene tolR 5662 6066 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_35170 6078 7178 gene locus_tag LOCUS_35180 6078 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 7221 8120 gene locus_tag LOCUS_35190 7221 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 8235 9527 gene locus_tag LOCUS_35200 gene tolB 8235 9527 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_35200 9567 10094 gene locus_tag LOCUS_35210 9567 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 10096 10890 gene locus_tag LOCUS_35220 gene ybgF 10096 10890 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_35220 10895 11554 gene locus_tag LOCUS_35230 gene queE 10895 11554 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_35230 11790 12500 gene locus_tag LOCUS_35240 gene queC 11790 12500 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_35240 12509 13612 gene locus_tag LOCUS_35250 12509 13612 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_35250 14951 13575 gene locus_tag LOCUS_35260 14951 13575 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_35260 15369 16055 gene locus_tag LOCUS_35270 15369 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 18575 16095 gene locus_tag LOCUS_35280 gene plsB 18575 16095 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113856.1 protein_id gnl|my_center|LOCUS_35280 20648 18600 gene locus_tag LOCUS_35290 gene fusA 20648 18600 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_35290 20862 23150 gene locus_tag LOCUS_35300 20862 23150 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_35300 23410 25131 gene locus_tag LOCUS_35310 gene pilB 23410 25131 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_35310 25145 26383 gene locus_tag LOCUS_35320 gene pilG 25145 26383 CDS product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689811.1 protein_id gnl|my_center|LOCUS_35320 26383 27243 gene locus_tag LOCUS_35330 26383 27243 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_35330 27350 27670 gene locus_tag LOCUS_35340 27350 27670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 27655 28305 gene locus_tag LOCUS_35350 27655 28305 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_35350 28327 30129 gene locus_tag LOCUS_35360 gene aspS 28327 30129 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_35360 30130 30531 gene locus_tag LOCUS_35370 30130 30531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 30534 30977 gene locus_tag LOCUS_35380 30534 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 30974 31423 gene locus_tag LOCUS_35390 gene nudB 30974 31423 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_35390 32370 31606 gene locus_tag LOCUS_35400 32370 31606 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_35400 33206 32367 gene locus_tag LOCUS_35410 33206 32367 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_35410 33549 33289 gene locus_tag LOCUS_35420 33549 33289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_35420 >Feature sequence47 282 1019 gene locus_tag LOCUS_35430 282 1019 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811686.1 protein_id gnl|my_center|LOCUS_35430 1022 1450 gene locus_tag LOCUS_35440 1022 1450 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_35440 2813 1491 gene locus_tag LOCUS_35450 gene hslU 2813 1491 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 protein_id gnl|my_center|LOCUS_35450 3361 2825 gene locus_tag LOCUS_35460 gene hslV 3361 2825 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_35460 4627 3383 gene locus_tag LOCUS_35470 4627 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 4935 5486 gene locus_tag LOCUS_35480 4935 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35480 5611 6777 gene locus_tag LOCUS_35490 5611 6777 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_35490 6781 7506 gene locus_tag LOCUS_35500 6781 7506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_35500 7488 8696 gene locus_tag LOCUS_35510 7488 8696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_35510 8715 9920 gene locus_tag LOCUS_35520 8715 9920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_35520 9989 10600 gene locus_tag LOCUS_35530 9989 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 10655 11011 gene locus_tag LOCUS_35540 gene arsC 10655 11011 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_35540 12940 11093 gene locus_tag LOCUS_35550 12940 11093 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820957.1 protein_id gnl|my_center|LOCUS_35550 13702 13187 gene locus_tag LOCUS_35560 13702 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 13947 15002 gene locus_tag LOCUS_35570 gene tdt 13947 15002 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870080.1 protein_id gnl|my_center|LOCUS_35570 15041 15982 gene locus_tag LOCUS_35580 15041 15982 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_35580 15989 16441 gene locus_tag LOCUS_35590 gene dtd 15989 16441 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_35590 16592 16517 gene locus_tag LOCUS_t00400 16592 16517 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16692 16617 gene locus_tag LOCUS_t00410 16692 16617 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18205 16787 gene locus_tag LOCUS_35600 gene gltX 18205 16787 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_35600 18400 19947 gene locus_tag LOCUS_35610 gene ggt 18400 19947 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083412.1 protein_id gnl|my_center|LOCUS_35610 20181 20375 gene locus_tag LOCUS_35620 20181 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 20398 21456 gene locus_tag LOCUS_35630 gene wlbA 20398 21456 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_35630 21459 22034 gene locus_tag LOCUS_35640 gene wlbB 21459 22034 CDS product O-antigen biosynthesis protein WlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807114.1 protein_id gnl|my_center|LOCUS_35640 22031 23101 gene locus_tag LOCUS_35650 22031 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 23252 23560 gene locus_tag LOCUS_35660 23252 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 23828 23634 gene locus_tag LOCUS_35670 23828 23634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 23859 25121 gene locus_tag LOCUS_35680 gene wlbC 23859 25121 CDS product O-antigen biosynthesis protein WlbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_35680 25118 26239 gene locus_tag LOCUS_35690 gene wlbD 25118 26239 CDS product O-antigen biosynthesis protein WlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447875.1 protein_id gnl|my_center|LOCUS_35690 26236 27177 gene locus_tag LOCUS_35700 26236 27177 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_35700 27190 28125 gene locus_tag LOCUS_35710 27190 28125 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038685.1 protein_id gnl|my_center|LOCUS_35710 28141 29199 gene locus_tag LOCUS_35720 28141 29199 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447870.1 protein_id gnl|my_center|LOCUS_35720 29402 29136 gene locus_tag LOCUS_35730 29402 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 29298 30185 gene locus_tag LOCUS_35740 29298 30185 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_35740 30182 30991 gene locus_tag LOCUS_35750 30182 30991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362627.1 protein_id gnl|my_center|LOCUS_35750 30984 32441 gene locus_tag LOCUS_35760 30984 32441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 32446 33639 gene locus_tag LOCUS_35770 32446 33639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence48 1141 3357 gene locus_tag LOCUS_35780 1141 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4256 5239 gene locus_tag LOCUS_35790 4256 5239 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947898.1 protein_id gnl|my_center|LOCUS_35790 5236 5742 gene locus_tag LOCUS_35800 5236 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 5839 6519 gene locus_tag LOCUS_35810 5839 6519 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 protein_id gnl|my_center|LOCUS_35810 6525 7037 gene locus_tag LOCUS_35820 6525 7037 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_35820 7137 7346 gene locus_tag LOCUS_35830 7137 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 7348 8220 gene locus_tag LOCUS_35840 7348 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 9023 8328 gene locus_tag LOCUS_35850 9023 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 11328 9223 gene locus_tag LOCUS_35860 11328 9223 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060825866.1 protein_id gnl|my_center|LOCUS_35860 11816 12055 gene locus_tag LOCUS_35870 gene hfq 11816 12055 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_35870 12172 13344 gene locus_tag LOCUS_35880 gene hflX 12172 13344 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_35880 13365 14636 gene locus_tag LOCUS_35890 gene hflK 13365 14636 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_35890 14636 15526 gene locus_tag LOCUS_35900 gene hflC 14636 15526 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_35900 15523 15708 gene locus_tag LOCUS_35910 15523 15708 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193501.1 protein_id gnl|my_center|LOCUS_35910 15705 16868 gene locus_tag LOCUS_35920 15705 16868 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_35920 16868 18175 gene locus_tag LOCUS_35930 16868 18175 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_35930 18348 19376 gene locus_tag LOCUS_35940 18348 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 19521 20006 gene locus_tag LOCUS_35950 19521 