>Feature sequence01 <1 721 gene locus_tag LOCUS_00010 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966773.1:molybdopterin guanine dinucleotide-containing S/N-oxide reductase 2541 1165 gene locus_tag LOCUS_00020 2541 1165 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259710.1 protein_id gnl|my_center|LOCUS_00020 3756 2566 gene locus_tag LOCUS_00030 3756 2566 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447280.1 protein_id gnl|my_center|LOCUS_00030 5451 4210 gene locus_tag LOCUS_00040 5451 4210 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970423.1 protein_id gnl|my_center|LOCUS_00040 6422 5448 gene locus_tag LOCUS_00050 6422 5448 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063678.1 protein_id gnl|my_center|LOCUS_00050 7317 6619 gene locus_tag LOCUS_00060 7317 6619 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807322.1 protein_id gnl|my_center|LOCUS_00060 8263 7433 gene locus_tag LOCUS_00070 8263 7433 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234820896.1 protein_id gnl|my_center|LOCUS_00070 8951 8286 gene locus_tag LOCUS_00080 8951 8286 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867636.1 protein_id gnl|my_center|LOCUS_00080 9627 8962 gene locus_tag LOCUS_00090 9627 8962 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_00090 10563 9682 gene locus_tag LOCUS_00100 10563 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11724 10750 gene locus_tag LOCUS_00110 11724 10750 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_00110 13434 12256 gene locus_tag LOCUS_00120 gene pobA 13434 12256 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532959.1 protein_id gnl|my_center|LOCUS_00120 14664 13504 gene locus_tag LOCUS_00130 14664 13504 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090572.1 protein_id gnl|my_center|LOCUS_00130 15148 14732 gene locus_tag LOCUS_00140 15148 14732 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 protein_id gnl|my_center|LOCUS_00140 16402 15158 gene locus_tag LOCUS_00150 16402 15158 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104287.1 protein_id gnl|my_center|LOCUS_00150 18269 16410 gene locus_tag LOCUS_00160 18269 16410 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090569.1 protein_id gnl|my_center|LOCUS_00160 19143 18340 gene locus_tag LOCUS_00170 19143 18340 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090568.1 protein_id gnl|my_center|LOCUS_00170 20381 19518 gene locus_tag LOCUS_00180 20381 19518 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384111.1 protein_id gnl|my_center|LOCUS_00180 20593 21462 gene locus_tag LOCUS_00190 20593 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22528 21848 gene locus_tag LOCUS_00200 22528 21848 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_00200 25250 22572 gene locus_tag LOCUS_00210 25250 22572 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327145.1 protein_id gnl|my_center|LOCUS_00210 25862 25260 gene locus_tag LOCUS_00220 25862 25260 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_00220 27925 25874 gene locus_tag LOCUS_00230 gene kdpB 27925 25874 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968197.1 protein_id gnl|my_center|LOCUS_00230 29642 27936 gene locus_tag LOCUS_00240 gene kdpA 29642 27936 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968198.1 protein_id gnl|my_center|LOCUS_00240 30271 31455 gene locus_tag LOCUS_00250 30271 31455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31548 32012 gene locus_tag LOCUS_00260 31548 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32009 33919 gene locus_tag LOCUS_00270 32009 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34155 35489 gene locus_tag LOCUS_00280 34155 35489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35486 36622 gene locus_tag LOCUS_00290 35486 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 36615 38003 gene locus_tag LOCUS_00300 36615 38003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38455 38216 gene locus_tag LOCUS_00310 38455 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39409 38465 gene locus_tag LOCUS_00320 39409 38465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40582 39887 gene locus_tag LOCUS_00330 40582 39887 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974790.1 protein_id gnl|my_center|LOCUS_00330 40686 41615 gene locus_tag LOCUS_00340 40686 41615 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 protein_id gnl|my_center|LOCUS_00340 41994 41647 gene locus_tag LOCUS_00350 41994 41647 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525116.1 protein_id gnl|my_center|LOCUS_00350 43160 42048 gene locus_tag LOCUS_00360 43160 42048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086903.1 protein_id gnl|my_center|LOCUS_00360 43220 43819 gene locus_tag LOCUS_00370 43220 43819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086904.1 protein_id gnl|my_center|LOCUS_00370 43816 44421 gene locus_tag LOCUS_00380 43816 44421 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086905.1 protein_id gnl|my_center|LOCUS_00380 44421 44999 gene locus_tag LOCUS_00390 44421 44999 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086906.1 protein_id gnl|my_center|LOCUS_00390 45090 45317 gene locus_tag LOCUS_00400 45090 45317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45531 45923 gene locus_tag LOCUS_00410 45531 45923 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327078.1 protein_id gnl|my_center|LOCUS_00410 46379 47131 gene locus_tag LOCUS_00420 46379 47131 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314962.1 protein_id gnl|my_center|LOCUS_00420 47231 47857 gene locus_tag LOCUS_00430 47231 47857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48089 48346 gene locus_tag LOCUS_00440 48089 48346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48500 49075 gene locus_tag LOCUS_00450 48500 49075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49486 49235 gene locus_tag LOCUS_00460 49486 49235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50183 49749 gene locus_tag LOCUS_00470 50183 49749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50582 50508 gene locus_tag LOCUS_t00010 50582 50508 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 50704 50916 gene locus_tag LOCUS_00480 50704 50916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51161 52450 gene locus_tag LOCUS_00490 gene murA 51161 52450 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970968.1 protein_id gnl|my_center|LOCUS_00490 52562 52864 gene locus_tag LOCUS_00500 52562 52864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53084 53623 gene locus_tag LOCUS_00510 53084 53623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00510 53856 53772 gene locus_tag LOCUS_t00020 53856 53772 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54836 53913 gene locus_tag LOCUS_00520 gene truB 54836 53913 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_00520 55273 54833 gene locus_tag LOCUS_00530 gene rbfA 55273 54833 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_00530 56067 55372 gene locus_tag LOCUS_00540 56067 55372 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_00540 57605 56097 gene locus_tag LOCUS_00550 57605 56097 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083579.1 protein_id gnl|my_center|LOCUS_00550 60133 57602 gene locus_tag LOCUS_00560 60133 57602 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965154.1 protein_id gnl|my_center|LOCUS_00560 60820 60320 gene locus_tag LOCUS_00570 60820 60320 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310198.1 protein_id gnl|my_center|LOCUS_00570 61509 60820 gene locus_tag LOCUS_00580 gene tsaB 61509 60820 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_00580 62437 61571 gene locus_tag LOCUS_00590 62437 61571 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113300.1 protein_id gnl|my_center|LOCUS_00590 62461 62871 gene locus_tag LOCUS_00600 62461 62871 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_00600 63518 62901 gene locus_tag LOCUS_00610 63518 62901 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083622.1 protein_id gnl|my_center|LOCUS_00610 64133 63636 gene locus_tag LOCUS_00620 64133 63636 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965167.1 protein_id gnl|my_center|LOCUS_00620 64305 64457 gene locus_tag LOCUS_00630 64305 64457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 64517 66334 gene locus_tag LOCUS_00640 gene lepA 64517 66334 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640125.1 protein_id gnl|my_center|LOCUS_00640 67525 66449 gene locus_tag LOCUS_00650 67525 66449 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055349.1 protein_id gnl|my_center|LOCUS_00650 68500 67637 gene locus_tag LOCUS_00660 68500 67637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 68742 69524 gene locus_tag LOCUS_00670 68742 69524 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385634.1 protein_id gnl|my_center|LOCUS_00670 69590 72304 gene locus_tag LOCUS_00680 gene mutS 69590 72304 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083746.1 protein_id gnl|my_center|LOCUS_00680 73073 72270 gene locus_tag LOCUS_00690 73073 72270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083743.1 protein_id gnl|my_center|LOCUS_00690 73697 73140 gene locus_tag LOCUS_00700 73697 73140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 74631 73825 gene locus_tag LOCUS_00710 74631 73825 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_00710 75092 74628 gene locus_tag LOCUS_00720 gene ptsN 75092 74628 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083550.1 protein_id gnl|my_center|LOCUS_00720 75766 75167 gene locus_tag LOCUS_00730 gene raiA 75766 75167 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083549.1 protein_id gnl|my_center|LOCUS_00730 75971 77257 gene locus_tag LOCUS_00740 gene cya 75971 77257 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408035.1 protein_id gnl|my_center|LOCUS_00740 77989 77258 gene locus_tag LOCUS_00750 77989 77258 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_00750 78374 78066 gene locus_tag LOCUS_00760 78374 78066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79024 78536 gene locus_tag LOCUS_00770 79024 78536 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_00770 80437 79520 gene locus_tag LOCUS_00780 80437 79520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088898.1 protein_id gnl|my_center|LOCUS_00780 81513 80437 gene locus_tag LOCUS_00790 81513 80437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088897.1 protein_id gnl|my_center|LOCUS_00790 83015 81510 gene locus_tag LOCUS_00800 83015 81510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088896.1 protein_id gnl|my_center|LOCUS_00800 83506 83015 gene locus_tag LOCUS_00810 83506 83015 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_00810 84809 83601 gene locus_tag LOCUS_00820 84809 83601 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265979.1 protein_id gnl|my_center|LOCUS_00820 85976 84897 gene locus_tag LOCUS_00830 85976 84897 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099004.1 protein_id gnl|my_center|LOCUS_00830 87136 85973 gene locus_tag LOCUS_00840 87136 85973 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_00840 88289 87255 gene locus_tag LOCUS_00850 88289 87255 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_00850 89470 88433 gene locus_tag LOCUS_00860 gene trpS 89470 88433 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083624.1 protein_id gnl|my_center|LOCUS_00860 93630 89575 gene locus_tag LOCUS_00870 93630 89575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 93900 94286 gene locus_tag LOCUS_00880 93900 94286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 94510 95034 gene locus_tag LOCUS_00890 94510 95034 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530255.1 protein_id gnl|my_center|LOCUS_00890 95289 95364 gene locus_tag LOCUS_t00030 95289 95364 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 95772 95428 gene locus_tag LOCUS_00900 95772 95428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 96656 95766 gene locus_tag LOCUS_00910 96656 95766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 98500 96821 gene locus_tag LOCUS_00920 98500 96821 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694565.1 protein_id gnl|my_center|LOCUS_00920 100609 98525 gene locus_tag LOCUS_00930 100609 98525 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050273.1 protein_id gnl|my_center|LOCUS_00930 101645 100584 gene locus_tag LOCUS_00940 gene mdtN 101645 100584 CDS product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817122.1 protein_id gnl|my_center|LOCUS_00940 102013 101645 gene locus_tag LOCUS_00950 102013 101645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 103279 102191 gene locus_tag LOCUS_00960 103279 102191 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_00960 103596 104369 gene locus_tag LOCUS_00970 103596 104369 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083804.1 protein_id gnl|my_center|LOCUS_00970 104464 105627 gene locus_tag LOCUS_00980 104464 105627 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965217.1 protein_id gnl|my_center|LOCUS_00980 105642 106301 gene locus_tag LOCUS_00990 105642 106301 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_00990 106659 108281 gene locus_tag LOCUS_01000 106659 108281 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083806.1 protein_id gnl|my_center|LOCUS_01000 108278 110278 gene locus_tag LOCUS_01010 108278 110278 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083807.1 protein_id gnl|my_center|LOCUS_01010 110289 111092 gene locus_tag LOCUS_01020 110289 111092 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_01020 111187 112050 gene locus_tag LOCUS_01030 111187 112050 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083805.1 protein_id gnl|my_center|LOCUS_01030 112133 113008 gene locus_tag LOCUS_01040 112133 113008 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_01040 113013 114089 gene locus_tag LOCUS_01050 113013 114089 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_01050 114086 114874 gene locus_tag LOCUS_01060 114086 114874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_01060 114871 115644 gene locus_tag LOCUS_01070 114871 115644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_01070 115651 117510 gene locus_tag LOCUS_01080 115651 117510 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_01080 117627 118805 gene locus_tag LOCUS_01090 117627 118805 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_01090 118877 120013 gene locus_tag LOCUS_01100 118877 120013 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172653.1 protein_id gnl|my_center|LOCUS_01100 121882 120023 gene locus_tag LOCUS_01110 121882 120023 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173514.1 protein_id gnl|my_center|LOCUS_01110 122519 121974 gene locus_tag LOCUS_01120 122519 121974 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546512.1 protein_id gnl|my_center|LOCUS_01120 122589 124982 gene locus_tag LOCUS_01130 122589 124982 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_01130 125748 125053 gene locus_tag LOCUS_01140 125748 125053 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 protein_id gnl|my_center|LOCUS_01140 126393 125857 gene locus_tag LOCUS_01150 126393 125857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 127076 126489 gene locus_tag LOCUS_01160 127076 126489 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_01160 128491 127073 gene locus_tag LOCUS_01170 128491 127073 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965126.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01170 129241 128519 gene locus_tag LOCUS_01180 129241 128519 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_01180 130403 129399 gene locus_tag LOCUS_01190 130403 129399 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086129.1 protein_id gnl|my_center|LOCUS_01190 131452 130400 gene locus_tag LOCUS_01200 131452 130400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_01200 131333 131406 gene locus_tag LOCUS_t00040 131333 131406 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 132373 131459 gene locus_tag LOCUS_01210 132373 131459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 protein_id gnl|my_center|LOCUS_01210 133311 132370 gene locus_tag LOCUS_01220 133311 132370 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_01220 135004 133397 gene locus_tag LOCUS_01230 135004 133397 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_01230 135475 136335 gene locus_tag LOCUS_01240 135475 136335 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244033.1 protein_id gnl|my_center|LOCUS_01240 136347 137114 gene locus_tag LOCUS_01250 136347 137114 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 protein_id gnl|my_center|LOCUS_01250 137161 138366 gene locus_tag LOCUS_01260 gene pcaF 137161 138366 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083747.1 protein_id gnl|my_center|LOCUS_01260 138463 139173 gene locus_tag LOCUS_01270 gene pcaH 138463 139173 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965195.1 protein_id gnl|my_center|LOCUS_01270 139163 139774 gene locus_tag LOCUS_01280 gene pcaG 139163 139774 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083750.1 protein_id gnl|my_center|LOCUS_01280 140402 139788 gene locus_tag LOCUS_01290 140402 139788 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190802.1 protein_id gnl|my_center|LOCUS_01290 141569 140481 gene locus_tag LOCUS_01300 gene mutY 141569 140481 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921414.1 protein_id gnl|my_center|LOCUS_01300 141631 142128 gene locus_tag LOCUS_01310 141631 142128 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085285.1 protein_id gnl|my_center|LOCUS_01310 142322 142612 gene locus_tag LOCUS_01320 142322 142612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 143230 142634 gene locus_tag LOCUS_01330 143230 142634 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085416.1 protein_id gnl|my_center|LOCUS_01330 143373 143882 gene locus_tag LOCUS_01340 gene lspA 143373 143882 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_01340 143947 144651 gene locus_tag LOCUS_01350 143947 144651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921550.1 protein_id gnl|my_center|LOCUS_01350 144674 144913 gene locus_tag LOCUS_01360 144674 144913 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090242.1 protein_id gnl|my_center|LOCUS_01360 145904 144891 gene locus_tag LOCUS_01370 gene lpxK 145904 144891 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090246.1 protein_id gnl|my_center|LOCUS_01370 147244 145937 gene locus_tag LOCUS_01380 147244 145937 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_01380 148064 147237 gene locus_tag LOCUS_01390 148064 147237 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_01390 148332 148084 gene locus_tag LOCUS_01400 148332 148084 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_01400 149147 148374 gene locus_tag LOCUS_01410 149147 148374 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174622.1 protein_id gnl|my_center|LOCUS_01410 150483 149134 gene locus_tag LOCUS_01420 150483 149134 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_01420 150861 151439 gene locus_tag LOCUS_01430 150861 151439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 151473 152225 gene locus_tag LOCUS_01440 151473 152225 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 protein_id gnl|my_center|LOCUS_01440 152362 153063 gene locus_tag LOCUS_01450 152362 153063 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 protein_id gnl|my_center|LOCUS_01450 153650 153165 gene locus_tag LOCUS_01460 153650 153165 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084004.1 protein_id gnl|my_center|LOCUS_01460 154221 153661 gene locus_tag LOCUS_01470 154221 153661 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084005.1 protein_id gnl|my_center|LOCUS_01470 154554 154327 gene locus_tag LOCUS_01480 154554 154327 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533642.1 protein_id gnl|my_center|LOCUS_01480 155367 154621 gene locus_tag LOCUS_01490 155367 154621 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084006.1 protein_id gnl|my_center|LOCUS_01490 155797 155441 gene locus_tag LOCUS_01500 155797 155441 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109866586.1 protein_id gnl|my_center|LOCUS_01500 159633 156178 gene locus_tag LOCUS_01510 gene smc 159633 156178 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085283.1 protein_id gnl|my_center|LOCUS_01510 159904 160032 gene locus_tag LOCUS_01520 159904 160032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 160745 160161 gene locus_tag LOCUS_01530 160745 160161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 161072 161251 gene locus_tag LOCUS_01540 161072 161251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 161990 161358 gene locus_tag LOCUS_01550 161990 161358 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_01550 162166 163143 gene locus_tag LOCUS_01560 162166 163143 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085408.1 protein_id gnl|my_center|LOCUS_01560 163632 163198 gene locus_tag LOCUS_01570 163632 163198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088530.1 protein_id gnl|my_center|LOCUS_01570 163783 164589 gene locus_tag LOCUS_01580 163783 164589 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_01580 165342 164605 gene locus_tag LOCUS_01590 165342 164605 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_01590 165443 166816 gene locus_tag LOCUS_01600 165443 166816 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965750.1 protein_id gnl|my_center|LOCUS_01600 166822 167592 gene locus_tag LOCUS_01610 gene eutC 166822 167592 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085780.1 protein_id gnl|my_center|LOCUS_01610 168219 167602 gene locus_tag LOCUS_01620 gene pdxH 168219 167602 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532806.1 protein_id gnl|my_center|LOCUS_01620 168426 168977 gene locus_tag LOCUS_01630 168426 168977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 169094 170071 gene locus_tag LOCUS_01640 169094 170071 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085412.1 protein_id gnl|my_center|LOCUS_01640 171361 170126 gene locus_tag LOCUS_01650 171361 170126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 172198 171467 gene locus_tag LOCUS_01660 172198 171467 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970595.1 protein_id gnl|my_center|LOCUS_01660 172391 173200 gene locus_tag LOCUS_01670 gene fabI 172391 173200 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085415.1 protein_id gnl|my_center|LOCUS_01670 173316 174401 gene locus_tag LOCUS_01680 173316 174401 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966719.1 protein_id gnl|my_center|LOCUS_01680 174547 175686 gene locus_tag LOCUS_01690 gene proB 174547 175686 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083260.1 protein_id gnl|my_center|LOCUS_01690 175834 176595 gene locus_tag LOCUS_01700 175834 176595 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_01700 178405 176876 gene locus_tag LOCUS_01710 gene rpoN 178405 176876 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_01710 179425 178532 gene locus_tag LOCUS_01720 179425 178532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 180140 179448 gene locus_tag LOCUS_01730 180140 179448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 180904 180158 gene locus_tag LOCUS_01740 180904 180158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 181670 181053 gene locus_tag LOCUS_01750 181670 181053 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_01750 181755 182192 gene locus_tag LOCUS_01760 181755 182192 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974418.1 protein_id gnl|my_center|LOCUS_01760 183087 182203 gene locus_tag LOCUS_01770 183087 182203 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085704.1 protein_id gnl|my_center|LOCUS_01770 183222 184022 gene locus_tag LOCUS_01780 183222 184022 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930607.1 protein_id gnl|my_center|LOCUS_01780 184019 184435 gene locus_tag LOCUS_01790 184019 184435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 184455 185534 gene locus_tag LOCUS_01800 184455 185534 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 protein_id gnl|my_center|LOCUS_01800 185567 186187 gene locus_tag LOCUS_01810 185567 186187 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 protein_id gnl|my_center|LOCUS_01810 186184 187560 gene locus_tag LOCUS_01820 186184 187560 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811061.1 protein_id gnl|my_center|LOCUS_01820 187874 190036 gene locus_tag LOCUS_01830 187874 190036 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088157.1 protein_id gnl|my_center|LOCUS_01830 190244 192079 gene locus_tag LOCUS_01840 190244 192079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088156.1 protein_id gnl|my_center|LOCUS_01840 192079 193143 gene locus_tag LOCUS_01850 192079 193143 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_01850 193277 193597 gene locus_tag LOCUS_01860 193277 193597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 194610 193600 gene locus_tag LOCUS_01870 194610 193600 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_01870 194713 195600 gene locus_tag LOCUS_01880 194713 195600 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 protein_id gnl|my_center|LOCUS_01880 197556 195619 gene locus_tag LOCUS_01890 gene cysN 197556 195619 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_01890 198497 197556 gene locus_tag LOCUS_01900 gene cysD 198497 197556 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 protein_id gnl|my_center|LOCUS_01900 199045 198518 gene locus_tag LOCUS_01910 199045 198518 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975276.1 protein_id gnl|my_center|LOCUS_01910 199805 199050 gene locus_tag LOCUS_01920 199805 199050 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529564.1 protein_id gnl|my_center|LOCUS_01920 201456 199798 gene locus_tag LOCUS_01930 201456 199798 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 protein_id gnl|my_center|LOCUS_01930 201796 201470 gene locus_tag LOCUS_01940 201796 201470 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315350.1 protein_id gnl|my_center|LOCUS_01940 203224 201806 gene locus_tag LOCUS_01950 gene cysG 203224 201806 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529561.1 protein_id gnl|my_center|LOCUS_01950 204415 203234 gene locus_tag LOCUS_01960 204415 203234 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391150.1 protein_id gnl|my_center|LOCUS_01960 205160 204297 gene locus_tag LOCUS_01970 gene cysW 205160 204297 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530874.1 protein_id gnl|my_center|LOCUS_01970 205959 205153 gene locus_tag LOCUS_01980 gene cysT 205959 205153 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530875.1 protein_id gnl|my_center|LOCUS_01980 207074 206010 gene locus_tag LOCUS_01990 207074 206010 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391147.1 protein_id gnl|my_center|LOCUS_01990 207844 208518 gene locus_tag LOCUS_02000 207844 208518 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_02000 208515 209867 gene locus_tag LOCUS_02010 208515 209867 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397257.1 protein_id gnl|my_center|LOCUS_02010 210464 209874 gene locus_tag LOCUS_02020 210464 209874 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089744.1 protein_id gnl|my_center|LOCUS_02020 211338 210481 gene locus_tag LOCUS_02030 211338 210481 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528712.1 protein_id gnl|my_center|LOCUS_02030 212189 211335 gene locus_tag LOCUS_02040 gene ssuC 212189 211335 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089746.1 protein_id gnl|my_center|LOCUS_02040 213373 212201 gene locus_tag LOCUS_02050 gene ssuD 213373 212201 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394296.1 protein_id gnl|my_center|LOCUS_02050 214426 213470 gene locus_tag LOCUS_02060 214426 213470 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084051.1 protein_id gnl|my_center|LOCUS_02060 214901 214716 gene locus_tag LOCUS_02070 214901 214716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 215324 216181 gene locus_tag LOCUS_02080 gene cysE 215324 216181 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175407.1 protein_id gnl|my_center|LOCUS_02080 216264 216827 gene locus_tag LOCUS_02090 216264 216827 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 protein_id gnl|my_center|LOCUS_02090 216939 218039 gene locus_tag LOCUS_02100 216939 218039 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085232.1 protein_id gnl|my_center|LOCUS_02100 219185 218085 gene locus_tag LOCUS_02110 219185 218085 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530811.1 protein_id gnl|my_center|LOCUS_02110 220017 219439 gene locus_tag LOCUS_02120 220017 219439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 220537 220280 gene locus_tag LOCUS_02130 220537 220280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 221414 220785 gene locus_tag LOCUS_02140 221414 220785 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090041.1 protein_id gnl|my_center|LOCUS_02140 222126 222656 gene locus_tag LOCUS_02150 222126 222656 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973257.1 protein_id gnl|my_center|LOCUS_02150 222736 223683 gene locus_tag LOCUS_02160 222736 223683 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973258.1 protein_id gnl|my_center|LOCUS_02160 223846 226395 gene locus_tag LOCUS_02170 223846 226395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 226773 227819 gene locus_tag LOCUS_02180 226773 227819 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084020.1 protein_id gnl|my_center|LOCUS_02180 228979 227840 gene locus_tag LOCUS_02190 228979 227840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_02190 229790 228999 gene locus_tag LOCUS_02200 229790 228999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383453.1 protein_id gnl|my_center|LOCUS_02200 230658 229804 gene locus_tag LOCUS_02210 230658 229804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_02210 231738 230731 gene locus_tag LOCUS_02220 231738 230731 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731892.1 protein_id gnl|my_center|LOCUS_02220 233073 232306 gene locus_tag LOCUS_02230 233073 232306 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 protein_id gnl|my_center|LOCUS_02230 233820 233131 gene locus_tag LOCUS_02240 233820 233131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 protein_id gnl|my_center|LOCUS_02240 234523 233810 gene locus_tag LOCUS_02250 gene nocQ 234523 233810 CDS product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 protein_id gnl|my_center|LOCUS_02250 235415 234618 gene locus_tag LOCUS_02260 235415 234618 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 protein_id gnl|my_center|LOCUS_02260 236720 235779 gene locus_tag LOCUS_02270 236720 235779 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_02270 236906 237694 gene locus_tag LOCUS_02280 236906 237694 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_02280 237756 238724 gene locus_tag LOCUS_02290 237756 238724 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970456.1 protein_id gnl|my_center|LOCUS_02290 239838 239212 gene locus_tag LOCUS_02300 239838 239212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 241191 239920 gene locus_tag LOCUS_02310 241191 239920 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_02310 241627 242493 gene locus_tag LOCUS_02320 241627 242493 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_02320 242493 242984 gene locus_tag LOCUS_02330 242493 242984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02330 242981 245332 gene locus_tag LOCUS_02340 242981 245332 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086134.1 protein_id gnl|my_center|LOCUS_02340 246824 245430 gene locus_tag LOCUS_02350 246824 245430 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_02350 247746 247060 gene locus_tag LOCUS_02360 247746 247060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 248171 247839 gene locus_tag LOCUS_02370 248171 247839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 249847 248207 gene locus_tag LOCUS_02380 249847 248207 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_02380 250715 249873 gene locus_tag LOCUS_02390 250715 249873 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727458.1 protein_id gnl|my_center|LOCUS_02390 250836 252302 gene locus_tag LOCUS_02400 250836 252302 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228896.1 protein_id gnl|my_center|LOCUS_02400 253304 252417 gene locus_tag LOCUS_02410 253304 252417 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973700.1 protein_id gnl|my_center|LOCUS_02410 253484 254722 gene locus_tag LOCUS_02420 253484 254722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541054.1 protein_id gnl|my_center|LOCUS_02420 255574 254867 gene locus_tag LOCUS_02430 255574 254867 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_02430 256736 255858 gene locus_tag LOCUS_02440 256736 255858 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172900.1 protein_id gnl|my_center|LOCUS_02440 257452 256820 gene locus_tag LOCUS_02450 257452 256820 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529481.1 protein_id gnl|my_center|LOCUS_02450 257566 258477 gene locus_tag LOCUS_02460 257566 258477 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504141.1 protein_id gnl|my_center|LOCUS_02460 259682 258552 gene locus_tag LOCUS_02470 259682 258552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064563.1 protein_id gnl|my_center|LOCUS_02470 260088 259702 gene locus_tag LOCUS_02480 260088 259702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 260275 261279 gene locus_tag LOCUS_02490 260275 261279 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_02490 261288 262067 gene locus_tag LOCUS_02500 261288 262067 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563356.1 protein_id gnl|my_center|LOCUS_02500 263099 262134 gene locus_tag LOCUS_02510 263099 262134 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085864.1 protein_id gnl|my_center|LOCUS_02510 264553 263204 gene locus_tag LOCUS_02520 gene hmgA 264553 263204 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967448.1 protein_id gnl|my_center|LOCUS_02520 265359 264586 gene locus_tag LOCUS_02530 265359 264586 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_02530 266820 265501 gene locus_tag LOCUS_02540 gene fahA 266820 265501 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 protein_id gnl|my_center|LOCUS_02540 267757 266972 gene locus_tag LOCUS_02550 267757 266972 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089754.1 protein_id gnl|my_center|LOCUS_02550 267867 268532 gene locus_tag LOCUS_02560 267867 268532 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965238.1 protein_id gnl|my_center|LOCUS_02560 269111 268692 gene locus_tag LOCUS_02570 269111 268692 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191582.1 protein_id gnl|my_center|LOCUS_02570 269475 269047 gene locus_tag LOCUS_02580 269475 269047 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 protein_id gnl|my_center|LOCUS_02580 269912 269823 gene locus_tag LOCUS_t00050 269912 269823 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 270797 270081 gene locus_tag LOCUS_02590 270797 270081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 271131 272051 gene locus_tag LOCUS_02600 gene mepA 271131 272051 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967706.1 protein_id gnl|my_center|LOCUS_02600 273309 272068 gene locus_tag LOCUS_02610 273309 272068 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965920.1 protein_id gnl|my_center|LOCUS_02610 273727 273485 gene locus_tag LOCUS_02620 273727 273485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 275501 273981 gene locus_tag LOCUS_02630 275501 273981 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965917.1 protein_id gnl|my_center|LOCUS_02630 276543 275602 gene locus_tag LOCUS_02640 276543 275602 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_02640 276867 276583 gene locus_tag LOCUS_02650 276867 276583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 279637 276959 gene locus_tag LOCUS_02660 gene ppdK 279637 276959 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 protein_id gnl|my_center|LOCUS_02660 279831 280415 gene locus_tag LOCUS_02670 279831 280415 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085300.1 protein_id gnl|my_center|LOCUS_02670 280878 281792 gene locus_tag LOCUS_02680 280878 281792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 283025 281796 gene locus_tag LOCUS_02690 gene hemA 283025 281796 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084018.1 protein_id gnl|my_center|LOCUS_02690 283902 283186 gene locus_tag LOCUS_02700 283902 283186 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968041.1 protein_id gnl|my_center|LOCUS_02700 284605 284078 gene locus_tag LOCUS_02710 gene infC 284605 284078 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083535.1 protein_id gnl|my_center|LOCUS_02710 285964 284744 gene locus_tag LOCUS_02720 285964 284744 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211860579.1 protein_id gnl|my_center|LOCUS_02720 286027 286791 gene locus_tag LOCUS_02730 286027 286791 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128777536.1 protein_id gnl|my_center|LOCUS_02730 286819 287409 gene locus_tag LOCUS_02740 286819 287409 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047143.1 protein_id gnl|my_center|LOCUS_02740 287406 288437 gene locus_tag LOCUS_02750 287406 288437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 289179 288442 gene locus_tag LOCUS_02760 289179 288442 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_02760 290675 289323 gene locus_tag LOCUS_02770 gene phaZ 290675 289323 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067438.1 protein_id gnl|my_center|LOCUS_02770 291713 290916 gene locus_tag LOCUS_02780 291713 290916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083729.1 protein_id gnl|my_center|LOCUS_02780 292401 291724 gene locus_tag LOCUS_02790 292401 291724 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_02790 293141 292398 gene locus_tag LOCUS_02800 293141 292398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965188.1 protein_id gnl|my_center|LOCUS_02800 293274 294206 gene locus_tag LOCUS_02810 gene rbsK 293274 294206 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_02810 294236 295018 gene locus_tag LOCUS_02820 294236 295018 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243756.1 protein_id gnl|my_center|LOCUS_02820 295567 295019 gene locus_tag LOCUS_02830 295567 295019 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089501.1 protein_id gnl|my_center|LOCUS_02830 296547 295564 gene locus_tag LOCUS_02840 gene gnd 296547 295564 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_02840 296701 297702 gene locus_tag LOCUS_02850 296701 297702 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_02850 298358 297735 gene locus_tag LOCUS_02860 298358 297735 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764543.1 protein_id gnl|my_center|LOCUS_02860 299175 298378 gene locus_tag LOCUS_02870 gene hisF 299175 298378 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501998.1 protein_id gnl|my_center|LOCUS_02870 299909 299172 gene locus_tag LOCUS_02880 gene hisA 299909 299172 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_02880 300556 299906 gene locus_tag LOCUS_02890 gene hisH 300556 299906 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528348.1 protein_id gnl|my_center|LOCUS_02890 301065 300553 gene locus_tag LOCUS_02900 301065 300553 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083478.1 protein_id gnl|my_center|LOCUS_02900 301652 301065 gene locus_tag LOCUS_02910 gene hisB 301652 301065 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_02910 301802 302149 gene locus_tag LOCUS_02920 301802 302149 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379544.1 protein_id gnl|my_center|LOCUS_02920 302206 302760 gene locus_tag LOCUS_02930 gene hslV 302206 302760 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 protein_id gnl|my_center|LOCUS_02930 302757 304067 gene locus_tag LOCUS_02940 gene hslU 302757 304067 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_02940 305056 304283 gene locus_tag LOCUS_02950 305056 304283 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_02950 305353 305063 gene locus_tag LOCUS_02960 305353 305063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 306122 305460 gene locus_tag LOCUS_02970 306122 305460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_02970 306307 307734 gene locus_tag LOCUS_02980 306307 307734 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969867.1 protein_id gnl|my_center|LOCUS_02980 309233 307731 gene locus_tag LOCUS_02990 gene glpK 309233 307731 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084227.1 protein_id gnl|my_center|LOCUS_02990 309251 310858 gene locus_tag LOCUS_03000 gene glpD 309251 310858 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085223.1 protein_id gnl|my_center|LOCUS_03000 310855 312099 gene locus_tag LOCUS_03010 310855 312099 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_03010 312729 312100 gene locus_tag LOCUS_03020 312729 312100 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920788.1 protein_id gnl|my_center|LOCUS_03020 313363 312743 gene locus_tag LOCUS_03030 313363 312743 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_03030 314010 313480 gene locus_tag LOCUS_03040 314010 313480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 314441 314608 gene locus_tag LOCUS_03050 314441 314608 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084259.1 protein_id gnl|my_center|LOCUS_03050 314691 314855 gene locus_tag LOCUS_03060 314691 314855 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173014.1 protein_id gnl|my_center|LOCUS_03060 314934 315110 gene locus_tag LOCUS_03070 314934 315110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 315174 315680 gene locus_tag LOCUS_03080 315174 315680 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 protein_id gnl|my_center|LOCUS_03080 315824 316681 gene locus_tag LOCUS_03090 gene cpaB 315824 316681 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965364.1 protein_id gnl|my_center|LOCUS_03090 316762 318171 gene locus_tag LOCUS_03100 316762 318171 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173504.1 protein_id gnl|my_center|LOCUS_03100 318197 318658 gene locus_tag LOCUS_03110 318197 318658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 318664 319929 gene locus_tag LOCUS_03120 318664 319929 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084254.1 protein_id gnl|my_center|LOCUS_03120 319951 321432 gene locus_tag LOCUS_03130 319951 321432 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_03130 321438 322415 gene locus_tag LOCUS_03140 321438 322415 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173506.1 protein_id gnl|my_center|LOCUS_03140 322430 323401 gene locus_tag LOCUS_03150 322430 323401 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084251.1 protein_id gnl|my_center|LOCUS_03150 323957 323388 gene locus_tag LOCUS_03160 323957 323388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_03160 325295 324048 gene locus_tag LOCUS_03170 325295 324048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_03170 326499 325414 gene locus_tag LOCUS_03180 326499 325414 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974562.1 protein_id gnl|my_center|LOCUS_03180 326599 327771 gene locus_tag LOCUS_03190 326599 327771 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854964.1 protein_id gnl|my_center|LOCUS_03190 328151 327777 gene locus_tag LOCUS_03200 328151 327777 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532266.1 protein_id gnl|my_center|LOCUS_03200 328336 330864 gene locus_tag LOCUS_03210 328336 330864 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 protein_id gnl|my_center|LOCUS_03210 330866 331573 gene locus_tag LOCUS_03220 gene pdeM 330866 331573 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 protein_id gnl|my_center|LOCUS_03220 332374 331871 gene locus_tag LOCUS_03230 332374 331871 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 protein_id gnl|my_center|LOCUS_03230 333300 332593 gene locus_tag LOCUS_03240 gene dnaQ 333300 332593 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083467.1 protein_id gnl|my_center|LOCUS_03240 333896 333300 gene locus_tag LOCUS_03250 gene coaE 333896 333300 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528726.1 protein_id gnl|my_center|LOCUS_03250 334728 333898 gene locus_tag LOCUS_03260 334728 333898 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039187079.1 protein_id gnl|my_center|LOCUS_03260 335315 334725 gene locus_tag LOCUS_03270 335315 334725 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067415.1 protein_id gnl|my_center|LOCUS_03270 336169 335318 gene locus_tag LOCUS_03280 336169 335318 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083464.1 protein_id gnl|my_center|LOCUS_03280 336620 337591 gene locus_tag LOCUS_03290 gene hemE 336620 337591 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085186.1 protein_id gnl|my_center|LOCUS_03290 337591 338121 gene locus_tag LOCUS_03300 gene hemJ 337591 338121 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528731.1 protein_id gnl|my_center|LOCUS_03300 338392 339657 gene locus_tag LOCUS_03310 gene rho 338392 339657 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083462.1 protein_id gnl|my_center|LOCUS_03310 339822 341117 gene locus_tag LOCUS_03320 gene mnmE 339822 341117 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083461.1 protein_id gnl|my_center|LOCUS_03320 341378 343168 gene locus_tag LOCUS_03330 gene mnmG 341378 343168 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083460.1 protein_id gnl|my_center|LOCUS_03330 343168 343824 gene locus_tag LOCUS_03340 gene rsmG 343168 343824 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178639.1 protein_id gnl|my_center|LOCUS_03340 343851 344663 gene locus_tag LOCUS_03350 343851 344663 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 protein_id gnl|my_center|LOCUS_03350 344734 345615 gene locus_tag LOCUS_03360 344734 345615 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965125.1 protein_id gnl|my_center|LOCUS_03360 347004 345973 gene locus_tag LOCUS_03370 gene holA 347004 345973 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083456.1 protein_id gnl|my_center|LOCUS_03370 347551 347009 gene locus_tag LOCUS_03380 347551 347009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 350216 347538 gene locus_tag LOCUS_03390 gene leuS 350216 347538 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398680.1 protein_id gnl|my_center|LOCUS_03390 350281 350943 gene locus_tag LOCUS_03400 350281 350943 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 protein_id gnl|my_center|LOCUS_03400 351353 350874 gene locus_tag LOCUS_03410 351353 350874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 351456 351380 gene locus_tag LOCUS_t00060 351456 351380 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 353242 351539 gene locus_tag LOCUS_03420 353242 351539 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083393.1 protein_id gnl|my_center|LOCUS_03420 354779 353253 gene locus_tag LOCUS_03430 354779 353253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 354529 354620 gene locus_tag LOCUS_t00070 354529 354620 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 355566 354847 gene locus_tag LOCUS_03440 355566 354847 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083395.1 protein_id gnl|my_center|LOCUS_03440 356495 355566 gene locus_tag LOCUS_03450 gene hemC 356495 355566 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528908.1 protein_id gnl|my_center|LOCUS_03450 356592 357674 gene locus_tag LOCUS_03460 gene tsaD 356592 357674 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083396.1 protein_id gnl|my_center|LOCUS_03460 357671 358669 gene locus_tag LOCUS_03470 357671 358669 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083397.1 protein_id gnl|my_center|LOCUS_03470 358673 358960 gene locus_tag LOCUS_03480 358673 358960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 358962 359405 gene locus_tag LOCUS_03490 358962 359405 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_03490 360636 359458 gene locus_tag LOCUS_03500 360636 359458 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965168.1 protein_id gnl|my_center|LOCUS_03500 361886 360720 gene locus_tag LOCUS_03510 361886 360720 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965168.1 protein_id gnl|my_center|LOCUS_03510 362178 364130 gene locus_tag LOCUS_03520 gene acs 362178 364130 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_03520 364136 364870 gene locus_tag LOCUS_03530 364136 364870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 364910 366343 gene locus_tag LOCUS_03540 364910 366343 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235885650.1 protein_id gnl|my_center|LOCUS_03540 366906 366376 gene locus_tag LOCUS_03550 366906 366376 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965122.1 protein_id gnl|my_center|LOCUS_03550 367041 367727 gene locus_tag LOCUS_03560 367041 367727 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142830.1 protein_id gnl|my_center|LOCUS_03560 367746 368204 gene locus_tag LOCUS_03570 367746 368204 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083447.1 protein_id gnl|my_center|LOCUS_03570 368367 370667 gene locus_tag LOCUS_03580 368367 370667 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173187.1 protein_id gnl|my_center|LOCUS_03580 371102 370671 gene locus_tag LOCUS_03590 371102 370671 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928811.1 protein_id gnl|my_center|LOCUS_03590 372099 371377 gene locus_tag LOCUS_03600 372099 371377 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529302.1 protein_id gnl|my_center|LOCUS_03600 372210 372935 gene locus_tag LOCUS_03610 372210 372935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299078.1 protein_id gnl|my_center|LOCUS_03610 372938 374917 gene locus_tag LOCUS_03620 372938 374917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 375269 378709 gene locus_tag LOCUS_03630 375269 378709 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082991.1 protein_id gnl|my_center|LOCUS_03630 378725 379108 gene locus_tag LOCUS_03640 378725 379108 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242426.1 protein_id gnl|my_center|LOCUS_03640 379290 380486 gene locus_tag LOCUS_03650 379290 380486 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_03650 380483 381124 gene locus_tag LOCUS_03660 gene metW 380483 381124 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173533.1 protein_id gnl|my_center|LOCUS_03660 382318 381137 gene locus_tag LOCUS_03670 382318 381137 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921469.1 protein_id gnl|my_center|LOCUS_03670 383122 382343 gene locus_tag LOCUS_03680 383122 382343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814560.1 protein_id gnl|my_center|LOCUS_03680 385861 383195 gene locus_tag LOCUS_03690 385861 383195 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085593.1 protein_id gnl|my_center|LOCUS_03690 387071 385863 gene locus_tag LOCUS_03700 387071 385863 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494075.1 protein_id gnl|my_center|LOCUS_03700 387884 387081 gene locus_tag LOCUS_03710 387884 387081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397937.1 protein_id gnl|my_center|LOCUS_03710 388816 387896 gene locus_tag LOCUS_03720 gene ntrB 388816 387896 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973416.1 protein_id gnl|my_center|LOCUS_03720 390227 388905 gene locus_tag LOCUS_03730 390227 388905 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973417.1 protein_id gnl|my_center|LOCUS_03730 391813 390608 gene locus_tag LOCUS_03740 391813 390608 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243154.1 protein_id gnl|my_center|LOCUS_03740 392283 391810 gene locus_tag LOCUS_03750 392283 391810 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_03750 393598 392831 gene locus_tag LOCUS_03760 393598 392831 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_03760 394429 393656 gene locus_tag LOCUS_03770 gene tam 394429 393656 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_03770 396207 394534 gene locus_tag LOCUS_03780 396207 394534 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_03780 397010 396210 gene locus_tag LOCUS_03790 gene hutG 397010 396210 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918842.1 protein_id gnl|my_center|LOCUS_03790 398545 397007 gene locus_tag LOCUS_03800 gene hutH 398545 397007 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036761.1 protein_id gnl|my_center|LOCUS_03800 399696 398545 gene locus_tag LOCUS_03810 gene hutI 399696 398545 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 protein_id gnl|my_center|LOCUS_03810 399810 401171 gene locus_tag LOCUS_03820 399810 401171 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 protein_id gnl|my_center|LOCUS_03820 401780 401244 gene locus_tag LOCUS_03830 401780 401244 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 protein_id gnl|my_center|LOCUS_03830 401964 402962 gene locus_tag LOCUS_03840 401964 402962 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083589.1 protein_id gnl|my_center|LOCUS_03840 404211 403438 gene locus_tag LOCUS_03850 gene moeB 404211 403438 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_03850 404378 404211 gene locus_tag LOCUS_03860 404378 404211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 404466 405377 gene locus_tag LOCUS_03870 gene yihU 404466 405377 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718883.1 protein_id gnl|my_center|LOCUS_03870 407292 405643 gene locus_tag LOCUS_03880 407292 405643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173725.1 protein_id gnl|my_center|LOCUS_03880 407475 410552 gene locus_tag LOCUS_03890 gene addB 407475 410552 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083576.1 protein_id gnl|my_center|LOCUS_03890 410549 413983 gene locus_tag LOCUS_03900 gene addA 410549 413983 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921368.1 protein_id gnl|my_center|LOCUS_03900 414913 413984 gene locus_tag LOCUS_03910 414913 413984 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310200.1 protein_id gnl|my_center|LOCUS_03910 415340 414900 gene locus_tag LOCUS_03920 415340 414900 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083619.1 protein_id gnl|my_center|LOCUS_03920 416785 415394 gene locus_tag LOCUS_03930 416785 415394 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083364.1 protein_id gnl|my_center|LOCUS_03930 417433 416876 gene locus_tag LOCUS_03940 417433 416876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 418508 417522 gene locus_tag LOCUS_03950 418508 417522 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_03950 418720 419088 gene locus_tag LOCUS_03960 418720 419088 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_03960 419058 420677 gene locus_tag LOCUS_03970 419058 420677 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459012.1 protein_id gnl|my_center|LOCUS_03970 420759 421472 gene locus_tag LOCUS_03980 gene radC 420759 421472 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415038.1 protein_id gnl|my_center|LOCUS_03980 421852 421487 gene locus_tag LOCUS_03990 421852 421487 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082918.1 protein_id gnl|my_center|LOCUS_03990 423409 422096 gene locus_tag LOCUS_04000 gene oxlT 423409 422096 CDS product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085934.1 protein_id gnl|my_center|LOCUS_04000 423734 423597 gene locus_tag LOCUS_04010 423734 423597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 424017 424736 gene locus_tag LOCUS_04020 424017 424736 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_04020 424813 426561 gene locus_tag LOCUS_04030 gene oxc 424813 426561 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085941.1 protein_id gnl|my_center|LOCUS_04030 426669 427946 gene locus_tag LOCUS_04040 gene frc 426669 427946 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085940.1 protein_id gnl|my_center|LOCUS_04040 431129 428352 gene locus_tag LOCUS_04050 gene fdhF 431129 428352 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_04050 432838 431126 gene locus_tag LOCUS_04060 432838 431126 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_04060 433228 435405 gene locus_tag LOCUS_04070 433228 435405 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966065.1 protein_id gnl|my_center|LOCUS_04070 435916 437112 gene locus_tag LOCUS_04080 gene sucC 435916 437112 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_04080 437124 438056 gene locus_tag LOCUS_04090 gene sucD 437124 438056 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083285.1 protein_id gnl|my_center|LOCUS_04090 438307 439032 gene locus_tag LOCUS_04100 438307 439032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_04100 440157 439336 gene locus_tag LOCUS_04110 440157 439336 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965702.1 protein_id gnl|my_center|LOCUS_04110 441610 440198 gene locus_tag LOCUS_04120 gene pyk 441610 440198 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114299.1 protein_id gnl|my_center|LOCUS_04120 442702 441674 gene locus_tag LOCUS_04130 442702 441674 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 protein_id gnl|my_center|LOCUS_04130 443614 442706 gene locus_tag LOCUS_04140 443614 442706 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_04140 444923 444129 gene locus_tag LOCUS_04150 gene hyi 444923 444129 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085951.1 protein_id gnl|my_center|LOCUS_04150 446762 444990 gene locus_tag LOCUS_04160 gene gcl 446762 444990 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085950.1 protein_id gnl|my_center|LOCUS_04160 447007 447843 gene locus_tag LOCUS_04170 447007 447843 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392225.1 protein_id gnl|my_center|LOCUS_04170 448721 447840 gene locus_tag LOCUS_04180 gene sucD 448721 447840 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_04180 449897 448725 gene locus_tag LOCUS_04190 gene sucC 449897 448725 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_04190 450096 450659 gene locus_tag LOCUS_04200 450096 450659 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391304.1 protein_id gnl|my_center|LOCUS_04200 450656 451198 gene locus_tag LOCUS_04210 450656 451198 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_04210 451978 451241 gene locus_tag LOCUS_04220 451978 451241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 452684 452013 gene locus_tag LOCUS_04230 gene mtgA 452684 452013 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172627.1 protein_id gnl|my_center|LOCUS_04230 452683 453426 gene locus_tag LOCUS_04240 452683 453426 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528989.1 protein_id gnl|my_center|LOCUS_04240 453475 454410 gene locus_tag LOCUS_04250 453475 454410 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084230.1 protein_id gnl|my_center|LOCUS_04250 454529 457201 gene locus_tag LOCUS_04260 454529 457201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 457942 457241 gene locus_tag LOCUS_04270 457942 457241 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528368.1 protein_id gnl|my_center|LOCUS_04270 458081 458710 gene locus_tag LOCUS_04280 458081 458710 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327682.1 protein_id gnl|my_center|LOCUS_04280 460037 458961 gene locus_tag LOCUS_04290 460037 458961 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965071.1 protein_id gnl|my_center|LOCUS_04290 460295 460044 gene locus_tag LOCUS_04300 gene moaD 460295 460044 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_04300 460888 460292 gene locus_tag LOCUS_04310 gene pgsA 460888 460292 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_04310 461017 461547 gene locus_tag LOCUS_04320 461017 461547 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084158.1 protein_id gnl|my_center|LOCUS_04320 462159 461563 gene locus_tag LOCUS_04330 462159 461563 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 protein_id gnl|my_center|LOCUS_04330 462912 462268 gene locus_tag LOCUS_04340 462912 462268 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_04340 463559 462912 gene locus_tag LOCUS_04350 463559 462912 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 protein_id gnl|my_center|LOCUS_04350 463663 464532 gene locus_tag LOCUS_04360 gene gluQRS 463663 464532 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970092.1 protein_id gnl|my_center|LOCUS_04360 465105 464557 gene locus_tag LOCUS_04370 465105 464557 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_04370 466211 465102 gene locus_tag LOCUS_04380 466211 465102 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_04380 467104 466217 gene locus_tag LOCUS_04390 467104 466217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 468756 467101 gene locus_tag LOCUS_04400 468756 467101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 470241 468997 gene locus_tag LOCUS_04410 470241 468997 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087740.1 protein_id gnl|my_center|LOCUS_04410 470425 470246 gene locus_tag LOCUS_04420 470425 470246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 470539 471021 gene locus_tag LOCUS_04430 470539 471021 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832408.1 protein_id gnl|my_center|LOCUS_04430 471155 472321 gene locus_tag LOCUS_04440 471155 472321 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_04440 473488 472385 gene locus_tag LOCUS_04450 473488 472385 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_04450 474314 473775 gene locus_tag LOCUS_04460 gene mog 474314 473775 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_04460 474927 474358 gene locus_tag LOCUS_04470 474927 474358 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972563.1 protein_id gnl|my_center|LOCUS_04470 475657 475010 gene locus_tag LOCUS_04480 475657 475010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965053.1 protein_id gnl|my_center|LOCUS_04480 476079 475810 gene locus_tag LOCUS_04490 gene rpmA 476079 475810 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709652.1 protein_id gnl|my_center|LOCUS_04490 476836 476147 gene locus_tag LOCUS_04500 476836 476147 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529062.1 protein_id gnl|my_center|LOCUS_04500 477157 477246 gene locus_tag LOCUS_t00080 477157 477246 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 478881 477490 gene locus_tag LOCUS_04510 478881 477490 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083720.1 protein_id gnl|my_center|LOCUS_04510 479133 479990 gene locus_tag LOCUS_04520 479133 479990 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085801.1 protein_id gnl|my_center|LOCUS_04520 480301 481170 gene locus_tag LOCUS_04530 480301 481170 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269056.1 protein_id gnl|my_center|LOCUS_04530 481778 482671 gene locus_tag LOCUS_04540 gene pdgB 481778 482671 CDS product diguanylate cyclase PdgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071093.1 protein_id gnl|my_center|LOCUS_04540 483022 486024 gene locus_tag LOCUS_04550 483022 486024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 487763 486339 gene locus_tag LOCUS_04560 487763 486339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 489507 487765 gene locus_tag LOCUS_04570 489507 487765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 490456 489944 gene locus_tag LOCUS_04580 490456 489944 CDS product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830214.1 protein_id gnl|my_center|LOCUS_04580 491504 490596 gene locus_tag LOCUS_04590 491504 490596 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 protein_id gnl|my_center|LOCUS_04590 491705 492568 gene locus_tag LOCUS_04600 491705 492568 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067698.1 protein_id gnl|my_center|LOCUS_04600 494584 494207 gene locus_tag LOCUS_04610 494584 494207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 495160 494726 gene locus_tag LOCUS_04620 495160 494726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 495351 495686 gene locus_tag LOCUS_04630 495351 495686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 495858 496571 gene locus_tag LOCUS_04640 495858 496571 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_04640 496568 497890 gene locus_tag LOCUS_04650 496568 497890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 497887 498372 gene locus_tag LOCUS_04660 497887 498372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 498443 499963 gene locus_tag LOCUS_04670 498443 499963 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_04670 500016 501272 gene locus_tag LOCUS_04680 500016 501272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 501287 504541 gene locus_tag LOCUS_04690 501287 504541 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007003880.1 protein_id gnl|my_center|LOCUS_04690 504743 505549 gene locus_tag LOCUS_04700 504743 505549 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_04700 505896 506351 gene locus_tag LOCUS_04710 505896 506351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174612.1 protein_id gnl|my_center|LOCUS_04710 506437 507033 gene locus_tag LOCUS_04720 506437 507033 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083844.1 protein_id gnl|my_center|LOCUS_04720 507100 508137 gene locus_tag LOCUS_04730 507100 508137 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_04730 508489 508178 gene locus_tag LOCUS_04740 508489 508178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 509207 508500 gene locus_tag LOCUS_04750 509207 508500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 510204 509317 gene locus_tag LOCUS_04760 510204 509317 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_04760 512021 510201 gene locus_tag LOCUS_04770 512021 510201 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_04770 512797 512018 gene locus_tag LOCUS_04780 512797 512018 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366338.1 protein_id gnl|my_center|LOCUS_04780 512883 513725 gene locus_tag LOCUS_04790 512883 513725 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812449.1 protein_id gnl|my_center|LOCUS_04790 515200 513998 gene locus_tag LOCUS_04800 515200 513998 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_04800 515393 515986 gene locus_tag LOCUS_04810 515393 515986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 515983 517464 gene locus_tag LOCUS_04820 515983 517464 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_04820 517466 517966 gene locus_tag LOCUS_04830 517466 517966 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_04830 517968 519575 gene locus_tag LOCUS_04840 517968 519575 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_04840 519584 520420 gene locus_tag LOCUS_04850 519584 520420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_04850 520417 522369 gene locus_tag LOCUS_04860 520417 522369 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_04860 522369 523256 gene locus_tag LOCUS_04870 522369 523256 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_04870 523263 524336 gene locus_tag LOCUS_04880 523263 524336 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_04880 524370 525635 gene locus_tag LOCUS_04890 524370 525635 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528156.1 protein_id gnl|my_center|LOCUS_04890 525724 526515 gene locus_tag LOCUS_04900 525724 526515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_04900 527461 526523 gene locus_tag LOCUS_04910 527461 526523 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976359.1 protein_id gnl|my_center|LOCUS_04910 527561 528997 gene locus_tag LOCUS_04920 527561 528997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_04920 529085 529411 gene locus_tag LOCUS_04930 529085 529411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 530661 529417 gene locus_tag LOCUS_04940 530661 529417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528114.1 protein_id gnl|my_center|LOCUS_04940 531032 530658 gene locus_tag LOCUS_04950 531032 530658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 533160 531043 gene locus_tag LOCUS_04960 533160 531043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 533582 534754 gene locus_tag LOCUS_04970 533582 534754 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_04970 534879 536558 gene locus_tag LOCUS_04980 534879 536558 CDS product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973126.1 protein_id gnl|my_center|LOCUS_04980 536647 537558 gene locus_tag LOCUS_04990 536647 537558 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528834.1 protein_id gnl|my_center|LOCUS_04990 539160 537793 gene locus_tag LOCUS_05000 539160 537793 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_05000 540137 539295 gene locus_tag LOCUS_05010 540137 539295 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967312.1 protein_id gnl|my_center|LOCUS_05010 540484 541212 gene locus_tag LOCUS_05020 540484 541212 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174613.1 protein_id gnl|my_center|LOCUS_05020 541330 542646 gene locus_tag LOCUS_05030 541330 542646 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_05030 542643 544115 gene locus_tag LOCUS_05040 542643 544115 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_05040 544189 545007 gene locus_tag LOCUS_05050 544189 545007 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257241.1 protein_id gnl|my_center|LOCUS_05050 547084 545294 gene locus_tag LOCUS_05060 547084 545294 CDS product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084139.1 protein_id gnl|my_center|LOCUS_05060 548387 547194 gene locus_tag LOCUS_05070 548387 547194 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968375.1 protein_id gnl|my_center|LOCUS_05070 549717 548392 gene locus_tag LOCUS_05080 gene deoA 549717 548392 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707412.1 protein_id gnl|my_center|LOCUS_05080 550512 549748 gene locus_tag LOCUS_05090 gene deoC 550512 549748 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309955.1 protein_id gnl|my_center|LOCUS_05090 551306 550509 gene locus_tag LOCUS_05100 551306 550509 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719365.1 protein_id gnl|my_center|LOCUS_05100 551704 551303 gene locus_tag LOCUS_05110 551704 551303 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564559.1 protein_id gnl|my_center|LOCUS_05110 552678 551701 gene locus_tag LOCUS_05120 552678 551701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067541.1 protein_id gnl|my_center|LOCUS_05120 553798 552692 gene locus_tag LOCUS_05130 553798 552692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970668.1 protein_id gnl|my_center|LOCUS_05130 555324 553795 gene locus_tag LOCUS_05140 555324 553795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_05140 556061 555321 gene locus_tag LOCUS_05150 556061 555321 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_05150 557068 556058 gene locus_tag LOCUS_05160 557068 556058 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 protein_id gnl|my_center|LOCUS_05160 557311 559659 gene locus_tag LOCUS_05170 557311 559659 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_05170 559788 560006 gene locus_tag LOCUS_05180 559788 560006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 560929 560027 gene locus_tag LOCUS_05190 560929 560027 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_05190 561142 561519 gene locus_tag LOCUS_05200 gene hisE 561142 561519 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084141.1 protein_id gnl|my_center|LOCUS_05200 562165 561545 gene locus_tag LOCUS_05210 562165 561545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 562465 562175 gene locus_tag LOCUS_05220 562465 562175 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_05220 563448 562567 gene locus_tag LOCUS_05230 563448 562567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_05230 564244 563459 gene locus_tag LOCUS_05240 564244 563459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_05240 565365 564313 gene locus_tag LOCUS_05250 565365 564313 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_05250 566701 565889 gene locus_tag LOCUS_05260 566701 565889 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966645.1 protein_id gnl|my_center|LOCUS_05260 566923 568602 gene locus_tag LOCUS_05270 566923 568602 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_05270 568663 570306 gene locus_tag LOCUS_05280 gene purH 568663 570306 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083410.1 protein_id gnl|my_center|LOCUS_05280 570374 570760 gene locus_tag LOCUS_05290 570374 570760 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_05290 572574 571123 gene locus_tag LOCUS_05300 572574 571123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_05300 573161 572598 gene locus_tag LOCUS_05310 573161 572598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 573275 575026 gene locus_tag LOCUS_05320 gene ggt 573275 575026 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083412.1 protein_id gnl|my_center|LOCUS_05320 575755 575051 gene locus_tag LOCUS_05330 575755 575051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_05330 576518 575766 gene locus_tag LOCUS_05340 576518 575766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_05340 577594 576515 gene locus_tag LOCUS_05350 577594 576515 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_05350 578459 577587 gene locus_tag LOCUS_05360 578459 577587 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_05360 579739 578549 gene locus_tag LOCUS_05370 579739 578549 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172709.1 protein_id gnl|my_center|LOCUS_05370 580485 579850 gene locus_tag LOCUS_05380 580485 579850 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531256.1 protein_id gnl|my_center|LOCUS_05380 581615 580572 gene locus_tag LOCUS_05390 gene gtdA 581615 580572 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082942.1 protein_id gnl|my_center|LOCUS_05390 581743 582375 gene locus_tag LOCUS_05400 gene maiA 581743 582375 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082941.1 protein_id gnl|my_center|LOCUS_05400 582495 582959 gene locus_tag LOCUS_05410 582495 582959 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966628.1 protein_id gnl|my_center|LOCUS_05410 583784 582990 gene locus_tag LOCUS_05420 583784 582990 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384059.1 protein_id gnl|my_center|LOCUS_05420 584204 583791 gene locus_tag LOCUS_05430 584204 583791 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 protein_id gnl|my_center|LOCUS_05430 584315 585445 gene locus_tag LOCUS_05440 584315 585445 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175116.1 protein_id gnl|my_center|LOCUS_05440 585442 587073 gene locus_tag LOCUS_05450 585442 587073 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082939.1 protein_id gnl|my_center|LOCUS_05450 587086 588081 gene locus_tag LOCUS_05460 587086 588081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 588166 589140 gene locus_tag LOCUS_05470 588166 589140 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_05470 589137 590504 gene locus_tag LOCUS_05480 589137 590504 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929583.1 protein_id gnl|my_center|LOCUS_05480 590501 591223 gene locus_tag LOCUS_05490 590501 591223 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 protein_id gnl|my_center|LOCUS_05490 591220 592053 gene locus_tag LOCUS_05500 591220 592053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 592210 592584 gene locus_tag LOCUS_05510 592210 592584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 593637 592663 gene locus_tag LOCUS_05520 593637 592663 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083359.1 protein_id gnl|my_center|LOCUS_05520 593889 594551 gene locus_tag LOCUS_05530 593889 594551 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329550.1 protein_id gnl|my_center|LOCUS_05530 594581 595300 gene locus_tag LOCUS_05540 594581 595300 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_05540 597322 595319 gene locus_tag LOCUS_05550 gene uvrC 597322 595319 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532481.1 protein_id gnl|my_center|LOCUS_05550 598182 597397 gene locus_tag LOCUS_05560 598182 597397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 protein_id gnl|my_center|LOCUS_05560 598726 599394 gene locus_tag LOCUS_05570 598726 599394 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967292.1 protein_id gnl|my_center|LOCUS_05570 599541 600305 gene locus_tag LOCUS_05580 599541 600305 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083300.1 protein_id gnl|my_center|LOCUS_05580 600310 600507 gene locus_tag LOCUS_05590 600310 600507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 600504 601076 gene locus_tag LOCUS_05600 600504 601076 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083302.1 protein_id gnl|my_center|LOCUS_05600 601851 601480 gene locus_tag LOCUS_05610 601851 601480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 603262 601856 gene locus_tag LOCUS_05620 603262 601856 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_05620 603523 604959 gene locus_tag LOCUS_05630 603523 604959 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529731.1 protein_id gnl|my_center|LOCUS_05630 605093 606373 gene locus_tag LOCUS_05640 605093 606373 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_05640 606472 607539 gene locus_tag LOCUS_05650 606472 607539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_05650 607536 608342 gene locus_tag LOCUS_05660 gene fabG 607536 608342 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_05660 608351 609775 gene locus_tag LOCUS_05670 608351 609775 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_05670 609807 610712 gene locus_tag LOCUS_05680 609807 610712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_05680 610714 611493 gene locus_tag LOCUS_05690 610714 611493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_05690 611532 612554 gene locus_tag LOCUS_05700 611532 612554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338610.1 protein_id gnl|my_center|LOCUS_05700 612593 614035 gene locus_tag LOCUS_05710 612593 614035 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_05710 614093 615196 gene locus_tag LOCUS_05720 614093 615196 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 protein_id gnl|my_center|LOCUS_05720 615596 616741 gene locus_tag LOCUS_05730 615596 616741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_05730 616747 617649 gene locus_tag LOCUS_05740 616747 617649 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530250.1 protein_id gnl|my_center|LOCUS_05740 617646 618440 gene locus_tag LOCUS_05750 617646 618440 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974521.1 protein_id gnl|my_center|LOCUS_05750 618548 619387 gene locus_tag LOCUS_05760 gene tesB 618548 619387 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174978.1 protein_id gnl|my_center|LOCUS_05760 619701 620027 gene locus_tag LOCUS_05770 619701 620027 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142813.1 protein_id gnl|my_center|LOCUS_05770 620069 621562 gene locus_tag LOCUS_05780 620069 621562 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965116.1 protein_id gnl|my_center|LOCUS_05780 621786 624497 gene locus_tag LOCUS_05790 621786 624497 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992362.1 protein_id gnl|my_center|LOCUS_05790 624571 625449 gene locus_tag LOCUS_05800 624571 625449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 626756 625749 gene locus_tag LOCUS_05810 626756 625749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529399.1 protein_id gnl|my_center|LOCUS_05810 627436 626750 gene locus_tag LOCUS_05820 gene ftsE 627436 626750 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544305.1 protein_id gnl|my_center|LOCUS_05820 627826 628722 gene locus_tag LOCUS_05830 627826 628722 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965355.1 protein_id gnl|my_center|LOCUS_05830 628800 629330 gene locus_tag LOCUS_05840 gene hpt 628800 629330 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527423.1 protein_id gnl|my_center|LOCUS_05840 629338 629721 gene locus_tag LOCUS_05850 629338 629721 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 protein_id gnl|my_center|LOCUS_05850 630281 629745 gene locus_tag LOCUS_05860 gene ppa 630281 629745 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528997.1 protein_id gnl|my_center|LOCUS_05860 630928 630419 gene locus_tag LOCUS_05870 630928 630419 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136728.1 protein_id gnl|my_center|LOCUS_05870 632098 631127 gene locus_tag LOCUS_05880 632098 631127 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533012.1 protein_id gnl|my_center|LOCUS_05880 632591 632286 gene locus_tag LOCUS_05890 gene rpmB 632591 632286 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082994.1 protein_id gnl|my_center|LOCUS_05890 632765 633853 gene locus_tag LOCUS_05900 632765 633853 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_05900 633935 634684 gene locus_tag LOCUS_05910 633935 634684 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_05910 634689 635312 gene locus_tag LOCUS_05920 634689 635312 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640024.1 protein_id gnl|my_center|LOCUS_05920 635416 635826 gene locus_tag LOCUS_05930 635416 635826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 635844 636818 gene locus_tag LOCUS_05940 635844 636818 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_05940 636978 642359 gene locus_tag LOCUS_05950 636978 642359 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087210.1 protein_id gnl|my_center|LOCUS_05950 642356 644428 gene locus_tag LOCUS_05960 gene pbpC 642356 644428 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494094.1 protein_id gnl|my_center|LOCUS_05960 645047 644415 gene locus_tag LOCUS_05970 645047 644415 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090341.1 protein_id gnl|my_center|LOCUS_05970 645188 645889 gene locus_tag LOCUS_05980 645188 645889 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090340.1 protein_id gnl|my_center|LOCUS_05980 645951 646226 gene locus_tag LOCUS_05990 645951 646226 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 protein_id gnl|my_center|LOCUS_05990 646351 647082 gene locus_tag LOCUS_06000 646351 647082 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524255.1 protein_id gnl|my_center|LOCUS_06000 647152 647457 gene locus_tag LOCUS_06010 647152 647457 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 protein_id gnl|my_center|LOCUS_06010 648036 647503 gene locus_tag LOCUS_06020 648036 647503 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 protein_id gnl|my_center|LOCUS_06020 649244 648132 gene locus_tag LOCUS_06030 649244 648132 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456661.1 protein_id gnl|my_center|LOCUS_06030 650965 649382 gene locus_tag LOCUS_06040 650965 649382 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 protein_id gnl|my_center|LOCUS_06040 651338 652375 gene locus_tag LOCUS_06050 651338 652375 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083332.1 protein_id gnl|my_center|LOCUS_06050 652451 652750 gene locus_tag LOCUS_06060 652451 652750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 653426 652755 gene locus_tag LOCUS_06070 653426 652755 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970569.1 protein_id gnl|my_center|LOCUS_06070 654778 653513 gene locus_tag LOCUS_06080 gene lysA 654778 653513 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529408.1 protein_id gnl|my_center|LOCUS_06080 655087 654782 gene locus_tag LOCUS_06090 655087 654782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 656484 655156 gene locus_tag LOCUS_06100 656484 655156 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_06100 656915 658567 gene locus_tag LOCUS_06110 656915 658567 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965915.1 protein_id gnl|my_center|LOCUS_06110 658697 658545 gene locus_tag LOCUS_06120 658697 658545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence02 1913 285 gene locus_tag LOCUS_06130 1913 285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 protein_id gnl|my_center|LOCUS_06130 2725 1910 gene locus_tag LOCUS_06140 2725 1910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 protein_id gnl|my_center|LOCUS_06140 3678 2731 gene locus_tag LOCUS_06150 3678 2731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 protein_id gnl|my_center|LOCUS_06150 5284 3707 gene locus_tag LOCUS_06160 5284 3707 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_06160 6396 5281 gene locus_tag LOCUS_06170 6396 5281 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_06170 6996 6712 gene locus_tag LOCUS_06180 6996 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7212 7481 gene locus_tag LOCUS_06190 7212 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7730 7485 gene locus_tag LOCUS_06200 7730 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 7936 10263 gene locus_tag LOCUS_06210 7936 10263 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399174.1 protein_id gnl|my_center|LOCUS_06210 11050 10301 gene locus_tag LOCUS_06220 11050 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089885.1 protein_id gnl|my_center|LOCUS_06220 13826 11517 gene locus_tag LOCUS_06230 13826 11517 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089886.1 protein_id gnl|my_center|LOCUS_06230 15215 13977 gene locus_tag LOCUS_06240 15215 13977 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085256.1 protein_id gnl|my_center|LOCUS_06240 15493 15212 gene locus_tag LOCUS_06250 15493 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 16155 15493 gene locus_tag LOCUS_06260 16155 15493 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967402.1 protein_id gnl|my_center|LOCUS_06260 16742 16152 gene locus_tag LOCUS_06270 16742 16152 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175034.1 protein_id gnl|my_center|LOCUS_06270 16895 17896 gene locus_tag LOCUS_06280 16895 17896 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085252.1 protein_id gnl|my_center|LOCUS_06280 17905 18846 gene locus_tag LOCUS_06290 17905 18846 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085251.1 protein_id gnl|my_center|LOCUS_06290 