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 20094 20543 gene locus_tag LOCUS_35960 gene ybaK 20094 20543 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_35960 22915 20615 gene locus_tag LOCUS_35970 22915 20615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 23515 24342 gene locus_tag LOCUS_35980 23515 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 24431 26209 gene locus_tag LOCUS_35990 24431 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 26370 28196 gene locus_tag LOCUS_36000 26370 28196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_36000 28216 29283 gene locus_tag LOCUS_36010 28216 29283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 29419 29889 gene locus_tag LOCUS_36020 29419 29889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 30027 31448 gene locus_tag LOCUS_36030 30027 31448 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_36030 31432 32505 gene locus_tag LOCUS_36040 31432 32505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 32527 33510 gene locus_tag LOCUS_36050 32527 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence49 2630 1083 gene locus_tag LOCUS_36060 2630 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 2939 3748 gene locus_tag LOCUS_36070 2939 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 4859 3882 gene locus_tag LOCUS_36080 4859 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 5354 6949 gene locus_tag LOCUS_36090 5354 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 7180 8640 gene locus_tag LOCUS_36100 7180 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 8660 9589 gene locus_tag LOCUS_36110 8660 9589 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814066.1 protein_id gnl|my_center|LOCUS_36110 9576 13565 gene locus_tag LOCUS_36120 9576 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 14127 13597 gene locus_tag LOCUS_36130 14127 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 14585 15394 gene locus_tag LOCUS_36140 14585 15394 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_36140 16686 15508 gene locus_tag LOCUS_36150 16686 15508 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064994.1 protein_id gnl|my_center|LOCUS_36150 17872 16712 gene locus_tag LOCUS_36160 17872 16712 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_36160 18141 18653 gene locus_tag LOCUS_36170 18141 18653 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_36170 19464 18700 gene locus_tag LOCUS_36180 19464 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 19747 19935 gene locus_tag LOCUS_36190 19747 19935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 19970 20128 gene locus_tag LOCUS_36200 19970 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 20125 20403 gene locus_tag LOCUS_36210 20125 20403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 20823 20551 gene locus_tag LOCUS_36220 20823 20551 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_36220 21106 20807 gene locus_tag LOCUS_36230 21106 20807 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_36230 21835 23577 gene locus_tag LOCUS_36240 21835 23577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 23785 24192 gene locus_tag LOCUS_36250 23785 24192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 24102 26102 gene locus_tag LOCUS_36260 24102 26102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 26449 26682 gene locus_tag LOCUS_36270 26449 26682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 26838 27029 gene locus_tag LOCUS_36280 26838 27029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 27052 28143 gene locus_tag LOCUS_36290 27052 28143 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 protein_id gnl|my_center|LOCUS_36290 28140 31202 gene locus_tag LOCUS_36300 28140 31202 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_36300 31605 31868 gene locus_tag LOCUS_36310 31605 31868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 31973 32704 gene locus_tag LOCUS_36320 31973 32704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence50 106 1053 gene locus_tag LOCUS_36330 106 1053 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086271.1 protein_id gnl|my_center|LOCUS_36330 1204 1737 gene locus_tag LOCUS_36340 1204 1737 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_36340 1734 2039 gene locus_tag LOCUS_36350 1734 2039 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_36350 2036 2353 gene locus_tag LOCUS_36360 2036 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 2401 3195 gene locus_tag LOCUS_36370 2401 3195 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_36370 7313 3294 gene locus_tag LOCUS_36380 gene purL 7313 3294 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527208.1 protein_id gnl|my_center|LOCUS_36380 7528 9039 gene locus_tag LOCUS_36390 7528 9039 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_36390 9029 9904 gene locus_tag LOCUS_36400 9029 9904 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_36400 11343 10045 gene locus_tag LOCUS_36410 11343 10045 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973503.1 protein_id gnl|my_center|LOCUS_36410 11999 11340 gene locus_tag LOCUS_36420 11999 11340 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339032.1 protein_id gnl|my_center|LOCUS_36420 12176 13846 gene locus_tag LOCUS_36430 12176 13846 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 protein_id gnl|my_center|LOCUS_36430 13843 14556 gene locus_tag LOCUS_36440 13843 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 15593 14616 gene locus_tag LOCUS_36450 15593 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 15789 16241 gene locus_tag LOCUS_36460 15789 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 16467 16324 gene locus_tag LOCUS_36470 16467 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 17037 19247 gene locus_tag LOCUS_36480 17037 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 19546 20928 gene locus_tag LOCUS_36490 19546 20928 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_36490 20978 23101 gene locus_tag LOCUS_36500 gene prsK 20978 23101 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_36500 23098 24456 gene locus_tag LOCUS_36510 gene prsR 23098 24456 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_36510 24518 27283 gene locus_tag LOCUS_36520 gene prsT 24518 27283 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390845.1 protein_id gnl|my_center|LOCUS_36520 27331 28611 gene locus_tag LOCUS_36530 27331 28611 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_36530 28599 29669 gene locus_tag LOCUS_36540 28599 29669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930472.1 protein_id gnl|my_center|LOCUS_36540 29669 30595 gene locus_tag LOCUS_36550 29669 30595 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704890.1 protein_id gnl|my_center|LOCUS_36550 30598 31386 gene locus_tag LOCUS_36560 30598 31386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 32294 32698 gene locus_tag LOCUS_36570 32294 32698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 >Feature sequence51 1472 234 gene locus_tag LOCUS_36580 1472 234 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_36580 2756 1590 gene locus_tag LOCUS_36590 gene metK 2756 1590 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_36590 2976 3839 gene locus_tag LOCUS_36600 2976 3839 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_36600 3892 5013 gene locus_tag LOCUS_36610 3892 5013 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_36610 5010 5834 gene locus_tag LOCUS_36620 gene rfaP 5010 5834 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_36620 5831 6598 gene locus_tag LOCUS_36630 5831 6598 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_36630 6640 8076 gene locus_tag LOCUS_36640 6640 8076 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_36640 9929 8118 gene locus_tag LOCUS_36650 gene msbA 9929 8118 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_36650 10416 10216 gene locus_tag LOCUS_36660 10416 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 11279 10713 gene locus_tag LOCUS_36670 11279 10713 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_36670 11708 12094 gene locus_tag LOCUS_36680 gene crcB 11708 12094 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_36680 12400 12176 gene locus_tag LOCUS_36690 12400 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 13247 12516 gene locus_tag LOCUS_36700 13247 12516 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266464.1 protein_id gnl|my_center|LOCUS_36700 13964 13281 gene locus_tag LOCUS_36710 13964 13281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739535.1 protein_id gnl|my_center|LOCUS_36710 14348 15256 gene locus_tag LOCUS_36720 14348 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 16408 15290 gene locus_tag LOCUS_36730 gene proB 16408 15290 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_36730 17517 16411 gene locus_tag LOCUS_36740 gene obgE 17517 16411 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_36740 17888 17625 gene locus_tag LOCUS_36750 gene rpmA 17888 17625 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_36750 18243 17908 gene locus_tag LOCUS_36760 gene rplU 18243 17908 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_36760 18407 19375 gene locus_tag LOCUS_36770 gene ispB 18407 19375 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_36770 19394 19470 gene locus_tag LOCUS_t00420 19394 19470 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19611 19838 gene locus_tag LOCUS_36780 19611 19838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 