18849 21698 gene locus_tag LOCUS_06300 18849 21698 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_06300 21702 23783 gene locus_tag LOCUS_06310 21702 23783 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_06310 24122 23808 gene locus_tag LOCUS_06320 24122 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 24719 24210 gene locus_tag LOCUS_06330 24719 24210 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 protein_id gnl|my_center|LOCUS_06330 25456 25193 gene locus_tag LOCUS_06340 25456 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 25368 25673 gene locus_tag LOCUS_06350 25368 25673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 26503 25655 gene locus_tag LOCUS_06360 26503 25655 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396530.1 protein_id gnl|my_center|LOCUS_06360 27065 26589 gene locus_tag LOCUS_06370 27065 26589 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085245.1 protein_id gnl|my_center|LOCUS_06370 27242 27361 gene locus_tag LOCUS_06380 27242 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 28600 27500 gene locus_tag LOCUS_06390 28600 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 28804 29658 gene locus_tag LOCUS_06400 28804 29658 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_06400 30191 29772 gene locus_tag LOCUS_06410 gene fliJ 30191 29772 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_06410 31712 30387 gene locus_tag LOCUS_06420 gene fliI 31712 30387 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084989.1 protein_id gnl|my_center|LOCUS_06420 32546 33193 gene locus_tag LOCUS_06430 32546 33193 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138878.1 protein_id gnl|my_center|LOCUS_06430 33455 33853 gene locus_tag LOCUS_06440 33455 33853 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966793.1 protein_id gnl|my_center|LOCUS_06440 34147 35124 gene locus_tag LOCUS_06450 gene cysK 34147 35124 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_06450 36863 35214 gene locus_tag LOCUS_06460 36863 35214 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_06460 38649 37021 gene locus_tag LOCUS_06470 38649 37021 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_06470 39093 39821 gene locus_tag LOCUS_06480 39093 39821 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_06480 40821 39922 gene locus_tag LOCUS_06490 40821 39922 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 protein_id gnl|my_center|LOCUS_06490 40954 42165 gene locus_tag LOCUS_06500 40954 42165 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065120.1 protein_id gnl|my_center|LOCUS_06500 42178 43035 gene locus_tag LOCUS_06510 42178 43035 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_06510 43800 43045 gene locus_tag LOCUS_06520 43800 43045 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921315.1 protein_id gnl|my_center|LOCUS_06520 44892 44023 gene locus_tag LOCUS_06530 44892 44023 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_06530 46070 44889 gene locus_tag LOCUS_06540 46070 44889 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084984.1 protein_id gnl|my_center|LOCUS_06540 46497 46132 gene locus_tag LOCUS_06550 46497 46132 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_06550 47014 46526 gene locus_tag LOCUS_06560 47014 46526 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 protein_id gnl|my_center|LOCUS_06560 49691 46998 gene locus_tag LOCUS_06570 49691 46998 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_06570 50538 49882 gene locus_tag LOCUS_06580 50538 49882 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 protein_id gnl|my_center|LOCUS_06580 51363 50668 gene locus_tag LOCUS_06590 51363 50668 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529237.1 protein_id gnl|my_center|LOCUS_06590 51717 51959 gene locus_tag LOCUS_06600 51717 51959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 52180 53058 gene locus_tag LOCUS_06610 52180 53058 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529652.1 protein_id gnl|my_center|LOCUS_06610 53869 53069 gene locus_tag LOCUS_06620 53869 53069 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_06620 54413 53931 gene locus_tag LOCUS_06630 54413 53931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 54719 54426 gene locus_tag LOCUS_06640 54719 54426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 56192 54792 gene locus_tag LOCUS_06650 56192 54792 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089861.1 protein_id gnl|my_center|LOCUS_06650 56685 56203 gene locus_tag LOCUS_06660 56685 56203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 57916 56696 gene locus_tag LOCUS_06670 57916 56696 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_06670 58165 58019 gene locus_tag LOCUS_06680 58165 58019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 58878 58273 gene locus_tag LOCUS_06690 58878 58273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 59879 58989 gene locus_tag LOCUS_06700 59879 58989 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_06700 60008 60253 gene locus_tag LOCUS_06710 60008 60253 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329758.1 protein_id gnl|my_center|LOCUS_06710 61288 60398 gene locus_tag LOCUS_06720 61288 60398 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_06720 63366 61489 gene locus_tag LOCUS_06730 63366 61489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 65373 63658 gene locus_tag LOCUS_06740 65373 63658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 66943 65459 gene locus_tag LOCUS_06750 66943 65459 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089866.1 protein_id gnl|my_center|LOCUS_06750 68066 67047 gene locus_tag LOCUS_06760 68066 67047 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090884.1 protein_id gnl|my_center|LOCUS_06760 68890 68066 gene locus_tag LOCUS_06770 68890 68066 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088645.1 protein_id gnl|my_center|LOCUS_06770 69134 69814 gene locus_tag LOCUS_06780 69134 69814 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089732.1 protein_id gnl|my_center|LOCUS_06780 69960 71804 gene locus_tag LOCUS_06790 69960 71804 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 protein_id gnl|my_center|LOCUS_06790 71804 72235 gene locus_tag LOCUS_06800 71804 72235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 72351 72782 gene locus_tag LOCUS_06810 72351 72782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 73074 73334 gene locus_tag LOCUS_06820 73074 73334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_06820 73331 73729 gene locus_tag LOCUS_06830 73331 73729 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_06830 73807 75171 gene locus_tag LOCUS_06840 73807 75171 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 protein_id gnl|my_center|LOCUS_06840 75234 75599 gene locus_tag LOCUS_06850 75234 75599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 75599 75901 gene locus_tag LOCUS_06860 75599 75901 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 protein_id gnl|my_center|LOCUS_06860 75954 76916 gene locus_tag LOCUS_06870 gene ispH 75954 76916 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084132.1 protein_id gnl|my_center|LOCUS_06870 76930 77892 gene locus_tag LOCUS_06880 76930 77892 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392593.1 protein_id gnl|my_center|LOCUS_06880 77889 78344 gene locus_tag LOCUS_06890 gene rnhA 77889 78344 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_06890 78401 79864 gene locus_tag LOCUS_06900 78401 79864 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965463.1 protein_id gnl|my_center|LOCUS_06900 80003 80506 gene locus_tag LOCUS_06910 80003 80506 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557493.1 protein_id gnl|my_center|LOCUS_06910 81028 80543 gene locus_tag LOCUS_06920 81028 80543 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241131.1 protein_id gnl|my_center|LOCUS_06920 82007 81153 gene locus_tag LOCUS_06930 82007 81153 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084307.1 protein_id gnl|my_center|LOCUS_06930 82163 82783 gene locus_tag LOCUS_06940 82163 82783 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_06940 83163 82804 gene locus_tag LOCUS_06950 83163 82804 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_06950 84122 83256 gene locus_tag LOCUS_06960 84122 83256 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972425.1 protein_id gnl|my_center|LOCUS_06960 84233 85234 gene locus_tag LOCUS_06970 84233 85234 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228161.1 protein_id gnl|my_center|LOCUS_06970 85331 86770 gene locus_tag LOCUS_06980 gene pyk 85331 86770 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089873.1 protein_id gnl|my_center|LOCUS_06980 86824 87624 gene locus_tag LOCUS_06990 86824 87624 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929763.1 protein_id gnl|my_center|LOCUS_06990 88568 87621 gene locus_tag LOCUS_07000 88568 87621 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967317.1 protein_id gnl|my_center|LOCUS_07000 89264 88629 gene locus_tag LOCUS_07010 89264 88629 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967322.1 protein_id gnl|my_center|LOCUS_07010 89471 89346 gene locus_tag LOCUS_07020 gene ykgO 89471 89346 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006611362.1 protein_id gnl|my_center|LOCUS_07020 89785 90138 gene locus_tag LOCUS_07030 89785 90138 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965925.1 protein_id gnl|my_center|LOCUS_07030 91821 90220 gene locus_tag LOCUS_07040 91821 90220 CDS product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 protein_id gnl|my_center|LOCUS_07040 92637 92059 gene locus_tag LOCUS_07050 92637 92059 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532299.1 protein_id gnl|my_center|LOCUS_07050 93707 92634 gene locus_tag LOCUS_07060 93707 92634 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 protein_id gnl|my_center|LOCUS_07060 93856 95487 gene locus_tag LOCUS_07070 93856 95487 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528039.1 protein_id gnl|my_center|LOCUS_07070 96224 95469 gene locus_tag LOCUS_07080 96224 95469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 97194 96466 gene locus_tag LOCUS_07090 97194 96466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 97891 97295 gene locus_tag LOCUS_07100 97891 97295 CDS product protein-S-isoprenylcysteine O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328453.1 protein_id gnl|my_center|LOCUS_07100 99120 97888 gene locus_tag LOCUS_07110 99120 97888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971913.1 protein_id gnl|my_center|LOCUS_07110 99457 100311 gene locus_tag LOCUS_07120 99457 100311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 100397 101353 gene locus_tag LOCUS_07130 100397 101353 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088467.1 protein_id gnl|my_center|LOCUS_07130 101962 101630 gene locus_tag LOCUS_07140 101962 101630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 103749 101959 gene locus_tag LOCUS_07150 103749 101959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 103988 104278 gene locus_tag LOCUS_07160 103988 104278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 105700 104309 gene locus_tag LOCUS_07170 105700 104309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 106701 105838 gene locus_tag LOCUS_07180 106701 105838 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968177.1 protein_id gnl|my_center|LOCUS_07180 107800 106910 gene locus_tag LOCUS_07190 107800 106910 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114850.1 protein_id gnl|my_center|LOCUS_07190 108240 107797 gene locus_tag LOCUS_07200 108240 107797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 109895 108237 gene locus_tag LOCUS_07210 109895 108237 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 protein_id gnl|my_center|LOCUS_07210 110047 111180 gene locus_tag LOCUS_07220 110047 111180 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268532.1 protein_id gnl|my_center|LOCUS_07220 111230 112255 gene locus_tag LOCUS_07230 111230 112255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 112472 112266 gene locus_tag LOCUS_07240 112472 112266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 113762 112743 gene locus_tag LOCUS_07250 113762 112743 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_07250 114737 113934 gene locus_tag LOCUS_07260 114737 113934 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090007.1 protein_id gnl|my_center|LOCUS_07260 115113 116276 gene locus_tag LOCUS_07270 115113 116276 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089195.1 protein_id gnl|my_center|LOCUS_07270 116281 117285 gene locus_tag LOCUS_07280 116281 117285 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089194.1 protein_id gnl|my_center|LOCUS_07280 117279 118073 gene locus_tag LOCUS_07290 117279 118073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 protein_id gnl|my_center|LOCUS_07290 118120 118731 gene locus_tag LOCUS_07300 118120 118731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 118770 119915 gene locus_tag LOCUS_07310 118770 119915 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089192.1 protein_id gnl|my_center|LOCUS_07310 120284 120694 gene locus_tag LOCUS_07320 120284 120694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 122170 120743 gene locus_tag LOCUS_07330 122170 120743 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_07330 123652 122237 gene locus_tag LOCUS_07340 gene mdtD 123652 122237 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185818.1 protein_id gnl|my_center|LOCUS_07340 125456 123720 gene locus_tag LOCUS_07350 125456 123720 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240434.1 protein_id gnl|my_center|LOCUS_07350 127322 125697 gene locus_tag LOCUS_07360 gene fadD8 127322 125697 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 protein_id gnl|my_center|LOCUS_07360 127565 129535 gene locus_tag LOCUS_07370 127565 129535 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_07370 129535 133848 gene locus_tag LOCUS_07380 129535 133848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 133856 134653 gene locus_tag LOCUS_07390 133856 134653 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970345.1 protein_id gnl|my_center|LOCUS_07390 134783 135136 gene locus_tag LOCUS_07400 134783 135136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 135295 136521 gene locus_tag LOCUS_07410 135295 136521 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084331.1 protein_id gnl|my_center|LOCUS_07410 136555 139725 gene locus_tag LOCUS_07420 136555 139725 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084332.1 protein_id gnl|my_center|LOCUS_07420 143105 139770 gene locus_tag LOCUS_07430 143105 139770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07430 143591 144655 gene locus_tag LOCUS_07440 143591 144655 CDS product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 protein_id gnl|my_center|LOCUS_07440 145696 144746 gene locus_tag LOCUS_07450 145696 144746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_07450 146316 145693 gene locus_tag LOCUS_07460 146316 145693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 147475 146372 gene locus_tag LOCUS_07470 147475 146372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 148618 147539 gene locus_tag LOCUS_07480 148618 147539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 148757 149719 gene locus_tag LOCUS_07490 148757 149719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 150057 152591 gene locus_tag LOCUS_07500 150057 152591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 153801 152779 gene locus_tag LOCUS_07510 153801 152779 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168991739.1 protein_id gnl|my_center|LOCUS_07510 154807 154232 gene locus_tag LOCUS_07520 154807 154232 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225507.1 protein_id gnl|my_center|LOCUS_07520 154913 155593 gene locus_tag LOCUS_07530 154913 155593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 155929 155854 gene locus_tag LOCUS_t00090 155929 155854 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 156399 156049 gene locus_tag LOCUS_07540 156399 156049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 156425 157408 gene locus_tag LOCUS_07550 156425 157408 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090071.1 protein_id gnl|my_center|LOCUS_07550 157729 158628 gene locus_tag LOCUS_07560 gene rpoH 157729 158628 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090072.1 protein_id gnl|my_center|LOCUS_07560 160337 158709 gene locus_tag LOCUS_07570 160337 158709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 161675 160386 gene locus_tag LOCUS_07580 161675 160386 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066835.1 protein_id gnl|my_center|LOCUS_07580 163487 161835 gene locus_tag LOCUS_07590 163487 161835 CDS product mucoidy inhibitor MuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_07590 164449 163634 gene locus_tag LOCUS_07600 gene pstB 164449 163634 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529271.1 protein_id gnl|my_center|LOCUS_07600 166319 164481 gene locus_tag LOCUS_07610 166319 164481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 167691 166312 gene locus_tag LOCUS_07620 gene pstC 167691 166312 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_07620 168815 167712 gene locus_tag LOCUS_07630 168815 167712 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_07630 169038 169922 gene locus_tag LOCUS_07640 169038 169922 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066836.1 protein_id gnl|my_center|LOCUS_07640 170510 169932 gene locus_tag LOCUS_07650 170510 169932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 172258 170672 gene locus_tag LOCUS_07660 gene serA 172258 170672 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_07660 173512 172337 gene locus_tag LOCUS_07670 173512 172337 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_07670 175539 174010 gene locus_tag LOCUS_07680 175539 174010 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066726.1 protein_id gnl|my_center|LOCUS_07680 176723 175905 gene locus_tag LOCUS_07690 176723 175905 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973269.1 protein_id gnl|my_center|LOCUS_07690 178143 177292 gene locus_tag LOCUS_07700 178143 177292 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174704.1 protein_id gnl|my_center|LOCUS_07700 179694 178348 gene locus_tag LOCUS_07710 gene glmM 179694 178348 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174702.1 protein_id gnl|my_center|LOCUS_07710 180587 179856 gene locus_tag LOCUS_07720 180587 179856 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338008.1 protein_id gnl|my_center|LOCUS_07720 180960 180655 gene locus_tag LOCUS_07730 180960 180655 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 protein_id gnl|my_center|LOCUS_07730 181099 181500 gene locus_tag LOCUS_07740 181099 181500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 182411 181620 gene locus_tag LOCUS_07750 182411 181620 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976335.1 protein_id gnl|my_center|LOCUS_07750 182537 183418 gene locus_tag LOCUS_07760 182537 183418 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_07760 184429 183419 gene locus_tag LOCUS_07770 184429 183419 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_07770 187631 184797 gene locus_tag LOCUS_07780 187631 184797 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173457.1 protein_id gnl|my_center|LOCUS_07780 187533 187778 gene locus_tag LOCUS_07790 187533 187778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 189013 187895 gene locus_tag LOCUS_07800 189013 187895 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_07800 191016 189097 gene locus_tag LOCUS_07810 gene ftsH 191016 189097 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089881.1 protein_id gnl|my_center|LOCUS_07810 192439 191402 gene locus_tag LOCUS_07820 gene tilS 192439 191402 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089882.1 protein_id gnl|my_center|LOCUS_07820 193448 192426 gene locus_tag LOCUS_07830 gene ybgF 193448 192426 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173009.1 protein_id gnl|my_center|LOCUS_07830 194173 193667 gene locus_tag LOCUS_07840 gene pal 194173 193667 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089884.1 protein_id gnl|my_center|LOCUS_07840 195077 194607 gene locus_tag LOCUS_07850 195077 194607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 195213 196028 gene locus_tag LOCUS_07860 195213 196028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 196151 198274 gene locus_tag LOCUS_07870 196151 198274 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 protein_id gnl|my_center|LOCUS_07870 199675 198314 gene locus_tag LOCUS_07880 199675 198314 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921555.1 protein_id gnl|my_center|LOCUS_07880 200225 199770 gene locus_tag LOCUS_07890 200225 199770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 200452 201819 gene locus_tag LOCUS_07900 200452 201819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 202124 201957 gene locus_tag LOCUS_07910 202124 201957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 202520 202236 gene locus_tag LOCUS_07920 202520 202236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 202440 203381 gene locus_tag LOCUS_07930 202440 203381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 204711 203386 gene locus_tag LOCUS_07940 gene tolB 204711 203386 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173006.1 protein_id gnl|my_center|LOCUS_07940 205993 204773 gene locus_tag LOCUS_07950 205993 204773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 206462 206010 gene locus_tag LOCUS_07960 gene tolR 206462 206010 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310275.1 protein_id gnl|my_center|LOCUS_07960 207213 206473 gene locus_tag LOCUS_07970 gene tolQ 207213 206473 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_07970 208249 207524 gene locus_tag LOCUS_07980 208249 207524 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845492.1 protein_id gnl|my_center|LOCUS_07980 208757 208305 gene locus_tag LOCUS_07990 gene ybgC 208757 208305 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089947.1 protein_id gnl|my_center|LOCUS_07990 209905 208859 gene locus_tag LOCUS_08000 gene ruvB 209905 208859 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094976806.1 protein_id gnl|my_center|LOCUS_08000 209955 210233 gene locus_tag LOCUS_08010 209955 210233 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140411.1 protein_id gnl|my_center|LOCUS_08010 210187 210453 gene locus_tag LOCUS_08020 210187 210453 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816743.1 protein_id gnl|my_center|LOCUS_08020 211103 210486 gene locus_tag LOCUS_08030 gene ruvA 211103 210486 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_08030 211888 211169 gene locus_tag LOCUS_08040 211888 211169 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531896.1 protein_id gnl|my_center|LOCUS_08040 212469 211957 gene locus_tag LOCUS_08050 gene ruvC 212469 211957 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004445748.1 protein_id gnl|my_center|LOCUS_08050 212601 213368 gene locus_tag LOCUS_08060 212601 213368 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083530.1 protein_id gnl|my_center|LOCUS_08060 214151 213405 gene locus_tag LOCUS_08070 214151 213405 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_08070 214818 214291 gene locus_tag LOCUS_08080 214818 214291 CDS product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329739.1 protein_id gnl|my_center|LOCUS_08080 215367 215179 gene locus_tag LOCUS_08090 215367 215179 CDS product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018235560.1 protein_id gnl|my_center|LOCUS_08090 215453 216463 gene locus_tag LOCUS_08100 215453 216463 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_08100 216539 217330 gene locus_tag LOCUS_08110 216539 217330 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041164662.1 protein_id gnl|my_center|LOCUS_08110 217327 218304 gene locus_tag LOCUS_08120 217327 218304 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967972.1 protein_id gnl|my_center|LOCUS_08120 218317 218565 gene locus_tag LOCUS_08130 218317 218565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 218661 219554 gene locus_tag LOCUS_08140 218661 219554 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083045.1 protein_id gnl|my_center|LOCUS_08140 220974 219889 gene locus_tag LOCUS_08150 220974 219889 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970190.1 protein_id gnl|my_center|LOCUS_08150 221473 220961 gene locus_tag LOCUS_08160 gene purE 221473 220961 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 protein_id gnl|my_center|LOCUS_08160 221397 221585 gene locus_tag LOCUS_08170 221397 221585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 221629 222375 gene locus_tag LOCUS_08180 221629 222375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 222548 222336 gene locus_tag LOCUS_08190 222548 222336 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_08190 222807 222989 gene locus_tag LOCUS_08200 222807 222989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 223681 223100 gene locus_tag LOCUS_08210 223681 223100 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206280.1 protein_id gnl|my_center|LOCUS_08210 224321 223668 gene locus_tag LOCUS_08220 224321 223668 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256067.1 protein_id gnl|my_center|LOCUS_08220 224632 225702 gene locus_tag LOCUS_08230 gene ribA 224632 225702 CDS product GTP cyclohydrolase II RibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038822.1 protein_id gnl|my_center|LOCUS_08230 225796 228054 gene locus_tag LOCUS_08240 225796 228054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 228816 228055 gene locus_tag LOCUS_08250 228816 228055 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087339.1 protein_id gnl|my_center|LOCUS_08250 229868 228831 gene locus_tag LOCUS_08260 229868 228831 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087338.1 protein_id gnl|my_center|LOCUS_08260 230593 229865 gene locus_tag LOCUS_08270 gene pxpB 230593 229865 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087337.1 protein_id gnl|my_center|LOCUS_08270 231974 230646 gene locus_tag LOCUS_08280 231974 230646 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_08280 232511 231978 gene locus_tag LOCUS_08290 232511 231978 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 protein_id gnl|my_center|LOCUS_08290 233700 232708 gene locus_tag LOCUS_08300 233700 232708 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_08300 234184 234642 gene locus_tag LOCUS_08310 234184 234642 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395860.1 protein_id gnl|my_center|LOCUS_08310 236346 234706 gene locus_tag LOCUS_08320 236346 234706 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 protein_id gnl|my_center|LOCUS_08320 238466 236352 gene locus_tag LOCUS_08330 238466 236352 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089915.1 protein_id gnl|my_center|LOCUS_08330 238603 239379 gene locus_tag LOCUS_08340 238603 239379 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530431.1 protein_id gnl|my_center|LOCUS_08340 240593 239646 gene locus_tag LOCUS_08350 240593 239646 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_08350 243052 240605 gene locus_tag LOCUS_08360 243052 240605 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_08360 244187 243216 gene locus_tag LOCUS_08370 244187 243216 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_08370 244485 244862 gene locus_tag LOCUS_08380 244485 244862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 245583 244894 gene locus_tag LOCUS_08390 245583 244894 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090673.1 protein_id gnl|my_center|LOCUS_08390 246495 245647 gene locus_tag LOCUS_08400 246495 245647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 246657 247826 gene locus_tag LOCUS_08410 gene mnmA 246657 247826 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089733.1 protein_id gnl|my_center|LOCUS_08410 247838 248497 gene locus_tag LOCUS_08420 247838 248497 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_08420 248519 249169 gene locus_tag LOCUS_08430 248519 249169 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764790.1 protein_id gnl|my_center|LOCUS_08430 249255 249331 gene locus_tag LOCUS_t00100 249255 249331 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 251080 249494 gene locus_tag LOCUS_08440 251080 249494 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_08440 252566 251109 gene locus_tag LOCUS_08450 252566 251109 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930967.1 protein_id gnl|my_center|LOCUS_08450 253684 252602 gene locus_tag LOCUS_08460 253684 252602 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 protein_id gnl|my_center|LOCUS_08460 254320 253694 gene locus_tag LOCUS_08470 gene gstA 254320 253694 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_08470 254460 255047 gene locus_tag LOCUS_08480 254460 255047 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089909.1 protein_id gnl|my_center|LOCUS_08480 255246 255497 gene locus_tag LOCUS_08490 255246 255497 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 protein_id gnl|my_center|LOCUS_08490 255500 256693 gene locus_tag LOCUS_08500 255500 256693 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_08500 256696 257604 gene locus_tag LOCUS_08510 256696 257604 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080728814.1 protein_id gnl|my_center|LOCUS_08510 257607 258623 gene locus_tag LOCUS_08520 257607 258623 CDS product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 protein_id gnl|my_center|LOCUS_08520 258631 261111 gene locus_tag LOCUS_08530 258631 261111 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972413.1 protein_id gnl|my_center|LOCUS_08530 261108 262859 gene locus_tag LOCUS_08540 261108 262859 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047161.1 protein_id gnl|my_center|LOCUS_08540 262956 264401 gene locus_tag LOCUS_08550 262956 264401 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967692.1 protein_id gnl|my_center|LOCUS_08550 264418 265605 gene locus_tag LOCUS_08560 264418 265605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 266744 265602 gene locus_tag LOCUS_08570 266744 265602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 267673 266741 gene locus_tag LOCUS_08580 267673 266741 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090303.1 protein_id gnl|my_center|LOCUS_08580 267975 268823 gene locus_tag LOCUS_08590 267975 268823 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966663.1 protein_id gnl|my_center|LOCUS_08590 268981 270471 gene locus_tag LOCUS_08600 268981 270471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 270490 271269 gene locus_tag LOCUS_08610 270490 271269 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090306.1 protein_id gnl|my_center|LOCUS_08610 271338 272570 gene locus_tag LOCUS_08620 271338 272570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 274022 272586 gene locus_tag LOCUS_08630 274022 272586 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085030.1 protein_id gnl|my_center|LOCUS_08630 275053 274022 gene locus_tag LOCUS_08640 275053 274022 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085029.1 protein_id gnl|my_center|LOCUS_08640 275424 276398 gene locus_tag LOCUS_08650 275424 276398 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_08650 277943 276462 gene locus_tag LOCUS_08660 277943 276462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 278759 278040 gene locus_tag LOCUS_08670 278759 278040 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090195.1 protein_id gnl|my_center|LOCUS_08670 279320 278763 gene locus_tag LOCUS_08680 279320 278763 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000365.1 protein_id gnl|my_center|LOCUS_08680 279515 280396 gene locus_tag LOCUS_08690 279515 280396 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_08690 280772 280413 gene locus_tag LOCUS_08700 280772 280413 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_08700 281522 280782 gene locus_tag LOCUS_08710 281522 280782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 282452 281592 gene locus_tag LOCUS_08720 gene proC 282452 281592 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976377.1 protein_id gnl|my_center|LOCUS_08720 283004 282507 gene locus_tag LOCUS_08730 283004 282507 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311131.1 protein_id gnl|my_center|LOCUS_08730 282985 283176 gene locus_tag LOCUS_08740 282985 283176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 285677 283569 gene locus_tag LOCUS_08750 285677 283569 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090149.1 protein_id gnl|my_center|LOCUS_08750 285980 285807 gene locus_tag LOCUS_08760 285980 285807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 286352 286050 gene locus_tag LOCUS_08770 286352 286050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 286290 286598 gene locus_tag LOCUS_08780 286290 286598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 286732 287859 gene locus_tag LOCUS_08790 286732 287859 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_08790 288672 287914 gene locus_tag LOCUS_08800 288672 287914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 289109 288846 gene locus_tag LOCUS_08810 289109 288846 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_08810 289207 290172 gene locus_tag LOCUS_08820 gene msrP 289207 290172 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406704.1 protein_id gnl|my_center|LOCUS_08820 290350 290706 gene locus_tag LOCUS_08830 290350 290706 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528714.1 protein_id gnl|my_center|LOCUS_08830 292340 291114 gene locus_tag LOCUS_08840 gene carA 292340 291114 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090106.1 protein_id gnl|my_center|LOCUS_08840 292610 293065 gene locus_tag LOCUS_08850 292610 293065 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976357.1 protein_id gnl|my_center|LOCUS_08850 294144 293167 gene locus_tag LOCUS_08860 294144 293167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 294720 294247 gene locus_tag LOCUS_08870 gene greA 294720 294247 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014764680.1 protein_id gnl|my_center|LOCUS_08870 298166 294837 gene locus_tag LOCUS_08880 gene carB 298166 294837 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090112.1 protein_id gnl|my_center|LOCUS_08880 299204 298419 gene locus_tag LOCUS_08890 299204 298419 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083922.1 protein_id gnl|my_center|LOCUS_08890 300400 299201 gene locus_tag LOCUS_08900 300400 299201 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 protein_id gnl|my_center|LOCUS_08900 301418 300519 gene locus_tag LOCUS_08910 301418 300519 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_08910 301934 301455 gene locus_tag LOCUS_08920 301934 301455 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157328319.1 protein_id gnl|my_center|LOCUS_08920 302191 302829 gene locus_tag LOCUS_08930 302191 302829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 303064 304026 gene locus_tag LOCUS_08940 gene trxB 303064 304026 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090115.1 protein_id gnl|my_center|LOCUS_08940 304060 304950 gene locus_tag LOCUS_08950 304060 304950 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172837.1 protein_id gnl|my_center|LOCUS_08950 305072 305770 gene locus_tag LOCUS_08960 305072 305770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 305824 306717 gene locus_tag LOCUS_08970 305824 306717 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807787.1 protein_id gnl|my_center|LOCUS_08970 307848 306745 gene locus_tag LOCUS_08980 gene mtnA 307848 306745 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_08980 309119 307848 gene locus_tag LOCUS_08990 gene mtnK 309119 307848 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087665.1 protein_id gnl|my_center|LOCUS_08990 309362 310855 gene locus_tag LOCUS_09000 309362 310855 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164830060.1 protein_id gnl|my_center|LOCUS_09000 310889 311890 gene locus_tag LOCUS_09010 310889 311890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456749.1 protein_id gnl|my_center|LOCUS_09010 311941 312993 gene locus_tag LOCUS_09020 311941 312993 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532920.1 protein_id gnl|my_center|LOCUS_09020 313050 313700 gene locus_tag LOCUS_09030 313050 313700 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976287.1 protein_id gnl|my_center|LOCUS_09030 314021 313746 gene locus_tag LOCUS_09040 314021 313746 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090176.1 protein_id gnl|my_center|LOCUS_09040 314148 314963 gene locus_tag LOCUS_09050 gene lgt 314148 314963 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969868.1 protein_id gnl|my_center|LOCUS_09050 314960 316042 gene locus_tag LOCUS_09060 314960 316042 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_09060 316067 316834 gene locus_tag LOCUS_09070 gene pgeF 316067 316834 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090180.1 protein_id gnl|my_center|LOCUS_09070 316917 317594 gene locus_tag LOCUS_09080 316917 317594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 317713 318666 gene locus_tag LOCUS_09090 317713 318666 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174674.1 protein_id gnl|my_center|LOCUS_09090 319693 318686 gene locus_tag LOCUS_09100 319693 318686 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227004.1 protein_id gnl|my_center|LOCUS_09100 319800 320741 gene locus_tag LOCUS_09110 319800 320741 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113363.1 protein_id gnl|my_center|LOCUS_09110 321331 320738 gene locus_tag LOCUS_09120 321331 320738 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_09120 321521 323500 gene locus_tag LOCUS_09130 321521 323500 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965916.1 protein_id gnl|my_center|LOCUS_09130 323565 325379 gene locus_tag LOCUS_09140 323565 325379 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_09140 325502 326410 gene locus_tag LOCUS_09150 325502 326410 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_09150 326407 327348 gene locus_tag LOCUS_09160 326407 327348 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_09160 327345 328622 gene locus_tag LOCUS_09170 327345 328622 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_09170 329654 328953 gene locus_tag LOCUS_09180 gene phoB 329654 328953 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143479.1 protein_id gnl|my_center|LOCUS_09180 330379 329672 gene locus_tag LOCUS_09190 gene phoU 330379 329672 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083915.1 protein_id gnl|my_center|LOCUS_09190 331897 330545 gene locus_tag LOCUS_09200 331897 330545 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083910.1 protein_id gnl|my_center|LOCUS_09200 332831 332067 gene locus_tag LOCUS_09210 332831 332067 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083972.1 protein_id gnl|my_center|LOCUS_09210 333757 332828 gene locus_tag LOCUS_09220 333757 332828 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172821.1 protein_id gnl|my_center|LOCUS_09220 335028 333856 gene locus_tag LOCUS_09230 335028 333856 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_09230 335737 335123 gene locus_tag LOCUS_09240 335737 335123 CDS product ParB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170879.1 protein_id gnl|my_center|LOCUS_09240 335892 339212 gene locus_tag LOCUS_09250 335892 339212 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529825.1 protein_id gnl|my_center|LOCUS_09250 339236 341743 gene locus_tag LOCUS_09260 339236 341743 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085762.1 protein_id gnl|my_center|LOCUS_09260 341743 342624 gene locus_tag LOCUS_09270 341743 342624 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085763.1 protein_id gnl|my_center|LOCUS_09270 343849 342647 gene locus_tag LOCUS_09280 343849 342647 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 protein_id gnl|my_center|LOCUS_09280 344243 343914 gene locus_tag LOCUS_09290 344243 343914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 345069 344269 gene locus_tag LOCUS_09300 345069 344269 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_09300 345212 346384 gene locus_tag LOCUS_09310 345212 346384 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_09310 348109 346400 gene locus_tag LOCUS_09320 348109 346400 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085777.1 protein_id gnl|my_center|LOCUS_09320 348330 349709 gene locus_tag LOCUS_09330 348330 349709 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_09330 350737 349853 gene locus_tag LOCUS_09340 350737 349853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_09340 351531 350734 gene locus_tag LOCUS_09350 351531 350734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_09350 352555 351533 gene locus_tag LOCUS_09360 352555 351533 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_09360 352789 354210 gene locus_tag LOCUS_09370 352789 354210 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_09370 355340 354399 gene locus_tag LOCUS_09380 355340 354399 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_09380 355677 356159 gene locus_tag LOCUS_09390 gene cynS 355677 356159 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_09390 356225 357049 gene locus_tag LOCUS_09400 356225 357049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 357844 357056 gene locus_tag LOCUS_09410 357844 357056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 protein_id gnl|my_center|LOCUS_09410 358614 357841 gene locus_tag LOCUS_09420 358614 357841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088987.1 protein_id gnl|my_center|LOCUS_09420 359799 358837 gene locus_tag LOCUS_09430 359799 358837 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088986.1 protein_id gnl|my_center|LOCUS_09430 360034 360387 gene locus_tag LOCUS_09440 360034 360387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 360443 361675 gene locus_tag LOCUS_09450 360443 361675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 363109 361685 gene locus_tag LOCUS_09460 gene hydA 363109 361685 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 protein_id gnl|my_center|LOCUS_09460 363476 363165 gene locus_tag LOCUS_09470 363476 363165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 364609 363473 gene locus_tag LOCUS_09480 364609 363473 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_09480 366705 364597 gene locus_tag LOCUS_09490 366705 364597 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921515.1 protein_id gnl|my_center|LOCUS_09490 367793 366702 gene locus_tag LOCUS_09500 367793 366702 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_09500 369297 367972 gene locus_tag LOCUS_09510 369297 367972 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494180.1 protein_id gnl|my_center|LOCUS_09510 370239 369463 gene locus_tag LOCUS_09520 370239 369463 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448787.1 protein_id gnl|my_center|LOCUS_09520 371211 370303 gene locus_tag LOCUS_09530 371211 370303 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927823.1 protein_id gnl|my_center|LOCUS_09530 371301 372050 gene locus_tag LOCUS_09540 371301 372050 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 protein_id gnl|my_center|LOCUS_09540 372153 372953 gene locus_tag LOCUS_09550 372153 372953 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_09550 373339 372950 gene locus_tag LOCUS_09560 gene hpxZ 373339 372950 CDS product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083862.1 protein_id gnl|my_center|LOCUS_09560 374748 373336 gene locus_tag LOCUS_09570 374748 373336 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_09570 374947 374750 gene locus_tag LOCUS_09580 374947 374750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 376825 375194 gene locus_tag LOCUS_09590 gene hutH 376825 375194 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_09590 378233 376986 gene locus_tag LOCUS_09600 gene serA 378233 376986 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175507.1 protein_id gnl|my_center|LOCUS_09600 378904 378443 gene locus_tag LOCUS_09610 378904 378443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 379275 383027 gene locus_tag LOCUS_09620 379275 383027 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921381.1 protein_id gnl|my_center|LOCUS_09620 383136 386357 gene locus_tag LOCUS_09630 383136 386357 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085666.1 protein_id gnl|my_center|LOCUS_09630 386497 387042 gene locus_tag LOCUS_09640 386497 387042 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086935.1 protein_id gnl|my_center|LOCUS_09640 387667 387152 gene locus_tag LOCUS_09650 387667 387152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 387945 389267 gene locus_tag LOCUS_09660 387945 389267 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531246.1 protein_id gnl|my_center|LOCUS_09660 389358 389780 gene locus_tag LOCUS_09670 389358 389780 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 protein_id gnl|my_center|LOCUS_09670 390639 389863 gene locus_tag LOCUS_09680 390639 389863 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 protein_id gnl|my_center|LOCUS_09680 392992 390950 gene locus_tag LOCUS_09690 392992 390950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 393237 394934 gene locus_tag LOCUS_09700 393237 394934 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_09700 394983 396908 gene locus_tag LOCUS_09710 gene phaC 394983 396908 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_09710 397035 397868 gene locus_tag LOCUS_09720 gene phaZ 397035 397868 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_09720 398184 397888 gene locus_tag LOCUS_09730 398184 397888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 399753 398464 gene locus_tag LOCUS_09740 399753 398464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084978.1 protein_id gnl|my_center|LOCUS_09740 400481 399882 gene locus_tag LOCUS_09750 400481 399882 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084979.1 protein_id gnl|my_center|LOCUS_09750 400674 401180 gene locus_tag LOCUS_09760 400674 401180 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_09760 401982 401194 gene locus_tag LOCUS_09770 401982 401194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 401927 402271 gene locus_tag LOCUS_09780 401927 402271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 403086 402196 gene locus_tag LOCUS_09790 403086 402196 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173703.1 protein_id gnl|my_center|LOCUS_09790 403286 404035 gene locus_tag LOCUS_09800 gene map 403286 404035 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087638.1 protein_id gnl|my_center|LOCUS_09800 404431 404051 gene locus_tag LOCUS_09810 404431 404051 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_09810 405443 404466 gene locus_tag LOCUS_09820 405443 404466 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_09820 405610 406527 gene locus_tag LOCUS_09830 405610 406527 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_09830 407858 406827 gene locus_tag LOCUS_09840 407858 406827 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_09840 409074 407974 gene locus_tag LOCUS_09850 409074 407974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 410149 409157 gene locus_tag LOCUS_09860 410149 409157 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_09860 411647 410268 gene locus_tag LOCUS_09870 411647 410268 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 protein_id gnl|my_center|LOCUS_09870 412032 411661 gene locus_tag LOCUS_09880 gene fliN 412032 411661 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089739.1 protein_id gnl|my_center|LOCUS_09880 412670 412029 gene locus_tag LOCUS_09890 412670 412029 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 protein_id gnl|my_center|LOCUS_09890 413766 412681 gene locus_tag LOCUS_09900 gene fliG 413766 412681 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089737.1 protein_id gnl|my_center|LOCUS_09900 415427 413763 gene locus_tag LOCUS_09910 gene fliF 415427 413763 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089736.1 protein_id gnl|my_center|LOCUS_09910 415911 415534 gene locus_tag LOCUS_09920 415911 415534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_09920 416133 418262 gene locus_tag LOCUS_09930 gene flhA 416133 418262 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966504.1 protein_id gnl|my_center|LOCUS_09930 418325 418873 gene locus_tag LOCUS_09940 418325 418873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 419963 418914 gene locus_tag LOCUS_09950 419963 418914 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966592.1 protein_id gnl|my_center|LOCUS_09950 420209 420622 gene locus_tag LOCUS_09960 420209 420622 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088015.1 protein_id gnl|my_center|LOCUS_09960 422070 421018 gene locus_tag LOCUS_09970 422070 421018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 424092 422083 gene locus_tag LOCUS_09980 424092 422083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 424378 425892 gene locus_tag LOCUS_09990 424378 425892 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526312.1 protein_id gnl|my_center|LOCUS_09990 425889 426170 gene locus_tag LOCUS_10000 425889 426170 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919773.1 protein_id gnl|my_center|LOCUS_10000 426274 428007 gene locus_tag LOCUS_10010 gene fadD 426274 428007 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_10010 429831 428050 gene locus_tag LOCUS_10020 429831 428050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 430076 431596 gene locus_tag LOCUS_10030 430076 431596 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_10030 431577 432062 gene locus_tag LOCUS_10040 431577 432062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 432314 432069 gene locus_tag LOCUS_10050 432314 432069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 432204 432776 gene locus_tag LOCUS_10060 gene nthA 432204 432776 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_10060 432773 433456 gene locus_tag LOCUS_10070 gene nthB 432773 433456 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_10070 433456 433842 gene locus_tag LOCUS_10080 433456 433842 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174057.1 protein_id gnl|my_center|LOCUS_10080 434019 434387 gene locus_tag LOCUS_10090 434019 434387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 435587 434508 gene locus_tag LOCUS_10100 435587 434508 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_10100 437557 435584 gene locus_tag LOCUS_10110 437557 435584 CDS product LodA/GoxA family CTQ-dependent oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_10110 437779 437600 gene locus_tag LOCUS_10120 437779 437600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 440673 437827 gene locus_tag LOCUS_10130 440673 437827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 443067 441148 gene locus_tag LOCUS_10140 443067 441148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 443527 444093 gene locus_tag LOCUS_10150 443527 444093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 446753 444327 gene locus_tag LOCUS_10160 gene gyrB 446753 444327 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083645.1 protein_id gnl|my_center|LOCUS_10160 447352 446906 gene locus_tag LOCUS_10170 447352 446906 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_10170 447596 448786 gene locus_tag LOCUS_10180 447596 448786 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_10180 448817 450091 gene locus_tag LOCUS_10190 448817 450091 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463741.1 protein_id gnl|my_center|LOCUS_10190 450213 451514 gene locus_tag LOCUS_10200 450213 451514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 451878 456641 gene locus_tag LOCUS_10210 gene gltB 451878 456641 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_10210 456646 458064 gene locus_tag LOCUS_10220 456646 458064 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_10220 458167 459246 gene locus_tag LOCUS_10230 458167 459246 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313436.1 protein_id gnl|my_center|LOCUS_10230 459345 460556 gene locus_tag LOCUS_10240 459345 460556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 461165 460689 gene locus_tag LOCUS_10250 461165 460689 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173863.1 protein_id gnl|my_center|LOCUS_10250 461460 461858 gene locus_tag LOCUS_10260 461460 461858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 461961 462329 gene locus_tag LOCUS_10270 461961 462329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 462441 463397 gene locus_tag LOCUS_10280 462441 463397 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_10280 464187 463405 gene locus_tag LOCUS_10290 gene hisN 464187 463405 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_10290 464376 465659 gene locus_tag LOCUS_10300 464376 465659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 protein_id gnl|my_center|LOCUS_10300 466963 466073 gene locus_tag LOCUS_10310 466963 466073 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090455.1 protein_id gnl|my_center|LOCUS_10310 467345 467710 gene locus_tag LOCUS_10320 467345 467710 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_10320 467789 467863 gene locus_tag LOCUS_t00110 467789 467863 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 468810 469802 gene locus_tag LOCUS_10330 468810 469802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 469901 470887 gene locus_tag LOCUS_10340 469901 470887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 470865 472187 gene locus_tag LOCUS_10350 470865 472187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 472218 473519 gene locus_tag LOCUS_10360 472218 473519 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938575.1 protein_id gnl|my_center|LOCUS_10360 473526 474791 gene locus_tag LOCUS_10370 473526 474791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 475035 476105 gene locus_tag LOCUS_10380 475035 476105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 476109 476879 gene locus_tag LOCUS_10390 476109 476879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194135.1 protein_id gnl|my_center|LOCUS_10390 476940 478139 gene locus_tag LOCUS_10400 476940 478139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 478139 478873 gene locus_tag LOCUS_10410 478139 478873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194035.1 protein_id gnl|my_center|LOCUS_10410 479004 479993 gene locus_tag LOCUS_10420 479004 479993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 480621 480268 gene locus_tag LOCUS_10430 480621 480268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 481011 480676 gene locus_tag LOCUS_10440 481011 480676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 481362 482216 gene locus_tag LOCUS_10450 481362 482216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 483342 482254 gene locus_tag LOCUS_10460 483342 482254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 484496 485923 gene locus_tag LOCUS_10470 484496 485923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 486230 486925 gene locus_tag LOCUS_10480 486230 486925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 488206 487442 gene locus_tag LOCUS_10490 488206 487442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 489573 488230 gene locus_tag LOCUS_10500 489573 488230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 490714 489590 gene locus_tag LOCUS_10510 490714 489590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 492764 491754 gene locus_tag LOCUS_10520 492764 491754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 494509 493361 gene locus_tag LOCUS_10530 gene yghO 494509 493361 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_10530 495312 494512 gene locus_tag LOCUS_10540 495312 494512 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938563.1 protein_id gnl|my_center|LOCUS_10540 496652 495318 gene locus_tag LOCUS_10550 496652 495318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 497728 498309 gene locus_tag LOCUS_10560 497728 498309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 498558 499724 gene locus_tag LOCUS_10570 498558 499724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 501159 499987 gene locus_tag LOCUS_10580 501159 499987 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194378.1 protein_id gnl|my_center|LOCUS_10580 501400 501954 gene locus_tag LOCUS_10590 501400 501954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 502655 501981 gene locus_tag LOCUS_10600 502655 501981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_10600 504114 502657 gene locus_tag LOCUS_10610 504114 502657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 505252 504413 gene locus_tag LOCUS_10620 505252 504413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 506231 505218 gene locus_tag LOCUS_10630 506231 505218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 506605 507096 gene locus_tag LOCUS_10640 gene msrB 506605 507096 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 protein_id gnl|my_center|LOCUS_10640 507116 509002 gene locus_tag LOCUS_10650 507116 509002 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447661.1 protein_id gnl|my_center|LOCUS_10650 509919 509101 gene locus_tag LOCUS_10660 509919 509101 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525151.1 protein_id gnl|my_center|LOCUS_10660 510984 509986 gene locus_tag LOCUS_10670 510984 509986 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_10670 511527 511009 gene locus_tag LOCUS_10680 511527 511009 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957534.1 protein_id gnl|my_center|LOCUS_10680 512664 511540 gene locus_tag LOCUS_10690 512664 511540 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_10690 513809 512661 gene locus_tag LOCUS_10700 513809 512661 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_10700 514930 513809 gene locus_tag LOCUS_10710 514930 513809 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_10710 515150 515911 gene locus_tag LOCUS_10720 515150 515911 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730668.1 protein_id gnl|my_center|LOCUS_10720 516604 515927 gene locus_tag LOCUS_10730 516604 515927 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_10730 517386 516646 gene locus_tag LOCUS_10740 517386 516646 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_10740 518365 517424 gene locus_tag LOCUS_10750 518365 517424 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 protein_id gnl|my_center|LOCUS_10750 519608 518454 gene locus_tag LOCUS_10760 519608 518454 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_10760 522642 519919 gene locus_tag LOCUS_10770 522642 519919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 523718 522786 gene locus_tag LOCUS_10780 523718 522786 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 protein_id gnl|my_center|LOCUS_10780 524327 523827 gene locus_tag LOCUS_10790 524327 523827 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085886197.1 protein_id gnl|my_center|LOCUS_10790 524879 525907 gene locus_tag LOCUS_10800 524879 525907 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388537.1 protein_id gnl|my_center|LOCUS_10800 526149 527186 gene locus_tag LOCUS_10810 526149 527186 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085696.1 protein_id gnl|my_center|LOCUS_10810 527188 528279 gene locus_tag LOCUS_10820 527188 528279 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_10820 528393 528758 gene locus_tag LOCUS_10830 528393 528758 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531026.1 protein_id gnl|my_center|LOCUS_10830 528905 529861 gene locus_tag LOCUS_10840 528905 529861 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966269.1 protein_id gnl|my_center|LOCUS_10840 529969 531375 gene locus_tag LOCUS_10850 529969 531375 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656430.1 protein_id gnl|my_center|LOCUS_10850 531532 532812 gene locus_tag LOCUS_10860 531532 532812 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_10860 533188 532838 gene locus_tag LOCUS_10870 533188 532838 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444506.1 protein_id gnl|my_center|LOCUS_10870 534324 533248 gene locus_tag LOCUS_10880 534324 533248 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086556.1 protein_id gnl|my_center|LOCUS_10880 534536 535990 gene locus_tag LOCUS_10890 534536 535990 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_10890 536899 536021 gene locus_tag LOCUS_10900 gene trpI 536899 536021 CDS product trpBA operon transcriptional activator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114633.1 protein_id gnl|my_center|LOCUS_10900 537215 537991 gene locus_tag LOCUS_10910 537215 537991 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228675.1 protein_id gnl|my_center|LOCUS_10910 538031 538435 gene locus_tag LOCUS_10920 538031 538435 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087887.1 protein_id gnl|my_center|LOCUS_10920 539834 538458 gene locus_tag LOCUS_10930 539834 538458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 540441 539845 gene locus_tag LOCUS_10940 540441 539845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 541736 540462 gene locus_tag LOCUS_10950 541736 540462 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_10950 541921 543249 gene locus_tag LOCUS_10960 541921 543249 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339053.1 protein_id gnl|my_center|LOCUS_10960 543390 544157 gene locus_tag LOCUS_10970 543390 544157 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086029.1 protein_id gnl|my_center|LOCUS_10970 544150 545037 gene locus_tag LOCUS_10980 544150 545037 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_10980 545034 545837 gene locus_tag LOCUS_10990 545034 545837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 protein_id gnl|my_center|LOCUS_10990 545878 546927 gene locus_tag LOCUS_11000 545878 546927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086026.1 protein_id gnl|my_center|LOCUS_11000 546927 547925 gene locus_tag LOCUS_11010 546927 547925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_11010 547928 548599 gene locus_tag LOCUS_11020 547928 548599 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_11020 548709 549794 gene locus_tag LOCUS_11030 548709 549794 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086023.1 protein_id gnl|my_center|LOCUS_11030 549791 551338 gene locus_tag LOCUS_11040 549791 551338 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086022.1 protein_id gnl|my_center|LOCUS_11040 551989 551594 gene locus_tag LOCUS_11050 551989 551594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 553626 551986 gene locus_tag LOCUS_11060 553626 551986 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530815.1 protein_id gnl|my_center|LOCUS_11060 554612 553623 gene locus_tag LOCUS_11070 554612 553623 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089190.1 protein_id gnl|my_center|LOCUS_11070 555129 555938 gene locus_tag LOCUS_11080 555129 555938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767688.1 protein_id gnl|my_center|LOCUS_11080 555943 556818 gene locus_tag LOCUS_11090 555943 556818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767689.1 protein_id gnl|my_center|LOCUS_11090 556903 557856 gene locus_tag LOCUS_11100 556903 557856 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089196.1 protein_id gnl|my_center|LOCUS_11100 558302 557886 gene locus_tag LOCUS_11110 558302 557886 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085287.1 protein_id gnl|my_center|LOCUS_11110 558679 559992 gene locus_tag LOCUS_11120 558679 559992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085688.1 protein_id gnl|my_center|LOCUS_11120 560176 561342 gene locus_tag LOCUS_11130 560176 561342 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 protein_id gnl|my_center|LOCUS_11130 562261 561401 gene locus_tag LOCUS_11140 562261 561401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 562727 562386 gene locus_tag LOCUS_11150 562727 562386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 562784 562975 gene locus_tag LOCUS_11160 562784 562975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 563054 564151 gene locus_tag LOCUS_11170 563054 564151 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970269.1 protein_id gnl|my_center|LOCUS_11170 564141 564806 gene locus_tag LOCUS_11180 564141 564806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973896.1 protein_id gnl|my_center|LOCUS_11180 564866 565681 gene locus_tag LOCUS_11190 564866 565681 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921647.1 protein_id gnl|my_center|LOCUS_11190 567178 566000 gene locus_tag LOCUS_11200 567178 566000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 protein_id gnl|my_center|LOCUS_11200 567226 568056 gene locus_tag LOCUS_11210 567226 568056 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967656.1 protein_id gnl|my_center|LOCUS_11210 569442 568063 gene locus_tag LOCUS_11220 569442 568063 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390989.1 protein_id gnl|my_center|LOCUS_11220 570116 569634 gene locus_tag LOCUS_11230 570116 569634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 570129 571103 gene locus_tag LOCUS_11240 gene argC 570129 571103 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082328.1 protein_id gnl|my_center|LOCUS_11240 571993 571325 gene locus_tag LOCUS_11250 571993 571325 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967141.1 protein_id gnl|my_center|LOCUS_11250 572212 572835 gene locus_tag LOCUS_11260 572212 572835 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967140.1 protein_id gnl|my_center|LOCUS_11260 572837 574102 gene locus_tag LOCUS_11270 572837 574102 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087197.1 protein_id gnl|my_center|LOCUS_11270 574135 575127 gene locus_tag LOCUS_11280 574135 575127 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence03 670 176 gene locus_tag LOCUS_11290 670 176 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_11290 2579 681 gene locus_tag LOCUS_11300 2579 681 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000404.1 protein_id gnl|my_center|LOCUS_11300 2883 3863 gene locus_tag LOCUS_11310 2883 3863 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_11310 3880 4920 gene locus_tag LOCUS_11320 gene tdh 3880 4920 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532321.1 protein_id gnl|my_center|LOCUS_11320 4917 5507 gene locus_tag LOCUS_11330 4917 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5577 6185 gene locus_tag LOCUS_11340 5577 6185 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 protein_id gnl|my_center|LOCUS_11340 6559 7488 gene locus_tag LOCUS_11350 6559 7488 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_11350 8830 7496 gene locus_tag LOCUS_11360 8830 7496 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089392.1 protein_id gnl|my_center|LOCUS_11360 9549 8830 gene locus_tag LOCUS_11370 9549 8830 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_11370 9734 10315 gene locus_tag LOCUS_11380 9734 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 10458 11333 gene locus_tag LOCUS_11390 10458 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 11364 11783 gene locus_tag LOCUS_11400 gene msrB 11364 11783 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529102.1 protein_id gnl|my_center|LOCUS_11400 12864 11986 gene locus_tag LOCUS_11410 12864 11986 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141439.1 protein_id gnl|my_center|LOCUS_11410 12967 13809 gene locus_tag LOCUS_11420 12967 13809 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087073.1 protein_id gnl|my_center|LOCUS_11420 13971 14828 gene locus_tag LOCUS_11430 13971 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 14913 15470 gene locus_tag LOCUS_11440 14913 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 16616 15516 gene locus_tag LOCUS_11450 gene ugpC 16616 15516 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087328.1 protein_id gnl|my_center|LOCUS_11450 17538 16627 gene locus_tag LOCUS_11460 17538 16627 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087327.1 protein_id gnl|my_center|LOCUS_11460 18458 17538 gene locus_tag LOCUS_11470 18458 17538 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174000.1 protein_id gnl|my_center|LOCUS_11470 20004 18664 gene locus_tag LOCUS_11480 20004 18664 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087324.1 protein_id gnl|my_center|LOCUS_11480 20605 22395 gene locus_tag LOCUS_11490 20605 22395 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_11490 22392 24212 gene locus_tag LOCUS_11500 22392 24212 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_11500 24209 25264 gene locus_tag LOCUS_11510 24209 25264 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_11510 25933 26943 gene locus_tag LOCUS_11520 25933 26943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 28153 27251 gene locus_tag LOCUS_11530 28153 27251 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808761.1 protein_id gnl|my_center|LOCUS_11530 28292 29569 gene locus_tag LOCUS_11540 28292 29569 CDS product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533063.1 protein_id gnl|my_center|LOCUS_11540 29566 30891 gene locus_tag LOCUS_11550 29566 30891 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243036.1 protein_id gnl|my_center|LOCUS_11550 30875 31753 gene locus_tag LOCUS_11560 30875 31753 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707251.1 protein_id gnl|my_center|LOCUS_11560 31792 32268 gene locus_tag LOCUS_11570 31792 32268 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532768.1 protein_id gnl|my_center|LOCUS_11570 33240 32329 gene locus_tag LOCUS_11580 33240 32329 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084956.1 protein_id gnl|my_center|LOCUS_11580 33594 34952 gene locus_tag LOCUS_11590 33594 34952 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892321.1 protein_id gnl|my_center|LOCUS_11590 35047 36042 gene locus_tag LOCUS_11600 35047 36042 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975598.1 protein_id gnl|my_center|LOCUS_11600 36106 36606 gene locus_tag LOCUS_11610 36106 36606 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099148.1 protein_id gnl|my_center|LOCUS_11610 36608 37891 gene locus_tag LOCUS_11620 36608 37891 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_11620 37903 38700 gene locus_tag LOCUS_11630 37903 38700 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975597.1 protein_id gnl|my_center|LOCUS_11630 39636 38965 gene locus_tag LOCUS_11640 39636 38965 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087077.1 protein_id gnl|my_center|LOCUS_11640 39817 41283 gene locus_tag LOCUS_11650 39817 41283 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528985.1 protein_id gnl|my_center|LOCUS_11650 41295 42896 gene locus_tag LOCUS_11660 41295 42896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_11660 43026 43439 gene locus_tag LOCUS_11670 43026 43439 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404606.1 protein_id gnl|my_center|LOCUS_11670 43436 45013 gene locus_tag LOCUS_11680 43436 45013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028294.1 protein_id gnl|my_center|LOCUS_11680 45852 45010 gene locus_tag LOCUS_11690 45852 45010 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_11690 46546 47451 gene locus_tag LOCUS_11700 46546 47451 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531798.1 protein_id gnl|my_center|LOCUS_11700 47448 48125 gene locus_tag LOCUS_11710 47448 48125 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312125.1 protein_id gnl|my_center|LOCUS_11710 48212 48535 gene locus_tag LOCUS_11720 48212 48535 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527320.1 protein_id gnl|my_center|LOCUS_11720 48593 49411 gene locus_tag LOCUS_11730 48593 49411 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_11730 49591 50844 gene locus_tag LOCUS_11740 49591 50844 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_11740 52291 51197 gene locus_tag LOCUS_11750 52291 51197 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_11750 52888 52481 gene locus_tag LOCUS_11760 52888 52481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 53265 52885 gene locus_tag LOCUS_11770 53265 52885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 54473 53262 gene locus_tag LOCUS_11780 54473 53262 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_11780 54753 54475 gene locus_tag LOCUS_11790 54753 54475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 55063 55575 gene locus_tag LOCUS_11800 55063 55575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 56361 55591 gene locus_tag LOCUS_11810 56361 55591 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324116.1 protein_id gnl|my_center|LOCUS_11810 57548 56358 gene locus_tag LOCUS_11820 57548 56358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 58663 57545 gene locus_tag LOCUS_11830 58663 57545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 58939 60072 gene locus_tag LOCUS_11840 58939 60072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_11840 60069 60566 gene locus_tag LOCUS_11850 60069 60566 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_11850 61474 60758 gene locus_tag LOCUS_11860 gene lptB 61474 60758 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529586.1 protein_id gnl|my_center|LOCUS_11860 62515 61556 gene locus_tag LOCUS_11870 62515 61556 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975141.1 protein_id gnl|my_center|LOCUS_11870 62717 63685 gene locus_tag LOCUS_11880 62717 63685 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922157.1 protein_id gnl|my_center|LOCUS_11880 63730 64872 gene locus_tag LOCUS_11890 63730 64872 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_11890 65875 64874 gene locus_tag LOCUS_11900 65875 64874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 66645 65872 gene locus_tag LOCUS_11910 66645 65872 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_11910 67537 66704 gene locus_tag LOCUS_11920 67537 66704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 67649 68383 gene locus_tag LOCUS_11930 67649 68383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 68383 69276 gene locus_tag LOCUS_11940 68383 69276 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_11940 69273 70862 gene locus_tag LOCUS_11950 69273 70862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965716.1 protein_id gnl|my_center|LOCUS_11950 71162 72820 gene locus_tag LOCUS_11960 71162 72820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 72944 74008 gene locus_tag LOCUS_11970 gene rfbG 72944 74008 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_11970 74129 74899 gene locus_tag LOCUS_11980 gene rfbF 74129 74899 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_11980 74914 76269 gene locus_tag LOCUS_11990 gene rfbH 74914 76269 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_11990 76323 78146 gene locus_tag LOCUS_12000 76323 78146 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551340.1 protein_id gnl|my_center|LOCUS_12000 78156 79115 gene locus_tag LOCUS_12010 78156 79115 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_12010 79108 79512 gene locus_tag LOCUS_12020 79108 79512 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062081852.1 protein_id gnl|my_center|LOCUS_12020 79509 80465 gene locus_tag LOCUS_12030 79509 80465 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_12030 82972 80759 gene locus_tag LOCUS_12040 82972 80759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 84550 83234 gene locus_tag LOCUS_12050 84550 83234 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_12050 85078 87285 gene locus_tag LOCUS_12060 85078 87285 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209600593.1 protein_id gnl|my_center|LOCUS_12060 87396 88589 gene locus_tag LOCUS_12070 gene yiuA 87396 88589 CDS product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_12070 88846 89871 gene locus_tag LOCUS_12080 88846 89871 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 protein_id gnl|my_center|LOCUS_12080 89868 90689 gene locus_tag LOCUS_12090 89868 90689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208783.1 protein_id gnl|my_center|LOCUS_12090 90876 92669 gene locus_tag LOCUS_12100 90876 92669 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904087.1 protein_id gnl|my_center|LOCUS_12100 92674 95643 gene locus_tag LOCUS_12110 92674 95643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 95640 96956 gene locus_tag LOCUS_12120 95640 96956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 96953 97795 gene locus_tag LOCUS_12130 gene asbF 96953 97795 CDS product petrobactin biosynthesis 3-dehydroshikimate dehydratase AsbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877695.1 protein_id gnl|my_center|LOCUS_12130 97872 98150 gene locus_tag LOCUS_12140 97872 98150 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_12140 98549 99049 gene locus_tag LOCUS_12150 98549 99049 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310431.1 protein_id gnl|my_center|LOCUS_12150 99547 101184 gene locus_tag LOCUS_12160 99547 101184 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_12160 101189 102130 gene locus_tag LOCUS_12170 101189 102130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_12170 102136 103020 gene locus_tag LOCUS_12180 102136 103020 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243753.1 protein_id gnl|my_center|LOCUS_12180 103061 104656 gene locus_tag LOCUS_12190 103061 104656 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339154.1 protein_id gnl|my_center|LOCUS_12190 104757 106211 gene locus_tag LOCUS_12200 104757 106211 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 protein_id gnl|my_center|LOCUS_12200 106216 107265 gene locus_tag LOCUS_12210 106216 107265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_12210 107262 108335 gene locus_tag LOCUS_12220 107262 108335 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_12220 109511 108393 gene locus_tag LOCUS_12230 109511 108393 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088689.1 protein_id gnl|my_center|LOCUS_12230 110263 109508 gene locus_tag LOCUS_12240 110263 109508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088690.1 protein_id gnl|my_center|LOCUS_12240 111009 110260 gene locus_tag LOCUS_12250 111009 110260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088691.1 protein_id gnl|my_center|LOCUS_12250 112007 111006 gene locus_tag LOCUS_12260 112007 111006 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088692.1 protein_id gnl|my_center|LOCUS_12260 112875 112015 gene locus_tag LOCUS_12270 112875 112015 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088693.1 protein_id gnl|my_center|LOCUS_12270 114123 112951 gene locus_tag LOCUS_12280 114123 112951 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_12280 114525 115496 gene locus_tag LOCUS_12290 114525 115496 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_12290 115694 116638 gene locus_tag LOCUS_12300 115694 116638 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257482.1 protein_id gnl|my_center|LOCUS_12300 116717 117061 gene locus_tag LOCUS_12310 116717 117061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 117256 117996 gene locus_tag LOCUS_12320 117256 117996 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_12320 118727 118005 gene locus_tag LOCUS_12330 118727 118005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089220.1 protein_id gnl|my_center|LOCUS_12330 118908 119171 gene locus_tag LOCUS_12340 118908 119171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 120143 119232 gene locus_tag LOCUS_12350 120143 119232 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531073.1 protein_id gnl|my_center|LOCUS_12350 121002 120151 gene locus_tag LOCUS_12360 gene pdxY 121002 120151 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_12360 121308 121919 gene locus_tag LOCUS_12370 121308 121919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 122916 122575 gene locus_tag LOCUS_12380 122916 122575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 122977 123855 gene locus_tag LOCUS_12390 122977 123855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 124229 125878 gene locus_tag LOCUS_12400 124229 125878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 125950 126540 gene locus_tag LOCUS_12410 125950 126540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 128555 126546 gene locus_tag LOCUS_12420 128555 126546 CDS product trifolitoxin synthesis, TfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530421.1 protein_id gnl|my_center|LOCUS_12420 128799 129731 gene locus_tag LOCUS_12430 128799 129731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 129734 130042 gene locus_tag LOCUS_12440 129734 130042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 130870 130631 gene locus_tag LOCUS_12450 130870 130631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 131123 131962 gene locus_tag LOCUS_12460 131123 131962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 132169 133344 gene locus_tag LOCUS_12470 132169 133344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 133871 133416 gene locus_tag LOCUS_12480 133871 133416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 134314 133874 gene locus_tag LOCUS_12490 134314 133874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 135533 134514 gene locus_tag LOCUS_12500 gene ilvC 135533 134514 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_12500 136431 135688 gene locus_tag LOCUS_12510 136431 135688 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243095.1 protein_id gnl|my_center|LOCUS_12510 137047 136469 gene locus_tag LOCUS_12520 gene ilvN 137047 136469 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089241.1 protein_id gnl|my_center|LOCUS_12520 138956 137196 gene locus_tag LOCUS_12530 138956 137196 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972014.1 protein_id gnl|my_center|LOCUS_12530 139020 139358 gene locus_tag LOCUS_12540 139020 139358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 139826 139608 gene locus_tag LOCUS_12550 139826 139608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 140476 139838 gene locus_tag LOCUS_12560 140476 139838 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084077.1 protein_id gnl|my_center|LOCUS_12560 140675 141724 gene locus_tag LOCUS_12570 140675 141724 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111198133.1 protein_id gnl|my_center|LOCUS_12570 141906 142469 gene locus_tag LOCUS_12580 141906 142469 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_12580 142466 143164 gene locus_tag LOCUS_12590 142466 143164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 143282 145333 gene locus_tag LOCUS_12600 143282 145333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 146431 145490 gene locus_tag LOCUS_12610 146431 145490 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926287.1 protein_id gnl|my_center|LOCUS_12610 146489 147610 gene locus_tag LOCUS_12620 146489 147610 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820140.1 protein_id gnl|my_center|LOCUS_12620 147610 149262 gene locus_tag LOCUS_12630 147610 149262 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926289.1 protein_id gnl|my_center|LOCUS_12630 149255 150091 gene locus_tag LOCUS_12640 149255 150091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064168.1 protein_id gnl|my_center|LOCUS_12640 150088 150882 gene locus_tag LOCUS_12650 150088 150882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930641.1 protein_id gnl|my_center|LOCUS_12650 150887 152029 gene locus_tag LOCUS_12660 150887 152029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064167.1 protein_id gnl|my_center|LOCUS_12660 152026 153492 gene locus_tag LOCUS_12670 152026 153492 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808661.1 protein_id gnl|my_center|LOCUS_12670 153523 155106 gene locus_tag LOCUS_12680 153523 155106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_12680 155467 155177 gene locus_tag LOCUS_12690 155467 155177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 155996 155706 gene locus_tag LOCUS_12700 155996 155706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 156251 156511 gene locus_tag LOCUS_12710 156251 156511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 158064 156667 gene locus_tag LOCUS_12720 gene lpdA 158064 156667 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_12720 158847 158101 gene locus_tag LOCUS_12730 158847 158101 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_12730 159309 158890 gene locus_tag LOCUS_12740 159309 158890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 159767 159333 gene locus_tag LOCUS_12750 159767 159333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 161021 159798 gene locus_tag LOCUS_12760 gene odhB 161021 159798 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_12760 164041 161075 gene locus_tag LOCUS_12770 164041 161075 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083284.1 protein_id gnl|my_center|LOCUS_12770 165064 164174 gene locus_tag LOCUS_12780 gene sucD 165064 164174 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083285.1 protein_id gnl|my_center|LOCUS_12780 166696 165074 gene locus_tag LOCUS_12790 166696 165074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 167773 166808 gene locus_tag LOCUS_12800 gene mdh 167773 166808 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921482.1 protein_id gnl|my_center|LOCUS_12800 168918 168202 gene locus_tag LOCUS_12810 168918 168202 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204183.1 protein_id gnl|my_center|LOCUS_12810 169730 169092 gene locus_tag LOCUS_12820 169730 169092 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140192.1 protein_id gnl|my_center|LOCUS_12820 171104 169929 gene locus_tag LOCUS_12830 gene zapE 171104 169929 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_12830 171298 171705 gene locus_tag LOCUS_12840 gene sdhC 171298 171705 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_12840 171716 172111 gene locus_tag LOCUS_12850 gene sdhD 171716 172111 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_12850 172182 174002 gene locus_tag LOCUS_12860 gene sdhA 172182 174002 