19845 21431 gene locus_tag LOCUS_36790 19845 21431 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946907.1 protein_id gnl|my_center|LOCUS_36790 21425 22795 gene locus_tag LOCUS_36800 21425 22795 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_36800 22792 23373 gene locus_tag LOCUS_36810 gene ampD 22792 23373 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_36810 24524 23424 gene locus_tag LOCUS_36820 24524 23424 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_36820 26528 24690 gene locus_tag LOCUS_36830 26528 24690 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_36830 26886 29186 gene locus_tag LOCUS_36840 26886 29186 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_36840 29409 30647 gene locus_tag LOCUS_36850 gene pbpG 29409 30647 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557110.1 protein_id gnl|my_center|LOCUS_36850 30965 31435 gene locus_tag LOCUS_36860 30965 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 31464 32621 gene locus_tag LOCUS_36870 31464 32621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_36870 >Feature sequence52 252 1595 gene locus_tag LOCUS_36880 252 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1904 8923 gene locus_tag LOCUS_36890 1904 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 9073 9297 gene locus_tag LOCUS_36900 9073 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 9481 10008 gene locus_tag LOCUS_36910 9481 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920888.1 protein_id gnl|my_center|LOCUS_36910 10136 10939 gene locus_tag LOCUS_36920 10136 10939 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387737.1 protein_id gnl|my_center|LOCUS_36920 12091 11162 gene locus_tag LOCUS_36930 12091 11162 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_36930 13305 12088 gene locus_tag LOCUS_36940 13305 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 14279 13290 gene locus_tag LOCUS_36950 14279 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 14899 14276 gene locus_tag LOCUS_36960 14899 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 16458 14896 gene locus_tag LOCUS_36970 16458 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 17597 16455 gene locus_tag LOCUS_36980 17597 16455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 18643 17720 gene locus_tag LOCUS_36990 18643 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 19848 18640 gene locus_tag LOCUS_37000 19848 18640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_37000 20659 19838 gene locus_tag LOCUS_37010 20659 19838 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_37010 21194 21619 gene locus_tag LOCUS_37020 21194 21619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 21686 23422 gene locus_tag LOCUS_37030 21686 23422 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_37030 23438 25174 gene locus_tag LOCUS_37040 gene aprD 23438 25174 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_37040 25197 26561 gene locus_tag LOCUS_37050 25197 26561 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_37050 26564 27892 gene locus_tag LOCUS_37060 26564 27892 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 protein_id gnl|my_center|LOCUS_37060 >Feature sequence53 990 529 gene locus_tag LOCUS_37070 990 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37070 1517 1281 gene locus_tag LOCUS_37080 1517 1281 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_37080 3001 1559 gene locus_tag LOCUS_37090 3001 1559 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_37090 2936 3202 gene locus_tag LOCUS_37100 2936 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3756 3535 gene locus_tag LOCUS_37110 3756 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 4513 3848 gene locus_tag LOCUS_37120 4513 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 5430 4510 gene locus_tag LOCUS_37130 5430 4510 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456728.1 protein_id gnl|my_center|LOCUS_37130 6417 5776 gene locus_tag LOCUS_37140 6417 5776 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_37140 6597 6521 gene locus_tag LOCUS_t00430 6597 6521 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9392 6744 gene locus_tag LOCUS_37150 gene pepN 9392 6744 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_37150 10077 9445 gene locus_tag LOCUS_37160 10077 9445 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_37160 11002 10109 gene locus_tag LOCUS_37170 gene prmB 11002 10109 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_37170 12161 10995 gene locus_tag LOCUS_37180 gene dapE 12161 10995 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812538.1 protein_id gnl|my_center|LOCUS_37180 13357 12176 gene locus_tag LOCUS_37190 13357 12176 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_37190 14214 13393 gene locus_tag LOCUS_37200 gene dapD 14214 13393 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_37200 15419 14226 gene locus_tag LOCUS_37210 gene dapC 15419 14226 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_37210 16344 15619 gene locus_tag LOCUS_37220 16344 15619 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_37220 16768 16322 gene locus_tag LOCUS_37230 16768 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 16955 20461 gene locus_tag LOCUS_37240 gene smc 16955 20461 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198894.1 protein_id gnl|my_center|LOCUS_37240 20470 21669 gene locus_tag LOCUS_37250 20470 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 21687 23708 gene locus_tag LOCUS_37260 gene ligA 21687 23708 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_37260 23794 24342 gene locus_tag LOCUS_37270 23794 24342 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694420.1 protein_id gnl|my_center|LOCUS_37270 24344 25087 gene locus_tag LOCUS_37280 24344 25087 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_37280 25101 25613 gene locus_tag LOCUS_37290 gene def 25101 25613 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_37290 25698 26213 gene locus_tag LOCUS_37300 25698 26213 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_37300 27271 26315 gene locus_tag LOCUS_37310 27271 26315 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 protein_id gnl|my_center|LOCUS_37310 27658 27275 gene locus_tag LOCUS_37320 27658 27275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence54 1390 611 gene locus_tag LOCUS_37330 1390 611 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_37330 2185 1772 gene locus_tag LOCUS_37340 2185 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 3072 2182 gene locus_tag LOCUS_37350 3072 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 3506 3165 gene locus_tag LOCUS_37360 3506 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 5503 3521 gene locus_tag LOCUS_37370 5503 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 9196 5519 gene locus_tag LOCUS_37380 9196 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 9677 10276 gene locus_tag LOCUS_37390 9677 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 11655 10270 gene locus_tag LOCUS_37400 11655 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 12368 12595 gene locus_tag LOCUS_37410 12368 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 12634 12933 gene locus_tag LOCUS_37420 12634 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 13368 13565 gene locus_tag LOCUS_37430 13368 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 13562 13933 gene locus_tag LOCUS_37440 13562 13933 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968151.1 protein_id gnl|my_center|LOCUS_37440 14519 14749 gene locus_tag LOCUS_37450 14519 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 14746 15258 gene locus_tag LOCUS_37460 14746 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 15371 15712 gene locus_tag LOCUS_37470 15371 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 15986 15744 gene locus_tag LOCUS_37480 15986 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 16744 15983 gene locus_tag LOCUS_37490 16744 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 18230 16731 gene locus_tag LOCUS_37500 18230 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 19137 19364 gene locus_tag LOCUS_37510 19137 19364 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_37510 19987 19721 gene locus_tag LOCUS_37520 19987 19721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 20261 19980 gene locus_tag LOCUS_37530 20261 19980 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_37530 20580 21173 gene locus_tag LOCUS_37540 20580 21173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 21170 21814 gene locus_tag LOCUS_37550 21170 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 22756 21902 gene locus_tag LOCUS_37560 22756 21902 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_37560 <24938 22851 gene locus_tag LOCUS_37570 <24938 22851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084743078.1:RHS repeat-associated core domain-containing protein >Feature sequence55 <1 1527 gene locus_tag LOCUS_37580 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201854.1:S41 family peptidase 2010 1855 gene locus_tag LOCUS_37590 2010 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 2323 1994 gene locus_tag LOCUS_37600 2323 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 2707 3327 gene locus_tag LOCUS_37610 2707 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 5712 3538 gene locus_tag LOCUS_37620 5712 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 6513 5722 gene locus_tag LOCUS_37630 6513 5722 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_37630 7952 6828 gene locus_tag LOCUS_37640 7952 6828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 protein_id gnl|my_center|LOCUS_37640 10728 7957 gene locus_tag LOCUS_37650 gene rbbA 10728 7957 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 protein_id gnl|my_center|LOCUS_37650 11798 10725 gene locus_tag LOCUS_37660 11798 10725 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_37660 13591 12125 gene locus_tag LOCUS_37670 13591 12125 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_37670 15171 13822 gene locus_tag LOCUS_37680 15171 13822 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 protein_id gnl|my_center|LOCUS_37680 15800 15252 gene locus_tag LOCUS_37690 15800 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 15889 16188 gene locus_tag LOCUS_37700 15889 16188 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_37700 16293 17195 gene locus_tag LOCUS_37710 16293 17195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37710 17850 17344 gene locus_tag LOCUS_37720 17850 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 18309 19019 gene locus_tag LOCUS_37730 18309 19019 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_37730 19000 19647 gene locus_tag LOCUS_37740 19000 19647 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 protein_id gnl|my_center|LOCUS_37740 19635 20435 gene locus_tag LOCUS_37750 19635 20435 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_37750 21125 20739 gene locus_tag LOCUS_37760 21125 20739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 21870 21256 gene locus_tag LOCUS_37770 21870 21256 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_37770 22580 21948 gene locus_tag LOCUS_37780 22580 21948 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192730530.1 protein_id gnl|my_center|LOCUS_37780 22716 23153 gene locus_tag LOCUS_37790 22716 23153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 23870 23139 gene locus_tag LOCUS_37800 23870 23139 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence56 766 1629 gene locus_tag LOCUS_37810 766 1629 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_37810 1736 2611 gene locus_tag LOCUS_37820 1736 2611 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_37820 2684 3526 gene locus_tag LOCUS_37830 2684 3526 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403550.1 protein_id gnl|my_center|LOCUS_37830 3523 4338 gene locus_tag LOCUS_37840 gene phnE 3523 4338 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_37840 4461 5132 gene locus_tag LOCUS_37850 4461 5132 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_37850 5129 6223 gene locus_tag LOCUS_37860 5129 6223 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085209.1 protein_id gnl|my_center|LOCUS_37860 6220 9330 gene locus_tag LOCUS_37870 gene mexK 6220 9330 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_37870 10810 9335 gene locus_tag LOCUS_37880 10810 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37880 11367 10705 gene locus_tag LOCUS_37890 11367 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37890 11326 11751 gene locus_tag LOCUS_37900 11326 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 12195 11818 gene locus_tag LOCUS_37910 12195 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 12790 12239 gene locus_tag LOCUS_37920 12790 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 13634 16315 gene locus_tag LOCUS_37930 gene ptsP 13634 16315 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256695.1 protein_id gnl|my_center|LOCUS_37930 16200 16937 gene locus_tag LOCUS_37940 16200 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 16957 18723 gene locus_tag LOCUS_37950 gene fruA 16957 18723 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684711.1 protein_id gnl|my_center|LOCUS_37950 18914 20248 gene locus_tag LOCUS_37960 18914 20248 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 protein_id gnl|my_center|LOCUS_37960 22221 20257 gene locus_tag LOCUS_37970 gene glgB 22221 20257 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_37970 >Feature sequence57 3399 2011 gene locus_tag LOCUS_37980 3399 2011 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_37980 5774 3420 gene locus_tag LOCUS_37990 5774 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 7471 5771 gene locus_tag LOCUS_38000 7471 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 7421 7573 gene locus_tag LOCUS_38010 7421 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 7711 7896 gene locus_tag LOCUS_38020 7711 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 7993 8475 gene locus_tag LOCUS_38030 7993 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 9005 9883 gene locus_tag LOCUS_38040 9005 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 10026 10370 gene locus_tag LOCUS_38050 10026 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 15306 10831 gene locus_tag LOCUS_38060 15306 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 16111 15599 gene locus_tag LOCUS_38070 16111 15599 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_38070 16437 16090 gene locus_tag LOCUS_38080 16437 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 16718 16978 gene locus_tag LOCUS_38090 16718 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 17696 18838 gene locus_tag LOCUS_38100 17696 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 18861 20384 gene locus_tag LOCUS_38110 18861 20384 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_38110 20381 20641 gene locus_tag LOCUS_38120 20381 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 20638 21498 gene locus_tag LOCUS_38130 20638 21498 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_38130 21743 21522 gene locus_tag LOCUS_38140 21743 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 >Feature sequence58 110 310 gene locus_tag LOCUS_38150 110 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 316 540 gene locus_tag LOCUS_38160 316 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 615 1220 gene locus_tag LOCUS_38170 615 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 1236 1736 gene locus_tag LOCUS_38180 1236 1736 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_38180 2683 1832 gene locus_tag LOCUS_38190 2683 1832 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528382.1 protein_id gnl|my_center|LOCUS_38190 3419 2676 gene locus_tag LOCUS_38200 gene narI 3419 2676 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528383.1 protein_id gnl|my_center|LOCUS_38200 4150 3416 gene locus_tag LOCUS_38210 gene narJ 4150 3416 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 protein_id gnl|my_center|LOCUS_38210 5688 4153 gene locus_tag LOCUS_38220 gene narH 5688 4153 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_38220 9503 5685 gene locus_tag LOCUS_38230 9503 5685 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 protein_id gnl|my_center|LOCUS_38230 11223 9550 gene locus_tag LOCUS_38240 11223 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 12565 11294 gene locus_tag LOCUS_38250 12565 11294 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_38250 12918 14651 gene locus_tag LOCUS_38260 gene nirS 12918 14651 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_38260 14770 15075 gene locus_tag LOCUS_38270 gene nirM 14770 15075 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_38270 15318 15602 gene locus_tag LOCUS_38280 15318 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38280 15687 16472 gene locus_tag LOCUS_38290 15687 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 16813 17049 gene locus_tag LOCUS_38300 16813 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 17046 17261 gene locus_tag LOCUS_38310 17046 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 17258 18322 gene locus_tag LOCUS_38320 17258 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 18800 18970 gene locus_tag LOCUS_38330 18800 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38330 19011 19310 gene locus_tag LOCUS_38340 19011 19310 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_38340 19340 19684 gene locus_tag LOCUS_38350 19340 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 19746 19946 gene locus_tag LOCUS_38360 19746 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 19943 20383 gene locus_tag LOCUS_38370 19943 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence59 380 2602 gene locus_tag LOCUS_38380 380 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 2593 3810 gene locus_tag LOCUS_38390 2593 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 3807 4211 gene locus_tag LOCUS_38400 3807 4211 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_38400 4201 5592 gene locus_tag LOCUS_38410 4201 5592 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_38410 5611 8727 gene locus_tag LOCUS_38420 5611 8727 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_38420 8724 9443 gene locus_tag LOCUS_38430 8724 9443 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_38430 10254 9961 gene locus_tag LOCUS_38440 10254 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 10236 11192 gene locus_tag LOCUS_38450 10236 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 11441 11800 gene locus_tag LOCUS_38460 11441 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 12226 16965 gene locus_tag LOCUS_38470 12226 16965 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975001.1 protein_id gnl|my_center|LOCUS_38470 18929 17139 gene locus_tag LOCUS_38480 gene kefC 18929 