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_12860 174111 175811 gene locus_tag LOCUS_12870 174111 175811 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_12870 175901 176455 gene locus_tag LOCUS_12880 175901 176455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 177670 176987 gene locus_tag LOCUS_12890 177670 176987 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 protein_id gnl|my_center|LOCUS_12890 178125 179831 gene locus_tag LOCUS_12900 178125 179831 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390237.1 protein_id gnl|my_center|LOCUS_12900 180006 180920 gene locus_tag LOCUS_12910 180006 180920 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812144.1 protein_id gnl|my_center|LOCUS_12910 181033 181851 gene locus_tag LOCUS_12920 181033 181851 CDS product DUF1932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494215.1 protein_id gnl|my_center|LOCUS_12920 181863 182741 gene locus_tag LOCUS_12930 181863 182741 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_12930 182803 183801 gene locus_tag LOCUS_12940 182803 183801 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 protein_id gnl|my_center|LOCUS_12940 184696 183998 gene locus_tag LOCUS_12950 184696 183998 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_12950 185415 184693 gene locus_tag LOCUS_12960 185415 184693 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086622.1 protein_id gnl|my_center|LOCUS_12960 186543 185449 gene locus_tag LOCUS_12970 186543 185449 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_12970 187083 186817 gene locus_tag LOCUS_12980 187083 186817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 187180 187431 gene locus_tag LOCUS_12990 187180 187431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089849.1 protein_id gnl|my_center|LOCUS_12990 188709 187447 gene locus_tag LOCUS_13000 188709 187447 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089529.1 protein_id gnl|my_center|LOCUS_13000 190107 188776 gene locus_tag LOCUS_13010 190107 188776 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389189.1 protein_id gnl|my_center|LOCUS_13010 191951 190107 gene locus_tag LOCUS_13020 191951 190107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389190.1 protein_id gnl|my_center|LOCUS_13020 192261 193592 gene locus_tag LOCUS_13030 192261 193592 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389191.1 protein_id gnl|my_center|LOCUS_13030 193926 195947 gene locus_tag LOCUS_13040 193926 195947 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491107.1 protein_id gnl|my_center|LOCUS_13040 196033 197232 gene locus_tag LOCUS_13050 196033 197232 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529818.1 protein_id gnl|my_center|LOCUS_13050 197393 198091 gene locus_tag LOCUS_13060 197393 198091 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 protein_id gnl|my_center|LOCUS_13060 199563 198181 gene locus_tag LOCUS_13070 199563 198181 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531202.1 protein_id gnl|my_center|LOCUS_13070 199739 199584 gene locus_tag LOCUS_13080 199739 199584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 200662 199751 gene locus_tag LOCUS_13090 200662 199751 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_13090 201157 202356 gene locus_tag LOCUS_13100 201157 202356 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529818.1 protein_id gnl|my_center|LOCUS_13100 202857 203798 gene locus_tag LOCUS_13110 202857 203798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 protein_id gnl|my_center|LOCUS_13110 203795 204628 gene locus_tag LOCUS_13120 203795 204628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 protein_id gnl|my_center|LOCUS_13120 204711 206375 gene locus_tag LOCUS_13130 204711 206375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 protein_id gnl|my_center|LOCUS_13130 208206 206410 gene locus_tag LOCUS_13140 208206 206410 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974115.1 protein_id gnl|my_center|LOCUS_13140 209584 208304 gene locus_tag LOCUS_13150 209584 208304 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_13150 211088 209664 gene locus_tag LOCUS_13160 211088 209664 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463318.1 protein_id gnl|my_center|LOCUS_13160 212858 211272 gene locus_tag LOCUS_13170 212858 211272 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_13170 213906 213262 gene locus_tag LOCUS_13180 213906 213262 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205950.1 protein_id gnl|my_center|LOCUS_13180 214348 215310 gene locus_tag LOCUS_13190 214348 215310 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064540.1 protein_id gnl|my_center|LOCUS_13190 215321 216916 gene locus_tag LOCUS_13200 gene ggt 215321 216916 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809852.1 protein_id gnl|my_center|LOCUS_13200 217858 216953 gene locus_tag LOCUS_13210 217858 216953 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085469.1 protein_id gnl|my_center|LOCUS_13210 217960 218274 gene locus_tag LOCUS_13220 217960 218274 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085468.1 protein_id gnl|my_center|LOCUS_13220 218383 219453 gene locus_tag LOCUS_13230 218383 219453 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_13230 219490 220365 gene locus_tag LOCUS_13240 219490 220365 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 protein_id gnl|my_center|LOCUS_13240 220571 221527 gene locus_tag LOCUS_13250 220571 221527 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147026359.1 protein_id gnl|my_center|LOCUS_13250 221624 222373 gene locus_tag LOCUS_13260 221624 222373 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_13260 222370 223734 gene locus_tag LOCUS_13270 222370 223734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_13270 226020 223777 gene locus_tag LOCUS_13280 226020 223777 CDS product N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086709.1 protein_id gnl|my_center|LOCUS_13280 227638 226046 gene locus_tag LOCUS_13290 227638 226046 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_13290 229106 227700 gene locus_tag LOCUS_13300 229106 227700 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086707.1 protein_id gnl|my_center|LOCUS_13300 229264 230010 gene locus_tag LOCUS_13310 229264 230010 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086706.1 protein_id gnl|my_center|LOCUS_13310 230222 231145 gene locus_tag LOCUS_13320 gene panE 230222 231145 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083418.1 protein_id gnl|my_center|LOCUS_13320 231357 231284 gene locus_tag LOCUS_t00120 231357 231284 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 231748 231584 gene locus_tag LOCUS_13330 231748 231584 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084366.1 protein_id gnl|my_center|LOCUS_13330 232199 232035 gene locus_tag LOCUS_13340 232199 232035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 232360 234819 gene locus_tag LOCUS_13350 gene hrpB 232360 234819 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_13350 235049 235972 gene locus_tag LOCUS_13360 235049 235972 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_13360 235974 236951 gene locus_tag LOCUS_13370 235974 236951 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_13370 237842 236991 gene locus_tag LOCUS_13380 237842 236991 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073761.1 protein_id gnl|my_center|LOCUS_13380 237945 238841 gene locus_tag LOCUS_13390 237945 238841 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529130.1 protein_id gnl|my_center|LOCUS_13390 240700 238850 gene locus_tag LOCUS_13400 240700 238850 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 protein_id gnl|my_center|LOCUS_13400 240876 241346 gene locus_tag LOCUS_13410 240876 241346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 241458 241943 gene locus_tag LOCUS_13420 gene secB 241458 241943 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_13420 242071 242718 gene locus_tag LOCUS_13430 242071 242718 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921252.1 protein_id gnl|my_center|LOCUS_13430 242779 243222 gene locus_tag LOCUS_13440 gene rsfS 242779 243222 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265955.1 protein_id gnl|my_center|LOCUS_13440 243247 243723 gene locus_tag LOCUS_13450 gene rlmH 243247 243723 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242497.1 protein_id gnl|my_center|LOCUS_13450 243828 244928 gene locus_tag LOCUS_13460 243828 244928 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171553.1 protein_id gnl|my_center|LOCUS_13460 245124 246443 gene locus_tag LOCUS_13470 gene ugpB 245124 246443 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083558.1 protein_id gnl|my_center|LOCUS_13470 246503 247384 gene locus_tag LOCUS_13480 gene ugpA 246503 247384 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083557.1 protein_id gnl|my_center|LOCUS_13480 247384 248232 gene locus_tag LOCUS_13490 gene ugpE 247384 248232 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083556.1 protein_id gnl|my_center|LOCUS_13490 248243 249313 gene locus_tag LOCUS_13500 248243 249313 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529416.1 protein_id gnl|my_center|LOCUS_13500 249453 249881 gene locus_tag LOCUS_13510 249453 249881 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083554.1 protein_id gnl|my_center|LOCUS_13510 249917 250159 gene locus_tag LOCUS_13520 249917 250159 CDS product DUF1150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083553.1 protein_id gnl|my_center|LOCUS_13520 251368 250271 gene locus_tag LOCUS_13530 251368 250271 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085824.1 protein_id gnl|my_center|LOCUS_13530 251721 251796 gene locus_tag LOCUS_t00130 251721 251796 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 253045 252269 gene locus_tag LOCUS_13540 253045 252269 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 protein_id gnl|my_center|LOCUS_13540 253950 253159 gene locus_tag LOCUS_13550 253950 253159 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976286.1 protein_id gnl|my_center|LOCUS_13550 254156 255175 gene locus_tag LOCUS_13560 254156 255175 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_13560 255222 255725 gene locus_tag LOCUS_13570 255222 255725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 255722 256984 gene locus_tag LOCUS_13580 gene dctM 255722 256984 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_13580 256990 258378 gene locus_tag LOCUS_13590 256990 258378 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969923.1 protein_id gnl|my_center|LOCUS_13590 259221 258388 gene locus_tag LOCUS_13600 259221 258388 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086441.1 protein_id gnl|my_center|LOCUS_13600 259356 260975 gene locus_tag LOCUS_13610 259356 260975 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_13610 260991 261872 gene locus_tag LOCUS_13620 260991 261872 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114850.1 protein_id gnl|my_center|LOCUS_13620 261912 262886 gene locus_tag LOCUS_13630 261912 262886 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 protein_id gnl|my_center|LOCUS_13630 263750 262911 gene locus_tag LOCUS_13640 263750 262911 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743852.1 protein_id gnl|my_center|LOCUS_13640 264555 263761 gene locus_tag LOCUS_13650 264555 263761 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_13650 265289 264600 gene locus_tag LOCUS_13660 265289 264600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 267007 265427 gene locus_tag LOCUS_13670 267007 265427 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_13670 268583 267171 gene locus_tag LOCUS_13680 268583 267171 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 protein_id gnl|my_center|LOCUS_13680 268921 269721 gene locus_tag LOCUS_13690 268921 269721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 269917 270663 gene locus_tag LOCUS_13700 269917 270663 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_13700 270660 272096 gene locus_tag LOCUS_13710 gene uxaC 270660 272096 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_13710 272093 273595 gene locus_tag LOCUS_13720 272093 273595 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965670.1 protein_id gnl|my_center|LOCUS_13720 274210 273605 gene locus_tag LOCUS_13730 gene recR 274210 273605 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 protein_id gnl|my_center|LOCUS_13730 274879 274556 gene locus_tag LOCUS_13740 274879 274556 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067631.1 protein_id gnl|my_center|LOCUS_13740 276742 274895 gene locus_tag LOCUS_13750 276742 274895 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090838.1 protein_id gnl|my_center|LOCUS_13750 276919 277344 gene locus_tag LOCUS_13760 276919 277344 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921484.1 protein_id gnl|my_center|LOCUS_13760 277408 278394 gene locus_tag LOCUS_13770 gene nudC 277408 278394 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527934.1 protein_id gnl|my_center|LOCUS_13770 279307 278405 gene locus_tag LOCUS_13780 279307 278405 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088611.1 protein_id gnl|my_center|LOCUS_13780 280222 279359 gene locus_tag LOCUS_13790 280222 279359 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_13790 281027 280293 gene locus_tag LOCUS_13800 281027 280293 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527937.1 protein_id gnl|my_center|LOCUS_13800 281217 281762 gene locus_tag LOCUS_13810 281217 281762 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084240.1 protein_id gnl|my_center|LOCUS_13810 281986 282681 gene locus_tag LOCUS_13820 281986 282681 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542552.1 protein_id gnl|my_center|LOCUS_13820 282707 284494 gene locus_tag LOCUS_13830 282707 284494 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175918.1 protein_id gnl|my_center|LOCUS_13830 284497 284946 gene locus_tag LOCUS_13840 284497 284946 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090867.1 protein_id gnl|my_center|LOCUS_13840 285082 285483 gene locus_tag LOCUS_13850 285082 285483 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_13850 285558 285878 gene locus_tag LOCUS_13860 285558 285878 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311103.1 protein_id gnl|my_center|LOCUS_13860 285938 286492 gene locus_tag LOCUS_13870 285938 286492 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_13870 286503 287237 gene locus_tag LOCUS_13880 286503 287237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 287315 288469 gene locus_tag LOCUS_13890 287315 288469 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086586.1 protein_id gnl|my_center|LOCUS_13890 288974 288549 gene locus_tag LOCUS_13900 288974 288549 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_13900 289554 289096 gene locus_tag LOCUS_13910 gene dut 289554 289096 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_13910 290946 289684 gene locus_tag LOCUS_13920 gene coaBC 290946 289684 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_13920 292419 290974 gene locus_tag LOCUS_13930 gene amn 292419 290974 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119204.1 protein_id gnl|my_center|LOCUS_13930 291980 291886 gene locus_tag LOCUS_t00140 291980 291886 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 294031 292463 gene locus_tag LOCUS_13940 gene ubiB 294031 292463 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083583.1 protein_id gnl|my_center|LOCUS_13940 294819 294034 gene locus_tag LOCUS_13950 gene ubiE 294819 294034 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083584.1 protein_id gnl|my_center|LOCUS_13950 294906 295775 gene locus_tag LOCUS_13960 gene mutM 294906 295775 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330821.1 protein_id gnl|my_center|LOCUS_13960 295785 296402 gene locus_tag LOCUS_13970 295785 296402 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104756.1 protein_id gnl|my_center|LOCUS_13970 296613 296747 gene locus_tag LOCUS_13980 gene rpmH 296613 296747 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706673.1 protein_id gnl|my_center|LOCUS_13980 296796 297149 gene locus_tag LOCUS_13990 gene rnpA 296796 297149 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090819.1 protein_id gnl|my_center|LOCUS_13990 297188 299035 gene locus_tag LOCUS_14000 gene yidC 297188 299035 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966085.1 protein_id gnl|my_center|LOCUS_14000 299181 299831 gene locus_tag LOCUS_14010 gene yihA 299181 299831 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090821.1 protein_id gnl|my_center|LOCUS_14010 302006 299853 gene locus_tag LOCUS_14020 302006 299853 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339303.1 protein_id gnl|my_center|LOCUS_14020 303354 302116 gene locus_tag LOCUS_14030 303354 302116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 303826 304302 gene locus_tag LOCUS_14040 303826 304302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 307488 304420 gene locus_tag LOCUS_14050 gene polA 307488 304420 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090853.1 protein_id gnl|my_center|LOCUS_14050 307726 308571 gene locus_tag LOCUS_14060 307726 308571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 310014 308992 gene locus_tag LOCUS_14070 310014 308992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 311069 310077 gene locus_tag LOCUS_14080 311069 310077 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_14080 311851 311075 gene locus_tag LOCUS_14090 311851 311075 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_14090 312629 311865 gene locus_tag LOCUS_14100 312629 311865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_14100 313402 312626 gene locus_tag LOCUS_14110 313402 312626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 314181 313402 gene locus_tag LOCUS_14120 314181 313402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_14120 315143 314193 gene locus_tag LOCUS_14130 315143 314193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 315926 315216 gene locus_tag LOCUS_14140 315926 315216 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919941.1 protein_id gnl|my_center|LOCUS_14140 316031 316837 gene locus_tag LOCUS_14150 316031 316837 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970116.1 protein_id gnl|my_center|LOCUS_14150 316908 317330 gene locus_tag LOCUS_14160 316908 317330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 317973 317341 gene locus_tag LOCUS_14170 317973 317341 CDS product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975391.1 protein_id gnl|my_center|LOCUS_14170 318528 317980 gene locus_tag LOCUS_14180 318528 317980 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 protein_id gnl|my_center|LOCUS_14180 318816 319331 gene locus_tag LOCUS_14190 318816 319331 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533661.1 protein_id gnl|my_center|LOCUS_14190 319415 321211 gene locus_tag LOCUS_14200 319415 321211 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_14200 321363 322520 gene locus_tag LOCUS_14210 321363 322520 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533659.1 protein_id gnl|my_center|LOCUS_14210 322564 323775 gene locus_tag LOCUS_14220 322564 323775 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083978.1 protein_id gnl|my_center|LOCUS_14220 323791 325998 gene locus_tag LOCUS_14230 323791 325998 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083979.1 protein_id gnl|my_center|LOCUS_14230 326323 329523 gene locus_tag LOCUS_14240 326323 329523 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_14240 329525 330694 gene locus_tag LOCUS_14250 329525 330694 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_14250 331124 331654 gene locus_tag LOCUS_14260 331124 331654 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067136.1 protein_id gnl|my_center|LOCUS_14260 331654 333180 gene locus_tag LOCUS_14270 gene atpA 331654 333180 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083274.1 protein_id gnl|my_center|LOCUS_14270 333193 333645 gene locus_tag LOCUS_14280 333193 333645 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083047.1 protein_id gnl|my_center|LOCUS_14280 333645 334514 gene locus_tag LOCUS_14290 333645 334514 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083273.1 protein_id gnl|my_center|LOCUS_14290 334590 335999 gene locus_tag LOCUS_14300 gene atpD 334590 335999 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529038.1 protein_id gnl|my_center|LOCUS_14300 336024 336437 gene locus_tag LOCUS_14310 336024 336437 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083271.1 protein_id gnl|my_center|LOCUS_14310 336924 336517 gene locus_tag LOCUS_14320 336924 336517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14320 337245 336943 gene locus_tag LOCUS_14330 337245 336943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14330 338145 337387 gene locus_tag LOCUS_14340 338145 337387 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089537.1 protein_id gnl|my_center|LOCUS_14340 339050 338190 gene locus_tag LOCUS_14350 339050 338190 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965686.1 protein_id gnl|my_center|LOCUS_14350 339508 339050 gene locus_tag LOCUS_14360 339508 339050 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_14360 340712 339510 gene locus_tag LOCUS_14370 340712 339510 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815601.1 protein_id gnl|my_center|LOCUS_14370 341927 340761 gene locus_tag LOCUS_14380 341927 340761 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_14380 343189 341957 gene locus_tag LOCUS_14390 343189 341957 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086703.1 protein_id gnl|my_center|LOCUS_14390 343560 345038 gene locus_tag LOCUS_14400 343560 345038 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267658.1 protein_id gnl|my_center|LOCUS_14400 345064 345834 gene locus_tag LOCUS_14410 345064 345834 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_14410 345907 347109 gene locus_tag LOCUS_14420 345907 347109 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_14420 347197 348069 gene locus_tag LOCUS_14430 347197 348069 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_14430 348069 349088 gene locus_tag LOCUS_14440 348069 349088 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_14440 349085 349807 gene locus_tag LOCUS_14450 349085 349807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_14450 349804 350514 gene locus_tag LOCUS_14460 349804 350514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 protein_id gnl|my_center|LOCUS_14460 351084 350581 gene locus_tag LOCUS_14470 351084 350581 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083268.1 protein_id gnl|my_center|LOCUS_14470 352285 351116 gene locus_tag LOCUS_14480 352285 351116 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083267.1 protein_id gnl|my_center|LOCUS_14480 352454 353788 gene locus_tag LOCUS_14490 352454 353788 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083261.1 protein_id gnl|my_center|LOCUS_14490 353785 354441 gene locus_tag LOCUS_14500 353785 354441 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965055.1 protein_id gnl|my_center|LOCUS_14500 354479 355042 gene locus_tag LOCUS_14510 354479 355042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 355493 356011 gene locus_tag LOCUS_14520 355493 356011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 356524 356012 gene locus_tag LOCUS_14530 356524 356012 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_14530 356665 357837 gene locus_tag LOCUS_14540 gene recF 356665 357837 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083649.1 protein_id gnl|my_center|LOCUS_14540 358618 357887 gene locus_tag LOCUS_14550 358618 357887 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086894.1 protein_id gnl|my_center|LOCUS_14550 359419 358736 gene locus_tag LOCUS_14560 359419 358736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 360666 359590 gene locus_tag LOCUS_14570 360666 359590 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_14570 361846 360770 gene locus_tag LOCUS_14580 361846 360770 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339267.1 protein_id gnl|my_center|LOCUS_14580 362015 362698 gene locus_tag LOCUS_14590 362015 362698 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_14590 362815 363789 gene locus_tag LOCUS_14600 362815 363789 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_14600 364776 363880 gene locus_tag LOCUS_14610 364776 363880 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_14610 364921 365904 gene locus_tag LOCUS_14620 364921 365904 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_14620 366534 365968 gene locus_tag LOCUS_14630 366534 365968 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191763.1 protein_id gnl|my_center|LOCUS_14630 368007 366628 gene locus_tag LOCUS_14640 368007 366628 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973695.1 protein_id gnl|my_center|LOCUS_14640 368109 368714 gene locus_tag LOCUS_14650 368109 368714 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_14650 369868 368825 gene locus_tag LOCUS_14660 369868 368825 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975825.1 protein_id gnl|my_center|LOCUS_14660 371264 369972 gene locus_tag LOCUS_14670 371264 369972 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528232.1 protein_id gnl|my_center|LOCUS_14670 371377 372027 gene locus_tag LOCUS_14680 371377 372027 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084115.1 protein_id gnl|my_center|LOCUS_14680 372156 373307 gene locus_tag LOCUS_14690 gene acdA 372156 373307 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545532.1 protein_id gnl|my_center|LOCUS_14690 373349 375028 gene locus_tag LOCUS_14700 373349 375028 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089552.1 protein_id gnl|my_center|LOCUS_14700 376140 375148 gene locus_tag LOCUS_14710 376140 375148 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816041.1 protein_id gnl|my_center|LOCUS_14710 377117 376137 gene locus_tag LOCUS_14720 377117 376137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 protein_id gnl|my_center|LOCUS_14720 378342 377425 gene locus_tag LOCUS_14730 378342 377425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816047.1 protein_id gnl|my_center|LOCUS_14730 379336 378359 gene locus_tag LOCUS_14740 379336 378359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817805.1 protein_id gnl|my_center|LOCUS_14740 381035 379452 gene locus_tag LOCUS_14750 381035 379452 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816050.1 protein_id gnl|my_center|LOCUS_14750 381346 382257 gene locus_tag LOCUS_14760 381346 382257 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811656.1 protein_id gnl|my_center|LOCUS_14760 382268 383428 gene locus_tag LOCUS_14770 gene argE 382268 383428 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967956.1 protein_id gnl|my_center|LOCUS_14770 383527 384585 gene locus_tag LOCUS_14780 gene obgE 383527 384585 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083257.1 protein_id gnl|my_center|LOCUS_14780 384682 385755 gene locus_tag LOCUS_14790 384682 385755 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267942.1 protein_id gnl|my_center|LOCUS_14790 386502 386044 gene locus_tag LOCUS_14800 386502 386044 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084076.1 protein_id gnl|my_center|LOCUS_14800 386989 386507 gene locus_tag LOCUS_14810 386989 386507 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 protein_id gnl|my_center|LOCUS_14810 388369 387074 gene locus_tag LOCUS_14820 gene hisD 388369 387074 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084074.1 protein_id gnl|my_center|LOCUS_14820 388514 389305 gene locus_tag LOCUS_14830 388514 389305 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529914.1 protein_id gnl|my_center|LOCUS_14830 389809 389333 gene locus_tag LOCUS_14840 389809 389333 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035332.1 protein_id gnl|my_center|LOCUS_14840 390837 389806 gene locus_tag LOCUS_14850 390837 389806 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501902.1 protein_id gnl|my_center|LOCUS_14850 391247 392302 gene locus_tag LOCUS_14860 391247 392302 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965983.1 protein_id gnl|my_center|LOCUS_14860 392800 393573 gene locus_tag LOCUS_14870 392800 393573 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532224.1 protein_id gnl|my_center|LOCUS_14870 394548 393886 gene locus_tag LOCUS_14880 394548 393886 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040397.1 protein_id gnl|my_center|LOCUS_14880 396228 394588 gene locus_tag LOCUS_14890 396228 394588 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_14890 396470 397660 gene locus_tag LOCUS_14900 396470 397660 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_14900 397703 398812 gene locus_tag LOCUS_14910 397703 398812 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_14910 398890 399708 gene locus_tag LOCUS_14920 398890 399708 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529669.1 protein_id gnl|my_center|LOCUS_14920 399705 400175 gene locus_tag LOCUS_14930 399705 400175 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 protein_id gnl|my_center|LOCUS_14930 400186 401115 gene locus_tag LOCUS_14940 400186 401115 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 protein_id gnl|my_center|LOCUS_14940 401138 402328 gene locus_tag LOCUS_14950 401138 402328 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 protein_id gnl|my_center|LOCUS_14950 402477 403724 gene locus_tag LOCUS_14960 402477 403724 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_14960 403800 404738 gene locus_tag LOCUS_14970 403800 404738 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_14970 404735 405985 gene locus_tag LOCUS_14980 404735 405985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 405982 406743 gene locus_tag LOCUS_14990 405982 406743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 406743 407438 gene locus_tag LOCUS_15000 406743 407438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930656.1 protein_id gnl|my_center|LOCUS_15000 407491 408720 gene locus_tag LOCUS_15010 407491 408720 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 protein_id gnl|my_center|LOCUS_15010 408724 409758 gene locus_tag LOCUS_15020 408724 409758 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_15020 409758 410537 gene locus_tag LOCUS_15030 409758 410537 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206876.1 protein_id gnl|my_center|LOCUS_15030 411807 410587 gene locus_tag LOCUS_15040 411807 410587 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 protein_id gnl|my_center|LOCUS_15040 411881 412279 gene locus_tag LOCUS_15050 411881 412279 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061591.1 protein_id gnl|my_center|LOCUS_15050 412730 413977 gene locus_tag LOCUS_15060 412730 413977 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_15060 414477 414058 gene locus_tag LOCUS_15070 414477 414058 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531182.1 protein_id gnl|my_center|LOCUS_15070 414956 414546 gene locus_tag LOCUS_15080 414956 414546 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531186.1 protein_id gnl|my_center|LOCUS_15080 415276 414953 gene locus_tag LOCUS_15090 415276 414953 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531187.1 protein_id gnl|my_center|LOCUS_15090 415866 415474 gene locus_tag LOCUS_15100 gene apaG 415866 415474 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530166.1 protein_id gnl|my_center|LOCUS_15100 416413 416066 gene locus_tag LOCUS_15110 416413 416066 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 protein_id gnl|my_center|LOCUS_15110 416621 417247 gene locus_tag LOCUS_15120 416621 417247 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327211.1 protein_id gnl|my_center|LOCUS_15120 418918 417257 gene locus_tag LOCUS_15130 418918 417257 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083952.1 protein_id gnl|my_center|LOCUS_15130 419110 419901 gene locus_tag LOCUS_15140 419110 419901 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_15140 420006 421277 gene locus_tag LOCUS_15150 420006 421277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040801.1 protein_id gnl|my_center|LOCUS_15150 421330 421926 gene locus_tag LOCUS_15160 421330 421926 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286291.1 protein_id gnl|my_center|LOCUS_15160 421929 422780 gene locus_tag LOCUS_15170 421929 422780 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083931.1 protein_id gnl|my_center|LOCUS_15170 422851 423219 gene locus_tag LOCUS_15180 422851 423219 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965261.1 protein_id gnl|my_center|LOCUS_15180 423537 423947 gene locus_tag LOCUS_15190 423537 423947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 425196 423952 gene locus_tag LOCUS_15200 425196 423952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402537.1 protein_id gnl|my_center|LOCUS_15200 426339 425461 gene locus_tag LOCUS_15210 426339 425461 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083951.1 protein_id gnl|my_center|LOCUS_15210 426597 427382 gene locus_tag LOCUS_15220 426597 427382 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_15220 427386 428900 gene locus_tag LOCUS_15230 427386 428900 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 protein_id gnl|my_center|LOCUS_15230 428903 429337 gene locus_tag LOCUS_15240 428903 429337 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_15240 430339 429365 gene locus_tag LOCUS_15250 430339 429365 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327203.1 protein_id gnl|my_center|LOCUS_15250 430728 431351 gene locus_tag LOCUS_15260 430728 431351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 431492 433927 gene locus_tag LOCUS_15270 431492 433927 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_15270 433984 434880 gene locus_tag LOCUS_15280 433984 434880 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089328.1 protein_id gnl|my_center|LOCUS_15280 435032 437461 gene locus_tag LOCUS_15290 435032 437461 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_15290 438141 437470 gene locus_tag LOCUS_15300 438141 437470 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090583.1 protein_id gnl|my_center|LOCUS_15300 438684 438226 gene locus_tag LOCUS_15310 438684 438226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 440894 438999 gene locus_tag LOCUS_15320 440894 438999 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965350.1 protein_id gnl|my_center|LOCUS_15320 441880 441074 gene locus_tag LOCUS_15330 441880 441074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 441994 442878 gene locus_tag LOCUS_15340 441994 442878 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104496.1 protein_id gnl|my_center|LOCUS_15340 444261 442885 gene locus_tag LOCUS_15350 gene gor 444261 442885 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 protein_id gnl|my_center|LOCUS_15350 444424 445401 gene locus_tag LOCUS_15360 444424 445401 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 protein_id gnl|my_center|LOCUS_15360 445401 445874 gene locus_tag LOCUS_15370 445401 445874 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970708.1 protein_id gnl|my_center|LOCUS_15370 445884 447389 gene locus_tag LOCUS_15380 445884 447389 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172209.1 protein_id gnl|my_center|LOCUS_15380 448021 447455 gene locus_tag LOCUS_15390 448021 447455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 448778 448077 gene locus_tag LOCUS_15400 gene rpiA 448778 448077 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_15400 450748 449009 gene locus_tag LOCUS_15410 450748 449009 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086561.1 protein_id gnl|my_center|LOCUS_15410 451016 451819 gene locus_tag LOCUS_15420 451016 451819 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090140.1 protein_id gnl|my_center|LOCUS_15420 453281 451896 gene locus_tag LOCUS_15430 453281 451896 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_15430 453488 454984 gene locus_tag LOCUS_15440 453488 454984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 455951 455004 gene locus_tag LOCUS_15450 455951 455004 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193566.1 protein_id gnl|my_center|LOCUS_15450 456939 455986 gene locus_tag LOCUS_15460 456939 455986 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_15460 458189 456945 gene locus_tag LOCUS_15470 458189 456945 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085640.1 protein_id gnl|my_center|LOCUS_15470 459199 458186 gene locus_tag LOCUS_15480 459199 458186 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920388.1 protein_id gnl|my_center|LOCUS_15480 459403 459912 gene locus_tag LOCUS_15490 459403 459912 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 protein_id gnl|my_center|LOCUS_15490 460019 460663 gene locus_tag LOCUS_15500 gene maiA 460019 460663 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_15500 461033 460668 gene locus_tag LOCUS_15510 461033 460668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 463274 461142 gene locus_tag LOCUS_15520 463274 461142 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_15520 463521 463826 gene locus_tag LOCUS_15530 463521 463826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 466956 464143 gene locus_tag LOCUS_15540 466956 464143 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965190.1 protein_id gnl|my_center|LOCUS_15540 468636 467035 gene locus_tag LOCUS_15550 468636 467035 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_15550 469466 468771 gene locus_tag LOCUS_15560 gene urtE 469466 468771 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084269.1 protein_id gnl|my_center|LOCUS_15560 470281 469472 gene locus_tag LOCUS_15570 gene urtD 470281 469472 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_15570 471435 470293 gene locus_tag LOCUS_15580 gene urtC 471435 470293 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_15580 473045 471432 gene locus_tag LOCUS_15590 gene urtB 473045 471432 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531848.1 protein_id gnl|my_center|LOCUS_15590 474456 473161 gene locus_tag LOCUS_15600 gene urtA 474456 473161 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_15600 474843 476222 gene locus_tag LOCUS_15610 474843 476222 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_15610 476227 477159 gene locus_tag LOCUS_15620 476227 477159 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083965.1 protein_id gnl|my_center|LOCUS_15620 477233 478072 gene locus_tag LOCUS_15630 477233 478072 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974986.1 protein_id gnl|my_center|LOCUS_15630 478200 478081 gene locus_tag LOCUS_15640 478200 478081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 479241 478348 gene locus_tag LOCUS_15650 479241 478348 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241624.1 protein_id gnl|my_center|LOCUS_15650 480443 479241 gene locus_tag LOCUS_15660 gene queG 480443 479241 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083539.1 protein_id gnl|my_center|LOCUS_15660 481027 480341 gene locus_tag LOCUS_15670 481027 480341 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083540.1 protein_id gnl|my_center|LOCUS_15670 481238 482041 gene locus_tag LOCUS_15680 481238 482041 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968508.1 protein_id gnl|my_center|LOCUS_15680 483047 482085 gene locus_tag LOCUS_15690 483047 482085 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083542.1 protein_id gnl|my_center|LOCUS_15690 484369 483170 gene locus_tag LOCUS_15700 484369 483170 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_15700 484906 484430 gene locus_tag LOCUS_15710 484906 484430 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 protein_id gnl|my_center|LOCUS_15710 485063 485413 gene locus_tag LOCUS_15720 485063 485413 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 protein_id gnl|my_center|LOCUS_15720 485446 486315 gene locus_tag LOCUS_15730 485446 486315 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_15730 486684 486346 gene locus_tag LOCUS_15740 486684 486346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 487448 486756 gene locus_tag LOCUS_15750 487448 486756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 489634 487541 gene locus_tag LOCUS_15760 489634 487541 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084286.1 protein_id gnl|my_center|LOCUS_15760 490723 489773 gene locus_tag LOCUS_15770 490723 489773 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089907.1 protein_id gnl|my_center|LOCUS_15770 492387 490720 gene locus_tag LOCUS_15780 492387 490720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965361.1 protein_id gnl|my_center|LOCUS_15780 492839 492384 gene locus_tag LOCUS_15790 492839 492384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 493092 492841 gene locus_tag LOCUS_15800 493092 492841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 494267 493089 gene locus_tag LOCUS_15810 494267 493089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173513.1 protein_id gnl|my_center|LOCUS_15810 495370 494267 gene locus_tag LOCUS_15820 495370 494267 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084243.1 protein_id gnl|my_center|LOCUS_15820 495609 496337 gene locus_tag LOCUS_15830 495609 496337 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533151.1 protein_id gnl|my_center|LOCUS_15830 496441 497523 gene locus_tag LOCUS_15840 496441 497523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 498190 497531 gene locus_tag LOCUS_15850 498190 497531 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966008.1 protein_id gnl|my_center|LOCUS_15850 498262 499743 gene locus_tag LOCUS_15860 gene hydA 498262 499743 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086117.1 protein_id gnl|my_center|LOCUS_15860 499864 501924 gene locus_tag LOCUS_15870 499864 501924 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_15870 503019 502261 gene locus_tag LOCUS_15880 503019 502261 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_15880 503469 504149 gene locus_tag LOCUS_15890 503469 504149 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 protein_id gnl|my_center|LOCUS_15890 505021 504155 gene locus_tag LOCUS_15900 505021 504155 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089239.1 protein_id gnl|my_center|LOCUS_15900 505937 505170 gene locus_tag LOCUS_15910 505937 505170 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_15910 506718 506104 gene locus_tag LOCUS_15920 506718 506104 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529176.1 protein_id gnl|my_center|LOCUS_15920 507618 506968 gene locus_tag LOCUS_15930 507618 506968 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529177.1 protein_id gnl|my_center|LOCUS_15930 508733 507825 gene locus_tag LOCUS_15940 508733 507825 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085297.1 protein_id gnl|my_center|LOCUS_15940 509035 510132 gene locus_tag LOCUS_15950 509035 510132 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085296.1 protein_id gnl|my_center|LOCUS_15950 510553 510143 gene locus_tag LOCUS_15960 510553 510143 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352231.1 protein_id gnl|my_center|LOCUS_15960 512366 510702 gene locus_tag LOCUS_15970 512366 510702 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_15970 512644 512991 gene locus_tag LOCUS_15980 512644 512991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 514627 513041 gene locus_tag LOCUS_15990 514627 513041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_15990 516468 514828 gene locus_tag LOCUS_16000 gene groL 516468 514828 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090265.1 protein_id gnl|my_center|LOCUS_16000 516810 516520 gene locus_tag LOCUS_16010 gene groES 516810 516520 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_16010 517073 517561 gene locus_tag LOCUS_16020 517073 517561 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339046.1 protein_id gnl|my_center|LOCUS_16020 517637 518119 gene locus_tag LOCUS_16030 517637 518119 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532579.1 protein_id gnl|my_center|LOCUS_16030 519032 518133 gene locus_tag LOCUS_16040 519032 518133 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267449.1 protein_id gnl|my_center|LOCUS_16040 519808 519029 gene locus_tag LOCUS_16050 519808 519029 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144067654.1 protein_id gnl|my_center|LOCUS_16050 520471 520139 gene locus_tag LOCUS_16060 520471 520139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 520707 521549 gene locus_tag LOCUS_16070 520707 521549 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 protein_id gnl|my_center|LOCUS_16070 521554 521955 gene locus_tag LOCUS_16080 521554 521955 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070494.1 protein_id gnl|my_center|LOCUS_16080 523381 522011 gene locus_tag LOCUS_16090 523381 522011 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083983.1 protein_id gnl|my_center|LOCUS_16090 523640 524335 gene locus_tag LOCUS_16100 523640 524335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 524416 525903 gene locus_tag LOCUS_16110 gene hisS 524416 525903 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090191.1 protein_id gnl|my_center|LOCUS_16110 525969 526688 gene locus_tag LOCUS_16120 gene lepB 525969 526688 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389606.1 protein_id gnl|my_center|LOCUS_16120 527327 526704 gene locus_tag LOCUS_16130 527327 526704 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724650.1 protein_id gnl|my_center|LOCUS_16130 527976 527332 gene locus_tag LOCUS_16140 gene grpE 527976 527332 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974227.1 protein_id gnl|my_center|LOCUS_16140 529092 528070 gene locus_tag LOCUS_16150 529092 528070 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204915.1 protein_id gnl|my_center|LOCUS_16150 530021 529110 gene locus_tag LOCUS_16160 gene folD 530021 529110 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530231.1 protein_id gnl|my_center|LOCUS_16160 531145 530027 gene locus_tag LOCUS_16170 gene dnaN 531145 530027 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083651.1 protein_id gnl|my_center|LOCUS_16170 531449 531868 gene locus_tag LOCUS_16180 531449 531868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 533461 531974 gene locus_tag LOCUS_16190 gene dnaA 533461 531974 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083652.1 protein_id gnl|my_center|LOCUS_16190 533992 533546 gene locus_tag LOCUS_16200 533992 533546 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078099.1 protein_id gnl|my_center|LOCUS_16200 534991 534725 gene locus_tag LOCUS_16210 gene rpsT 534991 534725 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241581.1 protein_id gnl|my_center|LOCUS_16210 535212 536105 gene locus_tag LOCUS_16220 535212 536105 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809826.1 protein_id gnl|my_center|LOCUS_16220 536450 538009 gene locus_tag LOCUS_16230 536450 538009 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089175.1 protein_id gnl|my_center|LOCUS_16230 538020 538925 gene locus_tag LOCUS_16240 538020 538925 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_16240 539080 539155 gene locus_tag LOCUS_t00150 539080 539155 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 539800 539306 gene locus_tag LOCUS_16250 539800 539306 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532467.1 protein_id gnl|my_center|LOCUS_16250 540196 540786 gene locus_tag LOCUS_16260 540196 540786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 541205 540996 gene locus_tag LOCUS_16270 541205 540996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 541302 541928 gene locus_tag LOCUS_16280 541302 541928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 541940 542332 gene locus_tag LOCUS_16290 541940 542332 CDS product DUF3768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_16290 542626 543078 gene locus_tag LOCUS_16300 542626 543078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 543410 543183 gene locus_tag LOCUS_16310 543410 543183 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970277.1 protein_id gnl|my_center|LOCUS_16310 543567 544028 gene locus_tag LOCUS_16320 543567 544028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 544113 544493 gene locus_tag LOCUS_16330 544113 544493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 545580 545122 gene locus_tag LOCUS_16340 545580 545122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 546432 546028 gene locus_tag LOCUS_16350 546432 546028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 546713 547930 gene locus_tag LOCUS_16360 546713 547930 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531557.1 protein_id gnl|my_center|LOCUS_16360 548104 548502 gene locus_tag LOCUS_16370 548104 548502 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531554.1 protein_id gnl|my_center|LOCUS_16370 549321 548761 gene locus_tag LOCUS_16380 549321 548761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16380 549541 550605 gene locus_tag LOCUS_16390 549541 550605 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253416.1 protein_id gnl|my_center|LOCUS_16390 551583 550777 gene locus_tag LOCUS_16400 551583 550777 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395528.1 protein_id gnl|my_center|LOCUS_16400 553854 551803 gene locus_tag LOCUS_16410 553854 551803 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974731.1 protein_id gnl|my_center|LOCUS_16410 558356 553869 gene locus_tag LOCUS_16420 558356 553869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 >Feature sequence04 402 2351 gene locus_tag LOCUS_16430 402 2351 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965357.1 protein_id gnl|my_center|LOCUS_16430 3810 2395 gene locus_tag LOCUS_16440 gene trmFO 3810 2395 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087495.1 protein_id gnl|my_center|LOCUS_16440 6559 3956 gene locus_tag LOCUS_16450 gene clpB 6559 3956 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 protein_id gnl|my_center|LOCUS_16450 6812 7573 gene locus_tag LOCUS_16460 6812 7573 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265642.1 protein_id gnl|my_center|LOCUS_16460 7631 8809 gene locus_tag LOCUS_16470 7631 8809 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531181.1 protein_id gnl|my_center|LOCUS_16470 9796 8840 gene locus_tag LOCUS_16480 9796 8840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241556.1 protein_id gnl|my_center|LOCUS_16480 10211 9951 gene locus_tag LOCUS_16490 10211 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 11814 10315 gene locus_tag LOCUS_16500 11814 10315 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_16500 12192 11968 gene locus_tag LOCUS_16510 12192 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 12997 12365 gene locus_tag LOCUS_16520 12997 12365 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083218.1 protein_id gnl|my_center|LOCUS_16520 14028 13114 gene locus_tag LOCUS_16530 14028 13114 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_16530 15326 14223 gene locus_tag LOCUS_16540 15326 14223 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_16540 15823 16767 gene locus_tag LOCUS_16550 gene rsmI 15823 16767 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310149.1 protein_id gnl|my_center|LOCUS_16550 16764 17159 gene locus_tag LOCUS_16560 16764 17159 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083496.1 protein_id gnl|my_center|LOCUS_16560 17172 18113 gene locus_tag LOCUS_16570 gene gshB 17172 18113 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083495.1 protein_id gnl|my_center|LOCUS_16570 18770 18135 gene locus_tag LOCUS_16580 18770 18135 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 protein_id gnl|my_center|LOCUS_16580 18875 19630 gene locus_tag LOCUS_16590 18875 19630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 19631 19933 gene locus_tag LOCUS_16600 19631 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 20020 21555 gene locus_tag LOCUS_16610 20020 21555 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083488.1 protein_id gnl|my_center|LOCUS_16610 21684 23765 gene locus_tag LOCUS_16620 21684 23765 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965129.1 protein_id gnl|my_center|LOCUS_16620 24321 23710 gene locus_tag LOCUS_16630 24321 23710 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974744.1 protein_id gnl|my_center|LOCUS_16630 24496 27018 gene locus_tag LOCUS_16640 24496 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 29355 27070 gene locus_tag LOCUS_16650 29355 27070 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_16650 30841 29447 gene locus_tag LOCUS_16660 30841 29447 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084248.1 protein_id gnl|my_center|LOCUS_16660 31773 30898 gene locus_tag LOCUS_16670 31773 30898 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088376.1 protein_id gnl|my_center|LOCUS_16670 31863 32453 gene locus_tag LOCUS_16680 31863 32453 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175439.1 protein_id gnl|my_center|LOCUS_16680 34932 32515 gene locus_tag LOCUS_16690 gene pheT 34932 32515 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083531.1 protein_id gnl|my_center|LOCUS_16690 35354 34929 gene locus_tag LOCUS_16700 35354 34929 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170242.1 protein_id gnl|my_center|LOCUS_16700 36433 35351 gene locus_tag LOCUS_16710 gene pheS 36433 35351 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083532.1 protein_id gnl|my_center|LOCUS_16710 37553 36495 gene locus_tag LOCUS_16720 37553 36495 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 protein_id gnl|my_center|LOCUS_16720 38091 37726 gene locus_tag LOCUS_16730 gene rplT 38091 37726 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710091.1 protein_id gnl|my_center|LOCUS_16730 38337 38137 gene locus_tag LOCUS_16740 gene rpmI 38337 38137 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539890.1 protein_id gnl|my_center|LOCUS_16740 38596 39585 gene locus_tag LOCUS_16750 38596 39585 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 protein_id gnl|my_center|LOCUS_16750 39734 40042 gene locus_tag LOCUS_16760 39734 40042 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 protein_id gnl|my_center|LOCUS_16760 41374 40097 gene locus_tag LOCUS_16770 gene ccrA 41374 40097 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920921.1 protein_id gnl|my_center|LOCUS_16770 41700 41954 gene locus_tag LOCUS_16780 41700 41954 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_16780 42083 44059 gene locus_tag LOCUS_16790 42083 44059 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_16790 44161 45780 gene locus_tag LOCUS_16800 44161 45780 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066743.1 protein_id gnl|my_center|LOCUS_16800 46930 45749 gene locus_tag LOCUS_16810 46930 45749 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088523.1 protein_id gnl|my_center|LOCUS_16810 48324 46945 gene locus_tag LOCUS_16820 48324 46945 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965385.1 protein_id gnl|my_center|LOCUS_16820 49653 48532 gene locus_tag LOCUS_16830 49653 48532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 49849 52641 gene locus_tag LOCUS_16840 gene secA 49849 52641 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083036.1 protein_id gnl|my_center|LOCUS_16840 52746 52821 gene locus_tag LOCUS_t00160 52746 52821 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 53282 54370 gene locus_tag LOCUS_16850 53282 54370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 54658 54948 gene locus_tag LOCUS_16860 54658 54948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 55107 55259 gene locus_tag LOCUS_16870 55107 55259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 55376 56038 gene locus_tag LOCUS_16880 55376 56038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 57468 56182 gene locus_tag LOCUS_16890 57468 56182 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 protein_id gnl|my_center|LOCUS_16890 59008 57455 gene locus_tag LOCUS_16900 59008 57455 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_16900 59268 59008 gene locus_tag LOCUS_16910 59268 59008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 60147 59296 gene locus_tag LOCUS_16920 60147 59296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972623.1 protein_id gnl|my_center|LOCUS_16920 61401 60442 gene locus_tag LOCUS_16930 61401 60442 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814318.1 protein_id gnl|my_center|LOCUS_16930 62670 61447 gene locus_tag LOCUS_16940 62670 61447 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113883.1 protein_id gnl|my_center|LOCUS_16940 64412 62667 gene locus_tag LOCUS_16950 64412 62667 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550172.1 protein_id gnl|my_center|LOCUS_16950 64529 65431 gene locus_tag LOCUS_16960 64529 65431 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193679.1 protein_id gnl|my_center|LOCUS_16960 66664 65477 gene locus_tag LOCUS_16970 66664 65477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 67064 66699 gene locus_tag LOCUS_16980 67064 66699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 67707 69533 gene locus_tag LOCUS_16990 gene typA 67707 69533 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529003.1 protein_id gnl|my_center|LOCUS_16990 69705 70106 gene locus_tag LOCUS_17000 69705 70106 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090276.1 protein_id gnl|my_center|LOCUS_17000 71606 70212 gene locus_tag LOCUS_17010 71606 70212 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090328.1 protein_id gnl|my_center|LOCUS_17010 71769 72011 gene locus_tag LOCUS_17020 71769 72011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 73032 72031 gene locus_tag LOCUS_17030 73032 72031 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_17030 74043 73066 gene locus_tag LOCUS_17040 74043 73066 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267551.1 protein_id gnl|my_center|LOCUS_17040 75005 74040 gene locus_tag LOCUS_17050 75005 74040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762885.1 protein_id gnl|my_center|LOCUS_17050 75901 75002 gene locus_tag LOCUS_17060 75901 75002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 protein_id gnl|my_center|LOCUS_17060 76820 75903 gene locus_tag LOCUS_17070 76820 75903 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617711.1 protein_id gnl|my_center|LOCUS_17070 78514 76997 gene locus_tag LOCUS_17080 78514 76997 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267554.1 protein_id gnl|my_center|LOCUS_17080 79564 78605 gene locus_tag LOCUS_17090 79564 78605 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 protein_id gnl|my_center|LOCUS_17090 79864 79583 gene locus_tag LOCUS_17100 79864 79583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 81356 79878 gene locus_tag LOCUS_17110 81356 79878 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390242.1 protein_id gnl|my_center|LOCUS_17110 81401 82378 gene locus_tag LOCUS_17120 81401 82378 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083599.1 protein_id gnl|my_center|LOCUS_17120 82978 82385 gene locus_tag LOCUS_17130 gene leuD 82978 82385 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721055.1 protein_id gnl|my_center|LOCUS_17130 84420 82981 gene locus_tag LOCUS_17140 gene leuC 84420 82981 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_17140 84994 84425 gene locus_tag LOCUS_17150 84994 84425 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528729.1 protein_id gnl|my_center|LOCUS_17150 85890 85063 gene locus_tag LOCUS_17160 85890 85063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 86667 85942 gene locus_tag LOCUS_17170 86667 85942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391053.1 protein_id gnl|my_center|LOCUS_17170 87448 86660 gene locus_tag LOCUS_17180 87448 86660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065077.1 protein_id gnl|my_center|LOCUS_17180 88437 87448 gene locus_tag LOCUS_17190 88437 87448 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_17190 89320 88445 gene locus_tag LOCUS_17200 89320 88445 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528527.1 protein_id gnl|my_center|LOCUS_17200 90613 89405 gene locus_tag LOCUS_17210 90613 89405 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966532.1 protein_id gnl|my_center|LOCUS_17210 91429 90659 gene locus_tag LOCUS_17220 91429 90659 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894813.1 protein_id gnl|my_center|LOCUS_17220 92563 91445 gene locus_tag LOCUS_17230 92563 91445 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463419.1 protein_id gnl|my_center|LOCUS_17230 93194 92616 gene locus_tag LOCUS_17240 93194 92616 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707014.1 protein_id gnl|my_center|LOCUS_17240 93664 94542 gene locus_tag LOCUS_17250 93664 94542 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181512989.1 protein_id gnl|my_center|LOCUS_17250 94924 94565 gene locus_tag LOCUS_17260 94924 94565 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 protein_id gnl|my_center|LOCUS_17260 96747 94975 gene locus_tag LOCUS_17270 gene ybaL 96747 94975 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 protein_id gnl|my_center|LOCUS_17270 96897 97133 gene locus_tag LOCUS_17280 96897 97133 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265969.1 protein_id gnl|my_center|LOCUS_17280 97326 98678 gene locus_tag LOCUS_17290 97326 98678 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992307.1 protein_id gnl|my_center|LOCUS_17290 99978 98746 gene locus_tag LOCUS_17300 99978 98746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554629.1 protein_id gnl|my_center|LOCUS_17300 100082 100981 gene locus_tag LOCUS_17310 100082 100981 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086740.1 protein_id gnl|my_center|LOCUS_17310 101447 101007 gene locus_tag LOCUS_17320 101447 101007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 101976 101551 gene locus_tag LOCUS_17330 101976 101551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 102106 102525 gene locus_tag LOCUS_17340 102106 102525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 102770 104323 gene locus_tag LOCUS_17350 gene ffh 102770 104323 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528802.1 protein_id gnl|my_center|LOCUS_17350 104329 104637 gene locus_tag LOCUS_17360 104329 104637 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067303.1 protein_id gnl|my_center|LOCUS_17360 104666 105025 gene locus_tag LOCUS_17370 104666 105025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 105191 105715 gene locus_tag LOCUS_17380 gene rimM 105191 105715 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528858.1 protein_id gnl|my_center|LOCUS_17380 105712 106377 gene locus_tag LOCUS_17390 105712 106377 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_17390 106377 107072 gene locus_tag LOCUS_17400 gene trmD 106377 107072 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_17400 107226 107609 gene locus_tag LOCUS_17410 107226 107609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 108048 107752 gene locus_tag LOCUS_17420 108048 107752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 109306 108335 gene locus_tag LOCUS_17430 109306 108335 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_17430 109626 112154 gene locus_tag LOCUS_17440 gene uvrB 109626 112154 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090165.1 protein_id gnl|my_center|LOCUS_17440 112329 113174 gene locus_tag LOCUS_17450 112329 113174 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920871.1 protein_id gnl|my_center|LOCUS_17450 113591 113241 gene locus_tag LOCUS_17460 113591 113241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 115032 113737 gene locus_tag LOCUS_17470 115032 113737 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369244.1 protein_id gnl|my_center|LOCUS_17470 115343 115963 gene locus_tag LOCUS_17480 115343 115963 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 protein_id gnl|my_center|LOCUS_17480 115973 117136 gene locus_tag LOCUS_17490 115973 117136 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394435.1 protein_id gnl|my_center|LOCUS_17490 117150 120305 gene locus_tag LOCUS_17500 117150 120305 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083188.1 protein_id gnl|my_center|LOCUS_17500 121322 120435 gene locus_tag LOCUS_17510 121322 120435 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970728.1 protein_id gnl|my_center|LOCUS_17510 121432 122928 gene locus_tag LOCUS_17520 121432 122928 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529086.1 protein_id gnl|my_center|LOCUS_17520 123110 124210 gene locus_tag LOCUS_17530 123110 124210 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_17530 125215 124238 gene locus_tag LOCUS_17540 125215 124238 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930624.1 protein_id gnl|my_center|LOCUS_17540 125478 126971 gene locus_tag LOCUS_17550 125478 126971 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_17550 128003 127023 gene locus_tag LOCUS_17560 128003 127023 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_17560 129216 128035 gene locus_tag LOCUS_17570 129216 128035 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528785.1 protein_id gnl|my_center|LOCUS_17570 129349 130239 gene locus_tag LOCUS_17580 129349 130239 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083330.1 protein_id gnl|my_center|LOCUS_17580 130877 131467 gene locus_tag LOCUS_17590 130877 131467 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_17590 131464 132600 gene locus_tag LOCUS_17600 gene aroB 131464 132600 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529358.1 protein_id gnl|my_center|LOCUS_17600 132672 133955 gene locus_tag LOCUS_17610 132672 133955 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083018.1 protein_id gnl|my_center|LOCUS_17610 133996 134385 gene locus_tag LOCUS_17620 133996 134385 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310016.1 protein_id gnl|my_center|LOCUS_17620 134730 134401 gene locus_tag LOCUS_17630 134730 134401 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_17630 134796 135401 gene locus_tag LOCUS_17640 gene leuD 134796 135401 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083326.1 protein_id gnl|my_center|LOCUS_17640 135467 135862 gene locus_tag LOCUS_17650 135467 135862 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393790.1 protein_id gnl|my_center|LOCUS_17650 135912 136709 gene locus_tag LOCUS_17660 135912 136709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 136753 137865 gene locus_tag LOCUS_17670 gene hisC 136753 137865 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970110.1 protein_id gnl|my_center|LOCUS_17670 137862 138782 gene locus_tag LOCUS_17680 137862 138782 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_17680 138819 139256 gene locus_tag LOCUS_17690 138819 139256 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083055.1 protein_id gnl|my_center|LOCUS_17690 139253 140014 gene locus_tag LOCUS_17700 139253 140014 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532200.1 protein_id gnl|my_center|LOCUS_17700 140970 140044 gene locus_tag LOCUS_17710 140970 140044 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083056.1 protein_id gnl|my_center|LOCUS_17710 141287 141003 gene locus_tag LOCUS_17720 gene infA 141287 141003 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084263.1 protein_id gnl|my_center|LOCUS_17720 141668 141456 gene locus_tag LOCUS_17730 141668 141456 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_17730 143562 141883 gene locus_tag LOCUS_17740 143562 141883 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087216.1 protein_id gnl|my_center|LOCUS_17740 144391 143633 gene locus_tag LOCUS_17750 144391 143633 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085257.1 protein_id gnl|my_center|LOCUS_17750 144689 144429 gene locus_tag LOCUS_17760 144689 144429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 144574 146661 gene locus_tag LOCUS_17770 144574 146661 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_17770 146757 147476 gene locus_tag LOCUS_17780 146757 147476 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392574.1 protein_id gnl|my_center|LOCUS_17780 148294 147515 gene locus_tag LOCUS_17790 148294 147515 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_17790 148408 149280 gene locus_tag LOCUS_17800 148408 149280 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 protein_id gnl|my_center|LOCUS_17800 150186 149290 gene locus_tag LOCUS_17810 150186 149290 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532551.1 protein_id gnl|my_center|LOCUS_17810 150351 150653 gene locus_tag LOCUS_17820 150351 150653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 151641 150898 gene locus_tag LOCUS_17830 151641 150898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 155651 151638 gene locus_tag LOCUS_17840 155651 151638 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269157.1 protein_id gnl|my_center|LOCUS_17840 158275 155891 gene locus_tag LOCUS_17850 158275 155891 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968934.1 protein_id gnl|my_center|LOCUS_17850 160313 158361 gene locus_tag LOCUS_17860 160313 158361 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921541.1 protein_id gnl|my_center|LOCUS_17860 161183 160524 gene locus_tag LOCUS_17870 161183 160524 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_17870 161910 161200 gene locus_tag LOCUS_17880 161910 161200 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_17880 161989 162282 gene locus_tag LOCUS_17890 161989 162282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 162449 163225 gene locus_tag LOCUS_17900 162449 163225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812446.1 protein_id gnl|my_center|LOCUS_17900 163225 164115 gene locus_tag LOCUS_17910 163225 164115 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812445.1 protein_id gnl|my_center|LOCUS_17910 164117 165160 gene locus_tag LOCUS_17920 164117 165160 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039704.1 protein_id gnl|my_center|LOCUS_17920 165210 166406 gene locus_tag LOCUS_17930 165210 166406 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_17930 166496 167677 gene locus_tag LOCUS_17940 166496 167677 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_17940 167772 168557 gene locus_tag LOCUS_17950 167772 168557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063643.1 protein_id gnl|my_center|LOCUS_17950 168554 170425 gene locus_tag LOCUS_17960 168554 170425 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930188.1 protein_id gnl|my_center|LOCUS_17960 171734 170727 gene locus_tag LOCUS_17970 171734 170727 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_17970 173051 172122 gene locus_tag LOCUS_17980 173051 172122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 173573 173115 gene locus_tag LOCUS_17990 173573 173115 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083044.1 protein_id gnl|my_center|LOCUS_17990 174415 173570 gene locus_tag LOCUS_18000 174415 173570 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_18000 174708 174421 gene locus_tag LOCUS_18010 gene grxC 174708 174421 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_18010 175502 174708 gene locus_tag LOCUS_18020 175502 174708 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_18020 175953 175630 gene locus_tag LOCUS_18030 gene trxA 175953 175630 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598398.1 protein_id gnl|my_center|LOCUS_18030 177291 176050 gene locus_tag LOCUS_18040 177291 176050 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528314.1 protein_id gnl|my_center|LOCUS_18040 178761 177358 gene locus_tag LOCUS_18050 gene ahcY 178761 177358 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088685.1 protein_id gnl|my_center|LOCUS_18050 180128 178914 gene locus_tag LOCUS_18060 gene argE 180128 178914 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338096.1 protein_id gnl|my_center|LOCUS_18060 180195 181373 gene locus_tag LOCUS_18070 180195 181373 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394617.1 protein_id gnl|my_center|LOCUS_18070 181448 182629 gene locus_tag LOCUS_18080 181448 182629 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085805.1 protein_id gnl|my_center|LOCUS_18080 182732 183898 gene locus_tag LOCUS_18090 182732 183898 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085805.1 protein_id gnl|my_center|LOCUS_18090 184000 185166 gene locus_tag LOCUS_18100 184000 185166 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088437.1 protein_id gnl|my_center|LOCUS_18100 186255 185497 gene locus_tag LOCUS_18110 186255 185497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 187984 186359 gene locus_tag LOCUS_18120 187984 186359 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085804.1 protein_id gnl|my_center|LOCUS_18120 188170 189156 gene locus_tag LOCUS_18130 188170 189156 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066709.1 protein_id gnl|my_center|LOCUS_18130 189163 189876 gene locus_tag LOCUS_18140 gene sfsA 189163 189876 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316347.1 protein_id gnl|my_center|LOCUS_18140 190095 189883 gene locus_tag LOCUS_18150 190095 189883 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327668.1 protein_id gnl|my_center|LOCUS_18150 191169 190099 gene locus_tag LOCUS_18160 191169 190099 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968467.1 protein_id gnl|my_center|LOCUS_18160 191405 193018 gene locus_tag LOCUS_18170 191405 193018 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090863.1 protein_id gnl|my_center|LOCUS_18170 193944 193108 gene locus_tag LOCUS_18180 193944 193108 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084250.1 protein_id gnl|my_center|LOCUS_18180 195383 194043 gene locus_tag LOCUS_18190 195383 194043 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083529.1 protein_id gnl|my_center|LOCUS_18190 195548 196381 gene locus_tag LOCUS_18200 195548 196381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 197071 196409 gene locus_tag LOCUS_18210 197071 196409 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 protein_id gnl|my_center|LOCUS_18210 198293 197142 gene locus_tag LOCUS_18220 198293 197142 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_18220 198522 199517 gene locus_tag LOCUS_18230 gene trxA 198522 199517 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_18230 200417 199560 gene locus_tag LOCUS_18240 200417 199560 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_18240 201677 200421 gene locus_tag LOCUS_18250 gene ispG 201677 200421 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083758.1 protein_id gnl|my_center|LOCUS_18250 201924 204014 gene locus_tag LOCUS_18260 201924 204014 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083215.1 protein_id gnl|my_center|LOCUS_18260 204518 204033 gene locus_tag LOCUS_18270 204518 204033 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083756.1 protein_id gnl|my_center|LOCUS_18270 204684 205469 gene locus_tag LOCUS_18280 204684 205469 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_18280 205466 206512 gene locus_tag LOCUS_18290 205466 206512 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_18290 206968 206534 gene locus_tag LOCUS_18300 206968 206534 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083384.1 protein_id gnl|my_center|LOCUS_18300 207155 207508 gene locus_tag LOCUS_18310 207155 207508 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_18310 209593 207614 gene locus_tag LOCUS_18320 209593 207614 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965916.1 protein_id gnl|my_center|LOCUS_18320 209788 210666 gene locus_tag LOCUS_18330 209788 210666 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061416.1 protein_id gnl|my_center|LOCUS_18330 210766 212445 gene locus_tag LOCUS_18340 210766 212445 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_18340 212525 212875 gene locus_tag LOCUS_18350 212525 212875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 214067 212907 gene locus_tag LOCUS_18360 214067 212907 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405736.1 protein_id gnl|my_center|LOCUS_18360 214235 214972 gene locus_tag LOCUS_18370 214235 214972 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240065.1 protein_id gnl|my_center|LOCUS_18370 215067 215852 gene locus_tag LOCUS_18380 215067 215852 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_18380 215880 216803 gene locus_tag LOCUS_18390 215880 216803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 217127 216834 gene locus_tag LOCUS_18400 217127 216834 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_18400 218045 217539 gene locus_tag LOCUS_18410 218045 217539 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973263.1 protein_id gnl|my_center|LOCUS_18410 218704 218075 gene locus_tag LOCUS_18420 218704 218075 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084198.1 protein_id gnl|my_center|LOCUS_18420 218798 220180 gene locus_tag LOCUS_18430 gene argH 218798 220180 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965353.1 protein_id gnl|my_center|LOCUS_18430 220288 220554 gene locus_tag LOCUS_18440 220288 220554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 221024 220599 gene locus_tag LOCUS_18450 221024 220599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 221348 221055 gene locus_tag LOCUS_18460 221348 221055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 222590 221355 gene locus_tag LOCUS_18470 222590 221355 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_18470 223403 222657 gene locus_tag LOCUS_18480 223403 222657 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_18480 224084 223473 gene locus_tag LOCUS_18490 224084 223473 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067297.1 protein_id gnl|my_center|LOCUS_18490 224127 224861 gene locus_tag LOCUS_18500 224127 224861 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089781.1 protein_id gnl|my_center|LOCUS_18500 228147 224968 gene locus_tag LOCUS_18510 228147 224968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 228885 228187 gene locus_tag LOCUS_18520 228885 228187 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 protein_id gnl|my_center|LOCUS_18520 230489 228906 gene locus_tag LOCUS_18530 gene nusA 230489 228906 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083607.1 protein_id gnl|my_center|LOCUS_18530 231327 230503 gene locus_tag LOCUS_18540 231327 230503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 231902 231486 gene locus_tag LOCUS_18550 231902 231486 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534381.1 protein_id gnl|my_center|LOCUS_18550 232033 233370 gene locus_tag LOCUS_18560 gene aroA 232033 233370 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965151.1 protein_id gnl|my_center|LOCUS_18560 233367 234002 gene locus_tag LOCUS_18570 gene cmk 233367 234002 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921417.1 protein_id gnl|my_center|LOCUS_18570 233999 234364 gene locus_tag LOCUS_18580 233999 234364 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_18580 235372 234623 gene locus_tag LOCUS_18590 235372 234623 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_18590 235472 236239 gene locus_tag LOCUS_18600 gene gloB 235472 236239 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083054.1 protein_id gnl|my_center|LOCUS_18600 236515 236267 gene locus_tag LOCUS_18610 236515 236267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 236798 236882 gene locus_tag LOCUS_t00170 236798 236882 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 237133 238122 gene locus_tag LOCUS_18620 237133 238122 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923336.1 protein_id gnl|my_center|LOCUS_18620 238122 238409 gene locus_tag LOCUS_18630 238122 238409 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920367.1 protein_id gnl|my_center|LOCUS_18630 238459 238926 gene locus_tag LOCUS_18640 238459 238926 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265993.1 protein_id gnl|my_center|LOCUS_18640 239319 240950 gene locus_tag LOCUS_18650 gene ilvD 239319 240950 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 protein_id gnl|my_center|LOCUS_18650 241027 242040 gene locus_tag LOCUS_18660 gene pyrC 241027 242040 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816073.1 protein_id gnl|my_center|LOCUS_18660 242161 243441 gene locus_tag LOCUS_18670 242161 243441 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_18670 244370 243483 gene locus_tag LOCUS_18680 244370 243483 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_18680 244446 246110 gene locus_tag LOCUS_18690 244446 246110 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_18690 246107 248671 gene locus_tag LOCUS_18700 246107 248671 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_18700 248668 249573 gene locus_tag LOCUS_18710 gene cysD 248668 249573 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_18710 249576 250439 gene locus_tag LOCUS_18720 249576 250439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057947.1 protein_id gnl|my_center|LOCUS_18720 250467 250715 gene locus_tag LOCUS_18730 250467 250715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 250880 251812 gene locus_tag LOCUS_18740 250880 251812 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976207.1 protein_id gnl|my_center|LOCUS_18740 252037 251819 gene locus_tag LOCUS_18750 252037 251819 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_18750 253257 252040 gene locus_tag LOCUS_18760 253257 252040 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_18760 254303 253254 gene locus_tag LOCUS_18770 gene trbG 254303 253254 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_18770 254983 254300 gene locus_tag LOCUS_18780 gene trbF 254983 254300 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 protein_id gnl|my_center|LOCUS_18780 256341 254983 gene locus_tag LOCUS_18790 gene trbL 256341 254983 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 protein_id gnl|my_center|LOCUS_18790 256629 256345 gene locus_tag LOCUS_18800 gene trbK-alt 256629 256345 CDS product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 protein_id gnl|my_center|LOCUS_18800 257401 256640 gene locus_tag LOCUS_18810 gene trbJ 257401 256640 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_18810 259836 257398 gene locus_tag LOCUS_18820 gene trbE 259836 257398 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_18820 260105 259845 gene locus_tag LOCUS_18830 260105 259845 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 protein_id gnl|my_center|LOCUS_18830 260437 260105 gene locus_tag LOCUS_18840 260437 260105 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 protein_id gnl|my_center|LOCUS_18840 261417 260434 gene locus_tag LOCUS_18850 gene trbB 261417 260434 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 protein_id gnl|my_center|LOCUS_18850 262236 261703 gene locus_tag LOCUS_18860 262236 261703 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968191.1 protein_id gnl|my_center|LOCUS_18860 262953 262519 gene locus_tag LOCUS_18870 262953 262519 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_18870 264954 262963 gene locus_tag LOCUS_18880 264954 262963 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645922.1 protein_id gnl|my_center|LOCUS_18880 266738 264981 gene locus_tag LOCUS_18890 266738 264981 CDS product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626034.1 protein_id gnl|my_center|LOCUS_18890 267747 266986 gene locus_tag LOCUS_18900 267747 266986 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082877.1 protein_id gnl|my_center|LOCUS_18900 268101 267751 gene locus_tag LOCUS_18910 268101 267751 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 protein_id gnl|my_center|LOCUS_18910 268692 268147 gene locus_tag LOCUS_18920 268692 268147 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 protein_id gnl|my_center|LOCUS_18920 269201 268689 gene locus_tag LOCUS_18930 269201 268689 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_18930 269464 269198 gene locus_tag LOCUS_18940 269464 269198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368642.1 protein_id gnl|my_center|LOCUS_18940 270108 269461 gene locus_tag LOCUS_18950 gene parA 270108 269461 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_18950 271195 270311 gene locus_tag LOCUS_18960 271195 270311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 271487 271206 gene locus_tag LOCUS_18970 271487 271206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 272167 271625 gene locus_tag LOCUS_18980 272167 271625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 272399 272151 gene locus_tag LOCUS_18990 272399 272151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 272774 272502 gene locus_tag LOCUS_19000 272774 272502 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 protein_id gnl|my_center|LOCUS_19000 273134 272895 gene locus_tag LOCUS_19010 273134 272895 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387924.1 protein_id gnl|my_center|LOCUS_19010 273650 273327 gene locus_tag LOCUS_19020 273650 273327 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368635.1 protein_id gnl|my_center|LOCUS_19020 274678 274238 gene locus_tag LOCUS_19030 274678 274238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368632.1 protein_id gnl|my_center|LOCUS_19030 274980 274816 gene locus_tag LOCUS_19040 274980 274816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368625.1 protein_id gnl|my_center|LOCUS_19040 275644 275195 gene locus_tag LOCUS_19050 275644 275195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 275769 276377 gene locus_tag LOCUS_19060 275769 276377 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 protein_id gnl|my_center|LOCUS_19060 277470 276526 gene locus_tag LOCUS_19070 277470 276526 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_19070 278841 277780 gene locus_tag LOCUS_19080 278841 277780 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082896.1 protein_id gnl|my_center|LOCUS_19080 281080 278915 gene locus_tag LOCUS_19090 281080 278915 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_19090 282415 281219 gene locus_tag LOCUS_19100 282415 281219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192137.1 protein_id gnl|my_center|LOCUS_19100 282632 285160 gene locus_tag LOCUS_19110 282632 285160 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974842.1 