17139 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368295.1 protein_id gnl|my_center|LOCUS_38480 19467 18922 gene locus_tag LOCUS_38490 gene kefF 19467 18922 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600696.1 protein_id gnl|my_center|LOCUS_38490 19786 19983 gene locus_tag LOCUS_38500 19786 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 >Feature sequence60 517 1050 gene locus_tag LOCUS_38510 517 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 1044 1487 gene locus_tag LOCUS_38520 1044 1487 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_38520 1490 2200 gene locus_tag LOCUS_38530 1490 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 2419 3459 gene locus_tag LOCUS_38540 2419 3459 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 protein_id gnl|my_center|LOCUS_38540 3807 4934 gene locus_tag LOCUS_38550 3807 4934 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999116.1 protein_id gnl|my_center|LOCUS_38550 6054 5341 gene locus_tag LOCUS_38560 6054 5341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_38560 6806 6051 gene locus_tag LOCUS_38570 6806 6051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_38570 7746 6799 gene locus_tag LOCUS_38580 7746 6799 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_38580 8660 7746 gene locus_tag LOCUS_38590 8660 7746 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_38590 9930 8764 gene locus_tag LOCUS_38600 9930 8764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_38600 11235 10051 gene locus_tag LOCUS_38610 11235 10051 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_38610 11671 12543 gene locus_tag LOCUS_38620 11671 12543 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_38620 12536 14632 gene locus_tag LOCUS_38630 12536 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 14856 17177 gene locus_tag LOCUS_38640 14856 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 17386 17222 gene locus_tag LOCUS_38650 17386 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 17625 17386 gene locus_tag LOCUS_38660 17625 17386 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_38660 18079 17648 gene locus_tag LOCUS_38670 18079 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 18583 18398 gene locus_tag LOCUS_38680 18583 18398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 >Feature sequence61 1065 2252 gene locus_tag LOCUS_38690 1065 2252 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525685.1 protein_id gnl|my_center|LOCUS_38690 3052 2348 gene locus_tag LOCUS_38700 3052 2348 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_38700 4255 3086 gene locus_tag LOCUS_38710 4255 3086 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527797.1 protein_id gnl|my_center|LOCUS_38710 4341 4742 gene locus_tag LOCUS_38720 4341 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 5151 4834 gene locus_tag LOCUS_38730 5151 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 6144 5200 gene locus_tag LOCUS_38740 gene hprK 6144 5200 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_38740 6593 6141 gene locus_tag LOCUS_38750 6593 6141 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 protein_id gnl|my_center|LOCUS_38750 7021 6695 gene locus_tag LOCUS_38760 gene raiA 7021 6695 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_38760 8460 7039 gene locus_tag LOCUS_38770 8460 7039 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_38770 9276 8542 gene locus_tag LOCUS_38780 gene lptB 9276 8542 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_38780 9731 9282 gene locus_tag LOCUS_38790 9731 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 10758 9742 gene locus_tag LOCUS_38800 gene recA 10758 9742 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_38800 12740 10923 gene locus_tag LOCUS_38810 12740 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 13374 12865 gene locus_tag LOCUS_38820 gene pncC 13374 12865 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005019686.1 protein_id gnl|my_center|LOCUS_38820 13856 13371 gene locus_tag LOCUS_38830 13856 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 14802 13849 gene locus_tag LOCUS_38840 gene thiL 14802 13849 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_38840 15341 14847 gene locus_tag LOCUS_38850 gene nusB 15341 14847 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185707.1 protein_id gnl|my_center|LOCUS_38850 15856 15341 gene locus_tag LOCUS_38860 gene ribH 15856 15341 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_38860 16989 15856 gene locus_tag LOCUS_38870 gene ribBA 16989 15856 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 protein_id gnl|my_center|LOCUS_38870 >Feature sequence62 696 217 gene locus_tag LOCUS_38880 696 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 984 2291 gene locus_tag LOCUS_38890 gene rlmD 984 2291 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_38890 2874 2317 gene locus_tag LOCUS_38900 2874 2317 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457820.1 protein_id gnl|my_center|LOCUS_38900 4554 2893 gene locus_tag LOCUS_38910 4554 2893 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_38910 5662 5015 gene locus_tag LOCUS_38920 5662 5015 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_38920 7582 5855 gene locus_tag LOCUS_38930 gene recJ 7582 5855 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_38930 8634 7579 gene locus_tag LOCUS_38940 8634 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 8802 10049 gene locus_tag LOCUS_38950 8802 10049 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_38950 10042 10728 gene locus_tag LOCUS_38960 gene lolD 10042 10728 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688655.1 protein_id gnl|my_center|LOCUS_38960 10804 12825 gene locus_tag LOCUS_38970 10804 12825 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966949.1 protein_id gnl|my_center|LOCUS_38970 12889 15204 gene locus_tag LOCUS_38980 12889 15204 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_38980 15207 16007 gene locus_tag LOCUS_38990 15207 16007 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039800.1 protein_id gnl|my_center|LOCUS_38990 17204 16314 gene locus_tag LOCUS_39000 17204 16314 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_39000 17433 17924 gene locus_tag LOCUS_39010 17433 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence63 471 920 gene locus_tag LOCUS_39020 471 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 923 1861 gene locus_tag LOCUS_39030 923 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 2290 2676 gene locus_tag LOCUS_39040 2290 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 2673 4286 gene locus_tag LOCUS_39050 2673 4286 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895701.1 protein_id gnl|my_center|LOCUS_39050 4298 6133 gene locus_tag LOCUS_39060 4298 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 6425 6171 gene locus_tag LOCUS_39070 gene yoeB 6425 6171 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_39070 6673 6422 gene locus_tag LOCUS_39080 gene yefM 6673 6422 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_39080 8658 7150 gene locus_tag LOCUS_39090 gene guaB 8658 7150 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_39090 9245 8883 gene locus_tag LOCUS_39100 9245 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 10075 11154 gene locus_tag LOCUS_39110 10075 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 11188 12612 gene locus_tag LOCUS_39120 11188 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 12644 13276 gene locus_tag LOCUS_39130 12644 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence64 904 110 gene locus_tag LOCUS_39140 904 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39140 1308 1009 gene locus_tag LOCUS_39150 1308 1009 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_39150 1654 2127 gene locus_tag LOCUS_39160 1654 2127 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_39160 2156 3337 gene locus_tag LOCUS_39170 gene coxB 2156 3337 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_39170 3361 4968 gene locus_tag LOCUS_39180 gene ctaD 3361 4968 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_39180 4965 5129 gene locus_tag LOCUS_39190 4965 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 5134 5718 gene locus_tag LOCUS_39200 5134 5718 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_39200 5743 6603 gene locus_tag LOCUS_39210 5743 6603 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948580.1 protein_id gnl|my_center|LOCUS_39210 6791 6591 gene locus_tag LOCUS_39220 6791 6591 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_39220 6865 7593 gene locus_tag LOCUS_39230 6865 7593 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_39230 7604 8200 gene locus_tag LOCUS_39240 7604 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_39240 8214 9110 gene locus_tag LOCUS_39250 gene cyoE 8214 9110 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 protein_id gnl|my_center|LOCUS_39250 10472 9072 gene locus_tag LOCUS_39260 gene mpl 10472 9072 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_39260 10582 11190 gene locus_tag LOCUS_39270 10582 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 protein_id gnl|my_center|LOCUS_39270 11187 11738 gene locus_tag LOCUS_39280 11187 11738 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_39280 11844 12284 gene locus_tag LOCUS_39290 gene aroQ 11844 12284 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_39290 12364 12816 gene locus_tag LOCUS_39300 gene accB 12364 12816 