protein_id gnl|my_center|LOCUS_19110 285939 285274 gene locus_tag LOCUS_19120 285939 285274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 289003 285920 gene locus_tag LOCUS_19130 289003 285920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 289545 289000 gene locus_tag LOCUS_19140 289545 289000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 291076 289655 gene locus_tag LOCUS_19150 291076 289655 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_19150 294373 291647 gene locus_tag LOCUS_19160 294373 291647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 294302 294814 gene locus_tag LOCUS_19170 294302 294814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 294786 295667 gene locus_tag LOCUS_19180 294786 295667 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787934.1 protein_id gnl|my_center|LOCUS_19180 297277 295679 gene locus_tag LOCUS_19190 297277 295679 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223362.1 protein_id gnl|my_center|LOCUS_19190 297996 297289 gene locus_tag LOCUS_19200 297996 297289 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967273.1 protein_id gnl|my_center|LOCUS_19200 298066 298629 gene locus_tag LOCUS_19210 298066 298629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 298824 299771 gene locus_tag LOCUS_19220 298824 299771 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808741.1 protein_id gnl|my_center|LOCUS_19220 299868 301097 gene locus_tag LOCUS_19230 299868 301097 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931674.1 protein_id gnl|my_center|LOCUS_19230 301094 302074 gene locus_tag LOCUS_19240 301094 302074 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808742.1 protein_id gnl|my_center|LOCUS_19240 302467 303228 gene locus_tag LOCUS_19250 302467 303228 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808745.1 protein_id gnl|my_center|LOCUS_19250 303863 303252 gene locus_tag LOCUS_19260 303863 303252 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067512.1 protein_id gnl|my_center|LOCUS_19260 305576 303933 gene locus_tag LOCUS_19270 305576 303933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965309.1 protein_id gnl|my_center|LOCUS_19270 306412 305573 gene locus_tag LOCUS_19280 306412 305573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_19280 307431 306409 gene locus_tag LOCUS_19290 307431 306409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_19290 309063 307459 gene locus_tag LOCUS_19300 309063 307459 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 protein_id gnl|my_center|LOCUS_19300 310449 309127 gene locus_tag LOCUS_19310 gene hemL 310449 309127 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258457.1 protein_id gnl|my_center|LOCUS_19310 310595 311611 gene locus_tag LOCUS_19320 310595 311611 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_19320 311614 312702 gene locus_tag LOCUS_19330 311614 312702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532164.1 protein_id gnl|my_center|LOCUS_19330 313621 312728 gene locus_tag LOCUS_19340 313621 312728 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226431.1 protein_id gnl|my_center|LOCUS_19340 314620 313634 gene locus_tag LOCUS_19350 314620 313634 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_19350 315370 314642 gene locus_tag LOCUS_19360 315370 314642 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_19360 317501 315402 gene locus_tag LOCUS_19370 gene fhuB 317501 315402 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533592.1 protein_id gnl|my_center|LOCUS_19370 318396 317494 gene locus_tag LOCUS_19380 318396 317494 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533593.1 protein_id gnl|my_center|LOCUS_19380 319261 318371 gene locus_tag LOCUS_19390 319261 318371 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 protein_id gnl|my_center|LOCUS_19390 321540 319264 gene locus_tag LOCUS_19400 321540 319264 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390127.1 protein_id gnl|my_center|LOCUS_19400 322810 321806 gene locus_tag LOCUS_19410 322810 321806 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974566.1 protein_id gnl|my_center|LOCUS_19410 323463 322918 gene locus_tag LOCUS_19420 323463 322918 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_19420 324462 323863 gene locus_tag LOCUS_19430 324462 323863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_19430 324814 325824 gene locus_tag LOCUS_19440 324814 325824 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728741.1 protein_id gnl|my_center|LOCUS_19440 325989 327047 gene locus_tag LOCUS_19450 325989 327047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 327099 327899 gene locus_tag LOCUS_19460 327099 327899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803987.1 protein_id gnl|my_center|LOCUS_19460 327911 328765 gene locus_tag LOCUS_19470 327911 328765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 protein_id gnl|my_center|LOCUS_19470 328817 330190 gene locus_tag LOCUS_19480 328817 330190 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_19480 330202 331578 gene locus_tag LOCUS_19490 330202 331578 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_19490 331584 332945 gene locus_tag LOCUS_19500 331584 332945 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_19500 333049 333909 gene locus_tag LOCUS_19510 333049 333909 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965199.1 protein_id gnl|my_center|LOCUS_19510 333917 334669 gene locus_tag LOCUS_19520 333917 334669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_19520 334758 335654 gene locus_tag LOCUS_19530 334758 335654 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 protein_id gnl|my_center|LOCUS_19530 335668 336732 gene locus_tag LOCUS_19540 335668 336732 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085682.1 protein_id gnl|my_center|LOCUS_19540 336738 337079 gene locus_tag LOCUS_19550 336738 337079 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 protein_id gnl|my_center|LOCUS_19550 337221 338192 gene locus_tag LOCUS_19560 337221 338192 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 protein_id gnl|my_center|LOCUS_19560 338286 339770 gene locus_tag LOCUS_19570 338286 339770 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_19570 340067 339834 gene locus_tag LOCUS_19580 340067 339834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 341562 340288 gene locus_tag LOCUS_19590 gene mtaB 341562 340288 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083307.1 protein_id gnl|my_center|LOCUS_19590 342372 341566 gene locus_tag LOCUS_19600 gene dapF 342372 341566 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083308.1 protein_id gnl|my_center|LOCUS_19600 342600 343376 gene locus_tag LOCUS_19610 342600 343376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 343473 344231 gene locus_tag LOCUS_19620 343473 344231 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532723.1 protein_id gnl|my_center|LOCUS_19620 344703 344278 gene locus_tag LOCUS_19630 344703 344278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 345068 345901 gene locus_tag LOCUS_19640 345068 345901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 345992 346246 gene locus_tag LOCUS_19650 345992 346246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 347420 346308 gene locus_tag LOCUS_19660 gene leuB 347420 346308 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083334.1 protein_id gnl|my_center|LOCUS_19660 348639 347560 gene locus_tag LOCUS_19670 348639 347560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 350063 349008 gene locus_tag LOCUS_19680 350063 349008 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532104.1 protein_id gnl|my_center|LOCUS_19680 350821 350171 gene locus_tag LOCUS_19690 350821 350171 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529696.1 protein_id gnl|my_center|LOCUS_19690 350908 351630 gene locus_tag LOCUS_19700 350908 351630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_19700 351627 354197 gene locus_tag LOCUS_19710 351627 354197 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083292.1 protein_id gnl|my_center|LOCUS_19710 354400 355245 gene locus_tag LOCUS_19720 354400 355245 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174871.1 protein_id gnl|my_center|LOCUS_19720 355450 355525 gene locus_tag LOCUS_t00180 355450 355525 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 357266 355611 gene locus_tag LOCUS_19730 357266 355611 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086799.1 protein_id gnl|my_center|LOCUS_19730 357548 357345 gene locus_tag LOCUS_19740 357548 357345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 358518 357643 gene locus_tag LOCUS_19750 358518 357643 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 protein_id gnl|my_center|LOCUS_19750 358941 358639 gene locus_tag LOCUS_19760 358941 358639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 359187 359026 gene locus_tag LOCUS_19770 359187 359026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 360101 359304 gene locus_tag LOCUS_19780 360101 359304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 360327 361175 gene locus_tag LOCUS_19790 360327 361175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 362048 361188 gene locus_tag LOCUS_19800 gene prmC 362048 361188 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083051.1 protein_id gnl|my_center|LOCUS_19800 363121 362048 gene locus_tag LOCUS_19810 gene prfA 363121 362048 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083050.1 protein_id gnl|my_center|LOCUS_19810 365358 363121 gene locus_tag LOCUS_19820 gene ptsP 365358 363121 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_19820 366460 365561 gene locus_tag LOCUS_19830 366460 365561 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973218.1 protein_id gnl|my_center|LOCUS_19830 367758 366535 gene locus_tag LOCUS_19840 367758 366535 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083048.1 protein_id gnl|my_center|LOCUS_19840 367857 368639 gene locus_tag LOCUS_19850 gene ubiG 367857 368639 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 protein_id gnl|my_center|LOCUS_19850 368722 369039 gene locus_tag LOCUS_19860 368722 369039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533097.1 protein_id gnl|my_center|LOCUS_19860 369211 369450 gene locus_tag LOCUS_19870 369211 369450 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544396.1 protein_id gnl|my_center|LOCUS_19870 369705 370943 gene locus_tag LOCUS_19880 369705 370943 CDS product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083432.1 protein_id gnl|my_center|LOCUS_19880 371052 372194 gene locus_tag LOCUS_19890 371052 372194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 372734 372204 gene locus_tag LOCUS_19900 372734 372204 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173537.1 protein_id gnl|my_center|LOCUS_19900 372824 373813 gene locus_tag LOCUS_19910 372824 373813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 373824 374525 gene locus_tag LOCUS_19920 373824 374525 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965238.1 protein_id gnl|my_center|LOCUS_19920 374735 376147 gene locus_tag LOCUS_19930 374735 376147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19930 376132 376569 gene locus_tag LOCUS_19940 376132 376569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19940 376607 377566 gene locus_tag LOCUS_19950 376607 377566 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207126.1 protein_id gnl|my_center|LOCUS_19950 377622 378476 gene locus_tag LOCUS_19960 377622 378476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665694.1 protein_id gnl|my_center|LOCUS_19960 378469 379248 gene locus_tag LOCUS_19970 378469 379248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_19970 379255 380145 gene locus_tag LOCUS_19980 379255 380145 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_19980 380174 380695 gene locus_tag LOCUS_19990 380174 380695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 381198 380644 gene locus_tag LOCUS_20000 381198 380644 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965381.1 protein_id gnl|my_center|LOCUS_20000 381342 381605 gene locus_tag LOCUS_20010 381342 381605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 382463 381789 gene locus_tag LOCUS_20020 382463 381789 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083296.1 protein_id gnl|my_center|LOCUS_20020 385450 382730 gene locus_tag LOCUS_20030 gene acnA 385450 382730 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067290.1 protein_id gnl|my_center|LOCUS_20030 385636 386250 gene locus_tag LOCUS_20040 gene ccmA 385636 386250 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083298.1 protein_id gnl|my_center|LOCUS_20040 386247 386918 gene locus_tag LOCUS_20050 gene ccmB 386247 386918 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067292.1 protein_id gnl|my_center|LOCUS_20050 386923 387972 gene locus_tag LOCUS_20060 386923 387972 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331425.1 protein_id gnl|my_center|LOCUS_20060 388083 388433 gene locus_tag LOCUS_20070 388083 388433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 389049 388441 gene locus_tag LOCUS_20080 389049 388441 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971416.1 protein_id gnl|my_center|LOCUS_20080 389266 389898 gene locus_tag LOCUS_20090 389266 389898 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844827.1 protein_id gnl|my_center|LOCUS_20090 390029 391018 gene locus_tag LOCUS_20100 gene cobS 390029 391018 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529367.1 protein_id gnl|my_center|LOCUS_20100 391033 391446 gene locus_tag LOCUS_20110 391033 391446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703859.1 protein_id gnl|my_center|LOCUS_20110 391443 393344 gene locus_tag LOCUS_20120 gene cobT 391443 393344 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_20120 393344 394450 gene locus_tag LOCUS_20130 393344 394450 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_20130 394476 395060 gene locus_tag LOCUS_20140 394476 395060 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 protein_id gnl|my_center|LOCUS_20140 395169 395318 gene locus_tag LOCUS_20150 395169 395318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 395833 395399 gene locus_tag LOCUS_20160 395833 395399 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 protein_id gnl|my_center|LOCUS_20160 396015 397604 gene locus_tag LOCUS_20170 gene ggt 396015 397604 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_20170 397962 397618 gene locus_tag LOCUS_20180 397962 397618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 398247 399953 gene locus_tag LOCUS_20190 398247 399953 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_20190 400584 399970 gene locus_tag LOCUS_20200 gene phaR 400584 399970 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083059.1 protein_id gnl|my_center|LOCUS_20200 400808 401983 gene locus_tag LOCUS_20210 400808 401983 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086505.1 protein_id gnl|my_center|LOCUS_20210 402168 402893 gene locus_tag LOCUS_20220 gene phbB 402168 402893 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086506.1 protein_id gnl|my_center|LOCUS_20220 403394 402975 gene locus_tag LOCUS_20230 403394 402975 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083039.1 protein_id gnl|my_center|LOCUS_20230 404667 403417 gene locus_tag LOCUS_20240 gene argJ 404667 403417 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083038.1 protein_id gnl|my_center|LOCUS_20240 405618 404782 gene locus_tag LOCUS_20250 405618 404782 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084192.1 protein_id gnl|my_center|LOCUS_20250 405711 406655 gene locus_tag LOCUS_20260 405711 406655 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966655.1 protein_id gnl|my_center|LOCUS_20260 406730 407236 gene locus_tag LOCUS_20270 406730 407236 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175650.1 protein_id gnl|my_center|LOCUS_20270 407717 407265 gene locus_tag LOCUS_20280 407717 407265 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965074.1 protein_id gnl|my_center|LOCUS_20280 407965 407714 gene locus_tag LOCUS_20290 407965 407714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 408078 408329 gene locus_tag LOCUS_20300 408078 408329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 409484 408333 gene locus_tag LOCUS_20310 gene ftsY 409484 408333 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083304.1 protein_id gnl|my_center|LOCUS_20310 409615 410340 gene locus_tag LOCUS_20320 409615 410340 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_20320 410337 411149 gene locus_tag LOCUS_20330 410337 411149 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113610.1 protein_id gnl|my_center|LOCUS_20330 411214 412446 gene locus_tag LOCUS_20340 411214 412446 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967026.1 protein_id gnl|my_center|LOCUS_20340 412885 412493 gene locus_tag LOCUS_20350 412885 412493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 414043 413021 gene locus_tag LOCUS_20360 gene hemH 414043 413021 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393586.1 protein_id gnl|my_center|LOCUS_20360 415046 414150 gene locus_tag LOCUS_20370 gene mntD 415046 414150 CDS product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 protein_id gnl|my_center|LOCUS_20370 415933 415046 gene locus_tag LOCUS_20380 415933 415046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 416701 415946 gene locus_tag LOCUS_20390 416701 415946 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_20390 417670 416705 gene locus_tag LOCUS_20400 417670 416705 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_20400 417999 418982 gene locus_tag LOCUS_20410 417999 418982 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090475.1 protein_id gnl|my_center|LOCUS_20410 418993 419445 gene locus_tag LOCUS_20420 418993 419445 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066921.1 protein_id gnl|my_center|LOCUS_20420 420414 419449 gene locus_tag LOCUS_20430 420414 419449 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082920.1 protein_id gnl|my_center|LOCUS_20430 420646 421707 gene locus_tag LOCUS_20440 gene ugpC 420646 421707 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086694.1 protein_id gnl|my_center|LOCUS_20440 421807 423123 gene locus_tag LOCUS_20450 421807 423123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086695.1 protein_id gnl|my_center|LOCUS_20450 423238 424203 gene locus_tag LOCUS_20460 423238 424203 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170961.1 protein_id gnl|my_center|LOCUS_20460 424303 425220 gene locus_tag LOCUS_20470 424303 425220 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086697.1 protein_id gnl|my_center|LOCUS_20470 425225 426121 gene locus_tag LOCUS_20480 425225 426121 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969407.1 protein_id gnl|my_center|LOCUS_20480 426661 426158 gene locus_tag LOCUS_20490 426661 426158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 427374 426793 gene locus_tag LOCUS_20500 427374 426793 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173711.1 protein_id gnl|my_center|LOCUS_20500 428882 427464 gene locus_tag LOCUS_20510 428882 427464 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_20510 430206 428887 gene locus_tag LOCUS_20520 430206 428887 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_20520 430506 430580 gene locus_tag LOCUS_t00190 430506 430580 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 430625 430822 gene locus_tag LOCUS_20530 430625 430822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 431168 430962 gene locus_tag LOCUS_20540 431168 430962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 431315 432031 gene locus_tag LOCUS_20550 431315 432031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 432140 432496 gene locus_tag LOCUS_20560 432140 432496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 432860 432699 gene locus_tag LOCUS_20570 432860 432699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 434319 433081 gene locus_tag LOCUS_20580 434319 433081 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775654.1 protein_id gnl|my_center|LOCUS_20580 437035 434663 gene locus_tag LOCUS_20590 437035 434663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 437316 437119 gene locus_tag LOCUS_20600 437316 437119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 438108 437407 gene locus_tag LOCUS_20610 438108 437407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 439904 438474 gene locus_tag LOCUS_20620 439904 438474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 441642 439891 gene locus_tag LOCUS_20630 441642 439891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 442667 441840 gene locus_tag LOCUS_20640 442667 441840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 443328 442741 gene locus_tag LOCUS_20650 443328 442741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 444583 443687 gene locus_tag LOCUS_20660 444583 443687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 446275 444605 gene locus_tag LOCUS_20670 446275 444605 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 protein_id gnl|my_center|LOCUS_20670 446509 447759 gene locus_tag LOCUS_20680 446509 447759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 448025 448222 gene locus_tag LOCUS_20690 448025 448222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 449435 448653 gene locus_tag LOCUS_20700 449435 448653 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018237596.1 protein_id gnl|my_center|LOCUS_20700 450105 449581 gene locus_tag LOCUS_20710 450105 449581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 451091 450120 gene locus_tag LOCUS_20720 451091 450120 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_20720 451378 452358 gene locus_tag LOCUS_20730 451378 452358 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969642.1 protein_id gnl|my_center|LOCUS_20730 453182 452451 gene locus_tag LOCUS_20740 453182 452451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275427.1 protein_id gnl|my_center|LOCUS_20740 453682 453323 gene locus_tag LOCUS_20750 453682 453323 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 protein_id gnl|my_center|LOCUS_20750 454714 454136 gene locus_tag LOCUS_20760 454714 454136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 456580 454757 gene locus_tag LOCUS_20770 456580 454757 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528580.1 protein_id gnl|my_center|LOCUS_20770 457650 456718 gene locus_tag LOCUS_20780 457650 456718 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090122.1 protein_id gnl|my_center|LOCUS_20780 457722 458069 gene locus_tag LOCUS_20790 457722 458069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 458207 458968 gene locus_tag LOCUS_20800 458207 458968 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 protein_id gnl|my_center|LOCUS_20800 459074 459613 gene locus_tag LOCUS_20810 gene thpR 459074 459613 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083289.1 protein_id gnl|my_center|LOCUS_20810 461709 460072 gene locus_tag LOCUS_20820 461709 460072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 462946 461993 gene locus_tag LOCUS_20830 462946 461993 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083023.1 protein_id gnl|my_center|LOCUS_20830 464015 463083 gene locus_tag LOCUS_20840 gene xerD 464015 463083 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083022.1 protein_id gnl|my_center|LOCUS_20840 464170 464021 gene locus_tag LOCUS_20850 464170 464021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 464341 465153 gene locus_tag LOCUS_20860 464341 465153 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067261.1 protein_id gnl|my_center|LOCUS_20860 465331 466083 gene locus_tag LOCUS_20870 465331 466083 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_20870 466083 467027 gene locus_tag LOCUS_20880 466083 467027 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084196.1 protein_id gnl|my_center|LOCUS_20880 467192 468067 gene locus_tag LOCUS_20890 467192 468067 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084197.1 protein_id gnl|my_center|LOCUS_20890 468149 468334 gene locus_tag LOCUS_20900 468149 468334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 469295 468384 gene locus_tag LOCUS_20910 469295 468384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 474145 469292 gene locus_tag LOCUS_20920 474145 469292 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090718.1 protein_id gnl|my_center|LOCUS_20920 474317 474901 gene locus_tag LOCUS_20930 474317 474901 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 protein_id gnl|my_center|LOCUS_20930 475091 475765 gene locus_tag LOCUS_20940 475091 475765 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_20940 475828 476070 gene locus_tag LOCUS_20950 475828 476070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 476958 476083 gene locus_tag LOCUS_20960 476958 476083 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 protein_id gnl|my_center|LOCUS_20960 477769 477185 gene locus_tag LOCUS_20970 477769 477185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20970 478522 478187 gene locus_tag LOCUS_20980 478522 478187 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_20980 478676 479605 gene locus_tag LOCUS_20990 gene htpX 478676 479605 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence05 550 1536 gene locus_tag LOCUS_21000 550 1536 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966168.1 protein_id gnl|my_center|LOCUS_21000 1652 2368 gene locus_tag LOCUS_21010 1652 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089317.1 protein_id gnl|my_center|LOCUS_21010 2636 2331 gene locus_tag LOCUS_21020 2636 2331 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034854252.1 protein_id gnl|my_center|LOCUS_21020 3394 2633 gene locus_tag LOCUS_21030 3394 2633 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529832.1 protein_id gnl|my_center|LOCUS_21030 4337 3471 gene locus_tag LOCUS_21040 4337 3471 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969060.1 protein_id gnl|my_center|LOCUS_21040 4627 6630 gene locus_tag LOCUS_21050 4627 6630 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_21050 6627 7427 gene locus_tag LOCUS_21060 6627 7427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_21060 7438 8556 gene locus_tag LOCUS_21070 7438 8556 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_21070 8571 9647 gene locus_tag LOCUS_21080 8571 9647 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_21080 9734 11056 gene locus_tag LOCUS_21090 9734 11056 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_21090 11232 12077 gene locus_tag LOCUS_21100 11232 12077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_21100 12147 12845 gene locus_tag LOCUS_21110 12147 12845 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_21110 12872 13267 gene locus_tag LOCUS_21120 12872 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 14242 13460 gene locus_tag LOCUS_21130 14242 13460 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524357.1 protein_id gnl|my_center|LOCUS_21130 14904 14248 gene locus_tag LOCUS_21140 14904 14248 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061262.1 protein_id gnl|my_center|LOCUS_21140 16157 14901 gene locus_tag LOCUS_21150 16157 14901 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765391.1 protein_id gnl|my_center|LOCUS_21150 16356 17789 gene locus_tag LOCUS_21160 16356 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 17803 18459 gene locus_tag LOCUS_21170 17803 18459 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089735.1 protein_id gnl|my_center|LOCUS_21170 18662 18925 gene locus_tag LOCUS_21180 18662 18925 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_21180 19104 19289 gene locus_tag LOCUS_21190 19104 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 19316 20053 gene locus_tag LOCUS_21200 19316 20053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_21200 20068 20934 gene locus_tag LOCUS_21210 20068 20934 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090495.1 protein_id gnl|my_center|LOCUS_21210 20957 21910 gene locus_tag LOCUS_21220 20957 21910 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966160.1 protein_id gnl|my_center|LOCUS_21220 21977 23068 gene locus_tag LOCUS_21230 21977 23068 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_21230 23110 23808 gene locus_tag LOCUS_21240 23110 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 23918 24628 gene locus_tag LOCUS_21250 23918 24628 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974403.1 protein_id gnl|my_center|LOCUS_21250 24698 24979 gene locus_tag LOCUS_21260 24698 24979 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398761.1 protein_id gnl|my_center|LOCUS_21260 25099 26067 gene locus_tag LOCUS_21270 25099 26067 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086618.1 protein_id gnl|my_center|LOCUS_21270 27686 26094 gene locus_tag LOCUS_21280 gene mdoG 27686 26094 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097164.1 protein_id gnl|my_center|LOCUS_21280 27882 28661 gene locus_tag LOCUS_21290 27882 28661 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_21290 28710 29024 gene locus_tag LOCUS_21300 28710 29024 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974482.1 protein_id gnl|my_center|LOCUS_21300 29045 30601 gene locus_tag LOCUS_21310 29045 30601 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930411.1 protein_id gnl|my_center|LOCUS_21310 30642 31397 gene locus_tag LOCUS_21320 30642 31397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 32610 31786 gene locus_tag LOCUS_21330 32610 31786 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_21330 33259 32744 gene locus_tag LOCUS_21340 33259 32744 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_21340 33477 33989 gene locus_tag LOCUS_21350 gene fabA 33477 33989 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968449.1 protein_id gnl|my_center|LOCUS_21350 34055 35281 gene locus_tag LOCUS_21360 gene fabB 34055 35281 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083592.1 protein_id gnl|my_center|LOCUS_21360 35478 36335 gene locus_tag LOCUS_21370 gene fabI 35478 36335 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083593.1 protein_id gnl|my_center|LOCUS_21370 37207 36452 gene locus_tag LOCUS_21380 37207 36452 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_21380 37984 37211 gene locus_tag LOCUS_21390 37984 37211 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251864.1 protein_id gnl|my_center|LOCUS_21390 39573 37981 gene locus_tag LOCUS_21400 39573 37981 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173052.1 protein_id gnl|my_center|LOCUS_21400 40594 39566 gene locus_tag LOCUS_21410 40594 39566 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535888.1 protein_id gnl|my_center|LOCUS_21410 41319 40591 gene locus_tag LOCUS_21420 41319 40591 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243741.1 protein_id gnl|my_center|LOCUS_21420 41956 41300 gene locus_tag LOCUS_21430 41956 41300 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974074.1 protein_id gnl|my_center|LOCUS_21430 42636 41953 gene locus_tag LOCUS_21440 42636 41953 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004431329.1 protein_id gnl|my_center|LOCUS_21440 43528 42710 gene locus_tag LOCUS_21450 43528 42710 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243744.1 protein_id gnl|my_center|LOCUS_21450 44380 43811 gene locus_tag LOCUS_21460 gene efp 44380 43811 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067676.1 protein_id gnl|my_center|LOCUS_21460 44501 45553 gene locus_tag LOCUS_21470 gene epmA 44501 45553 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_21470 46151 45543 gene locus_tag LOCUS_21480 46151 45543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_21480 48094 46148 gene locus_tag LOCUS_21490 48094 46148 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085096.1 protein_id gnl|my_center|LOCUS_21490 49146 48091 gene locus_tag LOCUS_21500 49146 48091 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234837588.1 protein_id gnl|my_center|LOCUS_21500 50048 49158 gene locus_tag LOCUS_21510 50048 49158 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970364.1 protein_id gnl|my_center|LOCUS_21510 50153 50854 gene locus_tag LOCUS_21520 50153 50854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_21520 50860 51576 gene locus_tag LOCUS_21530 50860 51576 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_21530 51603 52460 gene locus_tag LOCUS_21540 51603 52460 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_21540 53351 52467 gene locus_tag LOCUS_21550 53351 52467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_21550 54296 53355 gene locus_tag LOCUS_21560 54296 53355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085651.1 protein_id gnl|my_center|LOCUS_21560 55833 54310 gene locus_tag LOCUS_21570 55833 54310 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_21570 56959 55898 gene locus_tag LOCUS_21580 56959 55898 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039184056.1 protein_id gnl|my_center|LOCUS_21580 57984 56956 gene locus_tag LOCUS_21590 57984 56956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_21590 58697 57984 gene locus_tag LOCUS_21600 58697 57984 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_21600 60496 58694 gene locus_tag LOCUS_21610 60496 58694 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085656.1 protein_id gnl|my_center|LOCUS_21610 61343 60567 gene locus_tag LOCUS_21620 61343 60567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064395.1 protein_id gnl|my_center|LOCUS_21620 62159 61371 gene locus_tag LOCUS_21630 62159 61371 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808963.1 protein_id gnl|my_center|LOCUS_21630 63420 62197 gene locus_tag LOCUS_21640 63420 62197 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064401.1 protein_id gnl|my_center|LOCUS_21640 64276 63479 gene locus_tag LOCUS_21650 64276 63479 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_21650 64654 64280 gene locus_tag LOCUS_21660 64654 64280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259469.1 protein_id gnl|my_center|LOCUS_21660 65072 64641 gene locus_tag LOCUS_21670 65072 64641 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259467.1 protein_id gnl|my_center|LOCUS_21670 66577 65069 gene locus_tag LOCUS_21680 66577 65069 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_21680 67347 66574 gene locus_tag LOCUS_21690 67347 66574 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808019.1 protein_id gnl|my_center|LOCUS_21690 67960 67340 gene locus_tag LOCUS_21700 67960 67340 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085965.1 protein_id gnl|my_center|LOCUS_21700 68165 69373 gene locus_tag LOCUS_21710 68165 69373 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965179.1 protein_id gnl|my_center|LOCUS_21710 69709 69506 gene locus_tag LOCUS_21720 69709 69506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 69623 70405 gene locus_tag LOCUS_21730 69623 70405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083708.1 protein_id gnl|my_center|LOCUS_21730 70398 71135 gene locus_tag LOCUS_21740 70398 71135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083707.1 protein_id gnl|my_center|LOCUS_21740 71149 72180 gene locus_tag LOCUS_21750 71149 72180 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083706.1 protein_id gnl|my_center|LOCUS_21750 72186 73247 gene locus_tag LOCUS_21760 72186 73247 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463731.1 protein_id gnl|my_center|LOCUS_21760 74236 73430 gene locus_tag LOCUS_21770 74236 73430 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040793.1 protein_id gnl|my_center|LOCUS_21770 75014 74331 gene locus_tag LOCUS_21780 75014 74331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 75782 75072 gene locus_tag LOCUS_21790 75782 75072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086609.1 protein_id gnl|my_center|LOCUS_21790 76531 75779 gene locus_tag LOCUS_21800 76531 75779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21800 77778 76528 gene locus_tag LOCUS_21810 77778 76528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 78723 77782 gene locus_tag LOCUS_21820 78723 77782 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_21820 80042 78801 gene locus_tag LOCUS_21830 80042 78801 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_21830 80571 81389 gene locus_tag LOCUS_21840 80571 81389 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 protein_id gnl|my_center|LOCUS_21840 81441 82211 gene locus_tag LOCUS_21850 81441 82211 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528170.1 protein_id gnl|my_center|LOCUS_21850 82299 83042 gene locus_tag LOCUS_21860 82299 83042 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919670.1 protein_id gnl|my_center|LOCUS_21860 83119 83898 gene locus_tag LOCUS_21870 83119 83898 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730670.1 protein_id gnl|my_center|LOCUS_21870 83898 85622 gene locus_tag LOCUS_21880 83898 85622 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064453.1 protein_id gnl|my_center|LOCUS_21880 85662 85958 gene locus_tag LOCUS_21890 85662 85958 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807672.1 protein_id gnl|my_center|LOCUS_21890 86316 86924 gene locus_tag LOCUS_21900 86316 86924 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967992.1 protein_id gnl|my_center|LOCUS_21900 86937 88034 gene locus_tag LOCUS_21910 86937 88034 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085209.1 protein_id gnl|my_center|LOCUS_21910 88109 91330 gene locus_tag LOCUS_21920 88109 91330 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973652.1 protein_id gnl|my_center|LOCUS_21920 92448 91348 gene locus_tag LOCUS_21930 92448 91348 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089858.1 protein_id gnl|my_center|LOCUS_21930 92601 93170 gene locus_tag LOCUS_21940 92601 93170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 93220 93780 gene locus_tag LOCUS_21950 93220 93780 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_21950 94692 93799 gene locus_tag LOCUS_21960 94692 93799 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085617.1 protein_id gnl|my_center|LOCUS_21960 95128 94790 gene locus_tag LOCUS_21970 95128 94790 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_21970 95907 95143 gene locus_tag LOCUS_21980 gene kduD 95907 95143 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 protein_id gnl|my_center|LOCUS_21980 96749 95913 gene locus_tag LOCUS_21990 gene kduI 96749 95913 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529046.1 protein_id gnl|my_center|LOCUS_21990 98058 96778 gene locus_tag LOCUS_22000 98058 96778 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972785.1 protein_id gnl|my_center|LOCUS_22000 98590 98063 gene locus_tag LOCUS_22010 98590 98063 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529043.1 protein_id gnl|my_center|LOCUS_22010 99670 98654 gene locus_tag LOCUS_22020 99670 98654 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529042.1 protein_id gnl|my_center|LOCUS_22020 99781 100476 gene locus_tag LOCUS_22030 99781 100476 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845097.1 protein_id gnl|my_center|LOCUS_22030 101089 100688 gene locus_tag LOCUS_22040 101089 100688 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_22040 102715 101120 gene locus_tag LOCUS_22050 102715 101120 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085899.1 protein_id gnl|my_center|LOCUS_22050 103512 102715 gene locus_tag LOCUS_22060 103512 102715 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265631.1 protein_id gnl|my_center|LOCUS_22060 103744 105189 gene locus_tag LOCUS_22070 103744 105189 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088614.1 protein_id gnl|my_center|LOCUS_22070 105440 106354 gene locus_tag LOCUS_22080 105440 106354 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307641.1 protein_id gnl|my_center|LOCUS_22080 106480 108540 gene locus_tag LOCUS_22090 106480 108540 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_22090 108553 110337 gene locus_tag LOCUS_22100 108553 110337 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_22100 110363 111352 gene locus_tag LOCUS_22110 110363 111352 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_22110 111466 111390 gene locus_tag LOCUS_t00200 111466 111390 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 112767 111430 gene locus_tag LOCUS_22120 112767 111430 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_22120 114594 112840 gene locus_tag LOCUS_22130 114594 112840 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328825.1 protein_id gnl|my_center|LOCUS_22130 115259 114591 gene locus_tag LOCUS_22140 115259 114591 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529993.1 protein_id gnl|my_center|LOCUS_22140 116497 115364 gene locus_tag LOCUS_22150 116497 115364 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969663.1 protein_id gnl|my_center|LOCUS_22150 117479 116727 gene locus_tag LOCUS_22160 117479 116727 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_22160 117784 117476 gene locus_tag LOCUS_22170 117784 117476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 118265 117831 gene locus_tag LOCUS_22180 118265 117831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 118477 118265 gene locus_tag LOCUS_22190 118477 118265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 118735 119934 gene locus_tag LOCUS_22200 gene pimC 118735 119934 CDS product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 protein_id gnl|my_center|LOCUS_22200 120046 121194 gene locus_tag LOCUS_22210 gene pimD 120046 121194 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_22210 122315 121392 gene locus_tag LOCUS_22220 122315 121392 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_22220 124077 122344 gene locus_tag LOCUS_22230 gene araD 124077 122344 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_22230 125657 124140 gene locus_tag LOCUS_22240 125657 124140 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244061.1 protein_id gnl|my_center|LOCUS_22240 126146 125670 gene locus_tag LOCUS_22250 126146 125670 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170116.1 protein_id gnl|my_center|LOCUS_22250 127214 126216 gene locus_tag LOCUS_22260 127214 126216 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087143.1 protein_id gnl|my_center|LOCUS_22260 128324 127287 gene locus_tag LOCUS_22270 128324 127287 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087146.1 protein_id gnl|my_center|LOCUS_22270 128458 129843 gene locus_tag LOCUS_22280 128458 129843 CDS product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 protein_id gnl|my_center|LOCUS_22280 130374 129943 gene locus_tag LOCUS_22290 130374 129943 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 protein_id gnl|my_center|LOCUS_22290 130440 131789 gene locus_tag LOCUS_22300 gene hmgA 130440 131789 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967448.1 protein_id gnl|my_center|LOCUS_22300 131797 133104 gene locus_tag LOCUS_22310 gene fahA 131797 133104 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 protein_id gnl|my_center|LOCUS_22310 133169 133804 gene locus_tag LOCUS_22320 gene maiA 133169 133804 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113505.1 protein_id gnl|my_center|LOCUS_22320 134011 134817 gene locus_tag LOCUS_22330 134011 134817 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 protein_id gnl|my_center|LOCUS_22330 135426 134941 gene locus_tag LOCUS_22340 135426 134941 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459521.1 protein_id gnl|my_center|LOCUS_22340 136204 135443 gene locus_tag LOCUS_22350 136204 135443 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086233.1 protein_id gnl|my_center|LOCUS_22350 137145 136417 gene locus_tag LOCUS_22360 137145 136417 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112525.1 protein_id gnl|my_center|LOCUS_22360 137840 137169 gene locus_tag LOCUS_22370 137840 137169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 138915 137962 gene locus_tag LOCUS_22380 138915 137962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_22380 140718 138961 gene locus_tag LOCUS_22390 140718 138961 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089544.1 protein_id gnl|my_center|LOCUS_22390 141948 140731 gene locus_tag LOCUS_22400 141948 140731 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266942.1 protein_id gnl|my_center|LOCUS_22400 141838 142194 gene locus_tag LOCUS_22410 141838 142194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 142329 143552 gene locus_tag LOCUS_22420 142329 143552 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_22420 143687 144619 gene locus_tag LOCUS_22430 143687 144619 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446465.1 protein_id gnl|my_center|LOCUS_22430 144624 146435 gene locus_tag LOCUS_22440 144624 146435 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090557.1 protein_id gnl|my_center|LOCUS_22440 146432 147157 gene locus_tag LOCUS_22450 146432 147157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728924.1 protein_id gnl|my_center|LOCUS_22450 147467 148162 gene locus_tag LOCUS_22460 147467 148162 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244058.1 protein_id gnl|my_center|LOCUS_22460 148640 148179 gene locus_tag LOCUS_22470 gene nikR 148640 148179 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_22470 149493 148708 gene locus_tag LOCUS_22480 149493 148708 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_22480 149697 150671 gene locus_tag LOCUS_22490 149697 150671 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529749.1 protein_id gnl|my_center|LOCUS_22490 150982 151446 gene locus_tag LOCUS_22500 150982 151446 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971001.1 protein_id gnl|my_center|LOCUS_22500 151468 153624 gene locus_tag LOCUS_22510 151468 153624 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_22510 153626 153961 gene locus_tag LOCUS_22520 153626 153961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 153958 155229 gene locus_tag LOCUS_22530 153958 155229 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921427.1 protein_id gnl|my_center|LOCUS_22530 155234 155665 gene locus_tag LOCUS_22540 gene soxX 155234 155665 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_22540 155670 156137 gene locus_tag LOCUS_22550 155670 156137 CDS product SoxY-related AACIE arm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085519.1 protein_id gnl|my_center|LOCUS_22550 156140 156457 gene locus_tag LOCUS_22560 gene soxZ 156140 156457 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085518.1 protein_id gnl|my_center|LOCUS_22560 156460 157257 gene locus_tag LOCUS_22570 gene soxA 156460 157257 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174733.1 protein_id gnl|my_center|LOCUS_22570 157606 159006 gene locus_tag LOCUS_22580 157606 159006 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_22580 159003 160373 gene locus_tag LOCUS_22590 159003 160373 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087228.1 protein_id gnl|my_center|LOCUS_22590 160370 163507 gene locus_tag LOCUS_22600 160370 163507 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087229.1 protein_id gnl|my_center|LOCUS_22600 163511 166615 gene locus_tag LOCUS_22610 163511 166615 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087230.1 protein_id gnl|my_center|LOCUS_22610 167380 167081 gene locus_tag LOCUS_22620 167380 167081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 168458 167454 gene locus_tag LOCUS_22630 168458 167454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 168396 169271 gene locus_tag LOCUS_22640 168396 169271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22640 169890 169354 gene locus_tag LOCUS_22650 169890 169354 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284359.1 protein_id gnl|my_center|LOCUS_22650 171248 170052 gene locus_tag LOCUS_22660 171248 170052 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967739.1 protein_id gnl|my_center|LOCUS_22660 171892 171452 gene locus_tag LOCUS_22670 171892 171452 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_22670 172728 171889 gene locus_tag LOCUS_22680 172728 171889 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222556.1 protein_id gnl|my_center|LOCUS_22680 174356 172725 gene locus_tag LOCUS_22690 174356 172725 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_22690 176439 174373 gene locus_tag LOCUS_22700 176439 174373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_22700 177332 176448 gene locus_tag LOCUS_22710 177332 176448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527924.1 protein_id gnl|my_center|LOCUS_22710 178339 177329 gene locus_tag LOCUS_22720 178339 177329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370098.1 protein_id gnl|my_center|LOCUS_22720 179685 178642 gene locus_tag LOCUS_22730 179685 178642 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 protein_id gnl|my_center|LOCUS_22730 179746 180513 gene locus_tag LOCUS_22740 179746 180513 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970566.1 protein_id gnl|my_center|LOCUS_22740 180510 181532 gene locus_tag LOCUS_22750 180510 181532 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061680.1 protein_id gnl|my_center|LOCUS_22750 181529 182524 gene locus_tag LOCUS_22760 181529 182524 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089289.1 protein_id gnl|my_center|LOCUS_22760 182535 183380 gene locus_tag LOCUS_22770 182535 183380 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085064.1 protein_id gnl|my_center|LOCUS_22770 183492 184526 gene locus_tag LOCUS_22780 183492 184526 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064939.1 protein_id gnl|my_center|LOCUS_22780 186425 184800 gene locus_tag LOCUS_22790 186425 184800 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527926.1 protein_id gnl|my_center|LOCUS_22790 187109 186621 gene locus_tag LOCUS_22800 187109 186621 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089134.1 protein_id gnl|my_center|LOCUS_22800 187894 187121 gene locus_tag LOCUS_22810 187894 187121 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_22810 189683 188067 gene locus_tag LOCUS_22820 gene ggt 189683 188067 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_22820 191233 189719 gene locus_tag LOCUS_22830 191233 189719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267554.1 protein_id gnl|my_center|LOCUS_22830 192971 191427 gene locus_tag LOCUS_22840 192971 191427 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_22840 193202 197077 gene locus_tag LOCUS_22850 gene putA 193202 197077 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195842.1 protein_id gnl|my_center|LOCUS_22850 197084 197914 gene locus_tag LOCUS_22860 gene proC 197084 197914 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969866.1 protein_id gnl|my_center|LOCUS_22860 198092 198664 gene locus_tag LOCUS_22870 198092 198664 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_22870 198669 200474 gene locus_tag LOCUS_22880 gene cydD 198669 200474 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651734.1 protein_id gnl|my_center|LOCUS_22880 200471 202159 gene locus_tag LOCUS_22890 200471 202159 CDS product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973555.1 protein_id gnl|my_center|LOCUS_22890 202247 203824 gene locus_tag LOCUS_22900 202247 203824 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 protein_id gnl|my_center|LOCUS_22900 203830 204984 gene locus_tag LOCUS_22910 gene cydB 203830 204984 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 protein_id gnl|my_center|LOCUS_22910 205001 205165 gene locus_tag LOCUS_22920 205001 205165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 207016 205472 gene locus_tag LOCUS_22930 207016 205472 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 protein_id gnl|my_center|LOCUS_22930 207799 207047 gene locus_tag LOCUS_22940 207799 207047 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969311.1 protein_id gnl|my_center|LOCUS_22940 207900 208520 gene locus_tag LOCUS_22950 207900 208520 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 protein_id gnl|my_center|LOCUS_22950 208655 209125 gene locus_tag LOCUS_22960 208655 209125 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705397.1 protein_id gnl|my_center|LOCUS_22960 210491 209136 gene locus_tag LOCUS_22970 210491 209136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 212159 210789 gene locus_tag LOCUS_22980 212159 210789 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087571.1 protein_id gnl|my_center|LOCUS_22980 212859 212185 gene locus_tag LOCUS_22990 212859 212185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087570.1 protein_id gnl|my_center|LOCUS_22990 214311 212941 gene locus_tag LOCUS_23000 214311 212941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 214883 214416 gene locus_tag LOCUS_23010 214883 214416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 215056 215220 gene locus_tag LOCUS_23020 215056 215220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 216321 215401 gene locus_tag LOCUS_23030 216321 215401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 216496 217554 gene locus_tag LOCUS_23040 216496 217554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 219395 217608 gene locus_tag LOCUS_23050 219395 217608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 219842 219537 gene locus_tag LOCUS_23060 219842 219537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 220435 220073 gene locus_tag LOCUS_23070 220435 220073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385541.1 protein_id gnl|my_center|LOCUS_23070 221123 220599 gene locus_tag LOCUS_23080 221123 220599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844878.1 protein_id gnl|my_center|LOCUS_23080 222017 221355 gene locus_tag LOCUS_23090 222017 221355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 223463 223756 gene locus_tag LOCUS_23100 223463 223756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 224091 225137 gene locus_tag LOCUS_23110 224091 225137 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_23110 225171 226196 gene locus_tag LOCUS_23120 225171 226196 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_23120 226208 228412 gene locus_tag LOCUS_23130 226208 228412 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975242.1 protein_id gnl|my_center|LOCUS_23130 228409 229470 gene locus_tag LOCUS_23140 228409 229470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 protein_id gnl|my_center|LOCUS_23140 230370 229477 gene locus_tag LOCUS_23150 230370 229477 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_23150 231467 230667 gene locus_tag LOCUS_23160 231467 230667 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_23160 232135 231464 gene locus_tag LOCUS_23170 232135 231464 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965232.1 protein_id gnl|my_center|LOCUS_23170 232770 232165 gene locus_tag LOCUS_23180 232770 232165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926000.1 protein_id gnl|my_center|LOCUS_23180 233600 232779 gene locus_tag LOCUS_23190 233600 232779 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064596.1 protein_id gnl|my_center|LOCUS_23190 234565 233597 gene locus_tag LOCUS_23200 234565 233597 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090457.1 protein_id gnl|my_center|LOCUS_23200 234745 235707 gene locus_tag LOCUS_23210 234745 235707 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 protein_id gnl|my_center|LOCUS_23210 236952 235756 gene locus_tag LOCUS_23220 236952 235756 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_23220 238004 236949 gene locus_tag LOCUS_23230 238004 236949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 238802 238032 gene locus_tag LOCUS_23240 238802 238032 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_23240 238899 240089 gene locus_tag LOCUS_23250 238899 240089 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926091.1 protein_id gnl|my_center|LOCUS_23250 241492 240296 gene locus_tag LOCUS_23260 241492 240296 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_23260 241601 242770 gene locus_tag LOCUS_23270 241601 242770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 243983 242802 gene locus_tag LOCUS_23280 gene uxuA 243983 242802 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089569.1 protein_id gnl|my_center|LOCUS_23280 244811 244023 gene locus_tag LOCUS_23290 244811 244023 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244084.1 protein_id gnl|my_center|LOCUS_23290 245261 246328 gene locus_tag LOCUS_23300 245261 246328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 protein_id gnl|my_center|LOCUS_23300 246337 247263 gene locus_tag LOCUS_23310 246337 247263 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 protein_id gnl|my_center|LOCUS_23310 247269 248111 gene locus_tag LOCUS_23320 247269 248111 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 protein_id gnl|my_center|LOCUS_23320 248624 248223 gene locus_tag LOCUS_23330 248624 248223 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_23330 249898 248621 gene locus_tag LOCUS_23340 gene pepT 249898 248621 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061949.1 protein_id gnl|my_center|LOCUS_23340 251040 250024 gene locus_tag LOCUS_23350 251040 250024 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368551.1 protein_id gnl|my_center|LOCUS_23350 252067 251051 gene locus_tag LOCUS_23360 252067 251051 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973464.1 protein_id gnl|my_center|LOCUS_23360 253263 252076 gene locus_tag LOCUS_23370 253263 252076 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_23370 253924 253427 gene locus_tag LOCUS_23380 253924 253427 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 protein_id gnl|my_center|LOCUS_23380 255399 253921 gene locus_tag LOCUS_23390 gene zwf 255399 253921 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974509.1 protein_id gnl|my_center|LOCUS_23390 255515 256114 gene locus_tag LOCUS_23400 255515 256114 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975929.1 protein_id gnl|my_center|LOCUS_23400 256749 256111 gene locus_tag LOCUS_23410 256749 256111 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401008.1 protein_id gnl|my_center|LOCUS_23410 257071 257985 gene locus_tag LOCUS_23420 257071 257985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 258287 258006 gene locus_tag LOCUS_23430 258287 258006 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_23430 258977 258351 gene locus_tag LOCUS_23440 258977 258351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 261669 259018 gene locus_tag LOCUS_23450 261669 259018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 262191 263492 gene locus_tag LOCUS_23460 262191 263492 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_23460 264173 263583 gene locus_tag LOCUS_23470 264173 263583 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104210.1 protein_id gnl|my_center|LOCUS_23470 264676 264170 gene locus_tag LOCUS_23480 264676 264170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175245.1 protein_id gnl|my_center|LOCUS_23480 266282 264732 gene locus_tag LOCUS_23490 266282 264732 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969486.1 protein_id gnl|my_center|LOCUS_23490 266311 267258 gene locus_tag LOCUS_23500 266311 267258 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235611.1 protein_id gnl|my_center|LOCUS_23500 267408 268199 gene locus_tag LOCUS_23510 267408 268199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 268414 269757 gene locus_tag LOCUS_23520 gene tssK 268414 269757 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548748.1 protein_id gnl|my_center|LOCUS_23520 269754 271223 gene locus_tag LOCUS_23530 gene tssL 269754 271223 CDS product type VI secretion system protein TssL, long form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086381.1 protein_id gnl|my_center|LOCUS_23530 271246 274830 gene locus_tag LOCUS_23540 gene tssM 271246 274830 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086382.1 protein_id gnl|my_center|LOCUS_23540 274838 275512 gene locus_tag LOCUS_23550 gene tagF 274838 275512 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086383.1 protein_id gnl|my_center|LOCUS_23550 275517 276335 gene locus_tag LOCUS_23560 275517 276335 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525286.1 protein_id gnl|my_center|LOCUS_23560 276328 278526 gene locus_tag LOCUS_23570 276328 278526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 279882 278563 gene locus_tag LOCUS_23580 gene tagH 279882 278563 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967723.1 protein_id gnl|my_center|LOCUS_23580 280489 279935 gene locus_tag LOCUS_23590 280489 279935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086378.1 protein_id gnl|my_center|LOCUS_23590 282362 280503 gene locus_tag LOCUS_23600 gene tssI 282362 280503 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086377.1 protein_id gnl|my_center|LOCUS_23600 282752 283306 gene locus_tag LOCUS_23610 282752 283306 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525282.1 protein_id gnl|my_center|LOCUS_23610 283400 284806 gene locus_tag LOCUS_23620 283400 284806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 284895 285413 gene locus_tag LOCUS_23630 gene tssB 284895 285413 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063713277.1 protein_id gnl|my_center|LOCUS_23630 285462 286955 gene locus_tag LOCUS_23640 gene tssC 285462 286955 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967726.1 protein_id gnl|my_center|LOCUS_23640 287061 287540 gene locus_tag LOCUS_23650 287061 287540 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086373.1 protein_id gnl|my_center|LOCUS_23650 287720 288286 gene locus_tag LOCUS_23660 gene tssE 287720 288286 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086372.1 protein_id gnl|my_center|LOCUS_23660 288283 290247 gene locus_tag LOCUS_23670 gene tssF 288283 290247 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170696.1 protein_id gnl|my_center|LOCUS_23670 290244 291068 gene locus_tag LOCUS_23680 gene tssG 290244 291068 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086369.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23680 291306 293933 gene locus_tag LOCUS_23690 gene tssH 291306 293933 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086368.1 protein_id gnl|my_center|LOCUS_23690 294030 295163 gene locus_tag LOCUS_23700 294030 295163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 296156 295203 gene locus_tag LOCUS_23710 296156 295203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 296463 298076 gene locus_tag LOCUS_23720 296463 298076 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089923.1 protein_id gnl|my_center|LOCUS_23720 299271 298318 gene locus_tag LOCUS_23730 299271 298318 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040322.1 protein_id gnl|my_center|LOCUS_23730 300212 299439 gene locus_tag LOCUS_23740 300212 299439 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_23740 300308 300925 gene locus_tag LOCUS_23750 300308 300925 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 protein_id gnl|my_center|LOCUS_23750 302349 300952 gene locus_tag LOCUS_23760 gene lpdA 302349 300952 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 protein_id gnl|my_center|LOCUS_23760 303662 302355 gene locus_tag LOCUS_23770 303662 302355 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528743.1 protein_id gnl|my_center|LOCUS_23770 304627 303665 gene locus_tag LOCUS_23780 304627 303665 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528742.1 protein_id gnl|my_center|LOCUS_23780 305915 304683 gene locus_tag LOCUS_23790 305915 304683 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528741.1 protein_id gnl|my_center|LOCUS_23790 306968 306384 gene locus_tag LOCUS_23800 306968 306384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_23800 307438 307007 gene locus_tag LOCUS_23810 307438 307007 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398287.1 protein_id gnl|my_center|LOCUS_23810 307508 308119 gene locus_tag LOCUS_23820 307508 308119 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968400.1 protein_id gnl|my_center|LOCUS_23820 308646 309320 gene locus_tag LOCUS_23830 308646 309320 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087570.1 protein_id gnl|my_center|LOCUS_23830 309317 310681 gene locus_tag LOCUS_23840 309317 310681 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087571.1 protein_id gnl|my_center|LOCUS_23840 310868 311701 gene locus_tag LOCUS_23850 310868 311701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 311860 312537 gene locus_tag LOCUS_23860 gene tenA 311860 312537 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090123.1 protein_id gnl|my_center|LOCUS_23860 313378 314358 gene locus_tag LOCUS_23870 313378 314358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 314363 314866 gene locus_tag LOCUS_23880 gene exbD 314363 314866 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528969.1 protein_id gnl|my_center|LOCUS_23880 314863 315732 gene locus_tag LOCUS_23890 314863 315732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 315738 316556 gene locus_tag LOCUS_23900 315738 316556 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973507.1 protein_id gnl|my_center|LOCUS_23900 316599 317237 gene locus_tag LOCUS_23910 316599 317237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 318939 317392 gene locus_tag LOCUS_23920 318939 317392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_23920 319813 318965 gene locus_tag LOCUS_23930 319813 318965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_23930 321279 319813 gene locus_tag LOCUS_23940 321279 319813 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089472.1 protein_id gnl|my_center|LOCUS_23940 321407 322297 gene locus_tag LOCUS_23950 321407 322297 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528947.1 protein_id gnl|my_center|LOCUS_23950 322374 323708 gene locus_tag LOCUS_23960 322374 323708 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_23960 323819 324430 gene locus_tag LOCUS_23970 323819 324430 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_23970 324587 326272 gene locus_tag LOCUS_23980 324587 326272 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810780.1 protein_id gnl|my_center|LOCUS_23980 326313 327479 gene locus_tag LOCUS_23990 326313 327479 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_23990 327513 328274 gene locus_tag LOCUS_24000 327513 328274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 329584 328373 gene locus_tag LOCUS_24010 329584 328373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_24010 329698 330300 gene locus_tag LOCUS_24020 329698 330300 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527524.1 protein_id gnl|my_center|LOCUS_24020 330421 330912 gene locus_tag LOCUS_24030 gene msrB 330421 330912 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967753.1 protein_id gnl|my_center|LOCUS_24030 330952 331683 gene locus_tag LOCUS_24040 gene msrA 330952 331683 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528688.1 protein_id gnl|my_center|LOCUS_24040 332126 331635 gene locus_tag LOCUS_24050 332126 331635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 333364 332126 gene locus_tag LOCUS_24060 333364 332126 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 protein_id gnl|my_center|LOCUS_24060 334055 333351 gene locus_tag LOCUS_24070 334055 333351 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815479.1 protein_id gnl|my_center|LOCUS_24070 334184 335113 gene locus_tag LOCUS_24080 334184 335113 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815477.1 protein_id gnl|my_center|LOCUS_24080 336567 335125 gene locus_tag LOCUS_24090 336567 335125 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966276.1 protein_id gnl|my_center|LOCUS_24090 336834 338063 gene locus_tag LOCUS_24100 336834 338063 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_24100 339971 338088 gene locus_tag LOCUS_24110 339971 338088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372670.1 protein_id gnl|my_center|LOCUS_24110 341665 340202 gene locus_tag LOCUS_24120 341665 340202 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529596.1 protein_id gnl|my_center|LOCUS_24120 343172 342033 gene locus_tag LOCUS_24130 343172 342033 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 protein_id gnl|my_center|LOCUS_24130 343473 344408 gene locus_tag LOCUS_24140 343473 344408 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089437.1 protein_id gnl|my_center|LOCUS_24140 344466 345209 gene locus_tag LOCUS_24150 344466 345209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807684.1 protein_id gnl|my_center|LOCUS_24150 345856 345362 gene locus_tag LOCUS_24160 345856 345362 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 protein_id gnl|my_center|LOCUS_24160 346766 348244 gene locus_tag LOCUS_24170 346766 348244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 348286 350955 gene locus_tag LOCUS_24180 348286 350955 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975745.1 protein_id gnl|my_center|LOCUS_24180 351696 352997 gene locus_tag LOCUS_24190 351696 352997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 353199 354152 gene locus_tag LOCUS_24200 353199 354152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 354196 355320 gene locus_tag LOCUS_24210 354196 355320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 355597 356367 gene locus_tag LOCUS_24220 355597 356367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 356364 357209 gene locus_tag LOCUS_24230 356364 357209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 357206 358504 gene locus_tag LOCUS_24240 357206 358504 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 protein_id gnl|my_center|LOCUS_24240 360901 358433 gene locus_tag LOCUS_24250 360901 358433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 361588 360965 gene locus_tag LOCUS_24260 361588 360965 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 protein_id gnl|my_center|LOCUS_24260 362761 361685 gene locus_tag LOCUS_24270 362761 361685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017272940.1 protein_id gnl|my_center|LOCUS_24270 363621 362755 gene locus_tag LOCUS_24280 363621 362755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 364362 363634 gene locus_tag LOCUS_24290 364362 363634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 365270 367018 gene locus_tag LOCUS_24300 365270 367018 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266723.1 protein_id gnl|my_center|LOCUS_24300 367035 368369 gene locus_tag LOCUS_24310 367035 368369 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918893.1 protein_id gnl|my_center|LOCUS_24310 368446 370902 gene locus_tag LOCUS_24320 368446 370902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 371676 370906 gene locus_tag LOCUS_24330 371676 370906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 372541 371756 gene locus_tag LOCUS_24340 372541 371756 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 protein_id gnl|my_center|LOCUS_24340 373364 372588 gene locus_tag LOCUS_24350 373364 372588 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_24350 373638 374420 gene locus_tag LOCUS_24360 373638 374420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965770.1 protein_id gnl|my_center|LOCUS_24360 375151 374435 gene locus_tag LOCUS_24370 375151 374435 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090522.1 protein_id gnl|my_center|LOCUS_24370 376444 375248 gene locus_tag LOCUS_24380 376444 375248 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 protein_id gnl|my_center|LOCUS_24380 378290 376590 gene locus_tag LOCUS_24390 378290 376590 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090028.1 protein_id gnl|my_center|LOCUS_24390 379196 378426 gene locus_tag LOCUS_24400 379196 378426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 379603 381225 gene locus_tag LOCUS_24410 379603 381225 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376481.1 protein_id gnl|my_center|LOCUS_24410 380212 380307 gene locus_tag LOCUS_t00210 380212 380307 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 381298 384597 gene locus_tag LOCUS_24420 381298 384597 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_24420 385639 384896 gene locus_tag LOCUS_24430 385639 384896 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020660801.1 protein_id gnl|my_center|LOCUS_24430 385993 386607 gene locus_tag LOCUS_24440 385993 386607 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229036.1 protein_id gnl|my_center|LOCUS_24440 386600 387844 gene locus_tag LOCUS_24450 386600 387844 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229035.1 protein_id gnl|my_center|LOCUS_24450 387944 388522 gene locus_tag LOCUS_24460 387944 388522 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229034.1 protein_id gnl|my_center|LOCUS_24460 388525 389424 gene locus_tag LOCUS_24470 388525 389424 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229033.1 protein_id gnl|my_center|LOCUS_24470 389421 390206 gene locus_tag LOCUS_24480 389421 390206 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919681.1 protein_id gnl|my_center|LOCUS_24480 390314 391120 gene locus_tag LOCUS_24490 390314 391120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 392454 391483 gene locus_tag LOCUS_24500 392454 391483 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090457.1 protein_id gnl|my_center|LOCUS_24500 393696 392680 gene locus_tag LOCUS_24510 393696 392680 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_24510 394628 393711 gene locus_tag LOCUS_24520 394628 393711 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931529.1 protein_id gnl|my_center|LOCUS_24520 395263 394625 gene locus_tag LOCUS_24530 395263 394625 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229040.1 protein_id gnl|my_center|LOCUS_24530 396140 395271 gene locus_tag LOCUS_24540 396140 395271 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020867621.1 protein_id gnl|my_center|LOCUS_24540 397111 396731 gene locus_tag LOCUS_24550 397111 396731 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 protein_id gnl|my_center|LOCUS_24550 398430 397111 gene locus_tag LOCUS_24560 398430 397111 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966009.1 protein_id gnl|my_center|LOCUS_24560 400028 398547 gene locus_tag LOCUS_24570 400028 398547 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966015.1 protein_id gnl|my_center|LOCUS_24570 401647 400040 gene locus_tag LOCUS_24580 401647 400040 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966010.1 protein_id gnl|my_center|LOCUS_24580 403647 401644 gene locus_tag LOCUS_24590 403647 401644 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086110.1 protein_id gnl|my_center|LOCUS_24590 405346 403691 gene locus_tag LOCUS_24600 405346 403691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 protein_id gnl|my_center|LOCUS_24600 406188 405343 gene locus_tag LOCUS_24610 406188 405343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086123.1 protein_id gnl|my_center|LOCUS_24610 407216 406185 gene locus_tag LOCUS_24620 407216 406185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463752.1 protein_id gnl|my_center|LOCUS_24620 408784 407219 gene locus_tag LOCUS_24630 408784 407219 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086121.