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_39300 12832 14196 gene locus_tag LOCUS_39310 gene accC 12832 14196 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_39310 14213 15103 gene locus_tag LOCUS_39320 gene prmA 14213 15103 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931932.1 protein_id gnl|my_center|LOCUS_39320 15107 16078 gene locus_tag LOCUS_39330 15107 16078 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931242.1 protein_id gnl|my_center|LOCUS_39330 16175 17110 gene locus_tag LOCUS_39340 16175 17110 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_39340 17821 17189 gene locus_tag LOCUS_39350 17821 17189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence65 186 542 gene locus_tag LOCUS_39360 186 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 559 1944 gene locus_tag LOCUS_39370 gene miaB 559 1944 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_39370 1941 2969 gene locus_tag LOCUS_39380 1941 2969 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809398.1 protein_id gnl|my_center|LOCUS_39380 2956 3414 gene locus_tag LOCUS_39390 gene ybeY 2956 3414 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093160.1 protein_id gnl|my_center|LOCUS_39390 4350 3529 gene locus_tag LOCUS_39400 4350 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 5124 5969 gene locus_tag LOCUS_39410 5124 5969 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_39410 6001 7506 gene locus_tag LOCUS_39420 gene lnt 6001 7506 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555980.1 protein_id gnl|my_center|LOCUS_39420 7636 8379 gene locus_tag LOCUS_39430 7636 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 8585 9343 gene locus_tag LOCUS_39440 8585 9343 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_39440 9526 10431 gene locus_tag LOCUS_39450 gene glyQ 9526 10431 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 protein_id gnl|my_center|LOCUS_39450 10433 12505 gene locus_tag LOCUS_39460 gene glyS 10433 12505 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244319.1 protein_id gnl|my_center|LOCUS_39460 12502 13038 gene locus_tag LOCUS_39470 gene gmhB 12502 13038 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_39470 13038 13781 gene locus_tag LOCUS_39480 13038 13781 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814405.1 protein_id gnl|my_center|LOCUS_39480 13765 14529 gene locus_tag LOCUS_39490 13765 14529 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_39490 15161 14634 gene locus_tag LOCUS_39500 15161 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 15431 15165 gene locus_tag LOCUS_39510 15431 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 17197 15428 gene locus_tag LOCUS_39520 gene acsA 17197 15428 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_39520 17579 17244 gene locus_tag LOCUS_39530 17579 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 17481 17738 gene locus_tag LOCUS_39540 17481 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 >Feature sequence66 839 252 gene locus_tag LOCUS_39550 839 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 2765 1251 gene locus_tag LOCUS_39560 2765 1251 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 protein_id gnl|my_center|LOCUS_39560 3379 2762 gene locus_tag LOCUS_39570 3379 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 4389 3376 gene locus_tag LOCUS_39580 4389 3376 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_39580 4574 5749 gene locus_tag LOCUS_39590 4574 5749 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_39590 5770 7101 gene locus_tag LOCUS_39600 gene bioA 5770 7101 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189232.1 protein_id gnl|my_center|LOCUS_39600 7098 8252 gene locus_tag LOCUS_39610 gene bioF 7098 8252 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_39610 8249 9013 gene locus_tag LOCUS_39620 gene bioH 8249 9013 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_39620 8994 9764 gene locus_tag LOCUS_39630 gene bioC 8994 9764 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 protein_id gnl|my_center|LOCUS_39630 9761 10462 gene locus_tag LOCUS_39640 gene bioD 9761 10462 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_39640 11302 10538 gene locus_tag LOCUS_39650 11302 10538 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063819.1 protein_id gnl|my_center|LOCUS_39650 11948 11295 gene locus_tag LOCUS_39660 11948 11295 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 protein_id gnl|my_center|LOCUS_39660 12832 12032 gene locus_tag LOCUS_39670 12832 12032 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_39670 13397 15049 gene locus_tag LOCUS_39680 13397 15049 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_39680 15066 15308 gene locus_tag LOCUS_39690 15066 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 15369 15593 gene locus_tag LOCUS_39700 15369 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 15590 15889 gene locus_tag LOCUS_39710 15590 15889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 16203 17114 gene locus_tag LOCUS_39720 16203 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence67 860 117 gene locus_tag LOCUS_39730 860 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1288 857 gene locus_tag LOCUS_39740 1288 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 1611 1423 gene locus_tag LOCUS_39750 1611 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 1603 1887 gene locus_tag LOCUS_39760 1603 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 2471 2049 gene locus_tag LOCUS_39770 2471 2049 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 protein_id gnl|my_center|LOCUS_39770 2605 3711 gene locus_tag LOCUS_39780 2605 3711 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680822.1 protein_id gnl|my_center|LOCUS_39780 4397 4098 gene locus_tag LOCUS_39790 4397 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 4306 5292 gene locus_tag LOCUS_39800 4306 5292 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_39800 5304 6644 gene locus_tag LOCUS_39810 5304 6644 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413894.1 protein_id gnl|my_center|LOCUS_39810 6949 6641 gene locus_tag LOCUS_39820 6949 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39820 7803 7216 gene locus_tag LOCUS_39830 7803 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 8174 7800 gene locus_tag LOCUS_39840 8174 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 9136 8645 gene locus_tag LOCUS_39850 9136 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 9614 9138 gene locus_tag LOCUS_39860 9614 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 9918 10700 gene locus_tag LOCUS_39870 9918 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 10752 12053 gene locus_tag LOCUS_39880 10752 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 12050 13204 gene locus_tag LOCUS_39890 12050 13204 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097673.1 protein_id gnl|my_center|LOCUS_39890 13201 14460 gene locus_tag LOCUS_39900 13201 14460 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 protein_id gnl|my_center|LOCUS_39900 14704 14877 gene locus_tag LOCUS_39910 14704 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 14906 15829 gene locus_tag LOCUS_39920 gene rocF 14906 15829 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808362.1 protein_id gnl|my_center|LOCUS_39920 16864 15944 gene locus_tag LOCUS_39930 16864 15944 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976366.1 protein_id gnl|my_center|LOCUS_39930 >Feature sequence68 1019 1261 gene locus_tag LOCUS_39940 1019 1261 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_39940 1261 1677 gene locus_tag LOCUS_39950 1261 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 2127 1840 gene locus_tag LOCUS_39960 2127 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 2508 2245 gene locus_tag LOCUS_39970 2508 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 3410 2670 gene locus_tag LOCUS_39980 3410 2670 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_39980 3844 3407 gene locus_tag LOCUS_39990 3844 3407 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_39990 4126 4506 gene locus_tag LOCUS_40000 4126 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 5458 4646 gene locus_tag LOCUS_40010 5458 4646 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_40010 6703 6116 gene locus_tag LOCUS_40020 gene cobO 6703 6116 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_40020 7718 6690 gene locus_tag LOCUS_40030 gene cobD 7718 6690 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_40030 8585 7830 gene locus_tag LOCUS_40040 gene bluB 8585 7830 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_40040 9287 9952 gene locus_tag LOCUS_40050 9287 9952 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40050 9945 13319 gene locus_tag LOCUS_40060 9945 13319 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_40060 13377 13580 gene locus_tag LOCUS_40070 13377 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 13905 13621 gene locus_tag LOCUS_40080 13905 13621 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_40080 14223 13909 gene locus_tag LOCUS_40090 14223 13909 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_40090 14551 16914 gene locus_tag LOCUS_40100 14551 16914 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_40100 >Feature sequence69 5695 143 gene locus_tag LOCUS_40110 5695 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 6841 5870 gene locus_tag LOCUS_40120 6841 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 7262 7516 