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence06 1657 272 gene locus_tag LOCUS_24640 1657 272 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967518.1 protein_id gnl|my_center|LOCUS_24640 2834 1806 gene locus_tag LOCUS_24650 gene cobT 2834 1806 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975751.1 protein_id gnl|my_center|LOCUS_24650 2981 3763 gene locus_tag LOCUS_24660 2981 3763 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975752.1 protein_id gnl|my_center|LOCUS_24660 3767 3970 gene locus_tag LOCUS_24670 3767 3970 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314023.1 protein_id gnl|my_center|LOCUS_24670 3967 4683 gene locus_tag LOCUS_24680 3967 4683 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969540.1 protein_id gnl|my_center|LOCUS_24680 4783 6309 gene locus_tag LOCUS_24690 4783 6309 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_24690 7366 6350 gene locus_tag LOCUS_24700 7366 6350 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812279.1 protein_id gnl|my_center|LOCUS_24700 7580 9016 gene locus_tag LOCUS_24710 7580 9016 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_24710 9272 9673 gene locus_tag LOCUS_24720 9272 9673 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_24720 9820 10125 gene locus_tag LOCUS_24730 9820 10125 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084888.1 protein_id gnl|my_center|LOCUS_24730 11010 10144 gene locus_tag LOCUS_24740 gene panB 11010 10144 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153345.1 protein_id gnl|my_center|LOCUS_24740 11920 11066 gene locus_tag LOCUS_24750 11920 11066 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965087.1 protein_id gnl|my_center|LOCUS_24750 12697 12068 gene locus_tag LOCUS_24760 12697 12068 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_24760 13807 12767 gene locus_tag LOCUS_24770 gene dusA 13807 12767 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_24770 14559 14197 gene locus_tag LOCUS_24780 14559 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 15517 14753 gene locus_tag LOCUS_24790 15517 14753 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_24790 16440 15520 gene locus_tag LOCUS_24800 16440 15520 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_24800 17311 16469 gene locus_tag LOCUS_24810 17311 16469 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086325.1 protein_id gnl|my_center|LOCUS_24810 18793 17366 gene locus_tag LOCUS_24820 18793 17366 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_24820 19208 18822 gene locus_tag LOCUS_24830 19208 18822 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938222.1 protein_id gnl|my_center|LOCUS_24830 20309 19254 gene locus_tag LOCUS_24840 20309 19254 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_24840 21227 20343 gene locus_tag LOCUS_24850 21227 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 23493 21337 gene locus_tag LOCUS_24860 23493 21337 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_24860 23713 24288 gene locus_tag LOCUS_24870 23713 24288 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_24870 24334 25059 gene locus_tag LOCUS_24880 24334 25059 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 protein_id gnl|my_center|LOCUS_24880 26766 25105 gene locus_tag LOCUS_24890 26766 25105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813166.1 protein_id gnl|my_center|LOCUS_24890 27604 26768 gene locus_tag LOCUS_24900 27604 26768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813165.1 protein_id gnl|my_center|LOCUS_24900 28594 27617 gene locus_tag LOCUS_24910 28594 27617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064134.1 protein_id gnl|my_center|LOCUS_24910 30230 28659 gene locus_tag LOCUS_24920 30230 28659 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819100.1 protein_id gnl|my_center|LOCUS_24920 30598 30906 gene locus_tag LOCUS_24930 30598 30906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 32275 30854 gene locus_tag LOCUS_24940 32275 30854 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538286.1 protein_id gnl|my_center|LOCUS_24940 33881 32661 gene locus_tag LOCUS_24950 33881 32661 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061389.1 protein_id gnl|my_center|LOCUS_24950 34976 34413 gene locus_tag LOCUS_24960 34976 34413 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972952.1 protein_id gnl|my_center|LOCUS_24960 35544 35032 gene locus_tag LOCUS_24970 35544 35032 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 protein_id gnl|my_center|LOCUS_24970 36146 36571 gene locus_tag LOCUS_24980 36146 36571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 37307 36678 gene locus_tag LOCUS_24990 37307 36678 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090041.1 protein_id gnl|my_center|LOCUS_24990 38155 40896 gene locus_tag LOCUS_25000 38155 40896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 41100 41396 gene locus_tag LOCUS_25010 41100 41396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 41696 41842 gene locus_tag LOCUS_25020 41696 41842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 42098 42418 gene locus_tag LOCUS_25030 42098 42418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 43890 42529 gene locus_tag LOCUS_25040 43890 42529 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_25040 44989 45618 gene locus_tag LOCUS_25050 44989 45618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 46169 47146 gene locus_tag LOCUS_25060 46169 47146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 47469 48695 gene locus_tag LOCUS_25070 47469 48695 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533106.1 protein_id gnl|my_center|LOCUS_25070 48692 49945 gene locus_tag LOCUS_25080 48692 49945 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533107.1 protein_id gnl|my_center|LOCUS_25080 49950 51965 gene locus_tag LOCUS_25090 gene asnB 49950 51965 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_25090 51968 54136 gene locus_tag LOCUS_25100 51968 54136 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533109.1 protein_id gnl|my_center|LOCUS_25100 54232 55011 gene locus_tag LOCUS_25110 54232 55011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 55147 56595 gene locus_tag LOCUS_25120 55147 56595 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172046.1 protein_id gnl|my_center|LOCUS_25120 56704 57915 gene locus_tag LOCUS_25130 gene uppZ 56704 57915 CDS product polysaccharide biosynthesis acyltransferase UppZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972254.1 protein_id gnl|my_center|LOCUS_25130 58194 60956 gene locus_tag LOCUS_25140 58194 60956 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533126.1 protein_id gnl|my_center|LOCUS_25140 61200 61919 gene locus_tag LOCUS_25150 61200 61919 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533115.1 protein_id gnl|my_center|LOCUS_25150 61990 63126 gene locus_tag LOCUS_25160 61990 63126 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533116.1 protein_id gnl|my_center|LOCUS_25160 63123 63815 gene locus_tag LOCUS_25170 63123 63815 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533117.1 protein_id gnl|my_center|LOCUS_25170 63859 64866 gene locus_tag LOCUS_25180 63859 64866 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533118.1 protein_id gnl|my_center|LOCUS_25180 64863 66119 gene locus_tag LOCUS_25190 64863 66119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533119.1 protein_id gnl|my_center|LOCUS_25190 66139 67413 gene locus_tag LOCUS_25200 66139 67413 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533120.1 protein_id gnl|my_center|LOCUS_25200 67892 69004 gene locus_tag LOCUS_25210 67892 69004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25210 70566 69229 gene locus_tag LOCUS_25220 70566 69229 CDS product IS701-like element ISBj9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 protein_id gnl|my_center|LOCUS_25220 70838 72187 gene locus_tag LOCUS_25230 70838 72187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 72830 73531 gene locus_tag LOCUS_25240 72830 73531 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533112.1 protein_id gnl|my_center|LOCUS_25240 73528 73956 gene locus_tag LOCUS_25250 73528 73956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 74105 75160 gene locus_tag LOCUS_25260 74105 75160 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174325.1 protein_id gnl|my_center|LOCUS_25260 75245 78013 gene locus_tag LOCUS_25270 75245 78013 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 protein_id gnl|my_center|LOCUS_25270 78031 78225 gene locus_tag LOCUS_25280 78031 78225 CDS product DUF6494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399808.1 protein_id gnl|my_center|LOCUS_25280 78729 78256 gene locus_tag LOCUS_25290 gene ybaK 78729 78256 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435416.1 protein_id gnl|my_center|LOCUS_25290 78973 79188 gene locus_tag LOCUS_25300 78973 79188 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967554.1 protein_id gnl|my_center|LOCUS_25300 79200 79727 gene locus_tag LOCUS_25310 79200 79727 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086804.1 protein_id gnl|my_center|LOCUS_25310 79856 81262 gene locus_tag LOCUS_25320 79856 81262 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_25320 81420 83027 gene locus_tag LOCUS_25330 81420 83027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_25330 83095 84036 gene locus_tag LOCUS_25340 83095 84036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175416.1 protein_id gnl|my_center|LOCUS_25340 84033 84968 gene locus_tag LOCUS_25350 84033 84968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388736.1 protein_id gnl|my_center|LOCUS_25350 84965 86581 gene locus_tag LOCUS_25360 84965 86581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388737.1 protein_id gnl|my_center|LOCUS_25360 86688 88397 gene locus_tag LOCUS_25370 gene ade 86688 88397 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 protein_id gnl|my_center|LOCUS_25370 88459 89670 gene locus_tag LOCUS_25380 88459 89670 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087806.1 protein_id gnl|my_center|LOCUS_25380 90669 89686 gene locus_tag LOCUS_25390 90669 89686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 91594 90797 gene locus_tag LOCUS_25400 91594 90797 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331744.1 protein_id gnl|my_center|LOCUS_25400 91806 92288 gene locus_tag LOCUS_25410 91806 92288 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950627.1 protein_id gnl|my_center|LOCUS_25410 92331 93299 gene locus_tag LOCUS_25420 92331 93299 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930624.1 protein_id gnl|my_center|LOCUS_25420 94349 93387 gene locus_tag LOCUS_25430 94349 93387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 96050 94590 gene locus_tag LOCUS_25440 96050 94590 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266382.1 protein_id gnl|my_center|LOCUS_25440 97024 96185 gene locus_tag LOCUS_25450 97024 96185 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_25450 98430 97021 gene locus_tag LOCUS_25460 98430 97021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 98520 99920 gene locus_tag LOCUS_25470 98520 99920 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_25470 99978 102617 gene locus_tag LOCUS_25480 gene pepN 99978 102617 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060564028.1 protein_id gnl|my_center|LOCUS_25480 102813 105134 gene locus_tag LOCUS_25490 102813 105134 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085924.1 protein_id gnl|my_center|LOCUS_25490 108110 105159 gene locus_tag LOCUS_25500 108110 105159 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085917.1 protein_id gnl|my_center|LOCUS_25500 109572 108097 gene locus_tag LOCUS_25510 109572 108097 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_25510 110249 109569 gene locus_tag LOCUS_25520 110249 109569 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_25520 112006 110465 gene locus_tag LOCUS_25530 112006 110465 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085914.1 protein_id gnl|my_center|LOCUS_25530 112643 112164 gene locus_tag LOCUS_25540 112643 112164 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 protein_id gnl|my_center|LOCUS_25540 114631 112640 gene locus_tag LOCUS_25550 114631 112640 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968989.1 protein_id gnl|my_center|LOCUS_25550 115113 114634 gene locus_tag LOCUS_25560 gene ccmE 115113 114634 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_25560 116189 115119 gene locus_tag LOCUS_25570 gene ccmI 116189 115119 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085909.1 protein_id gnl|my_center|LOCUS_25570 117725 116328 gene locus_tag LOCUS_25580 117725 116328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 118318 117872 gene locus_tag LOCUS_25590 118318 117872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532637.1 protein_id gnl|my_center|LOCUS_25590 119817 118432 gene locus_tag LOCUS_25600 119817 118432 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_25600 120488 119820 gene locus_tag LOCUS_25610 120488 119820 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_25610 121138 120548 gene locus_tag LOCUS_25620 121138 120548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 121162 121407 gene locus_tag LOCUS_25630 121162 121407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 121627 121442 gene locus_tag LOCUS_25640 121627 121442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 121942 122670 gene locus_tag LOCUS_25650 121942 122670 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_25650 122667 123515 gene locus_tag LOCUS_25660 122667 123515 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_25660 124395 123670 gene locus_tag LOCUS_25670 124395 123670 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171067.1 protein_id gnl|my_center|LOCUS_25670 124710 125024 gene locus_tag LOCUS_25680 124710 125024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 125081 125383 gene locus_tag LOCUS_25690 125081 125383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 125643 125855 gene locus_tag LOCUS_25700 125643 125855 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 protein_id gnl|my_center|LOCUS_25700 126071 126301 gene locus_tag LOCUS_25710 126071 126301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 126337 126648 gene locus_tag LOCUS_25720 126337 126648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 127104 126715 gene locus_tag LOCUS_25730 127104 126715 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265884.1 protein_id gnl|my_center|LOCUS_25730 127247 127816 gene locus_tag LOCUS_25740 127247 127816 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_25740 127826 128245 gene locus_tag LOCUS_25750 127826 128245 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521805.1 protein_id gnl|my_center|LOCUS_25750 128233 128460 gene locus_tag LOCUS_25760 128233 128460 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920812.1 protein_id gnl|my_center|LOCUS_25760 128470 129435 gene locus_tag LOCUS_25770 128470 129435 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 protein_id gnl|my_center|LOCUS_25770 129609 130286 gene locus_tag LOCUS_25780 129609 130286 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_25780 130318 131892 gene locus_tag LOCUS_25790 130318 131892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_25790 132870 131941 gene locus_tag LOCUS_25800 132870 131941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_25800 132983 133654 gene locus_tag LOCUS_25810 132983 133654 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088533.1 protein_id gnl|my_center|LOCUS_25810 133871 134350 gene locus_tag LOCUS_25820 133871 134350 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090150.1 protein_id gnl|my_center|LOCUS_25820 134809 134384 gene locus_tag LOCUS_25830 134809 134384 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_25830 135187 134852 gene locus_tag LOCUS_25840 135187 134852 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_25840 135423 135175 gene locus_tag LOCUS_25850 135423 135175 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_25850 135991 135488 gene locus_tag LOCUS_25860 135991 135488 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085887.1 protein_id gnl|my_center|LOCUS_25860 136151 138337 gene locus_tag LOCUS_25870 136151 138337 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085886.1 protein_id gnl|my_center|LOCUS_25870 138351 138923 gene locus_tag LOCUS_25880 138351 138923 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085885.1 protein_id gnl|my_center|LOCUS_25880 138920 139492 gene locus_tag LOCUS_25890 138920 139492 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085884.1 protein_id gnl|my_center|LOCUS_25890 140293 139532 gene locus_tag LOCUS_25900 140293 139532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 140618 140388 gene locus_tag LOCUS_25910 140618 140388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 140832 141659 gene locus_tag LOCUS_25920 140832 141659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 142435 141686 gene locus_tag LOCUS_25930 142435 141686 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_25930 142962 144050 gene locus_tag LOCUS_25940 142962 144050 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085859.1 protein_id gnl|my_center|LOCUS_25940 144421 144071 gene locus_tag LOCUS_25950 144421 144071 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532655.1 protein_id gnl|my_center|LOCUS_25950 145417 144428 gene locus_tag LOCUS_25960 145417 144428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 147230 145410 gene locus_tag LOCUS_25970 147230 145410 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085855.1 protein_id gnl|my_center|LOCUS_25970 147637 148008 gene locus_tag LOCUS_25980 147637 148008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 148066 148500 gene locus_tag LOCUS_25990 148066 148500 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974817.1 protein_id gnl|my_center|LOCUS_25990 149202 148531 gene locus_tag LOCUS_26000 149202 148531 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_26000 149429 150295 gene locus_tag LOCUS_26010 149429 150295 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241072.1 protein_id gnl|my_center|LOCUS_26010 152055 150382 gene locus_tag LOCUS_26020 152055 150382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 152280 152879 gene locus_tag LOCUS_26030 152280 152879 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014491764.1 protein_id gnl|my_center|LOCUS_26030 153681 152968 gene locus_tag LOCUS_26040 153681 152968 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396825.1 protein_id gnl|my_center|LOCUS_26040 153894 155069 gene locus_tag LOCUS_26050 153894 155069 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 protein_id gnl|my_center|LOCUS_26050 157223 155085 gene locus_tag LOCUS_26060 157223 155085 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 protein_id gnl|my_center|LOCUS_26060 157752 158171 gene locus_tag LOCUS_26070 157752 158171 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085852.1 protein_id gnl|my_center|LOCUS_26070 159638 158247 gene locus_tag LOCUS_26080 159638 158247 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085848.1 protein_id gnl|my_center|LOCUS_26080 160217 159768 gene locus_tag LOCUS_26090 160217 159768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 161880 160372 gene locus_tag LOCUS_26100 161880 160372 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_26100 162158 162625 gene locus_tag LOCUS_26110 162158 162625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 164063 162645 gene locus_tag LOCUS_26120 164063 162645 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083078.1 protein_id gnl|my_center|LOCUS_26120 165152 164226 gene locus_tag LOCUS_26130 165152 164226 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966280.1 protein_id gnl|my_center|LOCUS_26130 166359 165376 gene locus_tag LOCUS_26140 gene meaB 166359 165376 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_26140 166692 167924 gene locus_tag LOCUS_26150 166692 167924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 169442 167940 gene locus_tag LOCUS_26160 169442 167940 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_26160 169992 169450 gene locus_tag LOCUS_26170 169992 169450 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085834.1 protein_id gnl|my_center|LOCUS_26170 171055 170072 gene locus_tag LOCUS_26180 171055 170072 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_26180 173342 171192 gene locus_tag LOCUS_26190 gene scpA 173342 171192 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085838.1 protein_id gnl|my_center|LOCUS_26190 173683 173339 gene locus_tag LOCUS_26200 173683 173339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 175689 173719 gene locus_tag LOCUS_26210 175689 173719 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085840.1 protein_id gnl|my_center|LOCUS_26210 176282 175785 gene locus_tag LOCUS_26220 gene folK 176282 175785 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085841.1 protein_id gnl|my_center|LOCUS_26220 176673 176305 gene locus_tag LOCUS_26230 gene folB 176673 176305 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544155.1 protein_id gnl|my_center|LOCUS_26230 177518 176670 gene locus_tag LOCUS_26240 gene folP 177518 176670 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172291.1 protein_id gnl|my_center|LOCUS_26240 178122 177577 gene locus_tag LOCUS_26250 178122 177577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 178508 178122 gene locus_tag LOCUS_26260 178508 178122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974781.1 protein_id gnl|my_center|LOCUS_26260 178783 179157 gene locus_tag LOCUS_26270 178783 179157 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083764.1 protein_id gnl|my_center|LOCUS_26270 180066 179245 gene locus_tag LOCUS_26280 180066 179245 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_26280 181460 180078 gene locus_tag LOCUS_26290 181460 180078 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_26290 181657 182835 gene locus_tag LOCUS_26300 181657 182835 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087069.1 protein_id gnl|my_center|LOCUS_26300 183676 182855 gene locus_tag LOCUS_26310 183676 182855 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530111.1 protein_id gnl|my_center|LOCUS_26310 183986 183708 gene locus_tag LOCUS_26320 183986 183708 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 protein_id gnl|my_center|LOCUS_26320 184236 184586 gene locus_tag LOCUS_26330 184236 184586 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967099.1 protein_id gnl|my_center|LOCUS_26330 184576 185046 gene locus_tag LOCUS_26340 184576 185046 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_26340 185552 185115 gene locus_tag LOCUS_26350 185552 185115 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114472.1 protein_id gnl|my_center|LOCUS_26350 185628 186509 gene locus_tag LOCUS_26360 185628 186509 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199880.1 protein_id gnl|my_center|LOCUS_26360 186670 188004 gene locus_tag LOCUS_26370 186670 188004 CDS product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085830.1 protein_id gnl|my_center|LOCUS_26370 188423 188013 gene locus_tag LOCUS_26380 188423 188013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 190601 188553 gene locus_tag LOCUS_26390 190601 188553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 190880 191341 gene locus_tag LOCUS_26400 190880 191341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 191338 191490 gene locus_tag LOCUS_26410 191338 191490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 191606 192187 gene locus_tag LOCUS_26420 191606 192187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 192901 192200 gene locus_tag LOCUS_26430 192901 192200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 194295 193522 gene locus_tag LOCUS_26440 194295 193522 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388288.1 protein_id gnl|my_center|LOCUS_26440 194504 195430 gene locus_tag LOCUS_26450 194504 195430 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527149.1 protein_id gnl|my_center|LOCUS_26450 195434 197137 gene locus_tag LOCUS_26460 195434 197137 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083199.1 protein_id gnl|my_center|LOCUS_26460 198132 197149 gene locus_tag LOCUS_26470 198132 197149 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_26470 198288 199097 gene locus_tag LOCUS_26480 198288 199097 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040702.1 protein_id gnl|my_center|LOCUS_26480 200330 199446 gene locus_tag LOCUS_26490 200330 199446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172662.1 protein_id gnl|my_center|LOCUS_26490 201289 200330 gene locus_tag LOCUS_26500 201289 200330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083812.1 protein_id gnl|my_center|LOCUS_26500 203003 201414 gene locus_tag LOCUS_26510 203003 201414 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083813.1 protein_id gnl|my_center|LOCUS_26510 205165 203090 gene locus_tag LOCUS_26520 205165 203090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_26520 208546 205592 gene locus_tag LOCUS_26530 208546 205592 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088782.1 protein_id gnl|my_center|LOCUS_26530 208717 209922 gene locus_tag LOCUS_26540 208717 209922 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088780.1 protein_id gnl|my_center|LOCUS_26540 209924 210601 gene locus_tag LOCUS_26550 209924 210601 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463762.1 protein_id gnl|my_center|LOCUS_26550 210672 211736 gene locus_tag LOCUS_26560 210672 211736 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084062.1 protein_id gnl|my_center|LOCUS_26560 211768 213186 gene locus_tag LOCUS_26570 211768 213186 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057471.1 protein_id gnl|my_center|LOCUS_26570 213264 214175 gene locus_tag LOCUS_26580 213264 214175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 214305 215216 gene locus_tag LOCUS_26590 214305 215216 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965893.1 protein_id gnl|my_center|LOCUS_26590 215698 215219 gene locus_tag LOCUS_26600 215698 215219 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528044.1 protein_id gnl|my_center|LOCUS_26600 215826 216083 gene locus_tag LOCUS_26610 215826 216083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 216090 216860 gene locus_tag LOCUS_26620 216090 216860 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968523.1 protein_id gnl|my_center|LOCUS_26620 216923 217933 gene locus_tag LOCUS_26630 216923 217933 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968948.1 protein_id gnl|my_center|LOCUS_26630 218141 219367 gene locus_tag LOCUS_26640 218141 219367 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388321.1 protein_id gnl|my_center|LOCUS_26640 219477 221351 gene locus_tag LOCUS_26650 219477 221351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039367.1 protein_id gnl|my_center|LOCUS_26650 221348 222166 gene locus_tag LOCUS_26660 221348 222166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_26660 222166 222903 gene locus_tag LOCUS_26670 222166 222903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_26670 222985 225036 gene locus_tag LOCUS_26680 222985 225036 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_26680 225179 226894 gene locus_tag LOCUS_26690 225179 226894 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_26690 226882 227760 gene locus_tag LOCUS_26700 226882 227760 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_26700 227760 230513 gene locus_tag LOCUS_26710 227760 230513 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_26710 230887 232395 gene locus_tag LOCUS_26720 230887 232395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966263.1 protein_id gnl|my_center|LOCUS_26720 232392 232859 gene locus_tag LOCUS_26730 232392 232859 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004356487.1 protein_id gnl|my_center|LOCUS_26730 232864 233730 gene locus_tag LOCUS_26740 232864 233730 CDS product thiamine biosynthesis protein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528452.1 protein_id gnl|my_center|LOCUS_26740 233727 234308 gene locus_tag LOCUS_26750 233727 234308 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_26750 234305 234775 gene locus_tag LOCUS_26760 234305 234775 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390521.1 protein_id gnl|my_center|LOCUS_26760 234782 235915 gene locus_tag LOCUS_26770 234782 235915 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_26770 236073 236453 gene locus_tag LOCUS_26780 236073 236453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533622.1 protein_id gnl|my_center|LOCUS_26780 237096 236470 gene locus_tag LOCUS_26790 237096 236470 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_26790 237242 238243 gene locus_tag LOCUS_26800 237242 238243 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921554.1 protein_id gnl|my_center|LOCUS_26800 241110 238273 gene locus_tag LOCUS_26810 241110 238273 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085336.1 protein_id gnl|my_center|LOCUS_26810 241783 241259 gene locus_tag LOCUS_26820 241783 241259 CDS product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 protein_id gnl|my_center|LOCUS_26820 242501 241872 gene locus_tag LOCUS_26830 242501 241872 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_26830 243188 242580 gene locus_tag LOCUS_26840 243188 242580 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_26840 245356 243185 gene locus_tag LOCUS_26850 245356 243185 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_26850 245516 246292 gene locus_tag LOCUS_26860 245516 246292 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172650.1 protein_id gnl|my_center|LOCUS_26860 246356 247330 gene locus_tag LOCUS_26870 246356 247330 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971701.1 protein_id gnl|my_center|LOCUS_26870 248948 247362 gene locus_tag LOCUS_26880 248948 247362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_26880 249147 250709 gene locus_tag LOCUS_26890 249147 250709 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087816.1 protein_id gnl|my_center|LOCUS_26890 251314 250718 gene locus_tag LOCUS_26900 251314 250718 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_26900 251455 252630 gene locus_tag LOCUS_26910 251455 252630 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_26910 252956 253879 gene locus_tag LOCUS_26920 252956 253879 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_26920 253883 254863 gene locus_tag LOCUS_26930 253883 254863 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_26930 254863 255618 gene locus_tag LOCUS_26940 254863 255618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_26940 255615 256124 gene locus_tag LOCUS_26950 255615 256124 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088818.1 protein_id gnl|my_center|LOCUS_26950 256128 256832 gene locus_tag LOCUS_26960 256128 256832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_26960 256854 257936 gene locus_tag LOCUS_26970 256854 257936 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_26970 257983 258444 gene locus_tag LOCUS_26980 257983 258444 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_26980 258517 259587 gene locus_tag LOCUS_26990 258517 259587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 259584 260765 gene locus_tag LOCUS_27000 259584 260765 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920725.1 protein_id gnl|my_center|LOCUS_27000 261566 261120 gene locus_tag LOCUS_27010 261566 261120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 263211 261571 gene locus_tag LOCUS_27020 263211 261571 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966695.1 protein_id gnl|my_center|LOCUS_27020 264419 263211 gene locus_tag LOCUS_27030 264419 263211 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527981.1 protein_id gnl|my_center|LOCUS_27030 265253 264423 gene locus_tag LOCUS_27040 265253 264423 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_27040 266015 265263 gene locus_tag LOCUS_27050 266015 265263 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 protein_id gnl|my_center|LOCUS_27050 266263 268596 gene locus_tag LOCUS_27060 266263 268596 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_27060 269169 268597 gene locus_tag LOCUS_27070 269169 268597 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928883.1 protein_id gnl|my_center|LOCUS_27070 270554 269238 gene locus_tag LOCUS_27080 gene pncB 270554 269238 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970734.1 protein_id gnl|my_center|LOCUS_27080 271380 270685 gene locus_tag LOCUS_27090 gene modB 271380 270685 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_27090 271593 272570 gene locus_tag LOCUS_27100 271593 272570 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 protein_id gnl|my_center|LOCUS_27100 272598 273053 gene locus_tag LOCUS_27110 272598 273053 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814615.1 protein_id gnl|my_center|LOCUS_27110 273067 274569 gene locus_tag LOCUS_27120 273067 274569 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089254.1 protein_id gnl|my_center|LOCUS_27120 276230 274608 gene locus_tag LOCUS_27130 276230 274608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389764.1 protein_id gnl|my_center|LOCUS_27130 277057 276227 gene locus_tag LOCUS_27140 277057 276227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389765.1 protein_id gnl|my_center|LOCUS_27140 278039 277062 gene locus_tag LOCUS_27150 278039 277062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389766.1 protein_id gnl|my_center|LOCUS_27150 279675 278074 gene locus_tag LOCUS_27160 279675 278074 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389767.1 protein_id gnl|my_center|LOCUS_27160 280652 279804 gene locus_tag LOCUS_27170 280652 279804 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085492.1 protein_id gnl|my_center|LOCUS_27170 280991 282331 gene locus_tag LOCUS_27180 280991 282331 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390624.1 protein_id gnl|my_center|LOCUS_27180 282344 282868 gene locus_tag LOCUS_27190 282344 282868 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820122.1 protein_id gnl|my_center|LOCUS_27190 282865 283194 gene locus_tag LOCUS_27200 282865 283194 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810016.1 protein_id gnl|my_center|LOCUS_27200 283406 284821 gene locus_tag LOCUS_27210 gene cimH 283406 284821 CDS product citrate/malate transporter CimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227271.1 protein_id gnl|my_center|LOCUS_27210 285835 284855 gene locus_tag LOCUS_27220 285835 284855 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_27220 287234 285909 gene locus_tag LOCUS_27230 287234 285909 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241248.1 protein_id gnl|my_center|LOCUS_27230 289010 287577 gene locus_tag LOCUS_27240 289010 287577 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_27240 290793 289135 gene locus_tag LOCUS_27250 290793 289135 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 protein_id gnl|my_center|LOCUS_27250 291769 290798 gene locus_tag LOCUS_27260 291769 290798 CDS product Bug family tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965054.1 protein_id gnl|my_center|LOCUS_27260 293551 291854 gene locus_tag LOCUS_27270 293551 291854 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_27270 294068 293562 gene locus_tag LOCUS_27280 gene hpaR 294068 293562 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085755.1 protein_id gnl|my_center|LOCUS_27280 294900 294076 gene locus_tag LOCUS_27290 gene hpaH 294900 294076 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085754.1 protein_id gnl|my_center|LOCUS_27290 295774 294905 gene locus_tag LOCUS_27300 295774 294905 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528546.1 protein_id gnl|my_center|LOCUS_27300 296768 295785 gene locus_tag LOCUS_27310 gene hpaD 296768 295785 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085751.1 protein_id gnl|my_center|LOCUS_27310 298336 296795 gene locus_tag LOCUS_27320 gene hpaE 298336 296795 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085752.1 protein_id gnl|my_center|LOCUS_27320 298754 298365 gene locus_tag LOCUS_27330 298754 298365 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085753.1 protein_id gnl|my_center|LOCUS_27330 299842 298871 gene locus_tag LOCUS_27340 299842 298871 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085091.1 protein_id gnl|my_center|LOCUS_27340 300760 299876 gene locus_tag LOCUS_27350 300760 299876 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812325.1 protein_id gnl|my_center|LOCUS_27350 301746 300772 gene locus_tag LOCUS_27360 301746 300772 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_27360 302655 301861 gene locus_tag LOCUS_27370 302655 301861 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965685.1 protein_id gnl|my_center|LOCUS_27370 302843 303538 gene locus_tag LOCUS_27380 302843 303538 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 protein_id gnl|my_center|LOCUS_27380 304476 303559 gene locus_tag LOCUS_27390 gene hemF 304476 303559 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175030.1 protein_id gnl|my_center|LOCUS_27390 305569 304583 gene locus_tag LOCUS_27400 305569 304583 CDS product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393015.1 protein_id gnl|my_center|LOCUS_27400 306722 305583 gene locus_tag LOCUS_27410 306722 305583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 308893 306800 gene locus_tag LOCUS_27420 308893 306800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_27420 309334 308969 gene locus_tag LOCUS_27430 309334 308969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 309505 309918 gene locus_tag LOCUS_27440 309505 309918 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243455.1 protein_id gnl|my_center|LOCUS_27440 310978 309935 gene locus_tag LOCUS_27450 310978 309935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 312245 311133 gene locus_tag LOCUS_27460 gene modC 312245 311133 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_27460 313073 312285 gene locus_tag LOCUS_27470 gene modA 313073 312285 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067036.1 protein_id gnl|my_center|LOCUS_27470 313293 314126 gene locus_tag LOCUS_27480 313293 314126 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532382.1 protein_id gnl|my_center|LOCUS_27480 314513 314202 gene locus_tag LOCUS_27490 314513 314202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 316777 314645 gene locus_tag LOCUS_27500 316777 314645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 317036 317497 gene locus_tag LOCUS_27510 317036 317497 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_27510 317576 318736 gene locus_tag LOCUS_27520 317576 318736 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 protein_id gnl|my_center|LOCUS_27520 318742 319827 gene locus_tag LOCUS_27530 318742 319827 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_27530 319824 320627 gene locus_tag LOCUS_27540 319824 320627 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_27540 320824 321879 gene locus_tag LOCUS_27550 gene hisC 320824 321879 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_27550 322923 321964 gene locus_tag LOCUS_27560 322923 321964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 324637 323066 gene locus_tag LOCUS_27570 324637 323066 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_27570 325670 324813 gene locus_tag LOCUS_27580 gene bla 325670 324813 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974796.1 protein_id gnl|my_center|LOCUS_27580 327364 325874 gene locus_tag LOCUS_27590 327364 325874 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_27590 327936 327472 gene locus_tag LOCUS_27600 327936 327472 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090566.1 protein_id gnl|my_center|LOCUS_27600 328326 329393 gene locus_tag LOCUS_27610 328326 329393 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_27610 329487 330005 gene locus_tag LOCUS_27620 329487 330005 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090564.1 protein_id gnl|my_center|LOCUS_27620 330010 331308 gene locus_tag LOCUS_27630 330010 331308 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_27630 331734 331372 gene locus_tag LOCUS_27640 331734 331372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 332922 331822 gene locus_tag LOCUS_27650 332922 331822 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969064.1 protein_id gnl|my_center|LOCUS_27650 334594 332948 gene locus_tag LOCUS_27660 334594 332948 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969063.1 protein_id gnl|my_center|LOCUS_27660 335067 334591 gene locus_tag LOCUS_27670 335067 334591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 336119 335481 gene locus_tag LOCUS_27680 336119 335481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 337041 336163 gene locus_tag LOCUS_27690 337041 336163 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_27690 337289 338008 gene locus_tag LOCUS_27700 337289 338008 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877138.1 protein_id gnl|my_center|LOCUS_27700 338886 338026 gene locus_tag LOCUS_27710 338886 338026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384741.1 protein_id gnl|my_center|LOCUS_27710 339839 338895 gene locus_tag LOCUS_27720 339839 338895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_27720 341524 339932 gene locus_tag LOCUS_27730 341524 339932 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_27730 342067 341609 gene locus_tag LOCUS_27740 342067 341609 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_27740 343050 342076 gene locus_tag LOCUS_27750 343050 342076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 344017 343031 gene locus_tag LOCUS_27760 344017 343031 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_27760 345045 344014 gene locus_tag LOCUS_27770 345045 344014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_27770 346165 345032 gene locus_tag LOCUS_27780 346165 345032 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_27780 347332 346418 gene locus_tag LOCUS_27790 347332 346418 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930748.1 protein_id gnl|my_center|LOCUS_27790 347964 347341 gene locus_tag LOCUS_27800 347964 347341 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197522.1 protein_id gnl|my_center|LOCUS_27800 348070 348990 gene locus_tag LOCUS_27810 348070 348990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090560.1 protein_id gnl|my_center|LOCUS_27810 349435 349031 gene locus_tag LOCUS_27820 349435 349031 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090502.1 protein_id gnl|my_center|LOCUS_27820 350687 349575 gene locus_tag LOCUS_27830 350687 349575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_27830 351494 350706 gene locus_tag LOCUS_27840 351494 350706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810041.1 protein_id gnl|my_center|LOCUS_27840 352303 351494 gene locus_tag LOCUS_27850 352303 351494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810039.1 protein_id gnl|my_center|LOCUS_27850 353973 352342 gene locus_tag LOCUS_27860 353973 352342 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926289.1 protein_id gnl|my_center|LOCUS_27860 355159 354041 gene locus_tag LOCUS_27870 355159 354041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820140.1 protein_id gnl|my_center|LOCUS_27870 355433 356143 gene locus_tag LOCUS_27880 355433 356143 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729444.1 protein_id gnl|my_center|LOCUS_27880 357348 356164 gene locus_tag LOCUS_27890 357348 356164 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061602.1 protein_id gnl|my_center|LOCUS_27890 358623 357409 gene locus_tag LOCUS_27900 358623 357409 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085402.1 protein_id gnl|my_center|LOCUS_27900 358781 359707 gene locus_tag LOCUS_27910 358781 359707 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 protein_id gnl|my_center|LOCUS_27910 359769 360056 gene locus_tag LOCUS_27920 359769 360056 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_27920 360053 360556 gene locus_tag LOCUS_27930 360053 360556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_27930 362224 360797 gene locus_tag LOCUS_27940 362224 360797 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_27940 362950 362375 gene locus_tag LOCUS_27950 362950 362375 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389795.1 protein_id gnl|my_center|LOCUS_27950 363094 364377 gene locus_tag LOCUS_27960 363094 364377 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391726.1 protein_id gnl|my_center|LOCUS_27960 365810 364470 gene locus_tag LOCUS_27970 365810 364470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104732.1 protein_id gnl|my_center|LOCUS_27970 366732 365896 gene locus_tag LOCUS_27980 366732 365896 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_27980 366921 367814 gene locus_tag LOCUS_27990 366921 367814 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_27990 369681 367816 gene locus_tag LOCUS_28000 369681 367816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109184.1 protein_id gnl|my_center|LOCUS_28000 369864 371222 gene locus_tag LOCUS_28010 369864 371222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921598.1 protein_id gnl|my_center|LOCUS_28010 371766 371936 gene locus_tag LOCUS_28020 371766 371936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 371982 373292 gene locus_tag LOCUS_28030 371982 373292 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_28030 375058 373310 gene locus_tag LOCUS_28040 375058 373310 CDS product SbmA/BacA-like family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384110.1 protein_id gnl|my_center|LOCUS_28040 375823 375098 gene locus_tag LOCUS_28050 375823 375098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 378228 375925 gene locus_tag LOCUS_28060 378228 375925 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537673.1 protein_id gnl|my_center|LOCUS_28060 378788 380179 gene locus_tag LOCUS_28070 gene fumC 378788 380179 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 protein_id gnl|my_center|LOCUS_28070 381168 380665 gene locus_tag LOCUS_28080 381168 380665 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038378.1 protein_id gnl|my_center|LOCUS_28080 381685 381275 gene locus_tag LOCUS_28090 381685 381275 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038379.1 protein_id gnl|my_center|LOCUS_28090 383322 381724 gene locus_tag LOCUS_28100 383322 381724 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_28100 384161 385855 gene locus_tag LOCUS_28110 384161 385855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 385927 386277 gene locus_tag LOCUS_28120 385927 386277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 386585 387694 gene locus_tag LOCUS_28130 386585 387694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 388656 387727 gene locus_tag LOCUS_28140 388656 387727 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_28140 389869 388709 gene locus_tag LOCUS_28150 389869 388709 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929834.1 protein_id gnl|my_center|LOCUS_28150 390112 391434 gene locus_tag LOCUS_28160 390112 391434 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085936.1 protein_id gnl|my_center|LOCUS_28160 393896 391707 gene locus_tag LOCUS_28170 393896 391707 CDS product N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086709.1 protein_id gnl|my_center|LOCUS_28170 394668 393958 gene locus_tag LOCUS_28180 394668 393958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 protein_id gnl|my_center|LOCUS_28180 395416 394658 gene locus_tag LOCUS_28190 395416 394658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_28190 396444 395413 gene locus_tag LOCUS_28200 396444 395413 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence07 371 538 gene locus_tag LOCUS_28210 371 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 611 1351 gene locus_tag LOCUS_28220 611 1351 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252482.1 protein_id gnl|my_center|LOCUS_28220 1446 1802 gene locus_tag LOCUS_28230 1446 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1947 2519 gene locus_tag LOCUS_28240 1947 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3440 2808 gene locus_tag LOCUS_28250 3440 2808 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_28250 3611 4312 gene locus_tag LOCUS_28260 3611 4312 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_28260 4902 5864 gene locus_tag LOCUS_28270 4902 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 6184 8163 gene locus_tag LOCUS_28280 6184 8163 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921615.1 protein_id gnl|my_center|LOCUS_28280 12352 8588 gene locus_tag LOCUS_28290 gene metH 12352 8588 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972100.1 protein_id gnl|my_center|LOCUS_28290 13337 12417 gene locus_tag LOCUS_28300 gene metF 13337 12417 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530934.1 protein_id gnl|my_center|LOCUS_28300 14371 13337 gene locus_tag LOCUS_28310 14371 13337 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328973.1 protein_id gnl|my_center|LOCUS_28310 14568 15755 gene locus_tag LOCUS_28320 14568 15755 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_28320 16032 16649 gene locus_tag LOCUS_28330 16032 16649 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533269.1 protein_id gnl|my_center|LOCUS_28330 16646 17212 gene locus_tag LOCUS_28340 16646 17212 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973984.1 protein_id gnl|my_center|LOCUS_28340 20185 17615 gene locus_tag LOCUS_28350 20185 17615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 21033 20518 gene locus_tag LOCUS_28360 21033 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 22365 21517 gene locus_tag LOCUS_28370 22365 21517 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 protein_id gnl|my_center|LOCUS_28370 23082 22468 gene locus_tag LOCUS_28380 23082 22468 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967896.1 protein_id gnl|my_center|LOCUS_28380 23387 25078 gene locus_tag LOCUS_28390 23387 25078 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974851.1 protein_id gnl|my_center|LOCUS_28390 25175 25861 gene locus_tag LOCUS_28400 25175 25861 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_28400 26262 25858 gene locus_tag LOCUS_28410 26262 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 26418 27137 gene locus_tag LOCUS_28420 26418 27137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 27653 27171 gene locus_tag LOCUS_28430 27653 27171 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_28430 28493 27783 gene locus_tag LOCUS_28440 28493 27783 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920906.1 protein_id gnl|my_center|LOCUS_28440 28620 29057 gene locus_tag LOCUS_28450 28620 29057 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529399.1 protein_id gnl|my_center|LOCUS_28450 29219 29641 gene locus_tag LOCUS_28460 29219 29641 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_28460 29944 30714 gene locus_tag LOCUS_28470 29944 30714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 30769 30957 gene locus_tag LOCUS_28480 30769 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 31116 32063 gene locus_tag LOCUS_28490 31116 32063 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085322.1 protein_id gnl|my_center|LOCUS_28490 32128 32634 gene locus_tag LOCUS_28500 32128 32634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 32794 33261 gene locus_tag LOCUS_28510 32794 33261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 33280 33756 gene locus_tag LOCUS_28520 33280 33756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 33920 36022 gene locus_tag LOCUS_28530 gene glyS 33920 36022 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085323.1 protein_id gnl|my_center|LOCUS_28530 37261 36341 gene locus_tag LOCUS_28540 37261 36341 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966538.1 protein_id gnl|my_center|LOCUS_28540 38324 37362 gene locus_tag LOCUS_28550 38324 37362 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_28550 38489 39211 gene locus_tag LOCUS_28560 38489 39211 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808119.1 protein_id gnl|my_center|LOCUS_28560 39420 39764 gene locus_tag LOCUS_28570 39420 39764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 39770 40057 gene locus_tag LOCUS_28580 39770 40057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 41090 40275 gene locus_tag LOCUS_28590 41090 40275 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085320.1 protein_id gnl|my_center|LOCUS_28590 41370 41134 gene locus_tag LOCUS_28600 41370 41134 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313100.1 protein_id gnl|my_center|LOCUS_28600 41456 42487 gene locus_tag LOCUS_28610 41456 42487 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085318.1 protein_id gnl|my_center|LOCUS_28610 42491 43228 gene locus_tag LOCUS_28620 gene queC 42491 43228 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174058.1 protein_id gnl|my_center|LOCUS_28620 44381 43491 gene locus_tag LOCUS_28630 44381 43491 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965922.1 protein_id gnl|my_center|LOCUS_28630 46244 44481 gene locus_tag LOCUS_28640 46244 44481 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_28640 46530 47456 gene locus_tag LOCUS_28650 gene prmB 46530 47456 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090207.1 protein_id gnl|my_center|LOCUS_28650 48209 47706 gene locus_tag LOCUS_28660 48209 47706 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528792.1 protein_id gnl|my_center|LOCUS_28660 49872 48220 gene locus_tag LOCUS_28670 gene ettA 49872 48220 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089425.1 protein_id gnl|my_center|LOCUS_28670 50052 50423 gene locus_tag LOCUS_28680 50052 50423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 50458 51732 gene locus_tag LOCUS_28690 50458 51732 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919272.1 protein_id gnl|my_center|LOCUS_28690 52989 52015 gene locus_tag LOCUS_28700 52989 52015 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087291.1 protein_id gnl|my_center|LOCUS_28700 54590 53067 gene locus_tag LOCUS_28710 54590 53067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090658.1 protein_id gnl|my_center|LOCUS_28710 55351 54587 gene locus_tag LOCUS_28720 55351 54587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173716.1 protein_id gnl|my_center|LOCUS_28720 56767 55496 gene locus_tag LOCUS_28730 56767 55496 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922082.1 protein_id gnl|my_center|LOCUS_28730 56874 57593 gene locus_tag LOCUS_28740 56874 57593 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177082959.1 protein_id gnl|my_center|LOCUS_28740 57680 57988 gene locus_tag LOCUS_28750 57680 57988 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173644.1 protein_id gnl|my_center|LOCUS_28750 58118 58945 gene locus_tag LOCUS_28760 58118 58945 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090862.1 protein_id gnl|my_center|LOCUS_28760 62518 59252 gene locus_tag LOCUS_28770 62518 59252 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921044.1 protein_id gnl|my_center|LOCUS_28770 64062 62515 gene locus_tag LOCUS_28780 64062 62515 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921433.1 protein_id gnl|my_center|LOCUS_28780 64765 63962 gene locus_tag LOCUS_28790 64765 63962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085808.1 protein_id gnl|my_center|LOCUS_28790 65090 67666 gene locus_tag LOCUS_28800 65090 67666 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966463.1 protein_id gnl|my_center|LOCUS_28800 68484 67717 gene locus_tag LOCUS_28810 68484 67717 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198168.1 protein_id gnl|my_center|LOCUS_28810 69789 68623 gene locus_tag LOCUS_28820 69789 68623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 70817 69789 gene locus_tag LOCUS_28830 70817 69789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 71401 70964 gene locus_tag LOCUS_28840 71401 70964 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532871.1 protein_id gnl|my_center|LOCUS_28840 72981 71464 gene locus_tag LOCUS_28850 72981 71464 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 protein_id gnl|my_center|LOCUS_28850 74132 73158 gene locus_tag LOCUS_28860 74132 73158 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165113428.1 protein_id gnl|my_center|LOCUS_28860 74402 76354 gene locus_tag LOCUS_28870 74402 76354 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969665.1 protein_id gnl|my_center|LOCUS_28870 76763 76374 gene locus_tag LOCUS_28880 76763 76374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 77082 78884 gene locus_tag LOCUS_28890 77082 78884 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974115.1 protein_id gnl|my_center|LOCUS_28890 79776 78952 gene locus_tag LOCUS_28900 79776 78952 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174730.1 protein_id gnl|my_center|LOCUS_28900 80699 79773 gene locus_tag LOCUS_28910 80699 79773 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085515.1 protein_id gnl|my_center|LOCUS_28910 82006 80711 gene locus_tag LOCUS_28920 82006 80711 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832539.1 protein_id gnl|my_center|LOCUS_28920 82315 83574 gene locus_tag LOCUS_28930 82315 83574 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_28930 83571 87038 gene locus_tag LOCUS_28940 83571 87038 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_28940 85432 85343 gene locus_tag LOCUS_t00220 85432 85343 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 87170 87430 gene locus_tag LOCUS_28950 87170 87430 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529822.1 protein_id gnl|my_center|LOCUS_28950 88314 87577 gene locus_tag LOCUS_28960 88314 87577 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_28960 89415 88528 gene locus_tag LOCUS_28970 89415 88528 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919495.1 protein_id gnl|my_center|LOCUS_28970 89850 90938 gene locus_tag LOCUS_28980 89850 90938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_28980 90938 91807 gene locus_tag LOCUS_28990 90938 91807 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064168.1 protein_id gnl|my_center|LOCUS_28990 91820 92614 gene locus_tag LOCUS_29000 91820 92614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810041.1 protein_id gnl|my_center|LOCUS_29000 92648 93772 gene locus_tag LOCUS_29010 92648 93772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930640.1 protein_id gnl|my_center|LOCUS_29010 93844 94767 gene locus_tag LOCUS_29020 93844 94767 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809536.1 protein_id gnl|my_center|LOCUS_29020 95240 96922 gene locus_tag LOCUS_29030 95240 96922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 97655 96936 gene locus_tag LOCUS_29040 97655 96936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525180.1 protein_id gnl|my_center|LOCUS_29040 98452 97661 gene locus_tag LOCUS_29050 98452 97661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_29050 99459 98449 gene locus_tag LOCUS_29060 99459 98449 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253118.1 protein_id gnl|my_center|LOCUS_29060 100343 99456 gene locus_tag LOCUS_29070 100343 99456 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_29070 101560 100418 gene locus_tag LOCUS_29080 101560 100418 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_29080 102941 101718 gene locus_tag LOCUS_29090 102941 101718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 103563 103036 gene locus_tag LOCUS_29100 103563 103036 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088836.1 protein_id gnl|my_center|LOCUS_29100 103695 104633 gene locus_tag LOCUS_29110 103695 104633 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141557.1 protein_id gnl|my_center|LOCUS_29110 104877 105644 gene locus_tag LOCUS_29120 104877 105644 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175884.1 protein_id gnl|my_center|LOCUS_29120 106726 105713 gene locus_tag LOCUS_29130 106726 105713 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_29130 107954 106743 gene locus_tag LOCUS_29140 107954 106743 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_29140 108081 108779 gene locus_tag LOCUS_29150 108081 108779 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_29150 109019 110770 gene locus_tag LOCUS_29160 109019 110770 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269421.1 protein_id gnl|my_center|LOCUS_29160 110782 112119 gene locus_tag LOCUS_29170 110782 112119 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739694.1 protein_id gnl|my_center|LOCUS_29170 113398 112361 gene locus_tag LOCUS_29180 113398 112361 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_29180 113631 114482 gene locus_tag LOCUS_29190 113631 114482 CDS product mesaconyl-C(4)-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256090.1 protein_id gnl|my_center|LOCUS_29190 116063 114858 gene locus_tag LOCUS_29200 116063 114858 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_29200 117536 116076 gene locus_tag LOCUS_29210 117536 116076 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_29210 118467 117547 gene locus_tag LOCUS_29220 118467 117547 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085741.1 protein_id gnl|my_center|LOCUS_29220 118614 119756 gene locus_tag LOCUS_29230 118614 119756 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_29230 120012 119725 gene locus_tag LOCUS_29240 120012 119725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 119893 121053 gene locus_tag LOCUS_29250 119893 121053 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_29250 122211 121597 gene locus_tag LOCUS_29260 122211 121597 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_29260 122897 122208 gene locus_tag LOCUS_29270 122897 122208 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088353.1 protein_id gnl|my_center|LOCUS_29270 124398 123370 gene locus_tag LOCUS_29280 124398 123370 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807939.1 protein_id gnl|my_center|LOCUS_29280 125266 124400 gene locus_tag LOCUS_29290 125266 124400 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_29290 125985 125281 gene locus_tag LOCUS_29300 125985 125281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_29300 126697 125978 gene locus_tag LOCUS_29310 126697 125978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_29310 128051 126765 gene locus_tag LOCUS_29320 128051 126765 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_29320 129145 128048 gene locus_tag LOCUS_29330 129145 128048 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_29330 129412 130800 gene locus_tag LOCUS_29340 129412 130800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_29340 131299 130805 gene locus_tag LOCUS_29350 131299 130805 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527880.1 protein_id gnl|my_center|LOCUS_29350 131468 132073 gene locus_tag LOCUS_29360 131468 132073 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_29360 133219 132089 gene locus_tag LOCUS_29370 133219 132089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 134374 133514 gene locus_tag LOCUS_29380 134374 133514 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040692.1 protein_id gnl|my_center|LOCUS_29380 134666 135712 gene locus_tag LOCUS_29390 134666 135712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 136137 135784 gene locus_tag LOCUS_29400 136137 135784 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530023.1 protein_id gnl|my_center|LOCUS_29400 136198 136497 gene locus_tag LOCUS_29410 136198 136497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 137980 136445 gene locus_tag LOCUS_29420 137980 136445 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_29420 139584 138028 gene locus_tag LOCUS_29430 139584 138028 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_29430 139740 140525 gene locus_tag LOCUS_29440 139740 140525 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817938.1 protein_id gnl|my_center|LOCUS_29440 140571 141812 gene locus_tag LOCUS_29450 140571 141812 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_29450 141843 143081 gene locus_tag LOCUS_29460 141843 143081 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_29460 143111 144343 gene locus_tag LOCUS_29470 143111 144343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 144505 145725 gene locus_tag LOCUS_29480 144505 145725 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674031.1 protein_id gnl|my_center|LOCUS_29480 145845 146558 gene locus_tag LOCUS_29490 145845 146558 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090522.1 protein_id gnl|my_center|LOCUS_29490 147097 147252 gene locus_tag LOCUS_29500 147097 147252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 147294 147557 gene locus_tag LOCUS_29510 147294 147557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 147582 147719 gene locus_tag LOCUS_29520 147582 147719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 148022 147774 gene locus_tag LOCUS_29530 148022 147774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920516.1 protein_id gnl|my_center|LOCUS_29530 148407 148120 gene locus_tag LOCUS_29540 148407 148120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083001.1 protein_id gnl|my_center|LOCUS_29540 149161 150786 gene locus_tag LOCUS_29550 gene groL 149161 150786 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530534.1 protein_id gnl|my_center|LOCUS_29550 150893 151171 gene locus_tag LOCUS_29560 150893 151171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 151235 152092 gene locus_tag LOCUS_29570 151235 152092 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_29570 152225 152962 gene locus_tag LOCUS_29580 152225 152962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 153238 152996 gene locus_tag LOCUS_29590 153238 152996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 153727 153383 gene locus_tag LOCUS_29600 153727 153383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967064.1 protein_id gnl|my_center|LOCUS_29600 155230 153932 gene locus_tag LOCUS_29610 155230 153932 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063785.1 protein_id gnl|my_center|LOCUS_29610 155981 155244 gene locus_tag LOCUS_29620 155981 155244 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085014.1 protein_id gnl|my_center|LOCUS_29620 156639 155986 gene locus_tag LOCUS_29630 156639 155986 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085013.1 protein_id gnl|my_center|LOCUS_29630 157490 156732 gene locus_tag LOCUS_29640 157490 156732 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085012.1 protein_id gnl|my_center|LOCUS_29640 157620 158210 gene locus_tag LOCUS_29650 157620 158210 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966513.1 protein_id gnl|my_center|LOCUS_29650 158612 158271 gene locus_tag LOCUS_29660 158612 158271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 158562 159149 gene locus_tag LOCUS_29670 158562 159149 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085032.1 protein_id gnl|my_center|LOCUS_29670 159146 159619 gene locus_tag LOCUS_29680 159146 159619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 159890 161017 gene locus_tag LOCUS_29690 159890 161017 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440462.1 protein_id gnl|my_center|LOCUS_29690 161121 161426 gene locus_tag LOCUS_29700 161121 161426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 161458 162315 gene locus_tag LOCUS_29710 161458 162315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 162637 163431 gene locus_tag LOCUS_29720 162637 163431 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925816.1 protein_id gnl|my_center|LOCUS_29720 163984 163466 gene locus_tag LOCUS_29730 163984 163466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000390.1 protein_id gnl|my_center|LOCUS_29730 164831 164211 gene locus_tag LOCUS_29740 164831 164211 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063713264.1 protein_id gnl|my_center|LOCUS_29740 166726 165083 gene locus_tag LOCUS_29750 166726 165083 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087315.1 protein_id gnl|my_center|LOCUS_29750 168383 166821 gene locus_tag LOCUS_29760 168383 166821 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_29760 168974 168708 gene locus_tag LOCUS_29770 168974 168708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 169205 170005 gene locus_tag LOCUS_29780 169205 170005 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_29780 170993 170016 gene locus_tag LOCUS_29790 170993 170016 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665688.1 protein_id gnl|my_center|LOCUS_29790 171065 172492 gene locus_tag LOCUS_29800 gene fadD2 171065 172492 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079983.1 protein_id gnl|my_center|LOCUS_29800 173938 172841 gene locus_tag LOCUS_29810 173938 172841 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091679.1 protein_id gnl|my_center|LOCUS_29810 174175 175089 gene locus_tag LOCUS_29820 174175 175089 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707685.1 protein_id gnl|my_center|LOCUS_29820 176012 175143 gene locus_tag LOCUS_29830 176012 175143 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192193.1 protein_id gnl|my_center|LOCUS_29830 176088 177275 gene locus_tag LOCUS_29840 176088 177275 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970397.1 protein_id gnl|my_center|LOCUS_29840 178297 177311 gene locus_tag LOCUS_29850 gene ftrA 178297 177311 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265949.1 protein_id gnl|my_center|LOCUS_29850 178389 178778 gene locus_tag LOCUS_29860 178389 178778 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265948.1 protein_id gnl|my_center|LOCUS_29860 180074 178818 gene locus_tag LOCUS_29870 180074 178818 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174520.1 protein_id gnl|my_center|LOCUS_29870 182389 180071 gene locus_tag LOCUS_29880 182389 180071 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064227.1 protein_id gnl|my_center|LOCUS_29880 182526 183488 gene locus_tag LOCUS_29890 182526 183488 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313724.1 protein_id gnl|my_center|LOCUS_29890 183574 185268 gene locus_tag LOCUS_29900 gene ggt 183574 185268 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976285.1 protein_id gnl|my_center|LOCUS_29900 185344 186921 gene locus_tag LOCUS_29910 185344 186921 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063957.1 protein_id gnl|my_center|LOCUS_29910 186934 187875 gene locus_tag LOCUS_29920 186934 187875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810637.1 protein_id gnl|my_center|LOCUS_29920 187889 188770 gene locus_tag LOCUS_29930 187889 188770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040088.1 protein_id gnl|my_center|LOCUS_29930 188767 190392 gene locus_tag LOCUS_29940 188767 190392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810641.1 protein_id gnl|my_center|LOCUS_29940 190644 191939 gene locus_tag LOCUS_29950 190644 191939 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806979.1 protein_id gnl|my_center|LOCUS_29950 192363 194885 gene locus_tag LOCUS_29960 192363 194885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 194882 195796 gene locus_tag LOCUS_29970 194882 195796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 195852 196622 gene locus_tag LOCUS_29980 195852 196622 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_29980 196740 197468 gene locus_tag LOCUS_29990 196740 197468 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_29990 198511 197630 gene locus_tag LOCUS_30000 198511 197630 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532208.1 protein_id gnl|my_center|LOCUS_30000 198608 199501 gene locus_tag LOCUS_30010 198608 199501 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268178.1 protein_id gnl|my_center|LOCUS_30010 199601 201094 gene locus_tag LOCUS_30020 199601 201094 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 protein_id gnl|my_center|LOCUS_30020 201550 201125 gene locus_tag LOCUS_30030 201550 201125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 202090 201560 gene locus_tag LOCUS_30040 202090 201560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 203369 202482 gene locus_tag LOCUS_30050 203369 202482 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393613.1 protein_id gnl|my_center|LOCUS_30050 203956 203546 gene locus_tag LOCUS_30060 203956 203546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 204213 203956 gene locus_tag LOCUS_30070 204213 203956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 204577 206025 gene locus_tag LOCUS_30080 204577 206025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 206946 206050 gene locus_tag LOCUS_30090 206946 206050 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112374.1 protein_id gnl|my_center|LOCUS_30090 207098 207889 gene locus_tag LOCUS_30100 207098 207889 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_30100 208587 207934 gene locus_tag LOCUS_30110 208587 207934 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395144.1 protein_id gnl|my_center|LOCUS_30110 209817 208597 gene locus_tag LOCUS_30120 209817 208597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241289.1 protein_id gnl|my_center|LOCUS_30120 211050 209923 gene locus_tag LOCUS_30130 211050 209923 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_30130 211259 212077 gene locus_tag LOCUS_30140 211259 212077 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252080.1 protein_id gnl|my_center|LOCUS_30140 212055 212372 gene locus_tag LOCUS_30150 212055 212372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395219.1 protein_id gnl|my_center|LOCUS_30150 212369 212785 gene locus_tag LOCUS_30160 212369 212785 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067708.1 protein_id gnl|my_center|LOCUS_30160 212954 213526 gene locus_tag LOCUS_30170 212954 213526 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972012.1 protein_id gnl|my_center|LOCUS_30170 214438 213893 gene locus_tag LOCUS_30180 214438 213893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 214665 215822 gene locus_tag LOCUS_30190 214665 215822 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_30190 216350 215913 gene locus_tag LOCUS_30200 216350 215913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 217284 216403 gene locus_tag LOCUS_30210 217284 216403 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970653.1 protein_id gnl|my_center|LOCUS_30210 217407 218396 gene locus_tag LOCUS_30220 217407 218396 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086910.1 protein_id gnl|my_center|LOCUS_30220 218572 219357 gene locus_tag LOCUS_30230 218572 219357 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_30230 219853 219380 gene locus_tag LOCUS_30240 219853 219380 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968639.1 protein_id gnl|my_center|LOCUS_30240 220502 219915 gene locus_tag LOCUS_30250 220502 219915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 220579 221493 gene locus_tag LOCUS_30260 220579 221493 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970176.1 protein_id gnl|my_center|LOCUS_30260 222691 221519 gene locus_tag LOCUS_30270 222691 221519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 224132 222705 gene locus_tag LOCUS_30280 224132 222705 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 protein_id gnl|my_center|LOCUS_30280 224239 225141 gene locus_tag LOCUS_30290 224239 225141 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445527.1 protein_id gnl|my_center|LOCUS_30290 225246 225728 gene locus_tag LOCUS_30300 225246 225728 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084025.1 protein_id gnl|my_center|LOCUS_30300 225806 226954 gene locus_tag LOCUS_30310 225806 226954 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223768.1 protein_id gnl|my_center|LOCUS_30310 227764 227021 gene locus_tag LOCUS_30320 227764 227021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 228288 227764 gene locus_tag LOCUS_30330 228288 227764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 229355 228423 gene locus_tag LOCUS_30340 229355 228423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 229541 230167 gene locus_tag LOCUS_30350 229541 230167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 230216 231055 gene locus_tag LOCUS_30360 230216 231055 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_30360 232959 231115 gene locus_tag LOCUS_30370 gene batA 232959 231115 CDS product autotransporter BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550237.1 protein_id gnl|my_center|LOCUS_30370 234297 233341 gene locus_tag LOCUS_30380 234297 233341 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640538.1 protein_id gnl|my_center|LOCUS_30380 235338 234331 gene locus_tag LOCUS_30390 235338 234331 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086129.1 protein_id gnl|my_center|LOCUS_30390 236345 235335 gene locus_tag LOCUS_30400 236345 235335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_30400 237249 236350 gene locus_tag LOCUS_30410 237249 236350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 protein_id gnl|my_center|LOCUS_30410 238214 237273 gene locus_tag LOCUS_30420 238214 237273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_30420 239623 238199 gene locus_tag LOCUS_30430 239623 238199 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966044.1 protein_id gnl|my_center|LOCUS_30430 240171 239632 gene locus_tag LOCUS_30440 240171 239632 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206017071.1 protein_id gnl|my_center|LOCUS_30440 241837 240209 gene locus_tag LOCUS_30450 241837 240209 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_30450 242128 242823 gene locus_tag LOCUS_30460 242128 242823 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532480.1 protein_id gnl|my_center|LOCUS_30460 243617 243901 gene locus_tag LOCUS_30470 243617 243901 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_30470 243978 244247 gene locus_tag LOCUS_30480 243978 244247 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197243.1 protein_id gnl|my_center|LOCUS_30480 244334 244600 gene locus_tag LOCUS_30490 244334 244600 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_30490 244668 244931 gene locus_tag LOCUS_30500 244668 244931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 245026 245262 gene locus_tag LOCUS_30510 245026 245262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 245259 245882 gene locus_tag LOCUS_30520 245259 245882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 245927 246277 gene locus_tag LOCUS_30530 245927 246277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 246318 247418 gene locus_tag LOCUS_30540 246318 247418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 247418 247816 gene locus_tag LOCUS_30550 247418 247816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 247925 251590 gene locus_tag LOCUS_30560 247925 251590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 253345 251675 gene locus_tag LOCUS_30570 253345 251675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 253848 255143 gene locus_tag LOCUS_30580 253848 255143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_30580 256131 255208 gene locus_tag LOCUS_30590 gene cysK 256131 255208 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_30590 256563 256252 gene locus_tag LOCUS_30600 256563 256252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 257324 256659 gene locus_tag LOCUS_30610 257324 256659 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_30610 257755 265218 gene locus_tag LOCUS_30620 257755 265218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 265666 265244 gene locus_tag LOCUS_30630 265666 265244 CDS product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527247.1 protein_id gnl|my_center|LOCUS_30630 267461 265863 gene locus_tag LOCUS_30640 gene ggtA 267461 265863 CDS product gamma-glutamyltranspeptidase GgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403933.1 protein_id gnl|my_center|LOCUS_30640 268011 267577 gene locus_tag LOCUS_30650 268011 267577 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479700.1 protein_id gnl|my_center|LOCUS_30650 269329 268085 gene locus_tag LOCUS_30660 269329 268085 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_30660 270794 269388 gene locus_tag LOCUS_30670 270794 269388 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_30670 271017 271910 gene locus_tag LOCUS_30680 gene gcvA 271017 271910 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 protein_id gnl|my_center|LOCUS_30680 271948 272601 gene locus_tag LOCUS_30690 271948 272601 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036512.1 protein_id gnl|my_center|LOCUS_30690 272802 273155 gene locus_tag LOCUS_30700 272802 273155 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968490.1 protein_id gnl|my_center|LOCUS_30700 273499 273152 gene locus_tag LOCUS_30710 273499 273152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 274204 273524 gene locus_tag LOCUS_30720 274204 273524 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_30720 274750 274211 gene locus_tag LOCUS_30730 274750 274211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 274798 275628 gene locus_tag LOCUS_30740 274798 275628 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553463.1 protein_id gnl|my_center|LOCUS_30740 275842 276798 gene locus_tag LOCUS_30750 275842 276798 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196382.1 protein_id gnl|my_center|LOCUS_30750 277276 276782 gene locus_tag LOCUS_30760 277276 276782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 277955 277365 gene locus_tag LOCUS_30770 277955 277365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 278111 278689 gene locus_tag LOCUS_30780 278111 278689 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086823.1 protein_id gnl|my_center|LOCUS_30780 278830 279477 gene locus_tag LOCUS_30790 278830 279477 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_30790 279655 279966 gene locus_tag LOCUS_30800 279655 279966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 279977 281353 gene locus_tag LOCUS_30810 gene der 279977 281353 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_30810 282333 281722 gene locus_tag LOCUS_30820 282333 281722 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088577.1 protein_id gnl|my_center|LOCUS_30820 282440 282817 gene locus_tag LOCUS_30830 282440 282817 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088578.1 protein_id gnl|my_center|LOCUS_30830 283737 282994 gene locus_tag LOCUS_30840 283737 282994 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086835.1 protein_id gnl|my_center|LOCUS_30840 285057 283750 gene locus_tag LOCUS_30850 gene purF 285057 283750 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 protein_id gnl|my_center|LOCUS_30850 284944 285267 gene locus_tag LOCUS_30860 284944 285267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 286130 285507 gene locus_tag LOCUS_30870 286130 285507 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086837.1 protein_id gnl|my_center|LOCUS_30870 286448 286750 gene locus_tag LOCUS_30880 286448 286750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 288169 286754 gene locus_tag LOCUS_30890 gene radA 288169 286754 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086838.1 protein_id gnl|my_center|LOCUS_30890 289308 288190 gene locus_tag LOCUS_30900 gene alr 289308 288190 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967543.1 protein_id gnl|my_center|LOCUS_30900 290814 289324 gene locus_tag LOCUS_30910 290814 289324 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086847.1 protein_id gnl|my_center|LOCUS_30910 291159 292001 gene locus_tag LOCUS_30920 291159 292001 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088049.1 protein_id gnl|my_center|LOCUS_30920 292710 292144 gene locus_tag LOCUS_30930 gene rplI 292710 292144 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338021.1 protein_id gnl|my_center|LOCUS_30930 293691 292741 gene locus_tag LOCUS_30940 293691 292741 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_30940 294137 293880 gene locus_tag LOCUS_30950 gene rpsR 294137 293880 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003496832.1 protein_id gnl|my_center|LOCUS_30950 294661 294140 gene locus_tag LOCUS_30960 294661 294140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 296366 295134 gene locus_tag LOCUS_30970 gene zigA 296366 295134 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972825.1 protein_id gnl|my_center|LOCUS_30970 297572 296745 gene locus_tag LOCUS_30980 297572 296745 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_30980 297724 298599 gene locus_tag LOCUS_30990 297724 298599 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084260.1 protein_id gnl|my_center|LOCUS_30990 298700 299644 gene locus_tag LOCUS_31000 gene fabD 298700 299644 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086857.1 protein_id gnl|my_center|LOCUS_31000 299656 300393 gene locus_tag LOCUS_31010 gene fabG 299656 300393 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086858.1 protein_id gnl|my_center|LOCUS_31010 300593 300832 gene locus_tag LOCUS_31020 300593 300832 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003502080.1 protein_id gnl|my_center|LOCUS_31020 300943 302205 gene locus_tag LOCUS_31030 gene fabF 300943 302205 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974945.1 protein_id gnl|my_center|LOCUS_31030 302396 303610 gene locus_tag LOCUS_31040 gene mltG 302396 303610 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086860.1 protein_id gnl|my_center|LOCUS_31040 303763 304635 gene locus_tag LOCUS_31050 303763 304635 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 protein_id gnl|my_center|LOCUS_31050 304635 305324 gene locus_tag LOCUS_31060 gene gmk 304635 305324 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 protein_id gnl|my_center|LOCUS_31060 306452 305607 gene locus_tag LOCUS_31070 gene rsmA 306452 305607 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086876.1 protein_id gnl|my_center|LOCUS_31070 307496 306477 gene locus_tag LOCUS_31080 gene pdxA 307496 306477 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086877.1 protein_id gnl|my_center|LOCUS_31080 308527 307583 gene locus_tag LOCUS_31090 308527 307583 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171094.1 protein_id gnl|my_center|LOCUS_31090 311267 308610 gene locus_tag LOCUS_31100 311267 308610 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921454.1 protein_id gnl|my_center|LOCUS_31100 312352 311267 gene locus_tag LOCUS_31110 gene lptG 312352 311267 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966780.1 protein_id gnl|my_center|LOCUS_31110 313527 312349 gene locus_tag LOCUS_31120 gene lptF 313527 312349 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086881.1 protein_id gnl|my_center|LOCUS_31120 313708 315213 gene locus_tag LOCUS_31130 313708 315213 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171097.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence08 6278 327 gene locus_tag LOCUS_31140 gene cdrA 6278 327 CDS product two-partner secretion system adhesin CdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148161.1 protein_id gnl|my_center|LOCUS_31140 7277 6507 gene locus_tag LOCUS_31150 7277 6507 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966886.1 protein_id gnl|my_center|LOCUS_31150 8652 7471 gene locus_tag LOCUS_31160 8652 7471 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705317.1 protein_id gnl|my_center|LOCUS_31160 9452 8673 gene locus_tag LOCUS_31170 gene hpaI 9452 8673 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785061.1 protein_id gnl|my_center|LOCUS_31170 10281 9481 gene locus_tag LOCUS_31180 10281 9481 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086662.1 protein_id gnl|my_center|LOCUS_31180 11001 10297 gene locus_tag LOCUS_31190 11001 10297 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419408.1 protein_id gnl|my_center|LOCUS_31190 12084 11011 gene locus_tag LOCUS_31200 12084 11011 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807533.1 protein_id gnl|my_center|LOCUS_31200 12974 12129 gene locus_tag LOCUS_31210 12974 12129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809017.1 protein_id gnl|my_center|LOCUS_31210 13798 12971 gene locus_tag LOCUS_31220 13798 12971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818996.1 protein_id gnl|my_center|LOCUS_31220 14731 14363 gene locus_tag LOCUS_31230 14731 14363 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967545.1 protein_id gnl|my_center|LOCUS_31230 15480 14824 gene locus_tag LOCUS_31240 15480 14824 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372679.1 protein_id gnl|my_center|LOCUS_31240 17011 15497 gene locus_tag LOCUS_31250 17011 15497 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_31250 18050 17028 gene locus_tag LOCUS_31260 18050 17028 CDS product s-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679362.1 protein_id gnl|my_center|LOCUS_31260 18907 18059 gene locus_tag LOCUS_31270 gene udp 18907 18059 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_31270 19809 18964 gene locus_tag LOCUS_31280 19809 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 20627 19806 gene locus_tag LOCUS_31290 20627 19806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626598.1 protein_id gnl|my_center|LOCUS_31290 21615 20605 gene locus_tag LOCUS_31300 21615 20605 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086100.1 protein_id gnl|my_center|LOCUS_31300 23307 21811 gene locus_tag LOCUS_31310 23307 21811 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_31310 23840 23355 gene locus_tag LOCUS_31320 23840 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965306.1 protein_id gnl|my_center|LOCUS_31320 24126 24767 gene locus_tag LOCUS_31330 24126 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 24877 25641 gene locus_tag LOCUS_31340 24877 25641 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_31340 26075 25653 gene locus_tag LOCUS_31350 26075 25653 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140245.1 protein_id gnl|my_center|LOCUS_31350 26121 27035 gene locus_tag LOCUS_31360 26121 27035 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235885780.1 protein_id gnl|my_center|LOCUS_31360 27126 29024 gene locus_tag LOCUS_31370 gene htpG 27126 29024 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391716.1 protein_id gnl|my_center|LOCUS_31370 29907 29050 gene locus_tag LOCUS_31380 29907 29050 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_31380 31618 30359 gene locus_tag LOCUS_31390 31618 30359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 protein_id gnl|my_center|LOCUS_31390 33079 31757 gene locus_tag LOCUS_31400 33079 31757 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330111.1 protein_id gnl|my_center|LOCUS_31400 33760 33092 gene locus_tag LOCUS_31410 33760 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665896.1 protein_id gnl|my_center|LOCUS_31410 34846 33905 gene locus_tag LOCUS_31420 gene dctP 34846 33905 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810897.1 protein_id gnl|my_center|LOCUS_31420 36436 35084 gene locus_tag LOCUS_31430 36436 35084 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083711.1 protein_id gnl|my_center|LOCUS_31430 36873 38114 gene locus_tag LOCUS_31440 36873 38114 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976085.1 protein_id gnl|my_center|LOCUS_31440 38207 39169 gene locus_tag LOCUS_31450 38207 39169 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976084.1 protein_id gnl|my_center|LOCUS_31450 40086 39166 gene locus_tag LOCUS_31460 40086 39166 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811101.1 protein_id gnl|my_center|LOCUS_31460 41275 40313 gene locus_tag LOCUS_31470 41275 40313 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972130.1 protein_id gnl|my_center|LOCUS_31470 41368 42306 gene locus_tag LOCUS_31480 41368 42306 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_31480 42720 42535 gene locus_tag LOCUS_31490 42720 42535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 42937 43785 gene locus_tag LOCUS_31500 42937 43785 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088049.1 protein_id gnl|my_center|LOCUS_31500 44054 44329 gene locus_tag LOCUS_31510 44054 44329 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918778.1 protein_id gnl|my_center|LOCUS_31510 44526 45407 gene locus_tag LOCUS_31520 44526 45407 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396441.1 protein_id gnl|my_center|LOCUS_31520 46265 45660 gene locus_tag LOCUS_31530 46265 45660 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086182.1 protein_id gnl|my_center|LOCUS_31530 47235 46273 gene locus_tag LOCUS_31540 47235 46273 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086181.1 protein_id gnl|my_center|LOCUS_31540 48932 47313 gene locus_tag LOCUS_31550 48932 47313 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063713265.1 protein_id gnl|my_center|LOCUS_31550 49132 50034 gene locus_tag LOCUS_31560 49132 50034 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086179.1 protein_id gnl|my_center|LOCUS_31560 50820 50083 gene locus_tag LOCUS_31570 50820 50083 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529132.1 protein_id gnl|my_center|LOCUS_31570 52178 50943 gene locus_tag LOCUS_31580 52178 50943 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967105.1 protein_id gnl|my_center|LOCUS_31580 52304 53230 gene locus_tag LOCUS_31590 52304 53230 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494093.1 protein_id gnl|my_center|LOCUS_31590 53404 54513 gene locus_tag LOCUS_31600 53404 54513 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397190.1 protein_id gnl|my_center|LOCUS_31600 54849 54523 gene locus_tag LOCUS_31610 54849 54523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529982.1 protein_id gnl|my_center|LOCUS_31610 54999 56384 gene locus_tag LOCUS_31620 54999 56384 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_31620 57631 56516 gene locus_tag LOCUS_31630 57631 56516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 58753 57785 gene locus_tag LOCUS_31640 58753 57785 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391115.1 protein_id gnl|my_center|LOCUS_31640 58891 59058 gene locus_tag LOCUS_31650 58891 59058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 59112 59375 gene locus_tag LOCUS_31660 59112 59375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 59525 60016 gene locus_tag LOCUS_31670 59525 60016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 60427 60038 gene locus_tag LOCUS_31680 60427 60038 CDS product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032808257.1 protein_id gnl|my_center|LOCUS_31680 62233 60587 gene locus_tag LOCUS_31690 gene groL 62233 60587 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087983.1 protein_id gnl|my_center|LOCUS_31690 63574 62984 gene locus_tag LOCUS_31700 63574 62984 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726810.1 protein_id gnl|my_center|LOCUS_31700 63749 64759 gene locus_tag LOCUS_31710 63749 64759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 65839 64811 gene locus_tag LOCUS_31720 65839 64811 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339375.1 protein_id gnl|my_center|LOCUS_31720 65943 66986 gene locus_tag LOCUS_31730 65943 66986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339376.1 protein_id gnl|my_center|LOCUS_31730 67024 68082 gene locus_tag LOCUS_31740 67024 68082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339377.1 protein_id gnl|my_center|LOCUS_31740 68088 68927 gene locus_tag LOCUS_31750 68088 68927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339378.1 protein_id gnl|my_center|LOCUS_31750 68924 69709 gene locus_tag LOCUS_31760 68924 69709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724379.1 protein_id gnl|my_center|LOCUS_31760 69738 70751 gene locus_tag LOCUS_31770 69738 70751 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339379.1 protein_id gnl|my_center|LOCUS_31770 70964 72511 gene locus_tag LOCUS_31780 70964 72511 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067364.1 protein_id gnl|my_center|LOCUS_31780 74049 72532 gene locus_tag LOCUS_31790 74049 72532 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_31790 74878 74087 gene locus_tag LOCUS_31800 74878 74087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384352.1 protein_id gnl|my_center|LOCUS_31800 75644 74865 gene locus_tag LOCUS_31810 75644 74865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_31810 76692 75697 gene locus_tag LOCUS_31820 76692 75697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 77760 76864 gene locus_tag LOCUS_31830 77760 76864 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 protein_id gnl|my_center|LOCUS_31830 78803 78132 gene locus_tag LOCUS_31840 78803 78132 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339331.1 protein_id gnl|my_center|LOCUS_31840 79481 78807 gene locus_tag LOCUS_31850 79481 78807 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339330.1 protein_id gnl|my_center|LOCUS_31850 80237 79500 gene locus_tag LOCUS_31860 80237 79500 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_31860 81168 80308 gene locus_tag LOCUS_31870 81168 80308 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339328.1 protein_id gnl|my_center|LOCUS_31870 81685 83115 gene locus_tag LOCUS_31880 81685 83115 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 protein_id gnl|my_center|LOCUS_31880 83105 84358 gene locus_tag LOCUS_31890 83105 84358 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 protein_id gnl|my_center|LOCUS_31890 84387 85322 gene locus_tag LOCUS_31900 84387 85322 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086114.1 protein_id gnl|my_center|LOCUS_31900 85858 85466 gene locus_tag LOCUS_31910 85858 85466 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_31910 86991 86014 gene locus_tag LOCUS_31920 86991 86014 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275492.1 protein_id gnl|my_center|LOCUS_31920 87738 87097 gene locus_tag LOCUS_31930 87738 87097 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207905.1 protein_id gnl|my_center|LOCUS_31930 88996 87893 gene locus_tag LOCUS_31940 88996 87893 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525171.1 protein_id gnl|my_center|LOCUS_31940 89078 89539 gene locus_tag LOCUS_31950 gene soxR 89078 89539 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969496.1 protein_id gnl|my_center|LOCUS_31950 89633 89938 gene locus_tag LOCUS_31960 89633 89938 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647290.1 protein_id gnl|my_center|LOCUS_31960 90816 89953 gene locus_tag LOCUS_31970 90816 89953 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 protein_id gnl|my_center|LOCUS_31970 90948 92351 gene locus_tag LOCUS_31980 90948 92351 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 protein_id gnl|my_center|LOCUS_31980 93158 92373 gene locus_tag LOCUS_31990 93158 92373 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_31990 93408 93187 gene locus_tag LOCUS_32000 93408 93187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 93456 94346 gene locus_tag LOCUS_32010 93456 94346 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085684.1 protein_id gnl|my_center|LOCUS_32010 94451 95218 gene locus_tag LOCUS_32020 94451 95218 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 protein_id gnl|my_center|LOCUS_32020 95716 95282 gene locus_tag LOCUS_32030 95716 95282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 95854 96660 gene locus_tag LOCUS_32040 95854 96660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 96903 97478 gene locus_tag LOCUS_32050 96903 97478 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966310.1 protein_id gnl|my_center|LOCUS_32050 97804 98013 gene locus_tag LOCUS_32060 97804 98013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 99069 98086 gene locus_tag LOCUS_32070 99069 98086 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931187.1 protein_id gnl|my_center|LOCUS_32070 99314 100549 gene locus_tag LOCUS_32080 99314 100549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 100835 101269 gene locus_tag LOCUS_32090 100835 101269 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_32090 101293 101706 gene locus_tag LOCUS_32100 101293 101706 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_32100 101807 103087 gene locus_tag LOCUS_32110 101807 103087 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_32110 103182 104246 gene locus_tag LOCUS_32120 103182 104246 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_32120 104431 105888 gene locus_tag LOCUS_32130 104431 105888 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 protein_id gnl|my_center|LOCUS_32130 107627 106329 gene locus_tag LOCUS_32140 107627 106329 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087901.1 protein_id gnl|my_center|LOCUS_32140 109985 107664 gene locus_tag LOCUS_32150 109985 107664 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087902.1 protein_id gnl|my_center|LOCUS_32150 111013 109982 gene locus_tag LOCUS_32160 111013 109982 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087903.1 protein_id gnl|my_center|LOCUS_32160 111461 111153 gene locus_tag LOCUS_32170 111461 111153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 111924 111712 gene locus_tag LOCUS_32180 111924 111712 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970295.1 protein_id gnl|my_center|LOCUS_32180 112308 113186 gene locus_tag LOCUS_32190 112308 113186 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390563.1 protein_id gnl|my_center|LOCUS_32190 113306 114688 gene locus_tag LOCUS_32200 113306 114688 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_32200 115633 114788 gene locus_tag LOCUS_32210 115633 114788 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 protein_id gnl|my_center|LOCUS_32210 116496 115630 gene locus_tag LOCUS_32220 116496 115630 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_32220 118072 116804 gene locus_tag LOCUS_32230 118072 116804 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_32230 118819 118178 gene locus_tag LOCUS_32240 118819 118178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 119011 119967 gene locus_tag LOCUS_32250 119011 119967 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 protein_id gnl|my_center|LOCUS_32250 120861 121229 gene locus_tag LOCUS_32260 120861 121229 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089906.1 protein_id gnl|my_center|LOCUS_32260 121226 122500 gene locus_tag LOCUS_32270 121226 122500 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529830.1 protein_id gnl|my_center|LOCUS_32270 122619 123029 gene locus_tag LOCUS_32280 122619 123029 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 protein_id gnl|my_center|LOCUS_32280 123056 123589 gene locus_tag LOCUS_32290 gene kdpF 123056 123589 CDS product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_32290 126113 123684 gene locus_tag LOCUS_32300 126113 123684 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 protein_id gnl|my_center|LOCUS_32300 126917 127846 gene locus_tag LOCUS_32310 126917 127846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_32310 129510 127849 gene locus_tag LOCUS_32320 129510 127849 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896053.1 protein_id gnl|my_center|LOCUS_32320 130252 129569 gene locus_tag LOCUS_32330 130252 129569 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812253.1 protein_id gnl|my_center|LOCUS_32330 130344 131375 gene locus_tag LOCUS_32340 130344 131375 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_32340 131372 133156 gene locus_tag LOCUS_32350 131372 133156 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_32350 133153 134286 gene locus_tag LOCUS_32360 133153 134286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_32360 134291 135409 gene locus_tag LOCUS_32370 134291 135409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_32370 135924 136373 gene locus_tag LOCUS_32380 135924 136373 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969810.1 protein_id gnl|my_center|LOCUS_32380 136389 137015 gene locus_tag LOCUS_32390 136389 137015 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531515.1 protein_id gnl|my_center|LOCUS_32390 138493 137423 gene locus_tag LOCUS_32400 138493 137423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969485.1 protein_id gnl|my_center|LOCUS_32400 139311 138493 gene locus_tag LOCUS_32410 139311 138493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975170.1 protein_id gnl|my_center|LOCUS_32410 140291 139311 gene locus_tag LOCUS_32420 140291 139311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969483.1 protein_id gnl|my_center|LOCUS_32420 141456 140359 gene locus_tag LOCUS_32430 141456 140359 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975172.1 protein_id gnl|my_center|LOCUS_32430 142631 141603 gene locus_tag LOCUS_32440 gene tdh 142631 141603 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564818.1 protein_id gnl|my_center|LOCUS_32440 143855 142659 gene locus_tag LOCUS_32450 143855 142659 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337442.1 protein_id gnl|my_center|LOCUS_32450 144507 143917 gene locus_tag LOCUS_32460 144507 143917 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_32460 144769 145848 gene locus_tag LOCUS_32470 144769 145848 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975174.1 protein_id gnl|my_center|LOCUS_32470 146177 146824 gene locus_tag LOCUS_32480 146177 146824 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_32480 146902 147996 gene locus_tag LOCUS_32490 gene dinB 146902 147996 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970234.1 protein_id gnl|my_center|LOCUS_32490 148261 149631 gene locus_tag LOCUS_32500 148261 149631 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811696.1 protein_id gnl|my_center|LOCUS_32500 149719 151419 gene locus_tag LOCUS_32510 149719 151419 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063768.1 protein_id gnl|my_center|LOCUS_32510 151474 153159 gene locus_tag LOCUS_32520 151474 153159 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086255.1 protein_id gnl|my_center|LOCUS_32520 155223 153184 gene locus_tag LOCUS_32530 155223 153184 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948595.1 protein_id gnl|my_center|LOCUS_32530 156919 155345 gene locus_tag LOCUS_32540 156919 155345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 158551 156977 gene locus_tag LOCUS_32550 158551 156977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 159113 158556 gene locus_tag LOCUS_32560 159113 158556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 160089 159403 gene locus_tag LOCUS_32570 160089 159403 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113042.1 protein_id gnl|my_center|LOCUS_32570 160445 161224 gene locus_tag LOCUS_32580 160445 161224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067356.1 protein_id gnl|my_center|LOCUS_32580 161221 162027 gene locus_tag LOCUS_32590 161221 162027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067355.1 protein_id gnl|my_center|LOCUS_32590 162038 162796 gene locus_tag LOCUS_32600 162038 162796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067353.1 protein_id gnl|my_center|LOCUS_32600 162793 163125 gene locus_tag LOCUS_32610 162793 163125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 163122 164192 gene locus_tag LOCUS_32620 163122 164192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 164616 164278 gene locus_tag LOCUS_32630 164616 164278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 164969 164805 gene locus_tag LOCUS_32640 164969 164805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 165855 165127 gene locus_tag LOCUS_32650 165855 165127 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919712.1 protein_id gnl|my_center|LOCUS_32650 166027 166539 gene locus_tag LOCUS_32660 166027 166539 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241885.1 protein_id gnl|my_center|LOCUS_32660 167723 166830 gene locus_tag LOCUS_32670 167723 166830 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767508.1 protein_id gnl|my_center|LOCUS_32670 167940 169103 gene locus_tag LOCUS_32680 167940 169103 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339264.1 protein_id gnl|my_center|LOCUS_32680 169990 169154 gene locus_tag LOCUS_32690 169990 169154 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_32690 170828 170001 gene locus_tag LOCUS_32700 170828 170001 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 protein_id gnl|my_center|LOCUS_32700 171723 170842 gene locus_tag LOCUS_32710 171723 170842 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_32710 173227 171929 gene locus_tag LOCUS_32720 173227 171929 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_32720 174313 173285 gene locus_tag LOCUS_32730 174313 173285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815923.1 protein_id gnl|my_center|LOCUS_32730 174982 174470 gene locus_tag LOCUS_32740 174982 174470 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_32740 175891 175043 gene locus_tag LOCUS_32750 175891 175043 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_32750 176098 177762 gene locus_tag LOCUS_32760 176098 177762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 177875 178507 gene locus_tag LOCUS_32770 177875 178507 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_32770 178981 178514 gene locus_tag LOCUS_32780 178981 178514 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965148.1 protein_id gnl|my_center|LOCUS_32780 179718 179050 gene locus_tag LOCUS_32790 179718 179050 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 protein_id gnl|my_center|LOCUS_32790 179833 180405 gene locus_tag LOCUS_32800 179833 180405 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971226.1 protein_id gnl|my_center|LOCUS_32800 180408 180773 gene locus_tag LOCUS_32810 180408 180773 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532154.1 protein_id gnl|my_center|LOCUS_32810 181754 180783 gene locus_tag LOCUS_32820 181754 180783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 182892 181933 gene locus_tag LOCUS_32830 182892 181933 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086660.1 protein_id gnl|my_center|LOCUS_32830 185603 182904 gene locus_tag LOCUS_32840 185603 182904 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 protein_id gnl|my_center|LOCUS_32840 186451 185600 gene locus_tag LOCUS_32850 186451 185600 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 protein_id gnl|my_center|LOCUS_32850 187610 186579 gene locus_tag LOCUS_32860 187610 186579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 188024 188686 gene locus_tag LOCUS_32870 188024 188686 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_32870 188978 188697 gene locus_tag LOCUS_32880 188978 188697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 189379 189005 gene locus_tag LOCUS_32890 189379 189005 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966245.1 protein_id gnl|my_center|LOCUS_32890 190126 189389 gene locus_tag LOCUS_32900 190126 189389 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 protein_id gnl|my_center|LOCUS_32900 190861 190154 gene locus_tag LOCUS_32910 190861 190154 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086564.1 protein_id gnl|my_center|LOCUS_32910 192669 190858 gene locus_tag LOCUS_32920 192669 190858 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086565.1 protein_id gnl|my_center|LOCUS_32920 193650 192811 gene locus_tag LOCUS_32930 193650 192811 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086566.1 protein_id gnl|my_center|LOCUS_32930 194924 194046 gene locus_tag LOCUS_32940 194924 194046 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_32940 195082 196239 gene locus_tag LOCUS_32950 195082 196239 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926482.1 protein_id gnl|my_center|LOCUS_32950 196236 196655 gene locus_tag LOCUS_32960 196236 196655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 196652 197437 gene locus_tag LOCUS_32970 196652 197437 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448787.1 protein_id gnl|my_center|LOCUS_32970 197434 198411 gene locus_tag LOCUS_32980 197434 198411 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807966.1 protein_id gnl|my_center|LOCUS_32980 198401 199444 gene locus_tag LOCUS_32990 198401 199444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 199523 200497 gene locus_tag LOCUS_33000 199523 200497 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065172.1 protein_id gnl|my_center|LOCUS_33000 200618 202015 gene locus_tag LOCUS_33010 200618 202015 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_33010 202152 203150 gene locus_tag LOCUS_33020 202152 203150 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969472.1 protein_id gnl|my_center|LOCUS_33020 203615 203923 gene locus_tag LOCUS_33030 203615 203923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 204282 204593 gene locus_tag LOCUS_33040 204282 204593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 204900 204649 gene locus_tag LOCUS_33050 204900 204649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 205092 205499 gene locus_tag LOCUS_33060 205092 205499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 205840 205592 gene locus_tag LOCUS_33070 205840 205592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 206354 206001 gene locus_tag LOCUS_33080 206354 206001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089794.1 protein_id gnl|my_center|LOCUS_33080 206440 206898 gene locus_tag LOCUS_33090 206440 206898 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467141.1 protein_id gnl|my_center|LOCUS_33090 207659 206967 gene locus_tag LOCUS_33100 207659 206967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33100 208522 207698 gene locus_tag LOCUS_33110 208522 207698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_33110 209352 208531 gene locus_tag LOCUS_33120 209352 208531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_33120 210505 209417 gene locus_tag LOCUS_33130 210505 209417 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_33130 210747 211880 gene locus_tag LOCUS_33140 210747 211880 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086105.1 protein_id gnl|my_center|LOCUS_33140 212405 213187 gene locus_tag LOCUS_33150 212405 213187 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807981.1 protein_id gnl|my_center|LOCUS_33150 213198 214079 gene locus_tag LOCUS_33160 213198 214079 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966017.1 protein_id gnl|my_center|LOCUS_33160 214088 215335 gene locus_tag LOCUS_33170 214088 215335 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086107.1 protein_id gnl|my_center|LOCUS_33170 215444 216220 gene locus_tag LOCUS_33180 215444 216220 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087141.1 protein_id gnl|my_center|LOCUS_33180 216351 216773 gene locus_tag LOCUS_33190 216351 216773 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 protein_id gnl|my_center|LOCUS_33190 217141 219276 gene locus_tag LOCUS_33200 217141 219276 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966299.1 protein_id gnl|my_center|LOCUS_33200 219270 220190 gene locus_tag LOCUS_33210 219270 220190 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528965.1 protein_id gnl|my_center|LOCUS_33210 220180 222162 gene locus_tag LOCUS_33220 gene fhuB 220180 222162 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533592.1 protein_id gnl|my_center|LOCUS_33220 222964 222200 gene locus_tag LOCUS_33230 gene fhuF 222964 222200 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268602.1 protein_id gnl|my_center|LOCUS_33230 223757 223089 gene locus_tag LOCUS_33240 223757 223089 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529441.1 protein_id gnl|my_center|LOCUS_33240 223927 224142 gene locus_tag LOCUS_33250 223927 224142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 224612 224160 gene locus_tag LOCUS_33260 224612 224160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 224793 225233 gene locus_tag LOCUS_33270 224793 225233 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389195.1 protein_id gnl|my_center|LOCUS_33270 226283 225282 gene locus_tag LOCUS_33280 226283 225282 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 protein_id gnl|my_center|LOCUS_33280 226396 227103 gene locus_tag LOCUS_33290 226396 227103 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_33290 227193 228368 gene locus_tag LOCUS_33300 227193 228368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921602.1 protein_id gnl|my_center|LOCUS_33300 228812 228429 gene locus_tag LOCUS_33310 228812 228429 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975801.1 protein_id gnl|my_center|LOCUS_33310 230904 229234 gene locus_tag LOCUS_33320 gene leuA 230904 229234 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389215.1 protein_id gnl|my_center|LOCUS_33320 231440 231279 gene locus_tag LOCUS_33330 231440 231279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 231905 232375 gene locus_tag LOCUS_33340 231905 232375 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327119.1 protein_id gnl|my_center|LOCUS_33340 234158 232470 gene locus_tag LOCUS_33350 gene metG 234158 232470 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338224.1 protein_id gnl|my_center|LOCUS_33350 235197 234436 gene locus_tag LOCUS_33360 235197 234436 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_33360 236001 235231 gene locus_tag LOCUS_33370 236001 235231 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531283.1 protein_id gnl|my_center|LOCUS_33370 236209 236532 gene locus_tag LOCUS_33380 236209 236532 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_33380 236577 237041 gene locus_tag LOCUS_33390 236577 237041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 237244 237861 gene locus_tag LOCUS_33400 237244 237861 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538268.1 protein_id gnl|my_center|LOCUS_33400 238574 237930 gene locus_tag LOCUS_33410 238574 237930 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103380.1 protein_id gnl|my_center|LOCUS_33410 239529 238699 gene locus_tag LOCUS_33420 239529 238699 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_33420 240180 239545 gene locus_tag LOCUS_33430 gene pcaG 240180 239545 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085122.1 protein_id gnl|my_center|LOCUS_33430 240979 240185 gene locus_tag LOCUS_33440 gene pcaH 240979 240185 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085121.1 protein_id gnl|my_center|LOCUS_33440 241459 242382 gene locus_tag LOCUS_33450 241459 242382 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089131.1 protein_id gnl|my_center|LOCUS_33450 242427 243779 gene locus_tag LOCUS_33460 242427 243779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 protein_id gnl|my_center|LOCUS_33460 244592 243900 gene locus_tag LOCUS_33470 244592 243900 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970529.1 protein_id gnl|my_center|LOCUS_33470 246229 244727 gene locus_tag LOCUS_33480 246229 244727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931207.1 protein_id gnl|my_center|LOCUS_33480 246313 246909 gene locus_tag LOCUS_33490 246313 246909 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206297.1 protein_id gnl|my_center|LOCUS_33490 247340 247020 gene locus_tag LOCUS_33500 247340 247020 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 protein_id gnl|my_center|LOCUS_33500 248379 247462 gene locus_tag LOCUS_33510 248379 247462 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525667.1 protein_id gnl|my_center|LOCUS_33510 249213 248785 gene locus_tag LOCUS_33520 249213 248785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 250127 249300 gene locus_tag LOCUS_33530 250127 249300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 250939 250127 gene locus_tag LOCUS_33540 250939 250127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 251538 250930 gene locus_tag LOCUS_33550 251538 250930 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_33550 251842 252990 gene locus_tag LOCUS_33560 251842 252990 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087240.1 protein_id gnl|my_center|LOCUS_33560 252993 253637 gene locus_tag LOCUS_33570 252993 253637 CDS product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087241.1 protein_id gnl|my_center|LOCUS_33570 253641 255305 gene locus_tag LOCUS_33580 253641 255305 CDS product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087242.1 protein_id gnl|my_center|LOCUS_33580 256458 255550 gene locus_tag LOCUS_33590 gene cmrA 256458 255550 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_33590 256636 257358 gene locus_tag LOCUS_33600 256636 257358 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_33600 258161 257502 gene locus_tag LOCUS_33610 258161 257502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 258427 258158 gene locus_tag LOCUS_33620 258427 258158 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006512.1 protein_id gnl|my_center|LOCUS_33620 258629 258952 gene locus_tag LOCUS_33630 258629 258952 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529383.1 protein_id gnl|my_center|LOCUS_33630 259079 260374 gene locus_tag LOCUS_33640 259079 260374 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 protein_id gnl|my_center|LOCUS_33640 260453 260755 gene locus_tag LOCUS_33650 260453 260755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 260752 261024 gene locus_tag LOCUS_33660 260752 261024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 261671 261045 gene locus_tag LOCUS_33670 261671 261045 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_33670 262298 261849 gene locus_tag LOCUS_33680 262298 261849 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971114.1 protein_id gnl|my_center|LOCUS_33680 262389 263030 gene locus_tag LOCUS_33690 262389 263030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 263798 263313 gene locus_tag LOCUS_33700 263798 263313 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083642.1 protein_id gnl|my_center|LOCUS_33700 263980 264807 gene locus_tag LOCUS_33710 263980 264807 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530061.1 protein_id gnl|my_center|LOCUS_33710 264904 265662 gene locus_tag LOCUS_33720 264904 265662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 266014 265769 gene locus_tag LOCUS_33730 266014 265769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 266435 266040 gene locus_tag LOCUS_33740 266435 266040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 266530 266847 gene locus_tag LOCUS_33750 266530 266847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 267922 266978 gene locus_tag LOCUS_33760 267922 266978 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 protein_id gnl|my_center|LOCUS_33760 269668 268412 gene locus_tag LOCUS_33770 269668 268412 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 protein_id gnl|my_center|LOCUS_33770 270839 269709 gene locus_tag LOCUS_33780 270839 269709 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 protein_id gnl|my_center|LOCUS_33780 271678 270893 gene locus_tag LOCUS_33790 271678 270893 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090841.1 protein_id gnl|my_center|LOCUS_33790 272364 271702 gene locus_tag LOCUS_33800 272364 271702 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_33800 273292 272501 gene locus_tag LOCUS_33810 273292 272501 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090839.1 protein_id gnl|my_center|LOCUS_33810 273204 273419 gene locus_tag LOCUS_33820 273204 273419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 273969 275576 gene locus_tag LOCUS_33830 273969 275576 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_33830 275598 276317 gene locus_tag LOCUS_33840 275598 276317 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_33840 276782 278374 gene locus_tag LOCUS_33850 276782 278374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33850 278610 280625 gene locus_tag LOCUS_33860 278610 280625 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085181.1 protein_id gnl|my_center|LOCUS_33860 282658 280997 gene locus_tag LOCUS_33870 282658 280997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243123.1 protein_id gnl|my_center|LOCUS_33870 283107 282655 gene locus_tag LOCUS_33880 283107 282655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 285085 283121 gene locus_tag LOCUS_33890 285085 283121 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529950.1 protein_id gnl|my_center|LOCUS_33890 285357 285085 gene locus_tag LOCUS_33900 285357 285085 CDS product XapX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965613.1 protein_id gnl|my_center|LOCUS_33900 286106 285453 gene locus_tag LOCUS_33910 286106 285453 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034858431.1 protein_id gnl|my_center|LOCUS_33910 287254 286217 gene locus_tag LOCUS_33920 287254 286217 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_33920 287579 288190 gene locus_tag LOCUS_33930 287579 288190 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_33930 289051 288236 gene locus_tag LOCUS_33940 289051 288236 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967744.1 protein_id gnl|my_center|LOCUS_33940 289483 291177 gene locus_tag LOCUS_33950 289483 291177 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_33950 291265 292254 gene locus_tag LOCUS_33960 291265 292254 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089456.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence09 595 182 gene locus_tag LOCUS_33970 595 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 977 606 gene locus_tag LOCUS_33980 977 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 4209 1072 gene locus_tag LOCUS_33990 4209 1072 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_33990 5887 4217 gene locus_tag LOCUS_34000 5887 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 7303 5945 gene locus_tag LOCUS_34010 7303 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 8040 7300 gene locus_tag LOCUS_34020 8040 7300 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_34020 8445 9161 gene locus_tag LOCUS_34030 8445 9161 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090491.1 protein_id gnl|my_center|LOCUS_34030 10738 9176 gene locus_tag LOCUS_34040 10738 9176 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 protein_id gnl|my_center|LOCUS_34040 12057 11362 gene locus_tag LOCUS_34050 12057 11362 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_34050 12192 13205 gene locus_tag LOCUS_34060 12192 13205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083213.1 protein_id gnl|my_center|LOCUS_34060 13212 14027 gene locus_tag LOCUS_34070 13212 14027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083212.1 protein_id gnl|my_center|LOCUS_34070 14304 15164 gene locus_tag LOCUS_34080 14304 15164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083211.1 protein_id gnl|my_center|LOCUS_34080 15242 16975 gene locus_tag LOCUS_34090 gene araD 15242 16975 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083210.1 protein_id gnl|my_center|LOCUS_34090 16991 17707 gene locus_tag LOCUS_34100 16991 17707 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969653.1 protein_id gnl|my_center|LOCUS_34100 19177 17927 gene locus_tag LOCUS_34110 19177 17927 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921155.1 protein_id gnl|my_center|LOCUS_34110 20489 19512 gene locus_tag LOCUS_34120 20489 19512 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966280.1 protein_id gnl|my_center|LOCUS_34120 22007 20613 gene locus_tag LOCUS_34130 22007 20613 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539274.1 protein_id gnl|my_center|LOCUS_34130 23390 22062 gene locus_tag LOCUS_34140 23390 22062 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 protein_id gnl|my_center|LOCUS_34140 24471 23395 gene locus_tag LOCUS_34150 24471 23395 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140266.1 protein_id gnl|my_center|LOCUS_34150 27420 24715 gene locus_tag LOCUS_34160 27420 24715 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228248.1 protein_id gnl|my_center|LOCUS_34160 27683 28489 gene locus_tag LOCUS_34170 27683 28489 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533082.1 protein_id gnl|my_center|LOCUS_34170 28581 29912 gene locus_tag LOCUS_34180 28581 29912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083823.1 protein_id gnl|my_center|LOCUS_34180 30001 31194 gene locus_tag LOCUS_34190 30001 31194 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_34190 31291 31734 gene locus_tag LOCUS_34200 31291 31734 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088820.1 protein_id gnl|my_center|LOCUS_34200 31779 32396 gene locus_tag LOCUS_34210 gene ssuE 31779 32396 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 protein_id gnl|my_center|LOCUS_34210 33049 34251 gene locus_tag LOCUS_34220 33049 34251 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_34220 34266 35138 gene locus_tag LOCUS_34230 34266 35138 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 protein_id gnl|my_center|LOCUS_34230 35230 36054 gene locus_tag LOCUS_34240 35230 36054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_34240 37673 36426 gene locus_tag LOCUS_34250 37673 36426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 38062 38754 gene locus_tag LOCUS_34260 38062 38754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 38887 40284 gene locus_tag LOCUS_34270 38887 40284 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 protein_id gnl|my_center|LOCUS_34270 40284 41039 gene locus_tag LOCUS_34280 40284 41039 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087714.1 protein_id gnl|my_center|LOCUS_34280 41486 41091 gene locus_tag LOCUS_34290 41486 41091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 42327 41611 gene locus_tag LOCUS_34300 42327 41611 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 protein_id gnl|my_center|LOCUS_34300 42473 42739 gene locus_tag LOCUS_34310 42473 42739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 43685 42774 gene locus_tag LOCUS_34320 43685 42774 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_34320 44038 44226 gene locus_tag LOCUS_34330 44038 44226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 46750 44291 gene locus_tag LOCUS_34340 46750 44291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 48625 46760 gene locus_tag LOCUS_34350 48625 46760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 48996 48766 gene locus_tag LOCUS_34360 48996 48766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 50454 49276 gene locus_tag LOCUS_34370 50454 49276 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969302.1 protein_id gnl|my_center|LOCUS_34370 51730 50480 gene locus_tag LOCUS_34380 51730 50480 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463864.1 protein_id gnl|my_center|LOCUS_34380 52829 51720 gene locus_tag LOCUS_34390 52829 51720 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083401.1 protein_id gnl|my_center|LOCUS_34390 53206 53012 gene locus_tag LOCUS_34400 53206 53012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 54006 53431 gene locus_tag LOCUS_34410 54006 53431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090748.1 protein_id gnl|my_center|LOCUS_34410 54526 54044 gene locus_tag LOCUS_34420 54526 54044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 54552 54821 gene locus_tag LOCUS_34430 54552 54821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 55062 55673 gene locus_tag LOCUS_34440 55062 55673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 56231 56671 gene locus_tag LOCUS_34450 56231 56671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 57364 56882 gene locus_tag LOCUS_34460 57364 56882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 58917 57493 gene locus_tag LOCUS_34470 58917 57493 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028150869.1 protein_id gnl|my_center|LOCUS_34470 59046 59363 gene locus_tag LOCUS_34480 59046 59363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531559.1 protein_id gnl|my_center|LOCUS_34480 59752 59594 gene locus_tag LOCUS_34490 59752 59594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 60811 59939 gene locus_tag LOCUS_34500 60811 59939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 62151 61165 gene locus_tag LOCUS_34510 62151 61165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 62397 63143 gene locus_tag LOCUS_34520 62397 63143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 64108 63491 gene locus_tag LOCUS_34530 64108 63491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 64436 65551 gene locus_tag LOCUS_34540 64436 65551 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975037.1 protein_id gnl|my_center|LOCUS_34540 65680 67842 gene locus_tag LOCUS_34550 65680 67842 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_34550 68160 68363 gene locus_tag LOCUS_34560 68160 68363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 68360 68665 gene locus_tag LOCUS_34570 68360 68665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525091.1 protein_id gnl|my_center|LOCUS_34570 68941 69333 gene locus_tag LOCUS_34580 68941 69333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 69681 69388 gene locus_tag LOCUS_34590 69681 69388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 70066 69884 gene locus_tag LOCUS_34600 70066 69884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 73033 70190 gene locus_tag LOCUS_34610 73033 70190 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104680.1 protein_id gnl|my_center|LOCUS_34610 73502 73107 gene locus_tag LOCUS_34620 73502 73107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 73735 74805 gene locus_tag LOCUS_34630 73735 74805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 75691 74837 gene locus_tag LOCUS_34640 75691 74837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 protein_id gnl|my_center|LOCUS_34640 76049 77248 gene locus_tag LOCUS_34650 76049 77248 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788709.1 protein_id gnl|my_center|LOCUS_34650 77252 78127 gene locus_tag LOCUS_34660 77252 78127 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_34660 78136 79083 gene locus_tag LOCUS_34670 78136 79083 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_34670 79083 79835 gene locus_tag LOCUS_34680 79083 79835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_34680 79832 80548 gene locus_tag LOCUS_34690 79832 80548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064267.1 protein_id gnl|my_center|LOCUS_34690 80575 82038 gene locus_tag LOCUS_34700 80575 82038 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_34700 82090 82839 gene locus_tag LOCUS_34710 82090 82839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085649.1 protein_id gnl|my_center|LOCUS_34710 83791 82997 gene locus_tag LOCUS_34720 83791 82997 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043780833.1 protein_id gnl|my_center|LOCUS_34720 84773 83877 gene locus_tag LOCUS_34730 84773 83877 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532831.1 protein_id gnl|my_center|LOCUS_34730 85951 84932 gene locus_tag LOCUS_34740 85951 84932 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086903.1 protein_id gnl|my_center|LOCUS_34740 86090 86680 gene locus_tag LOCUS_34750 86090 86680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 86706 87311 gene locus_tag LOCUS_34760 86706 87311 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086905.1 protein_id gnl|my_center|LOCUS_34760 87298 87918 gene locus_tag LOCUS_34770 87298 87918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 87915 88130 gene locus_tag LOCUS_34780 87915 88130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 88409 88158 gene locus_tag LOCUS_34790 88409 88158 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 protein_id gnl|my_center|LOCUS_34790 88839 88528 gene locus_tag LOCUS_34800 88839 88528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 88945 90066 gene locus_tag LOCUS_34810 88945 90066 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967372.1 protein_id gnl|my_center|LOCUS_34810 90179 90391 gene locus_tag LOCUS_34820 90179 90391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 90746 92557 gene locus_tag LOCUS_34830 90746 92557 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047161.1 protein_id gnl|my_center|LOCUS_34830 93150 94604 gene locus_tag LOCUS_34840 93150 94604 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054224.1 protein_id gnl|my_center|LOCUS_34840 94720 95523 gene locus_tag LOCUS_34850 94720 95523 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_34850 97001 95601 gene locus_tag LOCUS_34860 97001 95601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 97114 103533 gene locus_tag LOCUS_34870 97114 103533 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355187.1 protein_id gnl|my_center|LOCUS_34870 105025 104018 gene locus_tag LOCUS_34880 105025 104018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 105194 108652 gene locus_tag LOCUS_34890 105194 108652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 108657 108893 gene locus_tag LOCUS_34900 108657 108893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 109269 109194 gene locus_tag LOCUS_t00230 109269 109194 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 110316 109339 gene locus_tag LOCUS_34910 110316 109339 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082960.1 protein_id gnl|my_center|LOCUS_34910 110819 110385 gene locus_tag LOCUS_34920 gene lysM 110819 110385 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853464.1 protein_id gnl|my_center|LOCUS_34920 111113 111439 gene locus_tag LOCUS_34930 111113 111439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 113649 111841 gene locus_tag LOCUS_34940 gene recJ 113649 111841 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967117.1 protein_id gnl|my_center|LOCUS_34940 114647 113646 gene locus_tag LOCUS_34950 gene glpX 114647 113646 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087135.1 protein_id gnl|my_center|LOCUS_34950 115997 114678 gene locus_tag LOCUS_34960 115997 114678 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087134.1 protein_id gnl|my_center|LOCUS_34960 116935 116129 gene locus_tag LOCUS_34970 gene dapB 116935 116129 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257160.1 protein_id gnl|my_center|LOCUS_34970 118196 116967 gene locus_tag LOCUS_34980 118196 116967 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171284.1 protein_id gnl|my_center|LOCUS_34980 118830 118357 gene locus_tag LOCUS_34990 118830 118357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 119452 118823 gene locus_tag LOCUS_35000 119452 118823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 119427 121334 gene locus_tag LOCUS_35010 gene phaC 119427 121334 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 protein_id gnl|my_center|LOCUS_35010 121331 121771 gene locus_tag LOCUS_35020 121331 121771 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088625.1 protein_id gnl|my_center|LOCUS_35020 124021 122438 gene locus_tag LOCUS_35030 124021 122438 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972709.1 protein_id gnl|my_center|LOCUS_35030 122531 122605 gene locus_tag LOCUS_t00240 122531 122605 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 125118 124018 gene locus_tag LOCUS_35040 125118 124018 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972708.1 protein_id gnl|my_center|LOCUS_35040 125204 126148 gene locus_tag LOCUS_35050 125204 126148 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385594.1 protein_id gnl|my_center|LOCUS_35050 126694 128226 gene locus_tag LOCUS_35060 126694 128226 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_35060 129348 128290 gene locus_tag LOCUS_35070 gene argC 129348 128290 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_35070 130091 129570 gene locus_tag LOCUS_35080 130091 129570 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192889.1 protein_id gnl|my_center|LOCUS_35080 130709 130131 gene locus_tag LOCUS_35090 130709 130131 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066751.1 protein_id gnl|my_center|LOCUS_35090 130918 130733 gene locus_tag LOCUS_35100 130918 130733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 131428 130934 gene locus_tag LOCUS_35110 131428 130934 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_35110 131543 131716 gene locus_tag LOCUS_35120 131543 131716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 131770 133830 gene locus_tag LOCUS_35130 gene parE 131770 133830 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087127.1 protein_id gnl|my_center|LOCUS_35130 133832 134359 gene locus_tag LOCUS_35140 133832 134359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 135373 134669 gene locus_tag LOCUS_35150 135373 134669 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_35150 135634 137193 gene locus_tag LOCUS_35160 135634 137193 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087120.1 protein_id gnl|my_center|LOCUS_35160 137308 138372 gene locus_tag LOCUS_35170 137308 138372 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_35170 139029 138655 gene locus_tag LOCUS_35180 139029 138655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 139406 139029 gene locus_tag LOCUS_35190 139406 139029 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463761.1 protein_id gnl|my_center|LOCUS_35190 139895 139524 gene locus_tag LOCUS_35200 139895 139524 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087115.1 protein_id gnl|my_center|LOCUS_35200 141271 140021 gene locus_tag LOCUS_35210 141271 140021 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087114.1 protein_id gnl|my_center|LOCUS_35210 142620 141280 gene locus_tag LOCUS_35220 gene sufD 142620 141280 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_35220 143386 142631 gene locus_tag LOCUS_35230 gene sufC 143386 142631 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_35230 145000 143528 gene locus_tag LOCUS_35240 gene sufB 145000 143528 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 protein_id gnl|my_center|LOCUS_35240 146211 145048 gene locus_tag LOCUS_35250 146211 145048 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_35250 146445 147101 gene locus_tag LOCUS_35260 146445 147101 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_35260 147146 148096 gene locus_tag LOCUS_35270 147146 148096 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_35270 148101 149399 gene locus_tag LOCUS_35280 148101 149399 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171586.1 protein_id gnl|my_center|LOCUS_35280 149801 150460 gene locus_tag LOCUS_35290 gene plsY 149801 150460 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531796.1 protein_id gnl|my_center|LOCUS_35290 150457 151569 gene locus_tag LOCUS_35300 gene dprA 150457 151569 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087864.1 protein_id gnl|my_center|LOCUS_35300 151757 154501 gene locus_tag LOCUS_35310 gene topA 151757 154501 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966363.1 protein_id gnl|my_center|LOCUS_35310 154607 156925 gene locus_tag LOCUS_35320 gene rnr 154607 156925 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087872.1 protein_id gnl|my_center|LOCUS_35320 156922 157362 gene locus_tag LOCUS_35330 156922 157362 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087873.1 protein_id gnl|my_center|LOCUS_35330 157365 158123 gene locus_tag LOCUS_35340 157365 158123 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_35340 158528 158208 gene locus_tag LOCUS_35350 158528 158208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 158543 159721 gene locus_tag LOCUS_35360 158543 159721 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531920.1 protein_id gnl|my_center|LOCUS_35360 161656 159830 gene locus_tag LOCUS_35370 gene glmS 161656 159830 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_35370 161955 163532 gene locus_tag LOCUS_35380 161955 163532 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_35380 165162 163795 gene locus_tag LOCUS_35390 gene glmU 165162 163795 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533259.1 protein_id gnl|my_center|LOCUS_35390 166033 165200 gene locus_tag LOCUS_35400 gene kdsA 166033 165200 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_35400 167241 166081 gene locus_tag LOCUS_35410 167241 166081 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920219.1 protein_id gnl|my_center|LOCUS_35410 167749 167243 gene locus_tag LOCUS_35420 167749 167243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 168162 167758 gene locus_tag LOCUS_35430 168162 167758 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920223.1 protein_id gnl|my_center|LOCUS_35430 168875 168531 gene locus_tag LOCUS_35440 168875 168531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 170503 168875 gene locus_tag LOCUS_35450 170503 168875 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534733.1 protein_id gnl|my_center|LOCUS_35450 171126 170680 gene locus_tag LOCUS_35460 171126 170680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 172114 171362 gene locus_tag LOCUS_35470 gene tpiA 172114 171362 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400467.1 protein_id gnl|my_center|LOCUS_35470 172266 174149 gene locus_tag LOCUS_35480 172266 174149 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087576.1 protein_id gnl|my_center|LOCUS_35480 174181 175698 gene locus_tag LOCUS_35490 gene trpE 174181 175698 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_35490 174455 174366 gene locus_tag LOCUS_t00250 174455 174366 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 175975 176574 gene locus_tag LOCUS_35500 175975 176574 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_35500 176574 177590 gene locus_tag LOCUS_35510 gene trpD 176574 177590 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_35510 177606 178394 gene locus_tag LOCUS_35520 gene trpC 177606 178394 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087578.1 protein_id gnl|my_center|LOCUS_35520 178625 179776 gene locus_tag LOCUS_35530 178625 179776 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792063.1 protein_id gnl|my_center|LOCUS_35530 180474 180136 gene locus_tag LOCUS_35540 180474 180136 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244664.1 protein_id gnl|my_center|LOCUS_35540 181051 182475 gene locus_tag LOCUS_35550 181051 182475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 183224 182505 gene locus_tag LOCUS_35560 183224 182505 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_35560 184001 183249 gene locus_tag LOCUS_35570 184001 183249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_35570 184744 184106 gene locus_tag LOCUS_35580 184744 184106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 184973 186064 gene locus_tag LOCUS_35590 184973 186064 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_35590 186238 186954 gene locus_tag LOCUS_35600 186238 186954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 187309 186989 gene locus_tag LOCUS_35610 gene sugE 187309 186989 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528463.1 protein_id gnl|my_center|LOCUS_35610 188790 187462 gene locus_tag LOCUS_35620 188790 187462 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971520.1 protein_id gnl|my_center|LOCUS_35620 189549 189277 gene locus_tag LOCUS_35630 189549 189277 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087667.1 protein_id gnl|my_center|LOCUS_35630 189950 189546 gene locus_tag LOCUS_35640 gene mce 189950 189546 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_35640 191739 190051 gene locus_tag LOCUS_35650 191739 190051 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171719.1 protein_id gnl|my_center|LOCUS_35650 192514 191741 gene locus_tag LOCUS_35660 192514 191741 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087670.1 protein_id gnl|my_center|LOCUS_35660 193955 192519 gene locus_tag LOCUS_35670 gene nuoN 193955 192519 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_35670 195492 193969 gene locus_tag LOCUS_35680 195492 193969 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087672.1 protein_id gnl|my_center|LOCUS_35680 197561 195492 gene locus_tag LOCUS_35690 gene nuoL 197561 195492 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_35690 197880 197569 gene locus_tag LOCUS_35700 gene nuoK 197880 197569 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547737.1 protein_id gnl|my_center|LOCUS_35700 198488 197883 gene locus_tag LOCUS_35710 198488 197883 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087674.1 protein_id gnl|my_center|LOCUS_35710 199139 198651 gene locus_tag LOCUS_35720 gene nuoI 199139 198651 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 protein_id gnl|my_center|LOCUS_35720 200280 199261 gene locus_tag LOCUS_35730 gene nuoH 200280 199261 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531848.1 protein_id gnl|my_center|LOCUS_35730 202363 200285 gene locus_tag LOCUS_35740 gene nuoG 202363 200285 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969148.1 protein_id gnl|my_center|LOCUS_35740 203518 202526 gene locus_tag LOCUS_35750 203518 202526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 204843 203542 gene locus_tag LOCUS_35760 gene nuoF 204843 203542 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531094.1 protein_id gnl|my_center|LOCUS_35760 205573 204845 gene locus_tag LOCUS_35770 gene nuoE 205573 204845 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087680.1 protein_id gnl|my_center|LOCUS_35770 205885 205598 gene locus_tag LOCUS_35780 205885 205598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 207066 205882 gene locus_tag LOCUS_35790 207066 205882 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087682.1 protein_id gnl|my_center|LOCUS_35790 207699 207079 gene locus_tag LOCUS_35800 207699 207079 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531091.1 protein_id gnl|my_center|LOCUS_35800 208739 208158 gene locus_tag LOCUS_35810 gene nuoB 208739 208158 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531828.1 protein_id gnl|my_center|LOCUS_35810 209146 208781 gene locus_tag LOCUS_35820 209146 208781 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312714.1 protein_id gnl|my_center|LOCUS_35820 210016 209294 gene locus_tag LOCUS_35830 210016 209294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 210654 210409 gene locus_tag LOCUS_35840 210654 210409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 211288 210665 gene locus_tag LOCUS_35850 211288 210665 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172715.1 protein_id gnl|my_center|LOCUS_35850 212159 211431 gene locus_tag LOCUS_35860 212159 211431 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530376.1 protein_id gnl|my_center|LOCUS_35860 212673 212597 gene locus_tag LOCUS_t00260 212673 212597 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 213130 215094 gene locus_tag LOCUS_35870 213130 215094 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089908.1 protein_id gnl|my_center|LOCUS_35870 216892 215102 gene locus_tag LOCUS_35880 216892 215102 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_35880 218432 217308 gene locus_tag LOCUS_35890 218432 217308 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_35890 218744 219199 gene locus_tag LOCUS_35900 gene aroQ 218744 219199 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312617.1 protein_id gnl|my_center|LOCUS_35900 219236 219712 gene locus_tag LOCUS_35910 gene accB 219236 219712 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_35910 219709 221079 gene locus_tag LOCUS_35920 gene accC 219709 221079 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_35920 221150 221776 gene locus_tag LOCUS_35930 221150 221776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 221820 222974 gene locus_tag LOCUS_35940 gene rnd 221820 222974 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_35940 223087 224301 gene locus_tag LOCUS_35950 223087 224301 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_35950 225378 224545 gene locus_tag LOCUS_35960 225378 224545 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967606.1 protein_id gnl|my_center|LOCUS_35960 227024 225483 gene locus_tag LOCUS_35970 227024 225483 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088112.1 protein_id gnl|my_center|LOCUS_35970 227588 227211 gene locus_tag LOCUS_35980 227588 227211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 228661 227723 gene locus_tag LOCUS_35990 228661 227723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 229527 228742 gene locus_tag LOCUS_36000 229527 228742 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088120.1 protein_id gnl|my_center|LOCUS_36000 230213 229524 gene locus_tag LOCUS_36010 230213 229524 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_36010 230708 230271 gene locus_tag LOCUS_36020 230708 230271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 231008 230775 gene locus_tag LOCUS_36030 231008 230775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 232644 231013 gene locus_tag LOCUS_36040 232644 231013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 233645 232899 gene locus_tag LOCUS_36050 233645 232899 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921475.1 protein_id gnl|my_center|LOCUS_36050 234142 242715 gene locus_tag LOCUS_36060 234142 242715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 244252 242951 gene locus_tag LOCUS_36070 244252 242951 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969201.1 protein_id gnl|my_center|LOCUS_36070 245681 244254 gene locus_tag LOCUS_36080 245681 244254 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967063.1 protein_id gnl|my_center|LOCUS_36080 245867 246613 gene locus_tag LOCUS_36090 245867 246613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085649.1 protein_id gnl|my_center|LOCUS_36090 246660 247853 gene locus_tag LOCUS_36100 246660 247853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 248727 248299 gene locus_tag LOCUS_36110 gene rplQ 248727 248299 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 protein_id gnl|my_center|LOCUS_36110 249792 248776 gene locus_tag LOCUS_36120 249792 248776 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 protein_id gnl|my_center|LOCUS_36120 250313 249924 gene locus_tag LOCUS_36130 gene rpsK 250313 249924 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603045.1 protein_id gnl|my_center|LOCUS_36130 250769 250401 gene locus_tag LOCUS_36140 gene rpsM 250769 250401 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 protein_id gnl|my_center|LOCUS_36140 251542 250961 gene locus_tag LOCUS_36150 251542 250961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 252870 251539 gene locus_tag LOCUS_36160 gene secY 252870 251539 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088135.1 protein_id gnl|my_center|LOCUS_36160 253552 253076 gene locus_tag LOCUS_36170 gene rplO 253552 253076 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531434.1 protein_id gnl|my_center|LOCUS_36170 253742 253557 gene locus_tag LOCUS_36180 gene rpmD 253742 253557 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 protein_id gnl|my_center|LOCUS_36180 254301 253753 gene locus_tag LOCUS_36190 gene rpsE 254301 253753 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 protein_id gnl|my_center|LOCUS_36190 254699 254337 gene locus_tag LOCUS_36200 gene rplR 254699 254337 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383041.1 protein_id gnl|my_center|LOCUS_36200 255281 254748 gene locus_tag LOCUS_36210 gene rplF 255281 254748 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 protein_id gnl|my_center|LOCUS_36210 255715 255317 gene locus_tag LOCUS_36220 gene rpsH 255715 255317 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088139.1 protein_id gnl|my_center|LOCUS_36220 256034 255729 gene locus_tag LOCUS_36230 gene rpsN 256034 255729 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495202.1 protein_id gnl|my_center|LOCUS_36230 256652 256095 gene locus_tag LOCUS_36240 gene rplE 256652 256095 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531429.1 protein_id gnl|my_center|LOCUS_36240 256962 256645 gene locus_tag LOCUS_36250 gene rplX 256962 256645 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707762.1 protein_id gnl|my_center|LOCUS_36250 257330 256962 gene locus_tag LOCUS_36260 gene rplN 257330 256962 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495199.1 protein_id gnl|my_center|LOCUS_36260 257640 257407 gene locus_tag LOCUS_36270 gene rpsQ 257640 257407 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088143.1 protein_id gnl|my_center|LOCUS_36270 257848 257651 gene locus_tag LOCUS_36280 gene rpmC 257848 257651 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_36280 258273 257860 gene locus_tag LOCUS_36290 gene rplP 258273 257860 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_36290 259013 258291 gene locus_tag LOCUS_36300 gene rpsC 259013 258291 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_36300 259407 259024 gene locus_tag LOCUS_36310 gene rplV 259407 259024 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707758.1 protein_id gnl|my_center|LOCUS_36310 259694 259416 gene locus_tag LOCUS_36320 gene rpsS 259694 259416 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_36320 260540 259707 gene locus_tag LOCUS_36330 gene rplB 260540 259707 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088148.1 protein_id gnl|my_center|LOCUS_36330 260856 260557 gene locus_tag LOCUS_36340 260856 260557 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088149.1 protein_id gnl|my_center|LOCUS_36340 261473 260853 gene locus_tag LOCUS_36350 gene rplD 261473 260853 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383029.1 protein_id gnl|my_center|LOCUS_36350 262197 261475 gene locus_tag LOCUS_36360 gene rplC 262197 261475 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088151.1 protein_id gnl|my_center|LOCUS_36360 262599 262291 gene locus_tag LOCUS_36370 gene rpsJ 262599 262291 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_36370 >Feature sequence10 731 1687 gene locus_tag LOCUS_36380 731 1687 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235934756.1 protein_id gnl|my_center|LOCUS_36380 2165 1743 gene locus_tag LOCUS_36390 2165 1743 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974779.1 protein_id gnl|my_center|LOCUS_36390 2347 2814 gene locus_tag LOCUS_36400 2347 2814 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965150.1 protein_id gnl|my_center|LOCUS_36400 4252 2822 gene locus_tag LOCUS_36410 gene glcF 4252 2822 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530352.1 protein_id gnl|my_center|LOCUS_36410 5437 4259 gene locus_tag LOCUS_36420 gene glcE 5437 4259 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974600.1 protein_id gnl|my_center|LOCUS_36420 6923 5451 gene locus_tag LOCUS_36430 6923 5451 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401220.1 protein_id gnl|my_center|LOCUS_36430 7068 7979 gene locus_tag LOCUS_36440 7068 7979 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974598.1 protein_id gnl|my_center|LOCUS_36440 8082 9218 gene locus_tag LOCUS_36450 8082 9218 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_36450 9215 10195 gene locus_tag LOCUS_36460 gene hisG 9215 10195 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090257.1 protein_id gnl|my_center|LOCUS_36460 10936 10541 gene locus_tag LOCUS_36470 10936 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 11343 11020 gene locus_tag LOCUS_36480 11343 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 12070 11336 gene locus_tag LOCUS_36490 12070 11336 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310420.1 protein_id gnl|my_center|LOCUS_36490 13532 12195 gene locus_tag LOCUS_36500 13532 12195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 protein_id gnl|my_center|LOCUS_36500 14610 13702 gene locus_tag LOCUS_36510 14610 13702 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970419.1 protein_id gnl|my_center|LOCUS_36510 15180 15848 gene locus_tag LOCUS_36520 15180 15848 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_36520 15941 16993 gene locus_tag LOCUS_36530 15941 16993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_36530 17717 17028 gene locus_tag LOCUS_36540 17717 17028 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206385.1 protein_id gnl|my_center|LOCUS_36540 17944 19362 gene locus_tag LOCUS_36550 17944 19362 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965348.1 protein_id gnl|my_center|LOCUS_36550 19512 20267 gene locus_tag LOCUS_36560 19512 20267 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087105.1 protein_id gnl|my_center|LOCUS_36560 20777 20301 gene locus_tag LOCUS_36570 20777 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 21454 20774 gene locus_tag LOCUS_36580 gene aat 21454 20774 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087059.1 protein_id gnl|my_center|LOCUS_36580 22301 21501 gene locus_tag LOCUS_36590 22301 21501 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087565.1 protein_id gnl|my_center|LOCUS_36590 22772 22356 gene locus_tag LOCUS_36600 22772 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 23785 22769 gene locus_tag LOCUS_36610 23785 22769 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_36610 24016 24444 gene locus_tag LOCUS_36620 24016 24444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 24550 25176 gene locus_tag LOCUS_36630 24550 25176 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 protein_id gnl|my_center|LOCUS_36630 25255 26463 gene locus_tag LOCUS_36640 gene arsK 25255 26463 CDS product arsenite efflux MFS transporter ArsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975858.1 protein_id gnl|my_center|LOCUS_36640 26541 27452 gene locus_tag LOCUS_36650 26541 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 28154 27462 gene locus_tag LOCUS_36660 28154 27462 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975817.1 protein_id gnl|my_center|LOCUS_36660 28309 28869 gene locus_tag LOCUS_36670 28309 28869 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083269.1 protein_id gnl|my_center|LOCUS_36670 28931 30571 gene locus_tag LOCUS_36680 gene pgi 28931 30571 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252578.1 protein_id gnl|my_center|LOCUS_36680 32209 30578 gene locus_tag LOCUS_36690 32209 30578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173725.1 protein_id gnl|my_center|LOCUS_36690 33189 32404 gene locus_tag LOCUS_36700 33189 32404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 34238 33303 gene locus_tag LOCUS_36710 34238 33303 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086114.1 protein_id gnl|my_center|LOCUS_36710 34525 35127 gene locus_tag LOCUS_36720 34525 35127 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 protein_id gnl|my_center|LOCUS_36720 35132 36319 gene locus_tag LOCUS_36730 35132 36319 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063975.1 protein_id gnl|my_center|LOCUS_36730 36416 37363 gene locus_tag LOCUS_36740 36416 37363 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088087.1 protein_id gnl|my_center|LOCUS_36740 37398 37826 gene locus_tag LOCUS_36750 gene arfB 37398 37826 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_36750 38774 37830 gene locus_tag LOCUS_36760 38774 37830 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_36760 38931 40604 gene locus_tag LOCUS_36770 38931 40604 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_36770 41216 40608 gene locus_tag LOCUS_36780 41216 40608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530343.1 protein_id gnl|my_center|LOCUS_36780 42701 41223 gene locus_tag LOCUS_36790 42701 41223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 43407 42964 gene locus_tag LOCUS_36800 43407 42964 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_36800 43961 43476 gene locus_tag LOCUS_36810 43961 43476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_36810 44686 44192 gene locus_tag LOCUS_36820 44686 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 44812 45864 gene locus_tag LOCUS_36830 44812 45864 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090258.1 protein_id gnl|my_center|LOCUS_36830 45864 46652 gene locus_tag LOCUS_36840 45864 46652 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090259.1 protein_id gnl|my_center|LOCUS_36840 46915 48219 gene locus_tag LOCUS_36850 46915 48219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 48485 49756 gene locus_tag LOCUS_36860 48485 49756 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_36860 49791 52940 gene locus_tag LOCUS_36870 49791 52940 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_36870 54550 53066 gene locus_tag LOCUS_36880 54550 53066 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965742.1 protein_id gnl|my_center|LOCUS_36880 54813 55091 gene locus_tag LOCUS_36890 54813 55091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 55204 57303 gene locus_tag LOCUS_36900 55204 57303 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_36900 57814 57341 gene locus_tag LOCUS_36910 57814 57341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 59306 57861 gene locus_tag LOCUS_36920 59306 57861 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_36920 60046 59495 gene locus_tag LOCUS_36930 60046 59495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 61011 60172 gene locus_tag LOCUS_36940 61011 60172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 62510 61080 gene locus_tag LOCUS_36950 62510 61080 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_36950 64339 62507 gene locus_tag LOCUS_36960 64339 62507 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 protein_id gnl|my_center|LOCUS_36960 65873 64458 gene locus_tag LOCUS_36970 gene tldD 65873 64458 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965288.1 protein_id gnl|my_center|LOCUS_36970 66506 65961 gene locus_tag LOCUS_36980 66506 65961 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185888.1 protein_id gnl|my_center|LOCUS_36980 66977 67894 gene locus_tag LOCUS_36990 gene coxB 66977 67894 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_36990 67946 69571 gene locus_tag LOCUS_37000 gene ctaD 67946 69571 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_37000 69683 70657 gene locus_tag LOCUS_37010 69683 70657 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_37010 70657 70833 gene locus_tag LOCUS_37020 70657 70833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083992.1 protein_id gnl|my_center|LOCUS_37020 70842 71447 gene locus_tag LOCUS_37030 70842 71447 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923266.1 protein_id gnl|my_center|LOCUS_37030 71504 72391 gene locus_tag LOCUS_37040 71504 72391 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532775.1 protein_id gnl|my_center|LOCUS_37040 72617 73975 gene locus_tag LOCUS_37050 72617 73975 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532355.1 protein_id gnl|my_center|LOCUS_37050 73972 75306 gene locus_tag LOCUS_37060 73972 75306 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 protein_id gnl|my_center|LOCUS_37060 75388 75912 gene locus_tag LOCUS_37070 75388 75912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 76414 76187 gene locus_tag LOCUS_37080 76414 76187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 76611 76426 gene locus_tag LOCUS_37090 76611 76426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 77489 76725 gene locus_tag LOCUS_37100 77489 76725 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992415.1 protein_id gnl|my_center|LOCUS_37100 77884 77513 gene locus_tag LOCUS_37110 77884 77513 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_37110 78207 78572 gene locus_tag LOCUS_37120 78207 78572 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_37120 78681 79370 gene locus_tag LOCUS_37130 78681 79370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37130 80257 79400 gene locus_tag LOCUS_37140 80257 79400 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265598.1 protein_id gnl|my_center|LOCUS_37140 80401 80859 gene locus_tag LOCUS_37150 80401 80859 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833668.1 protein_id gnl|my_center|LOCUS_37150 81780 80872 gene locus_tag LOCUS_37160 81780 80872 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090229.1 protein_id gnl|my_center|LOCUS_37160 83142 81856 gene locus_tag LOCUS_37170 gene purD 83142 81856 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 protein_id gnl|my_center|LOCUS_37170 83216 84805 gene locus_tag LOCUS_37180 gene xseA 83216 84805 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090239.1 protein_id gnl|my_center|LOCUS_37180 85795 84812 gene locus_tag LOCUS_37190 85795 84812 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967304.1 protein_id gnl|my_center|LOCUS_37190 85892 86704 gene locus_tag LOCUS_37200 85892 86704 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920872.1 protein_id gnl|my_center|LOCUS_37200 86744 87430 gene locus_tag LOCUS_37210 86744 87430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 87710 87444 gene locus_tag LOCUS_37220 87710 87444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 88214 87786 gene locus_tag LOCUS_37230 88214 87786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 88983 88555 gene locus_tag LOCUS_37240 88983 88555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 89593 89342 gene locus_tag LOCUS_37250 89593 89342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 90950 89829 gene locus_tag LOCUS_37260 90950 89829 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173971.1 protein_id gnl|my_center|LOCUS_37260 91964 91218 gene locus_tag LOCUS_37270 91964 91218 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967316.1 protein_id gnl|my_center|LOCUS_37270 92147 92632 gene locus_tag LOCUS_37280 92147 92632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 92645 93580 gene locus_tag LOCUS_37290 gene ubiA 92645 93580 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090253.1 protein_id gnl|my_center|LOCUS_37290 94562 93597 gene locus_tag LOCUS_37300 94562 93597 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967295.1 protein_id gnl|my_center|LOCUS_37300 95078 94626 gene locus_tag LOCUS_37310 95078 94626 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_37310 95554 95168 gene locus_tag LOCUS_37320 95554 95168 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814499.1 protein_id gnl|my_center|LOCUS_37320 95953 97458 gene locus_tag LOCUS_37330 95953 97458 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090210.1 protein_id gnl|my_center|LOCUS_37330 97490 99328 gene locus_tag LOCUS_37340 gene mutL 97490 99328 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_37340 100318 99350 gene locus_tag LOCUS_37350 100318 99350 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 protein_id gnl|my_center|LOCUS_37350 100697 101473 gene locus_tag LOCUS_37360 100697 101473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 101478 102179 gene locus_tag LOCUS_37370 101478 102179 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_37370 102189 102866 gene locus_tag LOCUS_37380 102189 102866 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707929.1 protein_id gnl|my_center|LOCUS_37380 102929 103801 gene locus_tag LOCUS_37390 102929 103801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 103882 104997 gene locus_tag LOCUS_37400 103882 104997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 105059 106138 gene locus_tag LOCUS_37410 105059 106138 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_37410 106920 106231 gene locus_tag LOCUS_37420 106920 106231 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919957.1 protein_id gnl|my_center|LOCUS_37420 107908 107003 gene locus_tag LOCUS_37430 107908 107003 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 protein_id gnl|my_center|LOCUS_37430 108050 109009 gene locus_tag LOCUS_37440 108050 109009 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730392.1 protein_id gnl|my_center|LOCUS_37440 112577 109035 gene locus_tag LOCUS_37450 112577 109035 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084017.1 protein_id gnl|my_center|LOCUS_37450 113319 112702 gene locus_tag LOCUS_37460 113319 112702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 114466 113345 gene locus_tag LOCUS_37470 114466 113345 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_37470 114724 115137 gene locus_tag LOCUS_37480 gene mscL 114724 115137 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547170.1 protein_id gnl|my_center|LOCUS_37480 115755 115201 gene locus_tag LOCUS_37490 gene rsmD 115755 115201 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_37490 118953 115759 gene locus_tag LOCUS_37500 118953 115759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 119085 119513 gene locus_tag LOCUS_37510 119085 119513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 121220 119520 gene locus_tag LOCUS_37520 121220 119520 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_37520 122259 121225 gene locus_tag LOCUS_37530 122259 121225 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_37530 122844 122524 gene locus_tag LOCUS_37540 122844 122524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 123363 122887 gene locus_tag LOCUS_37550 123363 122887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 123636 124535 gene locus_tag LOCUS_37560 123636 124535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 124540 124902 gene locus_tag LOCUS_37570 gene bigR 124540 124902 CDS product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328584.1 protein_id gnl|my_center|LOCUS_37570 124899 125315 gene locus_tag LOCUS_37580 124899 125315 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967550.1 protein_id gnl|my_center|LOCUS_37580 125312 125740 gene locus_tag LOCUS_37590 125312 125740 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_37590 126568 125759 gene locus_tag LOCUS_37600 gene cysQ 126568 125759 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396169.1 protein_id gnl|my_center|LOCUS_37600 126749 127525 gene locus_tag LOCUS_37610 126749 127525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 127594 131238 gene locus_tag LOCUS_37620 127594 131238 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183752346.1 protein_id gnl|my_center|LOCUS_37620 131823 131476 gene locus_tag LOCUS_37630 131823 131476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 131713 132285 gene locus_tag LOCUS_37640 131713 132285 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_37640 132612 132788 gene locus_tag LOCUS_37650 132612 132788 CDS product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919404.1 protein_id gnl|my_center|LOCUS_37650 132785 133027 gene locus_tag LOCUS_37660 132785 133027 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089261.1 protein_id gnl|my_center|LOCUS_37660 133179 133718 gene locus_tag LOCUS_37670 133179 133718 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124220547.1 protein_id gnl|my_center|LOCUS_37670 133729 135297 gene locus_tag LOCUS_37680 133729 135297 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089254.1 protein_id gnl|my_center|LOCUS_37680 135489 135959 gene locus_tag LOCUS_37690 135489 135959 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_37690 136123 136443 gene locus_tag LOCUS_37700 136123 136443 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531020.1 protein_id gnl|my_center|LOCUS_37700 136623 137396 gene locus_tag LOCUS_37710 136623 137396 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_37710 137396 137707 gene locus_tag LOCUS_37720 137396 137707 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969337.1 protein_id gnl|my_center|LOCUS_37720 137704 138222 gene locus_tag LOCUS_37730 137704 138222 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084430.1 protein_id gnl|my_center|LOCUS_37730 138418 139557 gene locus_tag LOCUS_37740 gene hflK 138418 139557 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_37740 139554 140477 gene locus_tag LOCUS_37750 139554 140477 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_37750 140600 140785 gene locus_tag LOCUS_37760 140600 140785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 140890 141672 gene locus_tag LOCUS_37770 140890 141672 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531162.1 protein_id gnl|my_center|LOCUS_37770 141906 143246 gene locus_tag LOCUS_37780 gene creD 141906 143246 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_37780 143369 144073 gene locus_tag LOCUS_37790 143369 144073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 144688 144083 gene locus_tag LOCUS_37800 144688 144083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 145203 144970 gene locus_tag LOCUS_37810 gene rpmE 145203 144970 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 protein_id gnl|my_center|LOCUS_37810 145356 147167 gene locus_tag LOCUS_37820 145356 147167 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_37820 147591 147133 gene locus_tag LOCUS_37830 147591 147133 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084325.1 protein_id gnl|my_center|LOCUS_37830 148616 147588 gene locus_tag LOCUS_37840 148616 147588 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258142.1 protein_id gnl|my_center|LOCUS_37840 149613 148618 gene locus_tag LOCUS_37850 149613 148618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965387.1 protein_id gnl|my_center|LOCUS_37850 151108 149726 gene locus_tag LOCUS_37860 151108 149726 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_37860 151818 151201 gene locus_tag LOCUS_37870 151818 151201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966478.1 protein_id gnl|my_center|LOCUS_37870 152545 151877 gene locus_tag LOCUS_37880 152545 151877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 152871 152533 gene locus_tag LOCUS_37890 152871 152533 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_37890 153742 152939 gene locus_tag LOCUS_37900 153742 152939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 153926 155344 gene locus_tag LOCUS_37910 153926 155344 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965780.1 protein_id gnl|my_center|LOCUS_37910 155566 156399 gene locus_tag LOCUS_37920 155566 156399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 156435 157688 gene locus_tag LOCUS_37930 156435 157688 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084001.1 protein_id gnl|my_center|LOCUS_37930 157713 158324 gene locus_tag LOCUS_37940 157713 158324 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_37940 158713 158345 gene locus_tag LOCUS_37950 158713 158345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 159184 158843 gene locus_tag LOCUS_37960 159184 158843 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_37960 159789 159223 gene locus_tag LOCUS_37970 159789 159223 CDS product DUF4337 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083279.1 protein_id gnl|my_center|LOCUS_37970 159919 160650 gene locus_tag LOCUS_37980 159919 160650 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_37980 160647 161474 gene locus_tag LOCUS_37990 160647 161474 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089351.1 protein_id gnl|my_center|LOCUS_37990 161484 162233 gene locus_tag LOCUS_38000 161484 162233 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173723.1 protein_id gnl|my_center|LOCUS_38000 162318 162977 gene locus_tag LOCUS_38010 162318 162977 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_38010 163603 164670 gene locus_tag LOCUS_38020 163603 164670 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895534.1 protein_id gnl|my_center|LOCUS_38020 164667 165854 gene locus_tag LOCUS_38030 164667 165854 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 protein_id gnl|my_center|LOCUS_38030 167117 165891 gene locus_tag LOCUS_38040 167117 165891 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_38040 168168 167425 gene locus_tag LOCUS_38050 168168 167425 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020660801.1 protein_id gnl|my_center|LOCUS_38050 168633 169622 gene locus_tag LOCUS_38060 gene rsmH 168633 169622 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_38060 169619 170026 gene locus_tag LOCUS_38070 169619 170026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089349.1 protein_id gnl|my_center|LOCUS_38070 170026 171801 gene locus_tag LOCUS_38080 170026 171801 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_38080 171872 173356 gene locus_tag LOCUS_38090 171872 173356 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 protein_id gnl|my_center|LOCUS_38090 173353 174813 gene locus_tag LOCUS_38100 173353 174813 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969749.1 protein_id gnl|my_center|LOCUS_38100 174834 175916 gene locus_tag LOCUS_38110 gene mraY 174834 175916 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 protein_id gnl|my_center|LOCUS_38110 175922 177328 gene locus_tag LOCUS_38120 gene murD 175922 177328 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089344.1 protein_id gnl|my_center|LOCUS_38120 177458 178603 gene locus_tag LOCUS_38130 177458 178603 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089343.1 protein_id gnl|my_center|LOCUS_38130 178605 179723 gene locus_tag LOCUS_38140 gene murG 178605 179723 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089342.1 protein_id gnl|my_center|LOCUS_38140 179720 181132 gene locus_tag LOCUS_38150 gene murC 179720 181132 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089341.1 protein_id gnl|my_center|LOCUS_38150 181137 182072 gene locus_tag LOCUS_38160 gene murB 181137 182072 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_38160 182083 183006 gene locus_tag LOCUS_38170 182083 183006 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242931.1 protein_id gnl|my_center|LOCUS_38170 182973 183989 gene locus_tag LOCUS_38180 182973 183989 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089338.1 protein_id gnl|my_center|LOCUS_38180 183986 185311 gene locus_tag LOCUS_38190 gene ftsA 183986 185311 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004442783.1 protein_id gnl|my_center|LOCUS_38190 185432 187135 gene locus_tag LOCUS_38200 gene ftsZ 185432 187135 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089336.1 protein_id gnl|my_center|LOCUS_38200 187734 187459 gene locus_tag LOCUS_38210 187734 187459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 187738 188427 gene locus_tag LOCUS_38220 187738 188427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 188564 189433 gene locus_tag LOCUS_38230 188564 189433 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089334.1 protein_id gnl|my_center|LOCUS_38230 189551 191206 gene locus_tag LOCUS_38240 gene recN 189551 191206 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089333.1 protein_id gnl|my_center|LOCUS_38240 191203 191931 gene locus_tag LOCUS_38250 191203 191931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 192016 194433 gene locus_tag LOCUS_38260 gene ligA 192016 194433 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919396.1 protein_id gnl|my_center|LOCUS_38260 194481 195362 gene locus_tag LOCUS_38270 194481 195362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 195544 195780 gene locus_tag LOCUS_38280 195544 195780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 195867 196028 gene locus_tag LOCUS_38290 195867 196028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 196536 196018 gene locus_tag LOCUS_38300 196536 196018 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_38300 196696 198102 gene locus_tag LOCUS_38310 196696 198102 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089298.1 protein_id gnl|my_center|LOCUS_38310 198483 198178 gene locus_tag LOCUS_38320 198483 198178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 199631 198738 gene locus_tag LOCUS_38330 199631 198738 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445511.1 protein_id gnl|my_center|LOCUS_38330 199765 200637 gene locus_tag LOCUS_38340 199765 200637 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809084.1 protein_id gnl|my_center|LOCUS_38340 200735 201010 gene locus_tag LOCUS_38350 200735 201010 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_38350 201341 201033 gene locus_tag LOCUS_38360 201341 