gene locus_tag LOCUS_40130 7262 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 7988 7581 gene locus_tag LOCUS_40140 gene vapC 7988 7581 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_40140 8245 7985 gene locus_tag LOCUS_40150 8245 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 8305 8613 gene locus_tag LOCUS_40160 8305 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 8732 9361 gene locus_tag LOCUS_40170 8732 9361 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_40170 9453 10493 gene locus_tag LOCUS_40180 9453 10493 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_40180 10776 10453 gene locus_tag LOCUS_40190 10776 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 11369 10875 gene locus_tag LOCUS_40200 11369 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 11677 11363 gene locus_tag LOCUS_40210 11677 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 11925 11749 gene locus_tag LOCUS_40220 11925 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 12591 12016 gene locus_tag LOCUS_40230 12591 12016 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_40230 12863 12588 gene locus_tag LOCUS_40240 12863 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 13706 12930 gene locus_tag LOCUS_40250 13706 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 14075 13728 gene locus_tag LOCUS_40260 14075 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 14888 14154 gene locus_tag LOCUS_40270 14888 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 15412 16143 gene locus_tag LOCUS_40280 15412 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 16199 16594 gene locus_tag LOCUS_40290 16199 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence70 771 418 gene locus_tag LOCUS_40300 771 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 1900 3615 gene locus_tag LOCUS_40310 1900 3615 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_40310 3612 4415 gene locus_tag LOCUS_40320 3612 4415 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085533.1 protein_id gnl|my_center|LOCUS_40320 4422 5195 gene locus_tag LOCUS_40330 4422 5195 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_40330 5291 6445 gene locus_tag LOCUS_40340 5291 6445 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_40340 6608 7642 gene locus_tag LOCUS_40350 6608 7642 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 protein_id gnl|my_center|LOCUS_40350 7639 9411 gene locus_tag LOCUS_40360 7639 9411 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195813.1 protein_id gnl|my_center|LOCUS_40360 9408 10166 gene locus_tag LOCUS_40370 9408 10166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040242.1 protein_id gnl|my_center|LOCUS_40370 10687 10220 gene locus_tag LOCUS_40380 10687 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 10813 11733 gene locus_tag LOCUS_40390 10813 11733 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_40390 13529 11808 gene locus_tag LOCUS_40400 13529 11808 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945060.1 protein_id gnl|my_center|LOCUS_40400 15244 13688 gene locus_tag LOCUS_40410 gene ahpF 15244 13688 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 protein_id gnl|my_center|LOCUS_40410 15934 15371 gene locus_tag LOCUS_40420 gene ahpC 15934 15371 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525522.1 protein_id gnl|my_center|LOCUS_40420 >Feature sequence71 1829 1347 gene locus_tag LOCUS_40430 1829 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 2072 1854 gene locus_tag LOCUS_40440 2072 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 2783 4861 gene locus_tag LOCUS_40450 2783 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 6716 5103 gene locus_tag LOCUS_40460 gene ubiB 6716 5103 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_40460 9963 6793 gene locus_tag LOCUS_40470 9963 6793 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_40470 11633 9999 gene locus_tag LOCUS_40480 11633 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 12901 11630 gene locus_tag LOCUS_40490 12901 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 13416 14099 gene locus_tag LOCUS_40500 13416 14099 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_40500 14090 15532 gene locus_tag LOCUS_40510 gene pcoS 14090 15532 CDS product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 protein_id gnl|my_center|LOCUS_40510 15981 15520 gene locus_tag LOCUS_40520 15981 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 >Feature sequence72 281 81 gene locus_tag LOCUS_40530 281 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 189 2042 gene locus_tag LOCUS_40540 189 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 2968 2093 gene locus_tag LOCUS_40550 2968 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 3351 2965 gene locus_tag LOCUS_40560 3351 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 3676 3900 gene locus_tag LOCUS_40570 3676 3900 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082903.1 protein_id gnl|my_center|LOCUS_40570 3907 4911 gene locus_tag LOCUS_40580 3907 4911 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133548.1 protein_id gnl|my_center|LOCUS_40580 4911 6053 gene locus_tag LOCUS_40590 4911 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 6050 7675 gene locus_tag LOCUS_40600 6050 7675 CDS product E2/UBC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884104.1 protein_id gnl|my_center|LOCUS_40600 7663 8139 gene locus_tag LOCUS_40610 7663 8139 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188927153.1 protein_id gnl|my_center|LOCUS_40610 8589 8900 gene locus_tag LOCUS_40620 8589 8900 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_40620 9629 9045 gene locus_tag LOCUS_40630 9629 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 10233 9649 gene locus_tag LOCUS_40640 10233 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 11771 10248 gene locus_tag LOCUS_40650 gene trbL 11771 10248 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039738.1 protein_id gnl|my_center|LOCUS_40650 11985 11776 gene locus_tag LOCUS_40660 11985 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 12822 12001 gene locus_tag LOCUS_40670 gene trbJ 12822 12001 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 protein_id gnl|my_center|LOCUS_40670 14280 12841 gene locus_tag LOCUS_40680 gene trbI 14280 12841 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 protein_id gnl|my_center|LOCUS_40680 14718 14287 gene locus_tag LOCUS_40690 14718 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence73 1843 317 gene locus_tag LOCUS_40700 1843 317 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_40700 2313 3647 gene locus_tag LOCUS_40710 2313 3647 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_40710 3783 4043 gene locus_tag LOCUS_40720 3783 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 4040 5215 gene locus_tag LOCUS_40730 4040 5215 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_40730 5782 5396 gene locus_tag LOCUS_40740 5782 5396 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_40740 6012 5779 gene locus_tag LOCUS_40750 6012 5779 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_40750 6268 6492 gene locus_tag LOCUS_40760 6268 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 6508 7845 gene locus_tag LOCUS_40770 6508 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 8162 8512 gene locus_tag LOCUS_40780 8162 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 10590 8647 gene locus_tag LOCUS_40790 10590 8647 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275308.1 protein_id gnl|my_center|LOCUS_40790 11008 10748 gene locus_tag LOCUS_40800 11008 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 12529 11282 gene locus_tag LOCUS_40810 gene glgC 12529 11282 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544940.1 protein_id gnl|my_center|LOCUS_40810 13027 12827 gene locus_tag LOCUS_40820 13027 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 13152 14231 gene locus_tag LOCUS_40830 13152 14231 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_40830 >Feature sequence74 876 277 gene locus_tag LOCUS_40840 876 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 1491 1294 gene locus_tag LOCUS_40850 1491 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 3262 1964 gene locus_tag LOCUS_40860 gene aceA 3262 1964 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104513.1 protein_id gnl|my_center|LOCUS_40860 8775 3505 gene locus_tag LOCUS_40870 8775 3505 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670058.1 protein_id gnl|my_center|LOCUS_40870 10059 8797 gene locus_tag LOCUS_40880 10059 8797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_40880 10769 10056 gene locus_tag LOCUS_40890 10769 10056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_40890 11302 10775 gene locus_tag LOCUS_40900 11302 10775 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_40900 12074 11316 gene locus_tag LOCUS_40910 12074 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 13682 12156 gene locus_tag LOCUS_40920 gene malQ 13682 12156 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094267720.1 protein_id gnl|my_center|LOCUS_40920 >Feature sequence75 1314 130 gene locus_tag LOCUS_40930 1314 130 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_40930 2338 1490 gene locus_tag LOCUS_40940 2338 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 2485 3204 gene locus_tag LOCUS_40950 2485 3204 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_40950 3231 4037 gene locus_tag LOCUS_40960 gene ttcA 