201033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 201710 202729 gene locus_tag LOCUS_38370 201710 202729 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083852.1 protein_id gnl|my_center|LOCUS_38370 202726 204765 gene locus_tag LOCUS_38380 202726 204765 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172690.1 protein_id gnl|my_center|LOCUS_38380 204789 206543 gene locus_tag LOCUS_38390 204789 206543 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083850.1 protein_id gnl|my_center|LOCUS_38390 206540 207259 gene locus_tag LOCUS_38400 206540 207259 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083849.1 protein_id gnl|my_center|LOCUS_38400 207565 207972 gene locus_tag LOCUS_38410 207565 207972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 208035 208625 gene locus_tag LOCUS_38420 208035 208625 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172955.1 protein_id gnl|my_center|LOCUS_38420 209035 209110 gene locus_tag LOCUS_t00270 209035 209110 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 209353 209126 gene locus_tag LOCUS_38430 209353 209126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 210280 209504 gene locus_tag LOCUS_38440 210280 209504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 211055 210810 gene locus_tag LOCUS_38450 211055 210810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 211006 212238 gene locus_tag LOCUS_38460 211006 212238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 212731 212339 gene locus_tag LOCUS_38470 212731 212339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 214159 213308 gene locus_tag LOCUS_38480 214159 213308 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096460324.1 protein_id gnl|my_center|LOCUS_38480 215238 214294 gene locus_tag LOCUS_38490 215238 214294 CDS product glycine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085352.1 protein_id gnl|my_center|LOCUS_38490 217134 215341 gene locus_tag LOCUS_38500 217134 215341 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992392.1 protein_id gnl|my_center|LOCUS_38500 218073 217150 gene locus_tag LOCUS_38510 218073 217150 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_38510 218911 218126 gene locus_tag LOCUS_38520 218911 218126 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051288.1 protein_id gnl|my_center|LOCUS_38520 219608 218943 gene locus_tag LOCUS_38530 219608 218943 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_38530 220283 219618 gene locus_tag LOCUS_38540 220283 219618 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_38540 221172 220333 gene locus_tag LOCUS_38550 221172 220333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 221934 221218 gene locus_tag LOCUS_38560 221934 221218 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532877.1 protein_id gnl|my_center|LOCUS_38560 222958 222026 gene locus_tag LOCUS_38570 222958 222026 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522925.1 protein_id gnl|my_center|LOCUS_38570 223099 223992 gene locus_tag LOCUS_38580 223099 223992 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_38580 224100 225485 gene locus_tag LOCUS_38590 224100 225485 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_38590 225544 226524 gene locus_tag LOCUS_38600 225544 226524 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 protein_id gnl|my_center|LOCUS_38600 227572 226574 gene locus_tag LOCUS_38610 227572 226574 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086817.1 protein_id gnl|my_center|LOCUS_38610 228459 227572 gene locus_tag LOCUS_38620 228459 227572 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391054.1 protein_id gnl|my_center|LOCUS_38620 229763 228552 gene locus_tag LOCUS_38630 229763 228552 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086815.1 protein_id gnl|my_center|LOCUS_38630 230550 229807 gene locus_tag LOCUS_38640 230550 229807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_38640 231310 230543 gene locus_tag LOCUS_38650 231310 230543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086813.1 protein_id gnl|my_center|LOCUS_38650 232524 231604 gene locus_tag LOCUS_38660 232524 231604 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257308.1 protein_id gnl|my_center|LOCUS_38660 233471 232554 gene locus_tag LOCUS_38670 233471 232554 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087311.1 protein_id gnl|my_center|LOCUS_38670 234409 233471 gene locus_tag LOCUS_38680 234409 233471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967433.1 protein_id gnl|my_center|LOCUS_38680 235403 234411 gene locus_tag LOCUS_38690 235403 234411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970323.1 protein_id gnl|my_center|LOCUS_38690 236419 235400 gene locus_tag LOCUS_38700 236419 235400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087314.1 protein_id gnl|my_center|LOCUS_38700 237981 236422 gene locus_tag LOCUS_38710 237981 236422 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087315.1 protein_id gnl|my_center|LOCUS_38710 238026 238169 gene locus_tag LOCUS_38720 238026 238169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 239379 238510 gene locus_tag LOCUS_38730 239379 238510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 240740 239448 gene locus_tag LOCUS_38740 240740 239448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 protein_id gnl|my_center|LOCUS_38740 241618 240773 gene locus_tag LOCUS_38750 241618 240773 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 protein_id gnl|my_center|LOCUS_38750 242562 241627 gene locus_tag LOCUS_38760 242562 241627 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 protein_id gnl|my_center|LOCUS_38760 243742 242555 gene locus_tag LOCUS_38770 243742 242555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 protein_id gnl|my_center|LOCUS_38770 244596 243880 gene locus_tag LOCUS_38780 gene phnF 244596 243880 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 protein_id gnl|my_center|LOCUS_38780 244999 246789 gene locus_tag LOCUS_38790 244999 246789 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965642.1 protein_id gnl|my_center|LOCUS_38790 246836 247795 gene locus_tag LOCUS_38800 246836 247795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084172.1 protein_id gnl|my_center|LOCUS_38800 247761 248702 gene locus_tag LOCUS_38810 247761 248702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_38810 248702 249718 gene locus_tag LOCUS_38820 248702 249718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084174.1 protein_id gnl|my_center|LOCUS_38820 249715 250689 gene locus_tag LOCUS_38830 249715 250689 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_38830 250815 252395 gene locus_tag LOCUS_38840 250815 252395 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087816.1 protein_id gnl|my_center|LOCUS_38840 >Feature sequence11 1135 3435 gene locus_tag LOCUS_38850 1135 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 3808 3491 gene locus_tag LOCUS_38860 3808 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 4018 4428 gene locus_tag LOCUS_38870 4018 4428 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090502.1 protein_id gnl|my_center|LOCUS_38870 5208 4510 gene locus_tag LOCUS_38880 5208 4510 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974864.1 protein_id gnl|my_center|LOCUS_38880 5687 6079 gene locus_tag LOCUS_38890 5687 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 6575 6087 gene locus_tag LOCUS_38900 6575 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 7207 6572 gene locus_tag LOCUS_38910 7207 6572 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197522.1 protein_id gnl|my_center|LOCUS_38910 8380 7448 gene locus_tag LOCUS_38920 8380 7448 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974553.1 protein_id gnl|my_center|LOCUS_38920 8607 9092 gene locus_tag LOCUS_38930 8607 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 10625 9156 gene locus_tag LOCUS_38940 gene gatB 10625 9156 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531347.1 protein_id gnl|my_center|LOCUS_38940 11509 10793 gene locus_tag LOCUS_38950 11509 10793 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 protein_id gnl|my_center|LOCUS_38950 12045 11506 gene locus_tag LOCUS_38960 12045 11506 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 protein_id gnl|my_center|LOCUS_38960 12241 13017 gene locus_tag LOCUS_38970 12241 13017 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384314.1 protein_id gnl|my_center|LOCUS_38970 13602 13384 gene locus_tag LOCUS_38980 13602 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 15175 13604 gene locus_tag LOCUS_38990 15175 13604 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531785.1 protein_id gnl|my_center|LOCUS_38990 15513 15181 gene locus_tag LOCUS_39000 gene gatC 15513 15181 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087850.1 protein_id gnl|my_center|LOCUS_39000 16075 15551 gene locus_tag LOCUS_39010 16075 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 16150 16701 gene locus_tag LOCUS_39020 16150 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 16705 17769 gene locus_tag LOCUS_39030 16705 17769 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175852.1 protein_id gnl|my_center|LOCUS_39030 18241 17807 gene locus_tag LOCUS_39040 18241 17807 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_39040 19847 18483 gene locus_tag LOCUS_39050 19847 18483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226511.1 protein_id gnl|my_center|LOCUS_39050 20778 20026 gene locus_tag LOCUS_39060 20778 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 21594 20881 gene locus_tag LOCUS_39070 21594 20881 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921493.1 protein_id gnl|my_center|LOCUS_39070 22200 22805 gene locus_tag LOCUS_39080 22200 22805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 23100 22924 gene locus_tag LOCUS_39090 23100 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 23023 23547 gene locus_tag LOCUS_39100 23023 23547 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176079.1 protein_id gnl|my_center|LOCUS_39100 24210 24794 gene locus_tag LOCUS_39110 24210 24794 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967896.1 protein_id gnl|my_center|LOCUS_39110 25536 24931 gene locus_tag LOCUS_39120 25536 24931 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_39120 26070 25540 gene locus_tag LOCUS_39130 26070 25540 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_39130 26460 26140 gene locus_tag LOCUS_39140 26460 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088330.1 protein_id gnl|my_center|LOCUS_39140 26809 26594 gene locus_tag LOCUS_39150 26809 26594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 27749 26943 gene locus_tag LOCUS_39160 gene cysE 27749 26943 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535018.1 protein_id gnl|my_center|LOCUS_39160 28874 28020 gene locus_tag LOCUS_39170 28874 28020 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_39170 29664 28885 gene locus_tag LOCUS_39180 29664 28885 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_39180 29860 32058 gene locus_tag LOCUS_39190 29860 32058 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850081.1 protein_id gnl|my_center|LOCUS_39190 32249 32683 gene locus_tag LOCUS_39200 32249 32683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 33629 32874 gene locus_tag LOCUS_39210 33629 32874 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_39210 33841 35268 gene locus_tag LOCUS_39220 33841 35268 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_39220 35278 36222 gene locus_tag LOCUS_39230 35278 36222 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_39230 36343 37170 gene locus_tag LOCUS_39240 36343 37170 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967763.1 protein_id gnl|my_center|LOCUS_39240 37381 38145 gene locus_tag LOCUS_39250 37381 38145 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_39250 38258 38752 gene locus_tag LOCUS_39260 gene gpt 38258 38752 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532017.1 protein_id gnl|my_center|LOCUS_39260 39181 42651 gene locus_tag LOCUS_39270 39181 42651 CDS product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268617.1 protein_id gnl|my_center|LOCUS_39270 43374 42682 gene locus_tag LOCUS_39280 43374 42682 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397506.1 protein_id gnl|my_center|LOCUS_39280 44297 43386 gene locus_tag LOCUS_39290 44297 43386 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397461.1 protein_id gnl|my_center|LOCUS_39290 45197 44385 gene locus_tag LOCUS_39300 45197 44385 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527793.1 protein_id gnl|my_center|LOCUS_39300 45614 45297 gene locus_tag LOCUS_39310 45614 45297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 45847 45692 gene locus_tag LOCUS_39320 45847 45692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 48820 46067 gene locus_tag LOCUS_39330 48820 46067 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162471479.1 protein_id gnl|my_center|LOCUS_39330 52389 49222 gene locus_tag LOCUS_39340 52389 49222 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162471479.1 protein_id gnl|my_center|LOCUS_39340 52849 53025 gene locus_tag LOCUS_39350 52849 53025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 53384 53300 gene locus_tag LOCUS_t00280 53384 53300 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55220 53676 gene locus_tag LOCUS_39360 55220 53676 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 protein_id gnl|my_center|LOCUS_39360 55307 55516 gene locus_tag LOCUS_39370 55307 55516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 56705 55848 gene locus_tag LOCUS_39380 56705 55848 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992426.1 protein_id gnl|my_center|LOCUS_39380 56943 58496 gene locus_tag LOCUS_39390 56943 58496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973485.1 protein_id gnl|my_center|LOCUS_39390 59197 58478 gene locus_tag LOCUS_39400 59197 58478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 59844 59194 gene locus_tag LOCUS_39410 59844 59194 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_39410 60866 59844 gene locus_tag LOCUS_39420 60866 59844 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_39420 61608 61009 gene locus_tag LOCUS_39430 gene wrbA 61608 61009 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971828.1 protein_id gnl|my_center|LOCUS_39430 61731 62651 gene locus_tag LOCUS_39440 61731 62651 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966037.1 protein_id gnl|my_center|LOCUS_39440 62779 64008 gene locus_tag LOCUS_39450 62779 64008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 64196 64726 gene locus_tag LOCUS_39460 64196 64726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 66013 64847 gene locus_tag LOCUS_39470 66013 64847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 67339 66143 gene locus_tag LOCUS_39480 67339 66143 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_39480 67598 67350 gene locus_tag LOCUS_39490 67598 67350 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602543.1 protein_id gnl|my_center|LOCUS_39490 68322 67705 gene locus_tag LOCUS_39500 68322 67705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 68937 68362 gene locus_tag LOCUS_39510 68937 68362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 69402 69061 gene locus_tag LOCUS_39520 69402 69061 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 protein_id gnl|my_center|LOCUS_39520 71241 69682 gene locus_tag LOCUS_39530 71241 69682 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_39530 72328 71225 gene locus_tag LOCUS_39540 72328 71225 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_39540 74259 72649 gene locus_tag LOCUS_39550 74259 72649 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 protein_id gnl|my_center|LOCUS_39550 74961 74284 gene locus_tag LOCUS_39560 74961 74284 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088406.1 protein_id gnl|my_center|LOCUS_39560 75344 74961 gene locus_tag LOCUS_39570 75344 74961 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_39570 76635 75586 gene locus_tag LOCUS_39580 76635 75586 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_39580 78207 77017 gene locus_tag LOCUS_39590 78207 77017 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_39590 78712 78218 gene locus_tag LOCUS_39600 78712 78218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 79640 78726 gene locus_tag LOCUS_39610 79640 78726 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532114.1 protein_id gnl|my_center|LOCUS_39610 80535 79696 gene locus_tag LOCUS_39620 80535 79696 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966645.1 protein_id gnl|my_center|LOCUS_39620 81547 80753 gene locus_tag LOCUS_39630 81547 80753 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_39630 83934 81565 gene locus_tag LOCUS_39640 83934 81565 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970339.1 protein_id gnl|my_center|LOCUS_39640 84497 84003 gene locus_tag LOCUS_39650 84497 84003 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027560187.1 protein_id gnl|my_center|LOCUS_39650 84777 85556 gene locus_tag LOCUS_39660 gene pcaD 84777 85556 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449960.1 protein_id gnl|my_center|LOCUS_39660 85568 85954 gene locus_tag LOCUS_39670 gene pcaC 85568 85954 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525590.1 protein_id gnl|my_center|LOCUS_39670 86212 86985 gene locus_tag LOCUS_39680 86212 86985 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527624.1 protein_id gnl|my_center|LOCUS_39680 87095 87721 gene locus_tag LOCUS_39690 87095 87721 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190802.1 protein_id gnl|my_center|LOCUS_39690 88282 87740 gene locus_tag LOCUS_39700 88282 87740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 88693 88412 gene locus_tag LOCUS_39710 88693 88412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 89340 88837 gene locus_tag LOCUS_39720 89340 88837 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532115.1 protein_id gnl|my_center|LOCUS_39720 89696 90613 gene locus_tag LOCUS_39730 89696 90613 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066620.1 protein_id gnl|my_center|LOCUS_39730 90618 92027 gene locus_tag LOCUS_39740 gene livM 90618 92027 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066619.1 protein_id gnl|my_center|LOCUS_39740 92024 92881 gene locus_tag LOCUS_39750 92024 92881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066618.1 protein_id gnl|my_center|LOCUS_39750 92878 93600 gene locus_tag LOCUS_39760 92878 93600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066617.1 protein_id gnl|my_center|LOCUS_39760 93600 93977 gene locus_tag LOCUS_39770 93600 93977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529096.1 protein_id gnl|my_center|LOCUS_39770 94108 95226 gene locus_tag LOCUS_39780 94108 95226 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394374.1 protein_id gnl|my_center|LOCUS_39780 96151 95420 gene locus_tag LOCUS_39790 96151 95420 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085573.1 protein_id gnl|my_center|LOCUS_39790 96340 97338 gene locus_tag LOCUS_39800 96340 97338 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526837.1 protein_id gnl|my_center|LOCUS_39800 97335 97994 gene locus_tag LOCUS_39810 97335 97994 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529481.1 protein_id gnl|my_center|LOCUS_39810 98631 98005 gene locus_tag LOCUS_39820 98631 98005 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528284.1 protein_id gnl|my_center|LOCUS_39820 98800 99075 gene locus_tag LOCUS_39830 98800 99075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 99992 99300 gene locus_tag LOCUS_39840 99992 99300 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_39840 100601 100056 gene locus_tag LOCUS_39850 100601 100056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 101862 100615 gene locus_tag LOCUS_39860 101862 100615 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_39860 101990 102673 gene locus_tag LOCUS_39870 gene rpe 101990 102673 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 protein_id gnl|my_center|LOCUS_39870 103026 103673 gene locus_tag LOCUS_39880 103026 103673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 103725 104429 gene locus_tag LOCUS_39890 103725 104429 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532119.1 protein_id gnl|my_center|LOCUS_39890 104510 105817 gene locus_tag LOCUS_39900 gene purB 104510 105817 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088436.1 protein_id gnl|my_center|LOCUS_39900 105822 106376 gene locus_tag LOCUS_39910 105822 106376 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971907.1 protein_id gnl|my_center|LOCUS_39910 107212 106433 gene locus_tag LOCUS_39920 107212 106433 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532125.1 protein_id gnl|my_center|LOCUS_39920 107409 108326 gene locus_tag LOCUS_39930 107409 108326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 108540 109115 gene locus_tag LOCUS_39940 gene rpsD 108540 109115 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088452.1 protein_id gnl|my_center|LOCUS_39940 110060 109446 gene locus_tag LOCUS_39950 110060 109446 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526566.1 protein_id gnl|my_center|LOCUS_39950 111373 110183 gene locus_tag LOCUS_39960 111373 110183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 111948 111592 gene locus_tag LOCUS_39970 gene grxD 111948 111592 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971914.1 protein_id gnl|my_center|LOCUS_39970 112219 111986 gene locus_tag LOCUS_39980 112219 111986 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_39980 114463 112235 gene locus_tag LOCUS_39990 gene purL 114463 112235 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088464.1 protein_id gnl|my_center|LOCUS_39990 115342 114644 gene locus_tag LOCUS_40000 gene purQ 115342 114644 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_40000 116086 115391 gene locus_tag LOCUS_40010 116086 115391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 116432 116193 gene locus_tag LOCUS_40020 gene purS 116432 116193 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088473.1 protein_id gnl|my_center|LOCUS_40020 117097 116549 gene locus_tag LOCUS_40030 117097 116549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 117915 117217 gene locus_tag LOCUS_40040 117915 117217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 118923 118036 gene locus_tag LOCUS_40050 118923 118036 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008974302.1 protein_id gnl|my_center|LOCUS_40050 119090 119410 gene locus_tag LOCUS_40060 119090 119410 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_40060 120899 119553 gene locus_tag LOCUS_40070 120899 119553 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170976.1 protein_id gnl|my_center|LOCUS_40070 122499 121156 gene locus_tag LOCUS_40080 122499 121156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 123913 122705 gene locus_tag LOCUS_40090 123913 122705 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088490.1 protein_id gnl|my_center|LOCUS_40090 124120 125340 gene locus_tag LOCUS_40100 124120 125340 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088491.1 protein_id gnl|my_center|LOCUS_40100 125833 127881 gene locus_tag LOCUS_40110 125833 127881 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112213.1 protein_id gnl|my_center|LOCUS_40110 127980 128423 gene locus_tag LOCUS_40120 127980 128423 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064706.1 protein_id gnl|my_center|LOCUS_40120 131415 128758 gene locus_tag LOCUS_40130 gene alaS 131415 128758 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967195.1 protein_id gnl|my_center|LOCUS_40130 132743 131703 gene locus_tag LOCUS_40140 gene recA 132743 131703 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088499.1 protein_id gnl|my_center|LOCUS_40140 133490 132957 gene locus_tag LOCUS_40150 133490 132957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 133879 134796 gene locus_tag LOCUS_40160 133879 134796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 135342 134935 gene locus_tag LOCUS_40170 135342 134935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 136149 137408 gene locus_tag LOCUS_40180 136149 137408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267750.1 protein_id gnl|my_center|LOCUS_40180 137708 138862 gene locus_tag LOCUS_40190 137708 138862 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214492.1 protein_id gnl|my_center|LOCUS_40190 139256 140791 gene locus_tag LOCUS_40200 139256 140791 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530751.1 protein_id gnl|my_center|LOCUS_40200 141890 141066 gene locus_tag LOCUS_40210 141890 141066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967495.1 protein_id gnl|my_center|LOCUS_40210 142654 141962 gene locus_tag LOCUS_40220 142654 141962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967496.1 protein_id gnl|my_center|LOCUS_40220 144075 142921 gene locus_tag LOCUS_40230 144075 142921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394854.1 protein_id gnl|my_center|LOCUS_40230 145360 144260 gene locus_tag LOCUS_40240 145360 144260 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 protein_id gnl|my_center|LOCUS_40240 146272 147405 gene locus_tag LOCUS_40250 146272 147405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 147648 148937 gene locus_tag LOCUS_40260 147648 148937 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532883.1 protein_id gnl|my_center|LOCUS_40260 150149 149220 gene locus_tag LOCUS_40270 150149 149220 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527624.1 protein_id gnl|my_center|LOCUS_40270 150356 151198 gene locus_tag LOCUS_40280 150356 151198 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974278.1 protein_id gnl|my_center|LOCUS_40280 151333 152694 gene locus_tag LOCUS_40290 151333 152694 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086651.1 protein_id gnl|my_center|LOCUS_40290 152795 155980 gene locus_tag LOCUS_40300 152795 155980 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968567.1 protein_id gnl|my_center|LOCUS_40300 159626 156507 gene locus_tag LOCUS_40310 159626 156507 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086679.1 protein_id gnl|my_center|LOCUS_40310 160783 159623 gene locus_tag LOCUS_40320 160783 159623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40320 162302 161616 gene locus_tag LOCUS_40330 162302 161616 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926062.1 protein_id gnl|my_center|LOCUS_40330 162832 162332 gene locus_tag LOCUS_40340 162832 162332 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_40340 163557 162943 gene locus_tag LOCUS_40350 163557 162943 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971405.1 protein_id gnl|my_center|LOCUS_40350 165152 163554 gene locus_tag LOCUS_40360 165152 163554 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650617.1 protein_id gnl|my_center|LOCUS_40360 166404 165322 gene locus_tag LOCUS_40370 166404 165322 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404360.1 protein_id gnl|my_center|LOCUS_40370 167177 166401 gene locus_tag LOCUS_40380 gene fabG 167177 166401 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_40380 168011 167184 gene locus_tag LOCUS_40390 168011 167184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 168877 168017 gene locus_tag LOCUS_40400 168877 168017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 170249 168933 gene locus_tag LOCUS_40410 170249 168933 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_40410 171345 170278 gene locus_tag LOCUS_40420 gene ugpC 171345 170278 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972815.1 protein_id gnl|my_center|LOCUS_40420 172865 171348 gene locus_tag LOCUS_40430 gene xylB 172865 171348 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_40430 174339 172858 gene locus_tag LOCUS_40440 174339 172858 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 protein_id gnl|my_center|LOCUS_40440 175747 174737 gene locus_tag LOCUS_40450 175747 174737 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931013.1 protein_id gnl|my_center|LOCUS_40450 175810 176160 gene locus_tag LOCUS_40460 175810 176160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 176318 177037 gene locus_tag LOCUS_40470 176318 177037 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 protein_id gnl|my_center|LOCUS_40470 177195 178046 gene locus_tag LOCUS_40480 177195 178046 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820328.1 protein_id gnl|my_center|LOCUS_40480 178137 179720 gene locus_tag LOCUS_40490 178137 179720 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_40490 180225 181418 gene locus_tag LOCUS_40500 180225 181418 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 protein_id gnl|my_center|LOCUS_40500 182545 181442 gene locus_tag LOCUS_40510 182545 181442 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_40510 182838 184112 gene locus_tag LOCUS_40520 182838 184112 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_40520 184322 184083 gene locus_tag LOCUS_40530 184322 184083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 184528 184373 gene locus_tag LOCUS_40540 184528 184373 CDS product DUF3096 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528205.1 protein_id gnl|my_center|LOCUS_40540 184858 184694 gene locus_tag LOCUS_40550 184858 184694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 186093 185119 gene locus_tag LOCUS_40560 186093 185119 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975650.1 protein_id gnl|my_center|LOCUS_40560 186192 186596 gene locus_tag LOCUS_40570 186192 186596 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850743.1 protein_id gnl|my_center|LOCUS_40570 187951 186593 gene locus_tag LOCUS_40580 187951 186593 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_40580 188206 189165 gene locus_tag LOCUS_40590 188206 189165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 189162 190040 gene locus_tag LOCUS_40600 189162 190040 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_40600 190040 191242 gene locus_tag LOCUS_40610 190040 191242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 191239 192390 gene locus_tag LOCUS_40620 191239 192390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_40620 192387 193379 gene locus_tag LOCUS_40630 192387 193379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 195104 193374 gene locus_tag LOCUS_40640 195104 193374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 195285 196364 gene locus_tag LOCUS_40650 195285 196364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 196936 196385 gene locus_tag LOCUS_40660 196936 196385 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 protein_id gnl|my_center|LOCUS_40660 197118 198158 gene locus_tag LOCUS_40670 197118 198158 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967048.1 protein_id gnl|my_center|LOCUS_40670 198778 198287 gene locus_tag LOCUS_40680 198778 198287 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388632.1 protein_id gnl|my_center|LOCUS_40680 198950 199396 gene locus_tag LOCUS_40690 198950 199396 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 protein_id gnl|my_center|LOCUS_40690 199442 200113 gene locus_tag LOCUS_40700 199442 200113 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 protein_id gnl|my_center|LOCUS_40700 200175 201677 gene locus_tag LOCUS_40710 200175 201677 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965215.1 protein_id gnl|my_center|LOCUS_40710 201809 202510 gene locus_tag LOCUS_40720 201809 202510 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533651.1 protein_id gnl|my_center|LOCUS_40720 204298 202862 gene locus_tag LOCUS_40730 204298 202862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 206340 204781 gene locus_tag LOCUS_40740 206340 204781 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_40740 206559 208160 gene locus_tag LOCUS_40750 gene rtcR 206559 208160 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_40750 208763 208269 gene locus_tag LOCUS_40760 208763 208269 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 protein_id gnl|my_center|LOCUS_40760 208869 210053 gene locus_tag LOCUS_40770 208869 210053 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 protein_id gnl|my_center|LOCUS_40770 210091 211329 gene locus_tag LOCUS_40780 210091 211329 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_40780 211340 212509 gene locus_tag LOCUS_40790 211340 212509 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532460.1 protein_id gnl|my_center|LOCUS_40790 212549 213322 gene locus_tag LOCUS_40800 212549 213322 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 protein_id gnl|my_center|LOCUS_40800 213352 214344 gene locus_tag LOCUS_40810 213352 214344 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 protein_id gnl|my_center|LOCUS_40810 214918 214643 gene locus_tag LOCUS_40820 214918 214643 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227424.1 protein_id gnl|my_center|LOCUS_40820 215105 216085 gene locus_tag LOCUS_40830 215105 216085 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_40830 217011 216307 gene locus_tag LOCUS_40840 217011 216307 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441056.1 protein_id gnl|my_center|LOCUS_40840 217921 217016 gene locus_tag LOCUS_40850 217921 217016 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_40850 218088 219074 gene locus_tag LOCUS_40860 218088 219074 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_40860 219482 219862 gene locus_tag LOCUS_40870 219482 219862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 219927 220709 gene locus_tag LOCUS_40880 219927 220709 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018237596.1 protein_id gnl|my_center|LOCUS_40880 220819 221628 gene locus_tag LOCUS_40890 220819 221628 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975902.1 protein_id gnl|my_center|LOCUS_40890 222483 221659 gene locus_tag LOCUS_40900 222483 221659 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087483.1 protein_id gnl|my_center|LOCUS_40900 223894 222719 gene locus_tag LOCUS_40910 223894 222719 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966314.1 protein_id gnl|my_center|LOCUS_40910 224135 226213 gene locus_tag LOCUS_40920 224135 226213 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_40920 226210 227145 gene locus_tag LOCUS_40930 226210 227145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 227733 227212 gene locus_tag LOCUS_40940 227733 227212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 >Feature sequence12 <1 724 gene locus_tag LOCUS_40950 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532982.1:ABC transporter ATP-binding protein 721 1620 gene locus_tag LOCUS_40960 721 1620 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_40960 1617 2594 gene locus_tag LOCUS_40970 1617 2594 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_40970 2591 3874 gene locus_tag LOCUS_40980 2591 3874 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 protein_id gnl|my_center|LOCUS_40980 3889 4941 gene locus_tag LOCUS_40990 3889 4941 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_40990 4959 5306 gene locus_tag LOCUS_41000 4959 5306 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532978.1 protein_id gnl|my_center|LOCUS_41000 5338 8730 gene locus_tag LOCUS_41010 5338 8730 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033458904.1 protein_id gnl|my_center|LOCUS_41010 9475 8741 gene locus_tag LOCUS_41020 9475 8741 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820133.1 protein_id gnl|my_center|LOCUS_41020 10496 9522 gene locus_tag LOCUS_41030 10496 9522 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967041.1 protein_id gnl|my_center|LOCUS_41030 10826 10587 gene locus_tag LOCUS_41040 10826 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 10716 11837 gene locus_tag LOCUS_41050 10716 11837 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_41050 11955 12800 gene locus_tag LOCUS_41060 11955 12800 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973992.1 protein_id gnl|my_center|LOCUS_41060 13854 13240 gene locus_tag LOCUS_41070 13854 13240 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661920.1 protein_id gnl|my_center|LOCUS_41070 14160 14990 gene locus_tag LOCUS_41080 14160 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 15285 15025 gene locus_tag LOCUS_41090 15285 15025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 15547 15849 gene locus_tag LOCUS_41100 15547 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327215.1 protein_id gnl|my_center|LOCUS_41100 16136 16582 gene locus_tag LOCUS_41110 16136 16582 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 protein_id gnl|my_center|LOCUS_41110 16600 16953 gene locus_tag LOCUS_41120 16600 16953 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525103.1 protein_id gnl|my_center|LOCUS_41120 17405 16983 gene locus_tag LOCUS_41130 17405 16983 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088304.1 protein_id gnl|my_center|LOCUS_41130 17891 19147 gene locus_tag LOCUS_41140 17891 19147 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532855.1 protein_id gnl|my_center|LOCUS_41140 19270 20343 gene locus_tag LOCUS_41150 19270 20343 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723133.1 protein_id gnl|my_center|LOCUS_41150 20400 21962 gene locus_tag LOCUS_41160 20400 21962 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_41160 21966 22622 gene locus_tag LOCUS_41170 21966 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 22623 23732 gene locus_tag LOCUS_41180 22623 23732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 24788 23901 gene locus_tag LOCUS_41190 24788 23901 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968028.1 protein_id gnl|my_center|LOCUS_41190 24874 25806 gene locus_tag LOCUS_41200 24874 25806 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968027.1 protein_id gnl|my_center|LOCUS_41200 25790 25945 gene locus_tag LOCUS_41210 25790 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 26167 26568 gene locus_tag LOCUS_41220 26167 26568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083216.1 protein_id gnl|my_center|LOCUS_41220 26722 29895 gene locus_tag LOCUS_41230 26722 29895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 30135 31379 gene locus_tag LOCUS_41240 30135 31379 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391241.1 protein_id gnl|my_center|LOCUS_41240 31740 32423 gene locus_tag LOCUS_41250 31740 32423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41250 32563 34920 gene locus_tag LOCUS_41260 32563 34920 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966057.1 protein_id gnl|my_center|LOCUS_41260 34950 35537 gene locus_tag LOCUS_41270 34950 35537 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172196.1 protein_id gnl|my_center|LOCUS_41270 35862 35560 gene locus_tag LOCUS_41280 35862 35560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 37011 35878 gene locus_tag LOCUS_41290 37011 35878 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612426.1 protein_id gnl|my_center|LOCUS_41290 37531 37013 gene locus_tag LOCUS_41300 37531 37013 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043111304.1 protein_id gnl|my_center|LOCUS_41300 38287 37613 gene locus_tag LOCUS_41310 38287 37613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 38972 38268 gene locus_tag LOCUS_41320 38972 38268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_41320 39706 38966 gene locus_tag LOCUS_41330 39706 38966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_41330 40704 39694 gene locus_tag LOCUS_41340 40704 39694 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_41340 41585 40701 gene locus_tag LOCUS_41350 41585 40701 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_41350 42919 41651 gene locus_tag LOCUS_41360 42919 41651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089219.1 protein_id gnl|my_center|LOCUS_41360 44164 43391 gene locus_tag LOCUS_41370 44164 43391 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171680.1 protein_id gnl|my_center|LOCUS_41370 44419 45930 gene locus_tag LOCUS_41380 44419 45930 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538182.1 protein_id gnl|my_center|LOCUS_41380 45908 47524 gene locus_tag LOCUS_41390 45908 47524 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_41390 47640 47449 gene locus_tag LOCUS_41400 47640 47449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 48664 47948 gene locus_tag LOCUS_41410 48664 47948 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086928.1 protein_id gnl|my_center|LOCUS_41410 48740 50170 gene locus_tag LOCUS_41420 48740 50170 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086927.1 protein_id gnl|my_center|LOCUS_41420 50403 50149 gene locus_tag LOCUS_41430 50403 50149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 50532 51833 gene locus_tag LOCUS_41440 50532 51833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 52241 51885 gene locus_tag LOCUS_41450 52241 51885 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_41450 53154 52462 gene locus_tag LOCUS_41460 53154 52462 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119576.1 protein_id gnl|my_center|LOCUS_41460 54271 53141 gene locus_tag LOCUS_41470 54271 53141 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_41470 55446 54268 gene locus_tag LOCUS_41480 55446 54268 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_41480 55548 56369 gene locus_tag LOCUS_41490 55548 56369 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969060.1 protein_id gnl|my_center|LOCUS_41490 56584 58236 gene locus_tag LOCUS_41500 56584 58236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 58463 58807 gene locus_tag LOCUS_41510 58463 58807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 60061 58895 gene locus_tag LOCUS_41520 gene ampC 60061 58895 CDS product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972736.1 protein_id gnl|my_center|LOCUS_41520 60806 60186 gene locus_tag LOCUS_41530 60806 60186 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082512.1 protein_id gnl|my_center|LOCUS_41530 60886 61515 gene locus_tag LOCUS_41540 60886 61515 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003133652.1 protein_id gnl|my_center|LOCUS_41540 62568 61546 gene locus_tag LOCUS_41550 62568 61546 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258670.1 protein_id gnl|my_center|LOCUS_41550 63288 62668 gene locus_tag LOCUS_41560 63288 62668 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_41560 63592 64068 gene locus_tag LOCUS_41570 63592 64068 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_41570 64065 65048 gene locus_tag LOCUS_41580 64065 65048 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530701.1 protein_id gnl|my_center|LOCUS_41580 65045 67345 gene locus_tag LOCUS_41590 65045 67345 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530700.1 protein_id gnl|my_center|LOCUS_41590 67568 68305 gene locus_tag LOCUS_41600 67568 68305 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978344.1 protein_id gnl|my_center|LOCUS_41600 68553 68326 gene locus_tag LOCUS_41610 68553 68326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 68471 68890 gene locus_tag LOCUS_41620 68471 68890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 68900 69109 gene locus_tag LOCUS_41630 68900 69109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 70339 69155 gene locus_tag LOCUS_41640 70339 69155 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767567.1 protein_id gnl|my_center|LOCUS_41640 71193 70489 gene locus_tag LOCUS_41650 71193 70489 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528391.1 protein_id gnl|my_center|LOCUS_41650 71482 72864 gene locus_tag LOCUS_41660 71482 72864 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_41660 72992 74020 gene locus_tag LOCUS_41670 72992 74020 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_41670 74026 74472 gene locus_tag LOCUS_41680 74026 74472 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088400.1 protein_id gnl|my_center|LOCUS_41680 74737 74543 gene locus_tag LOCUS_41690 74737 74543 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 protein_id gnl|my_center|LOCUS_41690 76273 75290 gene locus_tag LOCUS_41700 76273 75290 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_41700 77096 76320 gene locus_tag LOCUS_41710 77096 76320 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974484.1 protein_id gnl|my_center|LOCUS_41710 77311 77117 gene locus_tag LOCUS_41720 77311 77117 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 protein_id gnl|my_center|LOCUS_41720 78542 77385 gene locus_tag LOCUS_41730 78542 77385 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612426.1 protein_id gnl|my_center|LOCUS_41730 79401 78571 gene locus_tag LOCUS_41740 79401 78571 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974484.1 protein_id gnl|my_center|LOCUS_41740 79861 81114 gene locus_tag LOCUS_41750 gene proV 79861 81114 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707141.1 protein_id gnl|my_center|LOCUS_41750 81127 82038 gene locus_tag LOCUS_41760 81127 82038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 82105 83151 gene locus_tag LOCUS_41770 gene proX 82105 83151 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098425.1 protein_id gnl|my_center|LOCUS_41770 83762 83382 gene locus_tag LOCUS_41780 83762 83382 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090034.1 protein_id gnl|my_center|LOCUS_41780 83861 84715 gene locus_tag LOCUS_41790 83861 84715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992426.1 protein_id gnl|my_center|LOCUS_41790 85613 84975 gene locus_tag LOCUS_41800 85613 84975 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948076.1 protein_id gnl|my_center|LOCUS_41800 86554 85730 gene locus_tag LOCUS_41810 86554 85730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244800.1 protein_id gnl|my_center|LOCUS_41810 86698 87612 gene locus_tag LOCUS_41820 86698 87612 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 protein_id gnl|my_center|LOCUS_41820 87728 88063 gene locus_tag LOCUS_41830 87728 88063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 88234 89967 gene locus_tag LOCUS_41840 88234 89967 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_41840 90242 90967 gene locus_tag LOCUS_41850 90242 90967 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_41850 90964 91182 gene locus_tag LOCUS_41860 90964 91182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 91179 92561 gene locus_tag LOCUS_41870 91179 92561 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969923.1 protein_id gnl|my_center|LOCUS_41870 92917 92558 gene locus_tag LOCUS_41880 92917 92558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532336.1 protein_id gnl|my_center|LOCUS_41880 93378 92932 gene locus_tag LOCUS_41890 93378 92932 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_41890 93493 94131 gene locus_tag LOCUS_41900 93493 94131 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528210.1 protein_id gnl|my_center|LOCUS_41900 94249 94905 gene locus_tag LOCUS_41910 94249 94905 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532259.1 protein_id gnl|my_center|LOCUS_41910 95541 94939 gene locus_tag LOCUS_41920 95541 94939 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120394.1 protein_id gnl|my_center|LOCUS_41920 96658 95585 gene locus_tag LOCUS_41930 96658 95585 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_41930 97460 96663 gene locus_tag LOCUS_41940 gene thiD 97460 96663 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_41940 98134 97457 gene locus_tag LOCUS_41950 gene thiE 98134 97457 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972915.1 protein_id gnl|my_center|LOCUS_41950 98926 98147 gene locus_tag LOCUS_41960 98926 98147 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972914.1 protein_id gnl|my_center|LOCUS_41960 98837 99043 gene locus_tag LOCUS_41970 98837 99043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 99181 99417 gene locus_tag LOCUS_41980 99181 99417 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014493934.1 protein_id gnl|my_center|LOCUS_41980 101639 99855 gene locus_tag LOCUS_41990 101639 99855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 102207 102821 gene locus_tag LOCUS_42000 102207 102821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 103962 102853 gene locus_tag LOCUS_42010 103962 102853 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 protein_id gnl|my_center|LOCUS_42010 104610 104182 gene locus_tag LOCUS_42020 104610 104182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 105537 104635 gene locus_tag LOCUS_42030 105537 104635 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921380.1 protein_id gnl|my_center|LOCUS_42030 105855 106259 gene locus_tag LOCUS_42040 105855 106259 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_42040 107138 106302 gene locus_tag LOCUS_42050 107138 106302 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028804.1 protein_id gnl|my_center|LOCUS_42050 109876 107579 gene locus_tag LOCUS_42060 109876 107579 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532625.1 protein_id gnl|my_center|LOCUS_42060 110279 110055 gene locus_tag LOCUS_42070 110279 110055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 110439 111449 gene locus_tag LOCUS_42080 110439 111449 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085506.1 protein_id gnl|my_center|LOCUS_42080 113208 111658 gene locus_tag LOCUS_42090 gene murJ 113208 111658 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088657.1 protein_id gnl|my_center|LOCUS_42090 114102 113380 gene locus_tag LOCUS_42100 114102 113380 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986655.1 protein_id gnl|my_center|LOCUS_42100 114359 115342 gene locus_tag LOCUS_42110 114359 115342 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_42110 115555 117015 gene locus_tag LOCUS_42120 gene rkpK 115555 117015 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969031.1 protein_id gnl|my_center|LOCUS_42120 117076 118062 gene locus_tag LOCUS_42130 gene galE 117076 118062 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_42130 118477 118929 gene locus_tag LOCUS_42140 118477 118929 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920131.1 protein_id gnl|my_center|LOCUS_42140 118943 121084 gene locus_tag LOCUS_42150 118943 121084 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965397.1 protein_id gnl|my_center|LOCUS_42150 121702 121433 gene locus_tag LOCUS_42160 121702 121433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 122649 121918 gene locus_tag LOCUS_42170 gene flgF 122649 121918 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088570.1 protein_id gnl|my_center|LOCUS_42170 123023 123358 gene locus_tag LOCUS_42180 123023 123358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 123857 124402 gene locus_tag LOCUS_42190 123857 124402 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966368.1 protein_id gnl|my_center|LOCUS_42190 124944 125921 gene locus_tag LOCUS_42200 124944 125921 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_42200 126178 126843 gene locus_tag LOCUS_42210 126178 126843 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_42210 127358 127846 gene locus_tag LOCUS_42220 127358 127846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 128967 128101 gene locus_tag LOCUS_42230 128967 128101 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085626.1 protein_id gnl|my_center|LOCUS_42230 130619 129432 gene locus_tag LOCUS_42240 130619 129432 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085625.1 protein_id gnl|my_center|LOCUS_42240 131785 130634 gene locus_tag LOCUS_42250 131785 130634 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085624.1 protein_id gnl|my_center|LOCUS_42250 133182 131782 gene locus_tag LOCUS_42260 133182 131782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085623.1 protein_id gnl|my_center|LOCUS_42260 134003 133185 gene locus_tag LOCUS_42270 134003 133185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_42270 135368 134349 gene locus_tag LOCUS_42280 135368 134349 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965807.1 protein_id gnl|my_center|LOCUS_42280 136206 135433 gene locus_tag LOCUS_42290 136206 135433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_42290 137517 136381 gene locus_tag LOCUS_42300 137517 136381 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_42300 137851 137570 gene locus_tag LOCUS_42310 137851 137570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 137765 138028 gene locus_tag LOCUS_42320 137765 138028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 138252 140216 gene locus_tag LOCUS_42330 138252 140216 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967035.1 protein_id gnl|my_center|LOCUS_42330 141749 140244 gene locus_tag LOCUS_42340 141749 140244 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969656.1 protein_id gnl|my_center|LOCUS_42340 143389 141749 gene locus_tag LOCUS_42350 143389 141749 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525076.1 protein_id gnl|my_center|LOCUS_42350 146911 144170 gene locus_tag LOCUS_42360 146911 144170 CDS product M10 family metallopeptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921503.1 protein_id gnl|my_center|LOCUS_42360 147132 147401 gene locus_tag LOCUS_42370 147132 147401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 148310 150403 gene locus_tag LOCUS_42380 148310 150403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 151610 150420 gene locus_tag LOCUS_42390 151610 150420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 152106 151804 gene locus_tag LOCUS_42400 152106 151804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 152105 153148 gene locus_tag LOCUS_42410 gene wlbD 152105 153148 CDS product O-antigen biosynthesis protein WlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447875.1 protein_id gnl|my_center|LOCUS_42410 153973 153743 gene locus_tag LOCUS_42420 153973 153743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 154097 155287 gene locus_tag LOCUS_42430 154097 155287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 155396 156229 gene locus_tag LOCUS_42440 155396 156229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 157163 156411 gene locus_tag LOCUS_42450 157163 156411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 protein_id gnl|my_center|LOCUS_42450 157348 157175 gene locus_tag LOCUS_42460 157348 157175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 159101 158040 gene locus_tag LOCUS_42470 159101 158040 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447870.1 protein_id gnl|my_center|LOCUS_42470 160140 159187 gene locus_tag LOCUS_42480 160140 159187 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807092.1 protein_id gnl|my_center|LOCUS_42480 161113 160154 gene locus_tag LOCUS_42490 161113 160154 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_42490 163077 161140 gene locus_tag LOCUS_42500 gene asnB 163077 161140 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_42500 165216 163315 gene locus_tag LOCUS_42510 gene asnB 165216 163315 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_42510 165991 165311 gene locus_tag LOCUS_42520 165991 165311 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957830.1 protein_id gnl|my_center|LOCUS_42520 167260 166034 gene locus_tag LOCUS_42530 167260 166034 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929975.1 protein_id gnl|my_center|LOCUS_42530 168499 167363 gene locus_tag LOCUS_42540 168499 167363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 169229 168624 gene locus_tag LOCUS_42550 169229 168624 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_42550 170173 169235 gene locus_tag LOCUS_42560 170173 169235 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_42560 171552 170206 gene locus_tag LOCUS_42570 171552 170206 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_42570 171922 173070 gene locus_tag LOCUS_42580 171922 173070 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_42580 173509 174639 gene locus_tag LOCUS_42590 173509 174639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 174680 175786 gene locus_tag LOCUS_42600 174680 175786 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088663.1 protein_id gnl|my_center|LOCUS_42600 175783 176703 gene locus_tag LOCUS_42610 175783 176703 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088664.1 protein_id gnl|my_center|LOCUS_42610 178147 176711 gene locus_tag LOCUS_42620 178147 176711 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173221.1 protein_id gnl|my_center|LOCUS_42620 179602 178295 gene locus_tag LOCUS_42630 179602 178295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 180379 179630 gene locus_tag LOCUS_42640 gene fabG 180379 179630 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_42640 181656 180379 gene locus_tag LOCUS_42650 181656 180379 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086589.1 protein_id gnl|my_center|LOCUS_42650 182870 181668 gene locus_tag LOCUS_42660 182870 181668 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086590.1 protein_id gnl|my_center|LOCUS_42660 183371 182898 gene locus_tag LOCUS_42670 183371 182898 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328697.1 protein_id gnl|my_center|LOCUS_42670 183681 183400 gene locus_tag LOCUS_42680 183681 183400 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007592476.1 protein_id gnl|my_center|LOCUS_42680 183987 185009 gene locus_tag LOCUS_42690 183987 185009 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975876.1 protein_id gnl|my_center|LOCUS_42690 185024 185938 gene locus_tag LOCUS_42700 185024 185938 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_42700 186566 187696 gene locus_tag LOCUS_42710 186566 187696 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_42710 187696 189093 gene locus_tag LOCUS_42720 187696 189093 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931468.1 protein_id gnl|my_center|LOCUS_42720 189585 189082 gene locus_tag LOCUS_42730 189585 189082 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143849.1 protein_id gnl|my_center|LOCUS_42730 189644 191146 gene locus_tag LOCUS_42740 189644 191146 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031842.1 protein_id gnl|my_center|LOCUS_42740 192568 191351 gene locus_tag LOCUS_42750 192568 191351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 protein_id gnl|my_center|LOCUS_42750 193249 192665 gene locus_tag LOCUS_42760 193249 192665 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 protein_id gnl|my_center|LOCUS_42760 193390 193668 gene locus_tag LOCUS_42770 193390 193668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 194032 195207 gene locus_tag LOCUS_42780 194032 195207 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028757.1 protein_id gnl|my_center|LOCUS_42780 196471 195227 gene locus_tag LOCUS_42790 196471 195227 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208960.1 protein_id gnl|my_center|LOCUS_42790 196595 197293 gene locus_tag LOCUS_42800 gene rutB 196595 197293 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266760.1 protein_id gnl|my_center|LOCUS_42800 197306 197764 gene locus_tag LOCUS_42810 197306 197764 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036037.1 protein_id gnl|my_center|LOCUS_42810 197961 199190 gene locus_tag LOCUS_42820 197961 199190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 199245 200456 gene locus_tag LOCUS_42830 199245 200456 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_42830 200453 201322 gene locus_tag LOCUS_42840 200453 201322 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088693.1 protein_id gnl|my_center|LOCUS_42840 201319 202272 gene locus_tag LOCUS_42850 201319 202272 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088692.1 protein_id gnl|my_center|LOCUS_42850 202269 203030 gene locus_tag LOCUS_42860 202269 203030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973920.1 protein_id gnl|my_center|LOCUS_42860 203017 203712 gene locus_tag LOCUS_42870 203017 203712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088690.1 protein_id gnl|my_center|LOCUS_42870 203747 204556 gene locus_tag LOCUS_42880 203747 204556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 205945 204773 gene locus_tag LOCUS_42890 205945 204773 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965540.1 protein_id gnl|my_center|LOCUS_42890 206942 206055 gene locus_tag LOCUS_42900 gene gcvA 206942 206055 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530746.1 protein_id gnl|my_center|LOCUS_42900 207058 207759 gene locus_tag LOCUS_42910 207058 207759 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088050.1 protein_id gnl|my_center|LOCUS_42910 208520 207780 gene locus_tag LOCUS_42920 208520 207780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 208894 208451 gene locus_tag LOCUS_42930 gene aroQ 208894 208451 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084019.1 protein_id gnl|my_center|LOCUS_42930 210236 208956 gene locus_tag LOCUS_42940 210236 208956 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243758.1 protein_id gnl|my_center|LOCUS_42940 210795 210277 gene locus_tag LOCUS_42950 210795 210277 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243841.1 protein_id gnl|my_center|LOCUS_42950 212069 211050 gene locus_tag LOCUS_42960 212069 211050 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_42960 213033 212368 gene locus_tag LOCUS_42970 213033 212368 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382872.1 protein_id gnl|my_center|LOCUS_42970 213718 213050 gene locus_tag LOCUS_42980 213718 213050 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382872.1 protein_id gnl|my_center|LOCUS_42980 213947 215944 gene locus_tag LOCUS_42990 213947 215944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 216192 217814 gene locus_tag LOCUS_43000 216192 217814 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_43000 >Feature sequence13 175 477 gene locus_tag LOCUS_43010 gene cas2e 175 477 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625880.1 protein_id gnl|my_center|LOCUS_43010 610 2771 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgccccgcctgcgcggggatgaaccg 3030 4247 gene locus_tag LOCUS_43020 3030 4247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_43020 5340 4342 gene locus_tag LOCUS_43030 5340 4342 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965312.1 protein_id gnl|my_center|LOCUS_43030 6245 5376 gene locus_tag LOCUS_43040 6245 5376 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084060.1 protein_id gnl|my_center|LOCUS_43040 6919 6287 gene locus_tag LOCUS_43050 6919 6287 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_43050 7302 6916 gene locus_tag LOCUS_43060 7302 6916 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084059.1 protein_id gnl|my_center|LOCUS_43060 8116 7313 gene locus_tag LOCUS_43070 gene hpaH 8116 7313 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085754.1 protein_id gnl|my_center|LOCUS_43070 9008 8151 gene locus_tag LOCUS_43080 9008 8151 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084057.1 protein_id gnl|my_center|LOCUS_43080 9143 9961 gene locus_tag LOCUS_43090 9143 9961 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965302.1 protein_id gnl|my_center|LOCUS_43090 10279 14088 gene locus_tag LOCUS_43100 10279 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 14132 16753 gene locus_tag LOCUS_43110 14132 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 16866 18788 gene locus_tag LOCUS_43120 16866 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 20136 18862 gene locus_tag LOCUS_43130 20136 18862 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058397906.1 protein_id gnl|my_center|LOCUS_43130 20843 20175 gene locus_tag LOCUS_43140 20843 20175 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243598.1 protein_id gnl|my_center|LOCUS_43140 21131 21991 gene locus_tag LOCUS_43150 21131 21991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268411.1 protein_id gnl|my_center|LOCUS_43150 22176 22670 gene locus_tag LOCUS_43160 22176 22670 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 protein_id gnl|my_center|LOCUS_43160 22924 23844 gene locus_tag LOCUS_43170 22924 23844 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_43170 23875 24321 gene locus_tag LOCUS_43180 23875 24321 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814615.1 protein_id gnl|my_center|LOCUS_43180 24339 25838 gene locus_tag LOCUS_43190 24339 25838 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063702.1 protein_id gnl|my_center|LOCUS_43190 26482 25865 gene locus_tag LOCUS_43200 26482 25865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170693.1 protein_id gnl|my_center|LOCUS_43200 26923 28074 gene locus_tag LOCUS_43210 26923 28074 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965185.1 protein_id gnl|my_center|LOCUS_43210 28518 28156 gene locus_tag LOCUS_43220 28518 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 30225 28687 gene locus_tag LOCUS_43230 30225 28687 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 protein_id gnl|my_center|LOCUS_43230 30471 32018 gene locus_tag LOCUS_43240 30471 32018 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533003.1 protein_id gnl|my_center|LOCUS_43240 32300 33274 gene locus_tag LOCUS_43250 32300 33274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533004.1 protein_id gnl|my_center|LOCUS_43250 33271 34128 gene locus_tag LOCUS_43260 33271 34128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533005.1 protein_id gnl|my_center|LOCUS_43260 34125 35114 gene locus_tag LOCUS_43270 34125 35114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533006.1 protein_id gnl|my_center|LOCUS_43270 35111 36055 gene locus_tag LOCUS_43280 35111 36055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533007.1 protein_id gnl|my_center|LOCUS_43280 36066 37085 gene locus_tag LOCUS_43290 36066 37085 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 protein_id gnl|my_center|LOCUS_43290 37082 37897 gene locus_tag LOCUS_43300 37082 37897 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419874.1 protein_id gnl|my_center|LOCUS_43300 38536 37919 gene locus_tag LOCUS_43310 38536 37919 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064359.1 protein_id gnl|my_center|LOCUS_43310 38826 39476 gene locus_tag LOCUS_43320 gene alkB 38826 39476 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965755.1 protein_id gnl|my_center|LOCUS_43320 39597 40118 gene locus_tag LOCUS_43330 39597 40118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 40204 40827 gene locus_tag LOCUS_43340 gene rhtC 40204 40827 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703986.1 protein_id gnl|my_center|LOCUS_43340 43248 41521 gene locus_tag LOCUS_43350 43248 41521 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089295.1 protein_id gnl|my_center|LOCUS_43350 44239 43319 gene locus_tag LOCUS_43360 44239 43319 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528171.1 protein_id gnl|my_center|LOCUS_43360 44399 45484 gene locus_tag LOCUS_43370 44399 45484 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_43370 45520 46674 gene locus_tag LOCUS_43380 45520 46674 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_43380 47619 46681 gene locus_tag LOCUS_43390 47619 46681 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703160.1 protein_id gnl|my_center|LOCUS_43390 48865 47696 gene locus_tag LOCUS_43400 gene argE 48865 47696 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338096.1 protein_id gnl|my_center|LOCUS_43400 49260 48934 gene locus_tag LOCUS_43410 49260 48934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 49919 49266 gene locus_tag LOCUS_43420 49919 49266 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_43420 50508 50182 gene locus_tag LOCUS_43430 50508 50182 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43430 51848 50691 gene locus_tag LOCUS_43440 51848 50691 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976382.1 protein_id gnl|my_center|LOCUS_43440 52121 53251 gene locus_tag LOCUS_43450 52121 53251 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368516.1 protein_id gnl|my_center|LOCUS_43450 53318 54172 gene locus_tag LOCUS_43460 53318 54172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_43460 54198 54992 gene locus_tag LOCUS_43470 54198 54992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038928.1 protein_id gnl|my_center|LOCUS_43470 55262 55531 gene locus_tag LOCUS_43480 55262 55531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 55756 56550 gene locus_tag LOCUS_43490 55756 56550 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_43490 56676 56957 gene locus_tag LOCUS_43500 56676 56957 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383336.1 protein_id gnl|my_center|LOCUS_43500 56987 57925 gene locus_tag LOCUS_43510 gene dmeF 56987 57925 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969625.1 protein_id gnl|my_center|LOCUS_43510 58661 57942 gene locus_tag LOCUS_43520 58661 57942 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184941.1 protein_id gnl|my_center|LOCUS_43520 59196 58675 gene locus_tag LOCUS_43530 59196 58675 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170904.1 protein_id gnl|my_center|LOCUS_43530 59264 59707 gene locus_tag LOCUS_43540 59264 59707 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 protein_id gnl|my_center|LOCUS_43540 61123 59810 gene locus_tag LOCUS_43550 61123 59810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 62839 61499 gene locus_tag LOCUS_43560 62839 61499 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974093.1 protein_id gnl|my_center|LOCUS_43560 63506 62826 gene locus_tag LOCUS_43570 63506 62826 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390935.1 protein_id gnl|my_center|LOCUS_43570 63664 64488 gene locus_tag LOCUS_43580 63664 64488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 64582 64932 gene locus_tag LOCUS_43590 64582 64932 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975764.1 protein_id gnl|my_center|LOCUS_43590 65072 65797 gene locus_tag LOCUS_43600 65072 65797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 66615 65953 gene locus_tag LOCUS_43610 66615 65953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000390.1 protein_id gnl|my_center|LOCUS_43610 67927 66632 gene locus_tag LOCUS_43620 67927 66632 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_43620 71185 68102 gene locus_tag LOCUS_43630 71185 68102 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527921.1 protein_id gnl|my_center|LOCUS_43630 72273 71182 gene locus_tag LOCUS_43640 72273 71182 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527920.1 protein_id gnl|my_center|LOCUS_43640 73370 72270 gene locus_tag LOCUS_43650 73370 72270 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089758.1 protein_id gnl|my_center|LOCUS_43650 74516 73725 gene locus_tag LOCUS_43660 74516 73725 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 protein_id gnl|my_center|LOCUS_43660 75052 74513 gene locus_tag LOCUS_43670 75052 74513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 75414 75082 gene locus_tag LOCUS_43680 75414 75082 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085799.1 protein_id gnl|my_center|LOCUS_43680 76385 75426 gene locus_tag LOCUS_43690 76385 75426 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 protein_id gnl|my_center|LOCUS_43690 77663 76767 gene locus_tag LOCUS_43700 77663 76767 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_43700 78919 77660 gene locus_tag LOCUS_43710 78919 77660 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523407.1 protein_id gnl|my_center|LOCUS_43710 80006 78903 gene locus_tag LOCUS_43720 80006 78903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030533.1 protein_id gnl|my_center|LOCUS_43720 81723 79999 gene locus_tag LOCUS_43730 81723 79999 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030534.1 protein_id gnl|my_center|LOCUS_43730 82846 81728 gene locus_tag LOCUS_43740 82846 81728 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 protein_id gnl|my_center|LOCUS_43740 82986 83639 gene locus_tag LOCUS_43750 82986 83639 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258641.1 protein_id gnl|my_center|LOCUS_43750 83764 84351 gene locus_tag LOCUS_43760 83764 84351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 84675 85349 gene locus_tag LOCUS_43770 84675 85349 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_43770 85528 86829 gene locus_tag LOCUS_43780 85528 86829 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085815.1 protein_id gnl|my_center|LOCUS_43780 86863 90012 gene locus_tag LOCUS_43790 86863 90012 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_43790 90241 91581 gene locus_tag LOCUS_43800 90241 91581 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_43800 92000 91614 gene locus_tag LOCUS_43810 92000 91614 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112456.1 protein_id gnl|my_center|LOCUS_43810 92654 92088 gene locus_tag LOCUS_43820 92654 92088 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088112.1 protein_id gnl|my_center|LOCUS_43820 92761 93690 gene locus_tag LOCUS_43830 92761 93690 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397470.1 protein_id gnl|my_center|LOCUS_43830 93823 94440 gene locus_tag LOCUS_43840 93823 94440 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_43840 95364 94447 gene locus_tag LOCUS_43850 95364 94447 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 protein_id gnl|my_center|LOCUS_43850 95880 95611 gene locus_tag LOCUS_43860 95880 95611 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 protein_id gnl|my_center|LOCUS_43860 96114 96884 gene locus_tag LOCUS_43870 96114 96884 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969574.1 protein_id gnl|my_center|LOCUS_43870 96955 97374 gene locus_tag LOCUS_43880 96955 97374 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316279.1 protein_id gnl|my_center|LOCUS_43880 97399 97755 gene locus_tag LOCUS_43890 97399 97755 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969576.1 protein_id gnl|my_center|LOCUS_43890 98252 98668 gene locus_tag LOCUS_43900 98252 98668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 98708 99190 gene locus_tag LOCUS_43910 98708 99190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 99204 99521 gene locus_tag LOCUS_43920 99204 99521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 99518 99769 gene locus_tag LOCUS_43930 99518 99769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 99992 102421 gene locus_tag LOCUS_43940 99992 102421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 102421 102792 gene locus_tag LOCUS_43950 102421 102792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 102792 103319 gene locus_tag LOCUS_43960 102792 103319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 103316 103714 gene locus_tag LOCUS_43970 103316 103714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 103718 107833 gene locus_tag LOCUS_43980 103718 107833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 107856 110615 gene locus_tag LOCUS_43990 107856 110615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 110725 111549 gene locus_tag LOCUS_44000 110725 111549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 111546 112094 gene locus_tag LOCUS_44010 111546 112094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 112100 112378 gene locus_tag LOCUS_44020 112100 112378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 112691 112398 gene locus_tag LOCUS_44030 112691 112398 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976351.1 protein_id gnl|my_center|LOCUS_44030 112922 113728 gene locus_tag LOCUS_44040 112922 113728 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338609.1 protein_id gnl|my_center|LOCUS_44040 114641 113760 gene locus_tag LOCUS_44050 114641 113760 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064258.1 protein_id gnl|my_center|LOCUS_44050 115336 114659 gene locus_tag LOCUS_44060 115336 114659 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039258.1 protein_id gnl|my_center|LOCUS_44060 116570 115827 gene locus_tag LOCUS_44070 116570 115827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_44070 116842 118443 gene locus_tag LOCUS_44080 116842 118443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040089.1 protein_id gnl|my_center|LOCUS_44080 118515 119045 gene locus_tag LOCUS_44090 118515 119045 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206017071.1 protein_id gnl|my_center|LOCUS_44090 119091 120515 gene locus_tag LOCUS_44100 119091 120515 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966044.1 protein_id gnl|my_center|LOCUS_44100 121700 120525 gene locus_tag LOCUS_44110 121700 120525 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_44110 122730 121837 gene locus_tag LOCUS_44120 gene gcvA 122730 121837 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044395.1 protein_id gnl|my_center|LOCUS_44120 123684 122812 gene locus_tag LOCUS_44130 123684 122812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089451.1 protein_id gnl|my_center|LOCUS_44130 124657 123707 gene locus_tag LOCUS_44140 124657 123707 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_44140 126341 124659 gene locus_tag LOCUS_44150 126341 124659 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967661.1 protein_id gnl|my_center|LOCUS_44150 127594 126443 gene locus_tag LOCUS_44160 gene dauA 127594 126443 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_44160 127829 128242 gene locus_tag LOCUS_44170 127829 128242 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067237.1 protein_id gnl|my_center|LOCUS_44170 128229 129584 gene locus_tag LOCUS_44180 128229 129584 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198451.1 protein_id gnl|my_center|LOCUS_44180 129607 131115 gene locus_tag LOCUS_44190 129607 131115 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777126.1 protein_id gnl|my_center|LOCUS_44190 131121 132926 gene locus_tag LOCUS_44200 131121 132926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372670.1 protein_id gnl|my_center|LOCUS_44200 133739 132957 gene locus_tag LOCUS_44210 133739 132957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086977.1 protein_id gnl|my_center|LOCUS_44210 134797 133736 gene locus_tag LOCUS_44220 134797 133736 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086978.1 protein_id gnl|my_center|LOCUS_44220 135719 134874 gene locus_tag LOCUS_44230 135719 134874 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086979.1 protein_id gnl|my_center|LOCUS_44230 136770 135706 gene locus_tag LOCUS_44240 136770 135706 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_44240 137569 136775 gene locus_tag LOCUS_44250 137569 136775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086981.1 protein_id gnl|my_center|LOCUS_44250 138370 137690 gene locus_tag LOCUS_44260 138370 137690 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_44260 138531 139538 gene locus_tag LOCUS_44270 138531 139538 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966817.1 protein_id gnl|my_center|LOCUS_44270 141094 139745 gene locus_tag LOCUS_44280 141094 139745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 142481 141141 gene locus_tag LOCUS_44290 142481 141141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 142417 142737 gene locus_tag LOCUS_44300 142417 142737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 143596 142691 gene locus_tag LOCUS_44310 143596 142691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 144723 143593 gene locus_tag LOCUS_44320 144723 143593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 145696 144704 gene locus_tag LOCUS_44330 145696 144704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 146835 145708 gene locus_tag LOCUS_44340 gene wecB 146835 145708 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942885.1 protein_id gnl|my_center|LOCUS_44340 147979 146882 gene locus_tag LOCUS_44350 147979 146882 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390551.1 protein_id gnl|my_center|LOCUS_44350 148854 148000 gene locus_tag LOCUS_44360 148854 148000 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597457.1 protein_id gnl|my_center|LOCUS_44360 150071 148842 gene locus_tag LOCUS_44370 150071 148842 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_44370 150593 151228 gene locus_tag LOCUS_44380 150593 151228 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_44380 151676 151419 gene locus_tag LOCUS_44390 151676 151419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 152068 152922 gene locus_tag LOCUS_44400 152068 152922 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173776.1 protein_id gnl|my_center|LOCUS_44400 152998 154260 gene locus_tag LOCUS_44410 152998 154260 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_44410 154948 154271 gene locus_tag LOCUS_44420 154948 154271 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_44420 155177 156343 gene locus_tag LOCUS_44430 155177 156343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 156489 157346 gene locus_tag LOCUS_44440 156489 157346 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064203.1 protein_id gnl|my_center|LOCUS_44440 157343 158293 gene locus_tag LOCUS_44450 157343 158293 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_44450 158290 159039 gene locus_tag LOCUS_44460 158290 159039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_44460 159036 159737 gene locus_tag LOCUS_44470 159036 159737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_44470 159768 161006 gene locus_tag LOCUS_44480 159768 161006 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_44480 161016 162566 gene locus_tag LOCUS_44490 161016 162566 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_44490 162582 164150 gene locus_tag LOCUS_44500 162582 164150 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_44500 164147 164632 gene locus_tag LOCUS_44510 164147 164632 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975559.1 protein_id gnl|my_center|LOCUS_44510 165168 164629 gene locus_tag LOCUS_44520 165168 164629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 166082 165354 gene locus_tag LOCUS_44530 166082 165354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 166228 166590 gene locus_tag LOCUS_44540 166228 166590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 167425 166727 gene locus_tag LOCUS_44550 167425 166727 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 protein_id gnl|my_center|LOCUS_44550 167547 167879 gene locus_tag LOCUS_44560 167547 167879 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061015.1 protein_id gnl|my_center|LOCUS_44560 169388 167901 gene locus_tag LOCUS_44570 169388 167901 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338086.1 protein_id gnl|my_center|LOCUS_44570 169926 169432 gene locus_tag LOCUS_44580 169926 169432 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338085.1 protein_id gnl|my_center|LOCUS_44580 170975 169923 gene locus_tag LOCUS_44590 170975 169923 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_44590 171280 172431 gene locus_tag LOCUS_44600 gene ada 171280 172431 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_44600 174493 172454 gene locus_tag LOCUS_44610 174493 172454 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392757.1 protein_id gnl|my_center|LOCUS_44610 176513 175008 gene locus_tag LOCUS_44620 176513 175008 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530751.1 protein_id gnl|my_center|LOCUS_44620 177001 176618 gene locus_tag LOCUS_44630 177001 176618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 176988 177371 gene locus_tag LOCUS_44640 176988 177371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 177399 178688 gene locus_tag LOCUS_44650 177399 178688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_44650 178751 179323 gene locus_tag LOCUS_44660 178751 179323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 179997 179392 gene locus_tag LOCUS_44670 179997 179392 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 protein_id gnl|my_center|LOCUS_44670 180927 180235 gene locus_tag LOCUS_44680 180927 180235 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099978.1 protein_id gnl|my_center|LOCUS_44680 181059 181799 gene locus_tag LOCUS_44690 gene fabG 181059 181799 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_44690 181796 183076 gene locus_tag LOCUS_44700 181796 183076 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064393.1 protein_id gnl|my_center|LOCUS_44700 183356 184258 gene locus_tag LOCUS_44710 183356 184258 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_44710 184258 185220 gene locus_tag LOCUS_44720 184258 185220 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_44720 185226 185987 gene locus_tag LOCUS_44730 185226 185987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064388.1 protein_id gnl|my_center|LOCUS_44730 185980 186696 gene locus_tag LOCUS_44740 185980 186696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_44740 186709 187437 gene locus_tag LOCUS_44750 186709 187437 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919670.1 protein_id gnl|my_center|LOCUS_44750 187743 188513 gene locus_tag LOCUS_44760 187743 188513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730670.1 protein_id gnl|my_center|LOCUS_44760 188510 190216 gene locus_tag LOCUS_44770 188510 190216 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085507.1 protein_id gnl|my_center|LOCUS_44770 190547 192157 gene locus_tag LOCUS_44780 190547 192157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965716.1 protein_id gnl|my_center|LOCUS_44780 192734 192129 gene locus_tag LOCUS_44790 192734 192129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 193294 192911 gene locus_tag LOCUS_44800 193294 192911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 193441 194334 gene locus_tag LOCUS_44810 193441 194334 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437082.1 protein_id gnl|my_center|LOCUS_44810 194498 195019 gene locus_tag LOCUS_44820 194498 195019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence14 <1 1474 gene locus_tag LOCUS_44830 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966355.1:porin 1719 4592 gene locus_tag LOCUS_44840 1719 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 4603 5229 gene locus_tag LOCUS_44850 4603 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 5395 7170 gene locus_tag LOCUS_44860 gene aspS 5395 7170 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086916.1 protein_id gnl|my_center|LOCUS_44860 7175 8047 gene locus_tag LOCUS_44870 7175 8047 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532597.1 protein_id gnl|my_center|LOCUS_44870 