3231 4037 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210992.1 protein_id gnl|my_center|LOCUS_40960 4034 4930 gene locus_tag LOCUS_40970 4034 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 5634 4981 gene locus_tag LOCUS_40980 5634 4981 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_40980 5758 6747 gene locus_tag LOCUS_40990 gene bioB 5758 6747 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_40990 6754 7641 gene locus_tag LOCUS_41000 6754 7641 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_41000 8003 7695 gene locus_tag LOCUS_41010 gene ilvN 8003 7695 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937668.1 protein_id gnl|my_center|LOCUS_41010 9689 8007 gene locus_tag LOCUS_41020 gene ilvB 9689 8007 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937667.1 protein_id gnl|my_center|LOCUS_41020 10706 10068 gene locus_tag LOCUS_41030 10706 10068 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_41030 >Feature sequence76 376 2400 gene locus_tag LOCUS_41040 376 2400 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_41040 2406 2993 gene locus_tag LOCUS_41050 2406 2993 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816833.1 protein_id gnl|my_center|LOCUS_41050 3845 2982 gene locus_tag LOCUS_41060 3845 2982 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_41060 4243 3842 gene locus_tag LOCUS_41070 4243 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 4486 4773 gene locus_tag LOCUS_41080 4486 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 4770 5693 gene locus_tag LOCUS_41090 4770 5693 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525142.1 protein_id gnl|my_center|LOCUS_41090 5743 7635 gene locus_tag LOCUS_41100 gene dxs 5743 7635 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_41100 7651 8475 gene locus_tag LOCUS_41110 gene folE2 7651 8475 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_41110 8914 8549 gene locus_tag LOCUS_41120 gene rplS 8914 8549 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_41120 9746 8937 gene locus_tag LOCUS_41130 gene trmD 9746 8937 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_41130 10318 9743 gene locus_tag LOCUS_41140 gene rimM 10318 9743 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_41140 10576 10322 gene locus_tag LOCUS_41150 gene rpsP 10576 10322 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_41150 >Feature sequence77 1974 1141 gene locus_tag LOCUS_41160 1974 1141 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132575.1 protein_id gnl|my_center|LOCUS_41160 2884 3564 gene locus_tag LOCUS_41170 2884 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 3561 4202 gene locus_tag LOCUS_41180 3561 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41180 4195 5862 gene locus_tag LOCUS_41190 4195 5862 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_41190 5904 6464 gene locus_tag LOCUS_41200 5904 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41200 6466 8904 gene locus_tag LOCUS_41210 6466 8904 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_41210 >Feature sequence78 1200 277 gene locus_tag LOCUS_41220 1200 277 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_41220 2131 1376 gene locus_tag LOCUS_41230 2131 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 2706 2128 gene locus_tag LOCUS_41240 2706 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 3981 2707 gene locus_tag LOCUS_41250 3981 2707 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_41250 4653 4207 gene locus_tag LOCUS_41260 4653 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 5063 6181 gene locus_tag LOCUS_41270 5063 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 6611 6399 gene locus_tag LOCUS_41280 6611 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 7661 7035 gene locus_tag LOCUS_41290 gene ycaC 7661 7035 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_41290 8557 7700 gene locus_tag LOCUS_41300 8557 7700 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809214.1 protein_id gnl|my_center|LOCUS_41300 8662 8895 gene locus_tag LOCUS_41310 8662 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence79 128 2536 gene locus_tag LOCUS_41320 128 2536 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927217.1 protein_id gnl|my_center|LOCUS_41320 4454 2685 gene locus_tag LOCUS_41330 4454 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4551 5588 gene locus_tag LOCUS_41340 4551 5588 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_41340 6937 5480 gene locus_tag LOCUS_41350 6937 5480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968432.1 protein_id gnl|my_center|LOCUS_41350 7141 8037 gene locus_tag LOCUS_41360 7141 8037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968433.1 protein_id gnl|my_center|LOCUS_41360 >Feature sequence80 423 2039 gene locus_tag LOCUS_41370 423 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 2068 2391 gene locus_tag LOCUS_41380 2068 2391 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_41380 2391 2993 gene locus_tag LOCUS_41390 gene recR 2391 2993 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_41390 3094 3690 gene locus_tag LOCUS_41400 gene petA 3094 3690 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815815.1 protein_id gnl|my_center|LOCUS_41400 3694 5013 gene locus_tag LOCUS_41410 3694 5013 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_41410 5027 5737 gene locus_tag LOCUS_41420 5027 5737 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_41420 5840 6436 gene locus_tag LOCUS_41430 5840 6436 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_41430 6509 6937 gene locus_tag LOCUS_41440 6509 6937 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815821.1 protein_id gnl|my_center|LOCUS_41440 6995 7070 gene locus_tag LOCUS_t00440 6995 7070 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7748 7527 gene locus_tag LOCUS_41450 7748 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 >Feature sequence81 2139 130 gene locus_tag LOCUS_41460 2139 130 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975901.1 protein_id gnl|my_center|LOCUS_41460 3560 2148 gene locus_tag LOCUS_41470 3560 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 4762 4031 gene locus_tag LOCUS_41480 4762 4031 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_41480 5028 4786 gene locus_tag LOCUS_41490 5028 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 5895 5260 gene locus_tag LOCUS_41500 5895 5260 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185910.1 protein_id gnl|my_center|LOCUS_41500 6499 6218 gene locus_tag LOCUS_41510 6499 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence82 602 1885 gene locus_tag LOCUS_41520 602 1885 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045019.1 protein_id gnl|my_center|LOCUS_41520 2029 2322 gene locus_tag LOCUS_41530 2029 2322 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 protein_id gnl|my_center|LOCUS_41530 2319 2558 gene locus_tag LOCUS_41540 2319 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41540 2933 4012 gene locus_tag LOCUS_41550 gene prfB 2933 4012 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_41550 4069 5580 gene locus_tag LOCUS_41560 gene lysS 4069 5580 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 protein_id gnl|my_center|LOCUS_41560 >Feature sequence83 <1 3065 gene locus_tag LOCUS_41570 <1 3065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035387.1:RHS repeat-associated core domain-containing protein 4779 3535 gene locus_tag LOCUS_41580 4779 3535 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703417.1 protein_id gnl|my_center|LOCUS_41580 5038 4962 gene locus_tag LOCUS_t00450 5038 4962 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence84 576 289 gene locus_tag LOCUS_41590 576 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 <4699 582 gene locus_tag LOCUS_41600 <4699 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051754043.1:polymorphic toxin-type HINT domain-containing protein >Feature sequence85 510 2531 gene locus_tag LOCUS_41610 510 2531 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105562.1 protein_id gnl|my_center|LOCUS_41610 2715 3548 gene locus_tag LOCUS_41620 2715 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 >Feature sequence86 572 482 gene locus_tag LOCUS_t00460 572 482 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 703 1227 gene locus_tag LOCUS_41630 gene paaI 703 1227 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_41630 1947 1237 gene locus_tag LOCUS_41640 1947 1237 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109565.1 protein_id gnl|my_center|LOCUS_41640 2911 2111 gene locus_tag LOCUS_41650 2911 2111 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_41650 3265 2942 gene locus_tag LOCUS_41660 3265 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 3795 3529 gene locus_tag LOCUS_41670 3795 3529 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_41670 >Feature sequence87 407 817 gene locus_tag LOCUS_41680 407 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 954 2444 gene locus_tag LOCUS_41690 gene istA 954 2444 CDS product IS21-like element IS1326 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324342.1 protein_id gnl|my_center|LOCUS_41690 2437 3240 gene locus_tag LOCUS_41700 gene istB 2437 3240 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_41700 >Feature sequence88 2226 184 gene locus_tag LOCUS_41710 2226 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 2855 3169 gene locus_tag LOCUS_41720 2855 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720