8414 8944 gene locus_tag LOCUS_44880 8414 8944 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_44880 9027 10121 gene locus_tag LOCUS_44890 9027 10121 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532443.1 protein_id gnl|my_center|LOCUS_44890 10124 10825 gene locus_tag LOCUS_44900 10124 10825 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086897.1 protein_id gnl|my_center|LOCUS_44900 10905 13163 gene locus_tag LOCUS_44910 10905 13163 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 protein_id gnl|my_center|LOCUS_44910 13150 14676 gene locus_tag LOCUS_44920 gene ppx 13150 14676 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086895.1 protein_id gnl|my_center|LOCUS_44920 15032 14673 gene locus_tag LOCUS_44930 15032 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 15469 15068 gene locus_tag LOCUS_44940 15469 15068 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_44940 15600 16163 gene locus_tag LOCUS_44950 15600 16163 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 protein_id gnl|my_center|LOCUS_44950 16305 18326 gene locus_tag LOCUS_44960 16305 18326 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088023.1 protein_id gnl|my_center|LOCUS_44960 18413 18497 gene locus_tag LOCUS_t00290 18413 18497 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19107 18577 gene locus_tag LOCUS_44970 19107 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 19998 19228 gene locus_tag LOCUS_44980 19998 19228 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967985.1 protein_id gnl|my_center|LOCUS_44980 20112 21509 gene locus_tag LOCUS_44990 gene mgtE 20112 21509 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088007.1 protein_id gnl|my_center|LOCUS_44990 21812 22198 gene locus_tag LOCUS_45000 21812 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 22533 24089 gene locus_tag LOCUS_45010 22533 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 24168 24767 gene locus_tag LOCUS_45020 24168 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 24895 25614 gene locus_tag LOCUS_45030 24895 25614 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339314.1 protein_id gnl|my_center|LOCUS_45030 25690 26733 gene locus_tag LOCUS_45040 25690 26733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 27464 26979 gene locus_tag LOCUS_45050 27464 26979 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606946.1 protein_id gnl|my_center|LOCUS_45050 27592 28764 gene locus_tag LOCUS_45060 27592 28764 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_45060 28809 29612 gene locus_tag LOCUS_45070 28809 29612 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_45070 30169 29903 gene locus_tag LOCUS_45080 30169 29903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 30250 32193 gene locus_tag LOCUS_45090 30250 32193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531454.1 protein_id gnl|my_center|LOCUS_45090 33123 32419 gene locus_tag LOCUS_45100 33123 32419 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_45100 34040 33120 gene locus_tag LOCUS_45110 34040 33120 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_45110 35035 34310 gene locus_tag LOCUS_45120 35035 34310 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087926.1 protein_id gnl|my_center|LOCUS_45120 35160 35567 gene locus_tag LOCUS_45130 35160 35567 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_45130 35675 36325 gene locus_tag LOCUS_45140 35675 36325 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966379.1 protein_id gnl|my_center|LOCUS_45140 36441 37211 gene locus_tag LOCUS_45150 36441 37211 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087565.1 protein_id gnl|my_center|LOCUS_45150 37304 38911 gene locus_tag LOCUS_45160 37304 38911 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532608.1 protein_id gnl|my_center|LOCUS_45160 40597 39200 gene locus_tag LOCUS_45170 40597 39200 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222025.1 protein_id gnl|my_center|LOCUS_45170 40771 42792 gene locus_tag LOCUS_45180 40771 42792 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_45180 42789 43190 gene locus_tag LOCUS_45190 42789 43190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 43249 43662 gene locus_tag LOCUS_45200 43249 43662 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536712.1 protein_id gnl|my_center|LOCUS_45200 44793 43945 gene locus_tag LOCUS_45210 gene panC 44793 43945 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087920.1 protein_id gnl|my_center|LOCUS_45210 45054 44833 gene locus_tag LOCUS_45220 45054 44833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 45148 46233 gene locus_tag LOCUS_45230 45148 46233 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969128.1 protein_id gnl|my_center|LOCUS_45230 47790 46507 gene locus_tag LOCUS_45240 47790 46507 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087730.1 protein_id gnl|my_center|LOCUS_45240 48792 48241 gene locus_tag LOCUS_45250 48792 48241 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_45250 49610 48789 gene locus_tag LOCUS_45260 49610 48789 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966315.1 protein_id gnl|my_center|LOCUS_45260 49729 50154 gene locus_tag LOCUS_45270 49729 50154 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_45270 50343 50804 gene locus_tag LOCUS_45280 gene rplM 50343 50804 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529229.1 protein_id gnl|my_center|LOCUS_45280 50807 51283 gene locus_tag LOCUS_45290 gene rpsI 50807 51283 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087725.1 protein_id gnl|my_center|LOCUS_45290 51372 51950 gene locus_tag LOCUS_45300 51372 51950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 52769 52383 gene locus_tag LOCUS_45310 52769 52383 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 protein_id gnl|my_center|LOCUS_45310 52905 53414 gene locus_tag LOCUS_45320 52905 53414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 53432 54250 gene locus_tag LOCUS_45330 53432 54250 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086143.1 protein_id gnl|my_center|LOCUS_45330 56266 54251 gene locus_tag LOCUS_45340 56266 54251 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969036.1 protein_id gnl|my_center|LOCUS_45340 56673 56885 gene locus_tag LOCUS_45350 56673 56885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 56976 57989 gene locus_tag LOCUS_45360 56976 57989 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919459.1 protein_id gnl|my_center|LOCUS_45360 59578 58169 gene locus_tag LOCUS_45370 gene glnA 59578 58169 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087712.1 protein_id gnl|my_center|LOCUS_45370 59988 59650 gene locus_tag LOCUS_45380 59988 59650 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 protein_id gnl|my_center|LOCUS_45380 60326 61807 gene locus_tag LOCUS_45390 60326 61807 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 protein_id gnl|my_center|LOCUS_45390 62496 62143 gene locus_tag LOCUS_45400 62496 62143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 63219 62635 gene locus_tag LOCUS_45410 63219 62635 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532873.1 protein_id gnl|my_center|LOCUS_45410 63444 63680 gene locus_tag LOCUS_45420 63444 63680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 63674 66832 gene locus_tag LOCUS_45430 63674 66832 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_45430 66848 68008 gene locus_tag LOCUS_45440 66848 68008 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532876.1 protein_id gnl|my_center|LOCUS_45440 68759 68055 gene locus_tag LOCUS_45450 68759 68055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_45450 69446 68766 gene locus_tag LOCUS_45460 69446 68766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 70165 69443 gene locus_tag LOCUS_45470 70165 69443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_45470 71148 70168 gene locus_tag LOCUS_45480 71148 70168 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_45480 72020 71145 gene locus_tag LOCUS_45490 72020 71145 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_45490 73268 72030 gene locus_tag LOCUS_45500 73268 72030 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_45500 73481 74446 gene locus_tag LOCUS_45510 73481 74446 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529948.1 protein_id gnl|my_center|LOCUS_45510 75613 75002 gene locus_tag LOCUS_45520 75613 75002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 77012 75642 gene locus_tag LOCUS_45530 77012 75642 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 protein_id gnl|my_center|LOCUS_45530 77273 77357 gene locus_tag LOCUS_t00300 77273 77357 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77409 78764 gene locus_tag LOCUS_45540 gene tig 77409 78764 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087709.1 protein_id gnl|my_center|LOCUS_45540 78940 79572 gene locus_tag LOCUS_45550 78940 79572 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087708.1 protein_id gnl|my_center|LOCUS_45550 79852 81108 gene locus_tag LOCUS_45560 gene clpX 79852 81108 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547851.1 protein_id gnl|my_center|LOCUS_45560 81662 81300 gene locus_tag LOCUS_45570 81662 81300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 82279 84705 gene locus_tag LOCUS_45580 gene lon 82279 84705 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087707.1 protein_id gnl|my_center|LOCUS_45580 84902 85177 gene locus_tag LOCUS_45590 gene hupB 84902 85177 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312721.1 protein_id gnl|my_center|LOCUS_45590 85321 85396 gene locus_tag LOCUS_t00310 85321 85396 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 86602 85487 gene locus_tag LOCUS_45600 86602 85487 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064386.1 protein_id gnl|my_center|LOCUS_45600 86877 88091 gene locus_tag LOCUS_45610 86877 88091 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921602.1 protein_id gnl|my_center|LOCUS_45610 88317 90458 gene locus_tag LOCUS_45620 88317 90458 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532237.1 protein_id gnl|my_center|LOCUS_45620 91245 90757 gene locus_tag LOCUS_45630 91245 90757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 91362 91901 gene locus_tag LOCUS_45640 91362 91901 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532235.1 protein_id gnl|my_center|LOCUS_45640 91898 92443 gene locus_tag LOCUS_45650 91898 92443 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971447.1 protein_id gnl|my_center|LOCUS_45650 92582 93646 gene locus_tag LOCUS_45660 gene plsX 92582 93646 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087782.1 protein_id gnl|my_center|LOCUS_45660 93643 94617 gene locus_tag LOCUS_45670 93643 94617 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_45670 94732 95079 gene locus_tag LOCUS_45680 94732 95079 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171641.1 protein_id gnl|my_center|LOCUS_45680 95220 96020 gene locus_tag LOCUS_45690 95220 96020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 96859 96173 gene locus_tag LOCUS_45700 96859 96173 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532483.1 protein_id gnl|my_center|LOCUS_45700 97671 97267 gene locus_tag LOCUS_45710 97671 97267 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819827.1 protein_id gnl|my_center|LOCUS_45710 97873 98286 gene locus_tag LOCUS_45720 97873 98286 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088450.1 protein_id gnl|my_center|LOCUS_45720 98406 98687 gene locus_tag LOCUS_45730 98406 98687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 101000 100227 gene locus_tag LOCUS_45740 101000 100227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 101500 101003 gene locus_tag LOCUS_45750 101500 101003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533242.1 protein_id gnl|my_center|LOCUS_45750 101863 101787 gene locus_tag LOCUS_t00320 101863 101787 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 103194 101854 gene locus_tag LOCUS_45760 103194 101854 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966321.1 protein_id gnl|my_center|LOCUS_45760 104756 103191 gene locus_tag LOCUS_45770 104756 103191 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171667.1 protein_id gnl|my_center|LOCUS_45770 105163 105381 gene locus_tag LOCUS_45780 105163 105381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 106713 105556 gene locus_tag LOCUS_45790 106713 105556 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087736.1 protein_id gnl|my_center|LOCUS_45790 107345 106713 gene locus_tag LOCUS_45800 107345 106713 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172554.1 protein_id gnl|my_center|LOCUS_45800 107508 109790 gene locus_tag LOCUS_45810 107508 109790 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087735.1 protein_id gnl|my_center|LOCUS_45810 111056 109857 gene locus_tag LOCUS_45820 111056 109857 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966320.1 protein_id gnl|my_center|LOCUS_45820 112539 111664 gene locus_tag LOCUS_45830 112539 111664 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530001.1 protein_id gnl|my_center|LOCUS_45830 112653 113906 gene locus_tag LOCUS_45840 112653 113906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170320.1 protein_id gnl|my_center|LOCUS_45840 113938 114462 gene locus_tag LOCUS_45850 113938 114462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 114626 115681 gene locus_tag LOCUS_45860 114626 115681 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_45860 115914 115678 gene locus_tag LOCUS_45870 115914 115678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 116180 117403 gene locus_tag LOCUS_45880 116180 117403 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_45880 117396 118094 gene locus_tag LOCUS_45890 117396 118094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087642.1 protein_id gnl|my_center|LOCUS_45890 119340 118375 gene locus_tag LOCUS_45900 119340 118375 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528882.1 protein_id gnl|my_center|LOCUS_45900 119608 120174 gene locus_tag LOCUS_45910 119608 120174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528879.1 protein_id gnl|my_center|LOCUS_45910 120697 120290 gene locus_tag LOCUS_45920 120697 120290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 121299 124733 gene locus_tag LOCUS_45930 gene dnaE 121299 124733 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087634.1 protein_id gnl|my_center|LOCUS_45930 124751 125158 gene locus_tag LOCUS_45940 124751 125158 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391315.1 protein_id gnl|my_center|LOCUS_45940 126209 125721 gene locus_tag LOCUS_45950 126209 125721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 127963 126332 gene locus_tag LOCUS_45960 127963 126332 CDS product class I tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030917.1 protein_id gnl|my_center|LOCUS_45960 129419 128109 gene locus_tag LOCUS_45970 129419 128109 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958628.1 protein_id gnl|my_center|LOCUS_45970 130901 129549 gene locus_tag LOCUS_45980 130901 129549 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_45980 131460 132461 gene locus_tag LOCUS_45990 131460 132461 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_45990 132645 133961 gene locus_tag LOCUS_46000 gene iucD 132645 133961 CDS product NADPH-dependent L-lysine N(6)-monooxygenase IucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750130.1 protein_id gnl|my_center|LOCUS_46000 133958 134311 gene locus_tag LOCUS_46010 133958 134311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 134308 135387 gene locus_tag LOCUS_46020 134308 135387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 135514 136749 gene locus_tag LOCUS_46030 135514 136749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214492.1 protein_id gnl|my_center|LOCUS_46030 137934 136765 gene locus_tag LOCUS_46040 137934 136765 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969980.1 protein_id gnl|my_center|LOCUS_46040 138400 137939 gene locus_tag LOCUS_46050 gene gloA 138400 137939 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_46050 138436 139218 gene locus_tag LOCUS_46060 138436 139218 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_46060 139373 139981 gene locus_tag LOCUS_46070 139373 139981 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967130.1 protein_id gnl|my_center|LOCUS_46070 139999 140460 gene locus_tag LOCUS_46080 139999 140460 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_46080 140523 140599 gene locus_tag LOCUS_t00330 140523 140599 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 140628 140933 gene locus_tag LOCUS_46090 140628 140933 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393354.1 protein_id gnl|my_center|LOCUS_46090 141024 141100 gene locus_tag LOCUS_t00340 141024 141100 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 141958 141227 gene locus_tag LOCUS_46100 141958 141227 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931051.1 protein_id gnl|my_center|LOCUS_46100 142881 142135 gene locus_tag LOCUS_46110 142881 142135 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067240.1 protein_id gnl|my_center|LOCUS_46110 143953 142994 gene locus_tag LOCUS_46120 143953 142994 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337437.1 protein_id gnl|my_center|LOCUS_46120 144390 145229 gene locus_tag LOCUS_46130 144390 145229 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_46130 145226 146002 gene locus_tag LOCUS_46140 145226 146002 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084110.1 protein_id gnl|my_center|LOCUS_46140 146012 147229 gene locus_tag LOCUS_46150 146012 147229 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113883.1 protein_id gnl|my_center|LOCUS_46150 147279 147953 gene locus_tag LOCUS_46160 147279 147953 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566033.1 protein_id gnl|my_center|LOCUS_46160 148034 150346 gene locus_tag LOCUS_46170 148034 150346 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209844.1 protein_id gnl|my_center|LOCUS_46170 150362 150931 gene locus_tag LOCUS_46180 150362 150931 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_46180 152415 151324 gene locus_tag LOCUS_46190 152415 151324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372667.1 protein_id gnl|my_center|LOCUS_46190 154249 152453 gene locus_tag LOCUS_46200 154249 152453 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 protein_id gnl|my_center|LOCUS_46200 155400 154246 gene locus_tag LOCUS_46210 155400 154246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 protein_id gnl|my_center|LOCUS_46210 155828 156343 gene locus_tag LOCUS_46220 155828 156343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 156803 156453 gene locus_tag LOCUS_46230 156803 156453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 157441 156980 gene locus_tag LOCUS_46240 157441 156980 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 protein_id gnl|my_center|LOCUS_46240 157691 157488 gene locus_tag LOCUS_46250 157691 157488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 159788 157842 gene locus_tag LOCUS_46260 159788 157842 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463733.1 protein_id gnl|my_center|LOCUS_46260 160217 159939 gene locus_tag LOCUS_46270 160217 159939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 160866 160333 gene locus_tag LOCUS_46280 160866 160333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 161088 161282 gene locus_tag LOCUS_46290 161088 161282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 161419 162294 gene locus_tag LOCUS_46300 161419 162294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 162303 162884 gene locus_tag LOCUS_46310 162303 162884 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404172.1 protein_id gnl|my_center|LOCUS_46310 164108 162903 gene locus_tag LOCUS_46320 gene metC 164108 162903 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215044.1 protein_id gnl|my_center|LOCUS_46320 164072 164329 gene locus_tag LOCUS_46330 164072 164329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 164351 165400 gene locus_tag LOCUS_46340 164351 165400 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_46340 165541 166734 gene locus_tag LOCUS_46350 165541 166734 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_46350 166746 168068 gene locus_tag LOCUS_46360 166746 168068 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087220.1 protein_id gnl|my_center|LOCUS_46360 168104 168877 gene locus_tag LOCUS_46370 168104 168877 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 protein_id gnl|my_center|LOCUS_46370 >Feature sequence15 483 1136 gene locus_tag LOCUS_46380 483 1136 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391165.1 protein_id gnl|my_center|LOCUS_46380 1133 1897 gene locus_tag LOCUS_46390 1133 1897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_46390 1894 2601 gene locus_tag LOCUS_46400 1894 2601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_46400 2635 3840 gene locus_tag LOCUS_46410 2635 3840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809693.1 protein_id gnl|my_center|LOCUS_46410 3849 4712 gene locus_tag LOCUS_46420 3849 4712 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_46420 4712 5614 gene locus_tag LOCUS_46430 4712 5614 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_46430 5611 6102 gene locus_tag LOCUS_46440 5611 6102 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088243.1 protein_id gnl|my_center|LOCUS_46440 6146 7381 gene locus_tag LOCUS_46450 6146 7381 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_46450 8375 7431 gene locus_tag LOCUS_46460 8375 7431 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085291.1 protein_id gnl|my_center|LOCUS_46460 8457 8864 gene locus_tag LOCUS_46470 8457 8864 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921415.1 protein_id gnl|my_center|LOCUS_46470 9808 9041 gene locus_tag LOCUS_46480 9808 9041 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083954.1 protein_id gnl|my_center|LOCUS_46480 11811 10132 gene locus_tag LOCUS_46490 11811 10132 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_46490 12100 13152 gene locus_tag LOCUS_46500 12100 13152 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_46500 13149 14204 gene locus_tag LOCUS_46510 13149 14204 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_46510 14201 15592 gene locus_tag LOCUS_46520 gene lpdA 14201 15592 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 protein_id gnl|my_center|LOCUS_46520 15589 16866 gene locus_tag LOCUS_46530 15589 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 16976 17806 gene locus_tag LOCUS_46540 16976 17806 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775607.1 protein_id gnl|my_center|LOCUS_46540 19587 17809 gene locus_tag LOCUS_46550 19587 17809 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965394.1 protein_id gnl|my_center|LOCUS_46550 20395 19706 gene locus_tag LOCUS_46560 20395 19706 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_46560 20434 22038 gene locus_tag LOCUS_46570 20434 22038 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083629.1 protein_id gnl|my_center|LOCUS_46570 22347 24209 gene locus_tag LOCUS_46580 22347 24209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_46580 25756 24221 gene locus_tag LOCUS_46590 25756 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 26476 25844 gene locus_tag LOCUS_46600 26476 25844 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508644.1 protein_id gnl|my_center|LOCUS_46600 26644 27114 gene locus_tag LOCUS_46610 26644 27114 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_46610 28162 27170 gene locus_tag LOCUS_46620 28162 27170 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105417854.1 protein_id gnl|my_center|LOCUS_46620 29511 28339 gene locus_tag LOCUS_46630 29511 28339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 29824 29420 gene locus_tag LOCUS_46640 29824 29420 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328553.1 protein_id gnl|my_center|LOCUS_46640 30020 31009 gene locus_tag LOCUS_46650 gene moaA 30020 31009 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_46650 31263 31844 gene locus_tag LOCUS_46660 31263 31844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 31986 33116 gene locus_tag LOCUS_46670 gene solA 31986 33116 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_46670 33113 34054 gene locus_tag LOCUS_46680 33113 34054 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328556.1 protein_id gnl|my_center|LOCUS_46680 35288 34086 gene locus_tag LOCUS_46690 gene nhaA 35288 34086 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528071.1 protein_id gnl|my_center|LOCUS_46690 35821 35372 gene locus_tag LOCUS_46700 35821 35372 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064752.1 protein_id gnl|my_center|LOCUS_46700 36197 36511 gene locus_tag LOCUS_46710 36197 36511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 36508 37047 gene locus_tag LOCUS_46720 36508 37047 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315177.1 protein_id gnl|my_center|LOCUS_46720 37078 38538 gene locus_tag LOCUS_46730 37078 38538 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315176.1 protein_id gnl|my_center|LOCUS_46730 38696 39877 gene locus_tag LOCUS_46740 38696 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 41023 39932 gene locus_tag LOCUS_46750 41023 39932 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_46750 42297 41209 gene locus_tag LOCUS_46760 42297 41209 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_46760 42546 43418 gene locus_tag LOCUS_46770 42546 43418 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_46770 45495 43528 gene locus_tag LOCUS_46780 45495 43528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46780 46281 45622 gene locus_tag LOCUS_46790 46281 45622 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_46790 47044 46433 gene locus_tag LOCUS_46800 47044 46433 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_46800 48756 47149 gene locus_tag LOCUS_46810 48756 47149 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966223.1 protein_id gnl|my_center|LOCUS_46810 48883 49425 gene locus_tag LOCUS_46820 48883 49425 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969536.1 protein_id gnl|my_center|LOCUS_46820 49532 51724 gene locus_tag LOCUS_46830 49532 51724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 51750 53312 gene locus_tag LOCUS_46840 51750 53312 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_46840 54787 53441 gene locus_tag LOCUS_46850 54787 53441 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705264.1 protein_id gnl|my_center|LOCUS_46850 54939 55172 gene locus_tag LOCUS_46860 54939 55172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 55733 56500 gene locus_tag LOCUS_46870 55733 56500 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085190.1 protein_id gnl|my_center|LOCUS_46870 56493 56711 gene locus_tag LOCUS_46880 56493 56711 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085189.1 protein_id gnl|my_center|LOCUS_46880 57216 56737 gene locus_tag LOCUS_46890 gene greA 57216 56737 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920063.1 protein_id gnl|my_center|LOCUS_46890 60619 57347 gene locus_tag LOCUS_46900 60619 57347 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083776.1 protein_id gnl|my_center|LOCUS_46900 62603 60834 gene locus_tag LOCUS_46910 62603 60834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 64154 62766 gene locus_tag LOCUS_46920 64154 62766 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338979.1 protein_id gnl|my_center|LOCUS_46920 64303 64692 gene locus_tag LOCUS_46930 64303 64692 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844628.1 protein_id gnl|my_center|LOCUS_46930 64734 65687 gene locus_tag LOCUS_46940 gene tehA 64734 65687 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966370.1 protein_id gnl|my_center|LOCUS_46940 66138 67136 gene locus_tag LOCUS_46950 66138 67136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 67258 68388 gene locus_tag LOCUS_46960 67258 68388 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088343.1 protein_id gnl|my_center|LOCUS_46960 68883 68428 gene locus_tag LOCUS_46970 68883 68428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 69101 69499 gene locus_tag LOCUS_46980 69101 69499 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088362.1 protein_id gnl|my_center|LOCUS_46980 69710 71257 gene locus_tag LOCUS_46990 69710 71257 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 protein_id gnl|my_center|LOCUS_46990 72253 71357 gene locus_tag LOCUS_47000 gene serB 72253 71357 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 protein_id gnl|my_center|LOCUS_47000 72245 73192 gene locus_tag LOCUS_47010 gene miaA 72245 73192 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_47010 74733 73183 gene locus_tag LOCUS_47020 74733 73183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 75349 74810 gene locus_tag LOCUS_47030 75349 74810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 76169 75369 gene locus_tag LOCUS_47040 76169 75369 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973295.1 protein_id gnl|my_center|LOCUS_47040 76767 76243 gene locus_tag LOCUS_47050 76767 76243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 77847 76858 gene locus_tag LOCUS_47060 77847 76858 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084334.1 protein_id gnl|my_center|LOCUS_47060 78515 77844 gene locus_tag LOCUS_47070 78515 77844 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921389.1 protein_id gnl|my_center|LOCUS_47070 78712 80625 gene locus_tag LOCUS_47080 78712 80625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 81818 80751 gene locus_tag LOCUS_47090 gene fba 81818 80751 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084337.1 protein_id gnl|my_center|LOCUS_47090 83066 81876 gene locus_tag LOCUS_47100 83066 81876 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084338.1 protein_id gnl|my_center|LOCUS_47100 84172 83126 gene locus_tag LOCUS_47110 gene gap 84172 83126 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535991.1 protein_id gnl|my_center|LOCUS_47110 86318 84321 gene locus_tag LOCUS_47120 gene tkt 86318 84321 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921605.1 protein_id gnl|my_center|LOCUS_47120 87508 86522 gene locus_tag LOCUS_47130 87508 86522 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090292.1 protein_id gnl|my_center|LOCUS_47130 88459 87581 gene locus_tag LOCUS_47140 88459 87581 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_47140 88748 89038 gene locus_tag LOCUS_47150 88748 89038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 89044 89418 gene locus_tag LOCUS_47160 89044 89418 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084342.1 protein_id gnl|my_center|LOCUS_47160 89466 90053 gene locus_tag LOCUS_47170 89466 90053 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_47170 90295 90579 gene locus_tag LOCUS_47180 90295 90579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 90967 92673 gene locus_tag LOCUS_47190 gene rpsA 90967 92673 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546860.1 protein_id gnl|my_center|LOCUS_47190 92876 93703 gene locus_tag LOCUS_47200 92876 93703 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_47200 94423 93827 gene locus_tag LOCUS_47210 94423 93827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 94745 95386 gene locus_tag LOCUS_47220 94745 95386 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083722.1 protein_id gnl|my_center|LOCUS_47220 95714 96790 gene locus_tag LOCUS_47230 95714 96790 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083909.1 protein_id gnl|my_center|LOCUS_47230 96858 97433 gene locus_tag LOCUS_47240 96858 97433 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_47240 97430 98146 gene locus_tag LOCUS_47250 gene pyrF 97430 98146 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_47250 98238 98552 gene locus_tag LOCUS_47260 98238 98552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 98961 98578 gene locus_tag LOCUS_47270 98961 98578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 99135 100040 gene locus_tag LOCUS_47280 99135 100040 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531695.1 protein_id gnl|my_center|LOCUS_47280 100191 101159 gene locus_tag LOCUS_47290 gene sppA 100191 101159 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083566.1 protein_id gnl|my_center|LOCUS_47290 101209 101490 gene locus_tag LOCUS_47300 101209 101490 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539997.1 protein_id gnl|my_center|LOCUS_47300 101516 101887 gene locus_tag LOCUS_47310 101516 101887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 101894 102853 gene locus_tag LOCUS_47320 101894 102853 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_47320 103394 102888 gene locus_tag LOCUS_47330 103394 102888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 104267 103410 gene locus_tag LOCUS_47340 104267 103410 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188844.1 protein_id gnl|my_center|LOCUS_47340 105424 104264 gene locus_tag LOCUS_47350 105424 104264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267598.1 protein_id gnl|my_center|LOCUS_47350 106827 105421 gene locus_tag LOCUS_47360 106827 105421 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104056.1 protein_id gnl|my_center|LOCUS_47360 107093 106824 gene locus_tag LOCUS_47370 107093 106824 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246655.1 protein_id gnl|my_center|LOCUS_47370 107791 107096 gene locus_tag LOCUS_47380 107791 107096 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086406.1 protein_id gnl|my_center|LOCUS_47380 108816 107809 gene locus_tag LOCUS_47390 108816 107809 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_47390 110672 108813 gene locus_tag LOCUS_47400 110672 108813 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 protein_id gnl|my_center|LOCUS_47400 111625 110672 gene locus_tag LOCUS_47410 111625 110672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_47410 113159 111630 gene locus_tag LOCUS_47420 113159 111630 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_47420 114922 113270 gene locus_tag LOCUS_47430 114922 113270 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538203.1 protein_id gnl|my_center|LOCUS_47430 116991 114919 gene locus_tag LOCUS_47440 116991 114919 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_47440 117155 117964 gene locus_tag LOCUS_47450 117155 117964 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104058.1 protein_id gnl|my_center|LOCUS_47450 118966 117965 gene locus_tag LOCUS_47460 118966 117965 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_47460 119119 119640 gene locus_tag LOCUS_47470 119119 119640 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085317.1 protein_id gnl|my_center|LOCUS_47470 119642 120907 gene locus_tag LOCUS_47480 gene fabF 119642 120907 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085316.1 protein_id gnl|my_center|LOCUS_47480 120982 121659 gene locus_tag LOCUS_47490 120982 121659 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083568.1 protein_id gnl|my_center|LOCUS_47490 121656 122873 gene locus_tag LOCUS_47500 gene trpB 121656 122873 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083569.1 protein_id gnl|my_center|LOCUS_47500 122870 123706 gene locus_tag LOCUS_47510 gene trpA 122870 123706 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 protein_id gnl|my_center|LOCUS_47510 123845 124717 gene locus_tag LOCUS_47520 gene accD 123845 124717 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083571.1 protein_id gnl|my_center|LOCUS_47520 124800 126131 gene locus_tag LOCUS_47530 124800 126131 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330401.1 protein_id gnl|my_center|LOCUS_47530 126190 126972 gene locus_tag LOCUS_47540 126190 126972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 128325 127084 gene locus_tag LOCUS_47550 128325 127084 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 protein_id gnl|my_center|LOCUS_47550 129734 128610 gene locus_tag LOCUS_47560 129734 128610 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926593.1 protein_id gnl|my_center|LOCUS_47560 129882 130898 gene locus_tag LOCUS_47570 129882 130898 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 protein_id gnl|my_center|LOCUS_47570 131026 132123 gene locus_tag LOCUS_47580 131026 132123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47580 133320 132127 gene locus_tag LOCUS_47590 133320 132127 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971806.1 protein_id gnl|my_center|LOCUS_47590 134408 133434 gene locus_tag LOCUS_47600 134408 133434 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_47600 135509 134520 gene locus_tag LOCUS_47610 135509 134520 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_47610 136323 135574 gene locus_tag LOCUS_47620 136323 135574 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813656.1 protein_id gnl|my_center|LOCUS_47620 136422 136709 gene locus_tag LOCUS_47630 136422 136709 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846820.1 protein_id gnl|my_center|LOCUS_47630 136730 138004 gene locus_tag LOCUS_47640 136730 138004 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460953.1 protein_id gnl|my_center|LOCUS_47640 138064 139119 gene locus_tag LOCUS_47650 138064 139119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 139116 140153 gene locus_tag LOCUS_47660 139116 140153 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339078.1 protein_id gnl|my_center|LOCUS_47660 140163 141098 gene locus_tag LOCUS_47670 140163 141098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 141095 142090 gene locus_tag LOCUS_47680 141095 142090 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_47680 142201 142677 gene locus_tag LOCUS_47690 gene dps 142201 142677 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312098.1 protein_id gnl|my_center|LOCUS_47690 143757 142738 gene locus_tag LOCUS_47700 143757 142738 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 protein_id gnl|my_center|LOCUS_47700 144157 145359 gene locus_tag LOCUS_47710 144157 145359 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_47710 145396 145605 gene locus_tag LOCUS_47720 145396 145605 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008141931.1 protein_id gnl|my_center|LOCUS_47720 145950 145708 gene locus_tag LOCUS_47730 145950 145708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 149056 146147 gene locus_tag LOCUS_47740 gene ileS 149056 146147 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090213.1 protein_id gnl|my_center|LOCUS_47740 149476 150165 gene locus_tag LOCUS_47750 149476 150165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 150775 150200 gene locus_tag LOCUS_47760 150775 150200 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965114.1 protein_id gnl|my_center|LOCUS_47760 150845 151195 gene locus_tag LOCUS_47770 150845 151195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083429.1 protein_id gnl|my_center|LOCUS_47770 152831 151263 gene locus_tag LOCUS_47780 gene gcvPB 152831 151263 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923258.1 protein_id gnl|my_center|LOCUS_47780 153150 152845 gene locus_tag LOCUS_47790 153150 152845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 154505 153147 gene locus_tag LOCUS_47800 gene gcvPA 154505 153147 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_47800 155001 154522 gene locus_tag LOCUS_47810 155001 154522 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 protein_id gnl|my_center|LOCUS_47810 155388 155011 gene locus_tag LOCUS_47820 gene gcvH 155388 155011 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921183.1 protein_id gnl|my_center|LOCUS_47820 156602 155463 gene locus_tag LOCUS_47830 gene gcvT 156602 155463 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266821.1 protein_id gnl|my_center|LOCUS_47830 157721 157056 gene locus_tag LOCUS_47840 157721 157056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 157915 159093 gene locus_tag LOCUS_47850 157915 159093 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533609.1 protein_id gnl|my_center|LOCUS_47850 159224 160531 gene locus_tag LOCUS_47860 159224 160531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 160548 161174 gene locus_tag LOCUS_47870 160548 161174 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083218.1 protein_id gnl|my_center|LOCUS_47870 161324 161779 gene locus_tag LOCUS_47880 161324 161779 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525768.1 protein_id gnl|my_center|LOCUS_47880 161776 164040 gene locus_tag LOCUS_47890 161776 164040 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_47890 >Feature sequence16 1962 2273 gene locus_tag LOCUS_47900 1962 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 2983 2270 gene locus_tag LOCUS_47910 2983 2270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090558.1 protein_id gnl|my_center|LOCUS_47910 4740 2980 gene locus_tag LOCUS_47920 4740 2980 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090557.1 protein_id gnl|my_center|LOCUS_47920 5781 4744 gene locus_tag LOCUS_47930 5781 4744 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173794.1 protein_id gnl|my_center|LOCUS_47930 6021 6530 gene locus_tag LOCUS_47940 6021 6530 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090555.1 protein_id gnl|my_center|LOCUS_47940 6652 7170 gene locus_tag LOCUS_47950 gene def 6652 7170 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090831.1 protein_id gnl|my_center|LOCUS_47950 7167 8099 gene locus_tag LOCUS_47960 gene fmt 7167 8099 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090830.1 protein_id gnl|my_center|LOCUS_47960 8099 8896 gene locus_tag LOCUS_47970 gene truA 8099 8896 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391799.1 protein_id gnl|my_center|LOCUS_47970 10380 9220 gene locus_tag LOCUS_47980 gene dapE 10380 9220 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090828.1 protein_id gnl|my_center|LOCUS_47980 10838 10377 gene locus_tag LOCUS_47990 10838 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 11426 10959 gene locus_tag LOCUS_48000 11426 10959 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528479.1 protein_id gnl|my_center|LOCUS_48000 12297 11455 gene locus_tag LOCUS_48010 gene dapD 12297 11455 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493576.1 protein_id gnl|my_center|LOCUS_48010 12533 13063 gene locus_tag LOCUS_48020 12533 13063 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_48020 14136 13087 gene locus_tag LOCUS_48030 14136 13087 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_48030 14879 14199 gene locus_tag LOCUS_48040 14879 14199 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088533.1 protein_id gnl|my_center|LOCUS_48040 14987 16390 gene locus_tag LOCUS_48050 14987 16390 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_48050 16624 16869 gene locus_tag LOCUS_48060 16624 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 16927 17184 gene locus_tag LOCUS_48070 16927 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 17332 17913 gene locus_tag LOCUS_48080 17332 17913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088536.1 protein_id gnl|my_center|LOCUS_48080 18058 18273 gene locus_tag LOCUS_48090 18058 18273 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814443.1 protein_id gnl|my_center|LOCUS_48090 20195 18339 gene locus_tag LOCUS_48100 gene thiC 20195 18339 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089399.1 protein_id gnl|my_center|LOCUS_48100 20646 20945 gene locus_tag LOCUS_48110 20646 20945 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_48110 21109 21993 gene locus_tag LOCUS_48120 gene argB 21109 21993 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090823.1 protein_id gnl|my_center|LOCUS_48120 21998 23008 gene locus_tag LOCUS_48130 21998 23008 CDS product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175983.1 protein_id gnl|my_center|LOCUS_48130 23008 23706 gene locus_tag LOCUS_48140 23008 23706 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_48140 25683 24205 gene locus_tag LOCUS_48150 25683 24205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 26637 25696 gene locus_tag LOCUS_48160 26637 25696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 27854 26661 gene locus_tag LOCUS_48170 27854 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325761.1 protein_id gnl|my_center|LOCUS_48170 28691 27972 gene locus_tag LOCUS_48180 28691 27972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 29867 28806 gene locus_tag LOCUS_48190 29867 28806 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970722.1 protein_id gnl|my_center|LOCUS_48190 31451 29940 gene locus_tag LOCUS_48200 31451 29940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 32653 31574 gene locus_tag LOCUS_48210 32653 31574 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527947.1 protein_id gnl|my_center|LOCUS_48210 32741 32911 gene locus_tag LOCUS_48220 32741 32911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 32919 33542 gene locus_tag LOCUS_48230 32919 33542 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083950.1 protein_id gnl|my_center|LOCUS_48230 33659 34843 gene locus_tag LOCUS_48240 gene rmuC 33659 34843 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175976.1 protein_id gnl|my_center|LOCUS_48240 36095 34848 gene locus_tag LOCUS_48250 36095 34848 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_48250 36215 36979 gene locus_tag LOCUS_48260 36215 36979 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931051.1 protein_id gnl|my_center|LOCUS_48260 37109 38152 gene locus_tag LOCUS_48270 gene tauA 37109 38152 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_48270 38174 39007 gene locus_tag LOCUS_48280 38174 39007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531158.1 protein_id gnl|my_center|LOCUS_48280 39004 39849 gene locus_tag LOCUS_48290 gene tauC 39004 39849 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 protein_id gnl|my_center|LOCUS_48290 40502 39936 gene locus_tag LOCUS_48300 40502 39936 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397132.1 protein_id gnl|my_center|LOCUS_48300 40590 41129 gene locus_tag LOCUS_48310 40590 41129 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973984.1 protein_id gnl|my_center|LOCUS_48310 42299 41151 gene locus_tag LOCUS_48320 gene dnaJ 42299 41151 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 protein_id gnl|my_center|LOCUS_48320 42639 42310 gene locus_tag LOCUS_48330 42639 42310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 44602 42701 gene locus_tag LOCUS_48340 gene dnaK 44602 42701 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083506.1 protein_id gnl|my_center|LOCUS_48340 44998 45861 gene locus_tag LOCUS_48350 44998 45861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 46338 45958 gene locus_tag LOCUS_48360 46338 45958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 47541 46459 gene locus_tag LOCUS_48370 gene hrcA 47541 46459 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083502.1 protein_id gnl|my_center|LOCUS_48370 47692 48405 gene locus_tag LOCUS_48380 gene rph 47692 48405 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083501.1 protein_id gnl|my_center|LOCUS_48380 48405 49064 gene locus_tag LOCUS_48390 gene rdgB 48405 49064 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083500.1 protein_id gnl|my_center|LOCUS_48390 49074 50255 gene locus_tag LOCUS_48400 gene hemW 49074 50255 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172453.1 protein_id gnl|my_center|LOCUS_48400 50341 51732 gene locus_tag LOCUS_48410 50341 51732 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083727.1 protein_id gnl|my_center|LOCUS_48410 51803 52375 gene locus_tag LOCUS_48420 51803 52375 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463732.1 protein_id gnl|my_center|LOCUS_48420 52907 52422 gene locus_tag LOCUS_48430 52907 52422 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083725.1 protein_id gnl|my_center|LOCUS_48430 53199 53468 gene locus_tag LOCUS_48440 gene rpsO 53199 53468 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_48440 53723 55864 gene locus_tag LOCUS_48450 gene pnp 53723 55864 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083601.1 protein_id gnl|my_center|LOCUS_48450 56094 57212 gene locus_tag LOCUS_48460 56094 57212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 57927 57280 gene locus_tag LOCUS_48470 57927 57280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173306.1 protein_id gnl|my_center|LOCUS_48470 59304 58081 gene locus_tag LOCUS_48480 59304 58081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 60908 59580 gene locus_tag LOCUS_48490 60908 59580 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 protein_id gnl|my_center|LOCUS_48490 61376 61089 gene locus_tag LOCUS_48500 61376 61089 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_48500 62298 61525 gene locus_tag LOCUS_48510 62298 61525 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_48510 63399 62407 gene locus_tag LOCUS_48520 gene coaA 63399 62407 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027543772.1 protein_id gnl|my_center|LOCUS_48520 63737 63396 gene locus_tag LOCUS_48530 63737 63396 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876448.1 protein_id gnl|my_center|LOCUS_48530 64038 63877 gene locus_tag LOCUS_48540 64038 63877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 64421 64050 gene locus_tag LOCUS_48550 64421 64050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 65507 64980 gene locus_tag LOCUS_48560 65507 64980 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967890.1 protein_id gnl|my_center|LOCUS_48560 66289 65516 gene locus_tag LOCUS_48570 66289 65516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 66936 66286 gene locus_tag LOCUS_48580 gene msrA 66936 66286 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_48580 67446 67114 gene locus_tag LOCUS_48590 67446 67114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 68990 67539 gene locus_tag LOCUS_48600 68990 67539 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528447.1 protein_id gnl|my_center|LOCUS_48600 69156 69232 gene locus_tag LOCUS_t00350 69156 69232 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70861 69167 gene locus_tag LOCUS_48610 70861 69167 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_48610 71247 70858 gene locus_tag LOCUS_48620 71247 70858 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 protein_id gnl|my_center|LOCUS_48620 71649 71335 gene locus_tag LOCUS_48630 71649 71335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 72325 73290 gene locus_tag LOCUS_48640 72325 73290 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368405.1 protein_id gnl|my_center|LOCUS_48640 73508 73287 gene locus_tag LOCUS_48650 73508 73287 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_48650 74769 73510 gene locus_tag LOCUS_48660 74769 73510 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_48660 75833 74766 gene locus_tag LOCUS_48670 gene trbG 75833 74766 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_48670 76513 75830 gene locus_tag LOCUS_48680 gene trbF 76513 75830 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 protein_id gnl|my_center|LOCUS_48680 77871 76516 gene locus_tag LOCUS_48690 gene trbL 77871 76516 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 protein_id gnl|my_center|LOCUS_48690 78220 77873 gene locus_tag LOCUS_48700 gene trbK-alt 78220 77873 CDS product putative entry exclusion protein TrbK-alt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 protein_id gnl|my_center|LOCUS_48700 78992 78231 gene locus_tag LOCUS_48710 gene trbJ 78992 78231 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_48710 81427 78989 gene locus_tag LOCUS_48720 gene trbE 81427 78989 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_48720 81723 81442 gene locus_tag LOCUS_48730 81723 81442 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368410.1 protein_id gnl|my_center|LOCUS_48730 82070 81723 gene locus_tag LOCUS_48740 82070 81723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 83113 82067 gene locus_tag LOCUS_48750 gene trbB 83113 82067 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 protein_id gnl|my_center|LOCUS_48750 83693 83226 gene locus_tag LOCUS_48760 83693 83226 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538234.1 protein_id gnl|my_center|LOCUS_48760 85685 83697 gene locus_tag LOCUS_48770 85685 83697 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 protein_id gnl|my_center|LOCUS_48770 86121 85807 gene locus_tag LOCUS_48780 86121 85807 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538229.1 protein_id gnl|my_center|LOCUS_48780 86229 86513 gene locus_tag LOCUS_48790 86229 86513 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 protein_id gnl|my_center|LOCUS_48790 87007 86510 gene locus_tag LOCUS_48800 87007 86510 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_48800 87296 87012 gene locus_tag LOCUS_48810 87296 87012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 89417 87369 gene locus_tag LOCUS_48820 89417 87369 CDS product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 protein_id gnl|my_center|LOCUS_48820 90633 89710 gene locus_tag LOCUS_48830 90633 89710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 90974 90639 gene locus_tag LOCUS_48840 90974 90639 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082878.1 protein_id gnl|my_center|LOCUS_48840 91556 91011 gene locus_tag LOCUS_48850 91556 91011 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368397.1 protein_id gnl|my_center|LOCUS_48850 92071 91553 gene locus_tag LOCUS_48860 92071 91553 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368643.1 protein_id gnl|my_center|LOCUS_48860 92322 92068 gene locus_tag LOCUS_48870 92322 92068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368642.1 protein_id gnl|my_center|LOCUS_48870 92972 92319 gene locus_tag LOCUS_48880 gene parA 92972 92319 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_48880 93997 92969 gene locus_tag LOCUS_48890 93997 92969 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368640.1 protein_id gnl|my_center|LOCUS_48890 94267 93998 gene locus_tag LOCUS_48900 94267 93998 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 protein_id gnl|my_center|LOCUS_48900 94933 94421 gene locus_tag LOCUS_48910 94933 94421 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538228.1 protein_id gnl|my_center|LOCUS_48910 96359 95517 gene locus_tag LOCUS_48920 96359 95517 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234445.1 protein_id gnl|my_center|LOCUS_48920 96944 96621 gene locus_tag LOCUS_48930 96944 96621 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970276.1 protein_id gnl|my_center|LOCUS_48930 98211 97723 gene locus_tag LOCUS_48940 98211 97723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 98700 98278 gene locus_tag LOCUS_48950 98700 98278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275398.1 protein_id gnl|my_center|LOCUS_48950 100906 98834 gene locus_tag LOCUS_48960 100906 98834 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490278.1 protein_id gnl|my_center|LOCUS_48960 101935 101231 gene locus_tag LOCUS_48970 101935 101231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 104385 102196 gene locus_tag LOCUS_48980 104385 102196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 104267 104752 gene locus_tag LOCUS_48990 104267 104752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 106900 106208 gene locus_tag LOCUS_49000 106900 106208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 107966 107262 gene locus_tag LOCUS_49010 107966 107262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 108452 108120 gene locus_tag LOCUS_49020 108452 108120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 109446 108883 gene locus_tag LOCUS_49030 109446 108883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_49030 109943 109500 gene locus_tag LOCUS_49040 109943 109500 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329997.1 protein_id gnl|my_center|LOCUS_49040 109965 110369 gene locus_tag LOCUS_49050 109965 110369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 111479 110505 gene locus_tag LOCUS_49060 111479 110505 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087121.1 protein_id gnl|my_center|LOCUS_49060 112159 111641 gene locus_tag LOCUS_49070 112159 111641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 112557 113129 gene locus_tag LOCUS_49080 112557 113129 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_49080 113183 114670 gene locus_tag LOCUS_49090 113183 114670 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529714.1 protein_id gnl|my_center|LOCUS_49090 114701 115081 gene locus_tag LOCUS_49100 114701 115081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 116169 115486 gene locus_tag LOCUS_49110 116169 115486 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970639.1 protein_id gnl|my_center|LOCUS_49110 116871 116185 gene locus_tag LOCUS_49120 116871 116185 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 protein_id gnl|my_center|LOCUS_49120 118102 116924 gene locus_tag LOCUS_49130 118102 116924 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_49130 118887 118144 gene locus_tag LOCUS_49140 118887 118144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_49140 119664 118891 gene locus_tag LOCUS_49150 119664 118891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063918.1 protein_id gnl|my_center|LOCUS_49150 120500 119661 gene locus_tag LOCUS_49160 120500 119661 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_49160 121372 120500 gene locus_tag LOCUS_49170 gene livH 121372 120500 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523160.1 protein_id gnl|my_center|LOCUS_49170 122656 121679 gene locus_tag LOCUS_49180 122656 121679 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 protein_id gnl|my_center|LOCUS_49180 122918 123769 gene locus_tag LOCUS_49190 122918 123769 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974708.1 protein_id gnl|my_center|LOCUS_49190 123851 124582 gene locus_tag LOCUS_49200 123851 124582 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313622.1 protein_id gnl|my_center|LOCUS_49200 124579 125352 gene locus_tag LOCUS_49210 124579 125352 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313623.1 protein_id gnl|my_center|LOCUS_49210 125367 126518 gene locus_tag LOCUS_49220 125367 126518 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_49220 126515 127639 gene locus_tag LOCUS_49230 126515 127639 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974706.1 protein_id gnl|my_center|LOCUS_49230 127636 128814 gene locus_tag LOCUS_49240 127636 128814 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 protein_id gnl|my_center|LOCUS_49240 129199 129951 gene locus_tag LOCUS_49250 129199 129951 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827390.1 protein_id gnl|my_center|LOCUS_49250 130012 131781 gene locus_tag LOCUS_49260 130012 131781 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531857.1 protein_id gnl|my_center|LOCUS_49260 131787 133037 gene locus_tag LOCUS_49270 131787 133037 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531858.1 protein_id gnl|my_center|LOCUS_49270 134511 133306 gene locus_tag LOCUS_49280 134511 133306 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533329.1 protein_id gnl|my_center|LOCUS_49280 135329 134610 gene locus_tag LOCUS_49290 135329 134610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_49290 136126 135326 gene locus_tag LOCUS_49300 136126 135326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_49300 137358 136123 gene locus_tag LOCUS_49310 137358 136123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 138266 137355 gene locus_tag LOCUS_49320 138266 137355 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_49320 139483 138302 gene locus_tag LOCUS_49330 139483 138302 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_49330 139772 140749 gene locus_tag LOCUS_49340 139772 140749 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_49340 140753 141283 gene locus_tag LOCUS_49350 140753 141283 CDS product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186987.1 protein_id gnl|my_center|LOCUS_49350 141419 142672 gene locus_tag LOCUS_49360 141419 142672 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_49360 142693 142995 gene locus_tag LOCUS_49370 142693 142995 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973738.1 protein_id gnl|my_center|LOCUS_49370 142992 145997 gene locus_tag LOCUS_49380 142992 145997 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529659.1 protein_id gnl|my_center|LOCUS_49380 145990 146559 gene locus_tag LOCUS_49390 145990 146559 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529660.1 protein_id gnl|my_center|LOCUS_49390 146590 147963 gene locus_tag LOCUS_49400 146590 147963 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446851.1 protein_id gnl|my_center|LOCUS_49400 147974 149260 gene locus_tag LOCUS_49410 147974 149260 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532252.1 protein_id gnl|my_center|LOCUS_49410 149327 149674 gene locus_tag LOCUS_49420 149327 149674 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_49420 150931 149729 gene locus_tag LOCUS_49430 150931 149729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040801.1 protein_id gnl|my_center|LOCUS_49430 151620 150928 gene locus_tag LOCUS_49440 151620 150928 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967556.1 protein_id gnl|my_center|LOCUS_49440 151619 152308 gene locus_tag LOCUS_49450 151619 152308 CDS product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090892.1 protein_id gnl|my_center|LOCUS_49450 153038 152346 gene locus_tag LOCUS_49460 153038 152346 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392117.1 protein_id gnl|my_center|LOCUS_49460 153648 153070 gene locus_tag LOCUS_49470 153648 153070 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392119.1 protein_id gnl|my_center|LOCUS_49470 154491 153769 gene locus_tag LOCUS_49480 154491 153769 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244058.1 protein_id gnl|my_center|LOCUS_49480 155257 154580 gene locus_tag LOCUS_49490 155257 154580 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_49490 156243 155257 gene locus_tag LOCUS_49500 156243 155257 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647844.1 protein_id gnl|my_center|LOCUS_49500 157583 156300 gene locus_tag LOCUS_49510 157583 156300 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967134.1 protein_id gnl|my_center|LOCUS_49510 158125 157580 gene locus_tag LOCUS_49520 158125 157580 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243986.1 protein_id gnl|my_center|LOCUS_49520 159206 158184 gene locus_tag LOCUS_49530 159206 158184 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_49530 160239 159235 gene locus_tag LOCUS_49540 160239 159235 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 protein_id gnl|my_center|LOCUS_49540 >Feature sequence17 1560 337 gene locus_tag LOCUS_49550 1560 337 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969673.1 protein_id gnl|my_center|LOCUS_49550 2172 3167 gene locus_tag LOCUS_49560 2172 3167 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088799.1 protein_id gnl|my_center|LOCUS_49560 3605 4168 gene locus_tag LOCUS_49570 3605 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 4172 5452 gene locus_tag LOCUS_49580 4172 5452 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811706.1 protein_id gnl|my_center|LOCUS_49580 5472 6278 gene locus_tag LOCUS_49590 5472 6278 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338969.1 protein_id gnl|my_center|LOCUS_49590 6325 7275 gene locus_tag LOCUS_49600 6325 7275 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_49600 7537 8250 gene locus_tag LOCUS_49610 7537 8250 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_49610 8290 8478 gene locus_tag LOCUS_49620 8290 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 8678 9565 gene locus_tag LOCUS_49630 8678 9565 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 protein_id gnl|my_center|LOCUS_49630 9771 9577 gene locus_tag LOCUS_49640 9771 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 10139 10777 gene locus_tag LOCUS_49650 gene bluB 10139 10777 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_49650 11939 11070 gene locus_tag LOCUS_49660 11939 11070 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921650.1 protein_id gnl|my_center|LOCUS_49660 12514 12110 gene locus_tag LOCUS_49670 12514 12110 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194288.1 protein_id gnl|my_center|LOCUS_49670 12673 13896 gene locus_tag LOCUS_49680 12673 13896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968029.1 protein_id gnl|my_center|LOCUS_49680 14469 14092 gene locus_tag LOCUS_49690 14469 14092 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_49690 14978 14694 gene locus_tag LOCUS_49700 14978 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 15812 15492 gene locus_tag LOCUS_49710 15812 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 15982 16221 gene locus_tag LOCUS_49720 15982 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 16350 16763 gene locus_tag LOCUS_49730 16350 16763 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269427.1 protein_id gnl|my_center|LOCUS_49730 17026 17367 gene locus_tag LOCUS_49740 17026 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 17685 17398 gene locus_tag LOCUS_49750 17685 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 18679 19041 gene locus_tag LOCUS_49760 18679 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 20197 19160 gene locus_tag LOCUS_49770 20197 19160 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530692.1 protein_id gnl|my_center|LOCUS_49770 20594 20418 gene locus_tag LOCUS_49780 20594 20418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 21622 21065 gene locus_tag LOCUS_49790 21622 21065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 22077 21622 gene locus_tag LOCUS_49800 22077 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 22505 22077 gene locus_tag LOCUS_49810 22505 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 22765 22502 gene locus_tag LOCUS_49820 22765 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 22871 23581 gene locus_tag LOCUS_49830 22871 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 23609 24373 gene locus_tag LOCUS_49840 23609 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 24598 24912 gene locus_tag LOCUS_49850 24598 24912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 24912 25109 gene locus_tag LOCUS_49860 24912 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 25363 25686 gene locus_tag LOCUS_49870 25363 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 26614 25742 gene locus_tag LOCUS_49880 26614 25742 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396254.1 protein_id gnl|my_center|LOCUS_49880 27657 26956 gene locus_tag LOCUS_49890 27657 26956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057841.1 protein_id gnl|my_center|LOCUS_49890 29461 27662 gene locus_tag LOCUS_49900 29461 27662 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247367.1 protein_id gnl|my_center|LOCUS_49900 30378 29461 gene locus_tag LOCUS_49910 30378 29461 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446465.1 protein_id gnl|my_center|LOCUS_49910 31871 30657 gene locus_tag LOCUS_49920 31871 30657 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_49920 33251 31944 gene locus_tag LOCUS_49930 33251 31944 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_49930 33402 34790 gene locus_tag LOCUS_49940 33402 34790 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243832.1 protein_id gnl|my_center|LOCUS_49940 34891 35097 gene locus_tag LOCUS_49950 34891 35097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 35662 35420 gene locus_tag LOCUS_49960 35662 35420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 35925 36245 gene locus_tag LOCUS_49970 35925 36245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 36492 36644 gene locus_tag LOCUS_49980 36492 36644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 36729 36959 gene locus_tag LOCUS_49990 36729 36959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 37267 36956 gene locus_tag LOCUS_50000 37267 36956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 37873 37346 gene locus_tag LOCUS_50010 37873 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 38388 39569 gene locus_tag LOCUS_50020 38388 39569 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083921.1 protein_id gnl|my_center|LOCUS_50020 40071 40904 gene locus_tag LOCUS_50030 40071 40904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 40990 41562 gene locus_tag LOCUS_50040 40990 41562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 41682 42902 gene locus_tag LOCUS_50050 41682 42902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895662.1 protein_id gnl|my_center|LOCUS_50050 42965 44158 gene locus_tag LOCUS_50060 42965 44158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 44346 44867 gene locus_tag LOCUS_50070 44346 44867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 44885 45988 gene locus_tag LOCUS_50080 44885 45988 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703827.1 protein_id gnl|my_center|LOCUS_50080 47706 46489 gene locus_tag LOCUS_50090 47706 46489 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039746.1 protein_id gnl|my_center|LOCUS_50090 49759 47699 gene locus_tag LOCUS_50100 49759 47699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_50100 50532 49756 gene locus_tag LOCUS_50110 50532 49756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 53303 50529 gene locus_tag LOCUS_50120 53303 50529 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_50120 53775 54458 gene locus_tag LOCUS_50130 53775 54458 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_50130 55079 54564 gene locus_tag LOCUS_50140 55079 54564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 55486 56217 gene locus_tag LOCUS_50150 55486 56217 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_50150 56480 57112 gene locus_tag LOCUS_50160 gene queE 56480 57112 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_50160 57407 57769 gene locus_tag LOCUS_50170 57407 57769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 57769 58197 gene locus_tag LOCUS_50180 57769 58197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 58358 59464 gene locus_tag LOCUS_50190 58358 59464 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533235.1 protein_id gnl|my_center|LOCUS_50190 62756 59754 gene locus_tag LOCUS_50200 62756 59754 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967015.1 protein_id gnl|my_center|LOCUS_50200 64225 63068 gene locus_tag LOCUS_50210 64225 63068 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_50210 65516 64602 gene locus_tag LOCUS_50220 65516 64602 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_50220 65665 66948 gene locus_tag LOCUS_50230 65665 66948 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086793.1 protein_id gnl|my_center|LOCUS_50230 67022 67990 gene locus_tag LOCUS_50240 67022 67990 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258670.1 protein_id gnl|my_center|LOCUS_50240 68329 69303 gene locus_tag LOCUS_50250 68329 69303 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 protein_id gnl|my_center|LOCUS_50250 70192 69338 gene locus_tag LOCUS_50260 70192 69338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 70358 70654 gene locus_tag LOCUS_50270 70358 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 70933 71829 gene locus_tag LOCUS_50280 70933 71829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383471.1 protein_id gnl|my_center|LOCUS_50280 71847 72935 gene locus_tag LOCUS_50290 71847 72935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383472.1 protein_id gnl|my_center|LOCUS_50290 72935 73975 gene locus_tag LOCUS_50300 72935 73975 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383473.1 protein_id gnl|my_center|LOCUS_50300 74121 74948 gene locus_tag LOCUS_50310 74121 74948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383474.1 protein_id gnl|my_center|LOCUS_50310 74967 75170 gene locus_tag LOCUS_50320 74967 75170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 75231 76421 gene locus_tag LOCUS_50330 75231 76421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 76672 77283 gene locus_tag LOCUS_50340 76672 77283 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088243.1 protein_id gnl|my_center|LOCUS_50340 77329 78216 gene locus_tag LOCUS_50350 77329 78216 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391165.1 protein_id gnl|my_center|LOCUS_50350 78406 78873 gene locus_tag LOCUS_50360 78406 78873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 81374 78954 gene locus_tag LOCUS_50370 81374 78954 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529412.1 protein_id gnl|my_center|LOCUS_50370 83206 81599 gene locus_tag LOCUS_50380 83206 81599 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966289.1 protein_id gnl|my_center|LOCUS_50380 84084 83239 gene locus_tag LOCUS_50390 84084 83239 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104230.1 protein_id gnl|my_center|LOCUS_50390 84605 84216 gene locus_tag LOCUS_50400 84605 84216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 86351 84714 gene locus_tag LOCUS_50410 86351 84714 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339388.1 protein_id gnl|my_center|LOCUS_50410 87154 86348 gene locus_tag LOCUS_50420 87154 86348 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970566.1 protein_id gnl|my_center|LOCUS_50420 88911 87157 gene locus_tag LOCUS_50430 88911 87157 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 protein_id gnl|my_center|LOCUS_50430 90002 88908 gene locus_tag LOCUS_50440 90002 88908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970338.1 protein_id gnl|my_center|LOCUS_50440 91111 90059 gene locus_tag LOCUS_50450 91111 90059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 protein_id gnl|my_center|LOCUS_50450 91290 91985 gene locus_tag LOCUS_50460 91290 91985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 92214 92005 gene locus_tag LOCUS_50470 92214 92005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 92750 93130 gene locus_tag LOCUS_50480 92750 93130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 93170 94105 gene locus_tag LOCUS_50490 93170 94105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 96016 94130 gene locus_tag LOCUS_50500 96016 94130 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395800.1 protein_id gnl|my_center|LOCUS_50500 97016 96279 gene locus_tag LOCUS_50510 97016 96279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083874.1 protein_id gnl|my_center|LOCUS_50510 97761 97018 gene locus_tag LOCUS_50520 97761 97018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083875.1 protein_id gnl|my_center|LOCUS_50520 98753 97758 gene locus_tag LOCUS_50530 98753 97758 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083876.1 protein_id gnl|my_center|LOCUS_50530 99628 98750 gene locus_tag LOCUS_50540 99628 98750 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083877.1 protein_id gnl|my_center|LOCUS_50540 101207 100041 gene locus_tag LOCUS_50550 101207 100041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083878.1 protein_id gnl|my_center|LOCUS_50550 102194 101271 gene locus_tag LOCUS_50560 102194 101271 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083879.1 protein_id gnl|my_center|LOCUS_50560 102988 102383 gene locus_tag LOCUS_50570 102988 102383 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_50570 103767 102985 gene locus_tag LOCUS_50580 gene rutD 103767 102985 CDS product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691080.1 protein_id gnl|my_center|LOCUS_50580 104180 103773 gene locus_tag LOCUS_50590 gene rutC 104180 103773 CDS product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004443491.1 protein_id gnl|my_center|LOCUS_50590 104970 104230 gene locus_tag LOCUS_50600 gene rutB 104970 104230 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004443492.1 protein_id gnl|my_center|LOCUS_50600 106058 104970 gene locus_tag LOCUS_50610 gene rutA 106058 104970 CDS product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097193.1 protein_id gnl|my_center|LOCUS_50610 106399 107109 gene locus_tag LOCUS_50620 gene rutR 106399 107109 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001571240.1 protein_id gnl|my_center|LOCUS_50620 107474 108343 gene locus_tag LOCUS_50630 107474 108343 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090009.1 protein_id gnl|my_center|LOCUS_50630 108340 108720 gene locus_tag LOCUS_50640 108340 108720 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090010.1 protein_id gnl|my_center|LOCUS_50640 109154 110116 gene locus_tag LOCUS_50650 109154 110116 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530692.1 protein_id gnl|my_center|LOCUS_50650 110456 114073 gene locus_tag LOCUS_50660 110456 114073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 114125 114481 gene locus_tag LOCUS_50670 114125 114481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 114639 115286 gene locus_tag LOCUS_50680 114639 115286 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090887.1 protein_id gnl|my_center|LOCUS_50680 115612 116247 gene locus_tag LOCUS_50690 115612 116247 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965307.1 protein_id gnl|my_center|LOCUS_50690 116427 117347 gene locus_tag LOCUS_50700 gene metA 116427 117347 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252334.1 protein_id gnl|my_center|LOCUS_50700 117623 121126 gene locus_tag LOCUS_50710 117623 121126 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967015.1 protein_id gnl|my_center|LOCUS_50710 121957 121373 gene locus_tag LOCUS_50720 121957 121373 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085642.1 protein_id gnl|my_center|LOCUS_50720 122521 121967 gene locus_tag LOCUS_50730 122521 121967 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172439.1 protein_id gnl|my_center|LOCUS_50730 122698 123663 gene locus_tag LOCUS_50740 122698 123663 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089979.1 protein_id gnl|my_center|LOCUS_50740 123948 123712 gene locus_tag LOCUS_50750 123948 123712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 124306 124554 gene locus_tag LOCUS_50760 124306 124554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 125508 124579 gene locus_tag LOCUS_50770 125508 124579 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525156.1 protein_id gnl|my_center|LOCUS_50770 125764 126876 gene locus_tag LOCUS_50780 125764 126876 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275469.1 protein_id gnl|my_center|LOCUS_50780 126900 127940 gene locus_tag LOCUS_50790 126900 127940 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_50790 128801 127950 gene locus_tag LOCUS_50800 128801 127950 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332090.1 protein_id gnl|my_center|LOCUS_50800 129494 128814 gene locus_tag LOCUS_50810 129494 128814 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104188.1 protein_id gnl|my_center|LOCUS_50810 130171 129503 gene locus_tag LOCUS_50820 130171 129503 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104187.1 protein_id gnl|my_center|LOCUS_50820 131267 130344 gene locus_tag LOCUS_50830 131267 130344 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396234.1 protein_id gnl|my_center|LOCUS_50830 131914 132879 gene locus_tag LOCUS_50840 131914 132879 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 protein_id gnl|my_center|LOCUS_50840 134550 132898 gene locus_tag LOCUS_50850 134550 132898 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205307.1 protein_id gnl|my_center|LOCUS_50850 135634 134732 gene locus_tag LOCUS_50860 135634 134732 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083880.1 protein_id gnl|my_center|LOCUS_50860 135799 136401 gene locus_tag LOCUS_50870 135799 136401 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328872.1 protein_id gnl|my_center|LOCUS_50870 137689 136676 gene locus_tag LOCUS_50880 137689 136676 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_50880 137815 138456 gene locus_tag LOCUS_50890 137815 138456 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090406.1 protein_id gnl|my_center|LOCUS_50890 139239 138616 gene locus_tag LOCUS_50900 139239 138616 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533542.1 protein_id gnl|my_center|LOCUS_50900 139340 140746 gene locus_tag LOCUS_50910 139340 140746 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533544.1 protein_id gnl|my_center|LOCUS_50910 140828 141568 gene locus_tag LOCUS_50920 140828 141568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275427.1 protein_id gnl|my_center|LOCUS_50920 142594 141581 gene locus_tag LOCUS_50930 142594 141581 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969472.1 protein_id gnl|my_center|LOCUS_50930 142995 143336 gene locus_tag LOCUS_50940 142995 143336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 143443 143802 gene locus_tag LOCUS_50950 143443 143802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 144125 143895 gene locus_tag LOCUS_50960 144125 143895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 145426 144245 gene locus_tag LOCUS_50970 145426 144245 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119555905.1 protein_id gnl|my_center|LOCUS_50970 146715 145438 gene locus_tag LOCUS_50980 146715 145438 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967134.1 protein_id gnl|my_center|LOCUS_50980 147274 146699 gene locus_tag LOCUS_50990 147274 146699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 148269 147271 gene locus_tag LOCUS_51000 148269 147271 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814124.1 protein_id gnl|my_center|LOCUS_51000 149318 148359 gene locus_tag LOCUS_51010 149318 148359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 149548 150450 gene locus_tag LOCUS_51020 149548 150450 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931595.1 protein_id gnl|my_center|LOCUS_51020 150866 151798 gene locus_tag LOCUS_51030 150866 151798 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808120.1 protein_id gnl|my_center|LOCUS_51030 151908 152300 gene locus_tag LOCUS_51040 151908 152300 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530449.1 protein_id gnl|my_center|LOCUS_51040 152356 153423 gene locus_tag LOCUS_51050 152356 153423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 153465 154784 gene locus_tag LOCUS_51060 153465 154784 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_51060 155086 156024 gene locus_tag LOCUS_51070 155086 156024 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973947.1 protein_id gnl|my_center|LOCUS_51070 156134 157192 gene locus_tag LOCUS_51080 156134 157192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 157299 158630 gene locus_tag LOCUS_51090 157299 158630 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085466.1 protein_id gnl|my_center|LOCUS_51090 >Feature sequence18 945 136 gene locus_tag LOCUS_51100 945 136 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391054.1 protein_id gnl|my_center|LOCUS_51100 2210 984 gene locus_tag LOCUS_51110 2210 984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067077.1 protein_id gnl|my_center|LOCUS_51110 2397 2996 gene locus_tag LOCUS_51120 2397 2996 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 protein_id gnl|my_center|LOCUS_51120 4941 3289 gene locus_tag LOCUS_51130 4941 3289 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521481.1 protein_id gnl|my_center|LOCUS_51130 6035 4938 gene locus_tag LOCUS_51140 6035 4938 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521482.1 protein_id gnl|my_center|LOCUS_51140 6183 7403 gene locus_tag LOCUS_51150 6183 7403 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057204.1 protein_id gnl|my_center|LOCUS_51150 8102 7437 gene locus_tag LOCUS_51160 8102 7437 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339331.1 protein_id gnl|my_center|LOCUS_51160 8788 8102 gene locus_tag LOCUS_51170 8788 8102 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339330.1 protein_id gnl|my_center|LOCUS_51170 9603 8848 gene locus_tag LOCUS_51180 9603 8848 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339329.1 protein_id gnl|my_center|LOCUS_51180 10430 9597 gene locus_tag LOCUS_51190 10430 9597 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339328.1 protein_id gnl|my_center|LOCUS_51190 10992 11441 gene locus_tag LOCUS_51200 10992 11441 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528705.1 protein_id gnl|my_center|LOCUS_51200 12185 11469 gene locus_tag LOCUS_51210 12185 11469 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254903.1 protein_id gnl|my_center|LOCUS_51210 12320 12904 gene locus_tag LOCUS_51220 12320 12904 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531333.1 protein_id gnl|my_center|LOCUS_51220 12897 13733 gene locus_tag LOCUS_51230 12897 13733 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527060.1 protein_id gnl|my_center|LOCUS_51230 13788 14780 gene locus_tag LOCUS_51240 13788 14780 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064844.1 protein_id gnl|my_center|LOCUS_51240 15182 16117 gene locus_tag LOCUS_51250 15182 16117 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_51250 16233 16910 gene locus_tag LOCUS_51260 16233 16910 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_51260 16967 17782 gene locus_tag LOCUS_51270 16967 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 18000 17803 gene locus_tag LOCUS_51280 18000 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 19355 17997 gene locus_tag LOCUS_51290 gene hemL 19355 17997 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_51290 20440 19394 gene locus_tag LOCUS_51300 20440 19394 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414790.1 protein_id gnl|my_center|LOCUS_51300 21151 20486 gene locus_tag LOCUS_51310 21151 20486 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444585.1 protein_id gnl|my_center|LOCUS_51310 22371 21148 gene locus_tag LOCUS_51320 22371 21148 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090589.1 protein_id gnl|my_center|LOCUS_51320 22561 23331 gene locus_tag LOCUS_51330 22561 23331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 23483 23947 gene locus_tag LOCUS_51340 23483 23947 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925827.1 protein_id gnl|my_center|LOCUS_51340 25610 24066 gene locus_tag LOCUS_51350 25610 24066 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930411.1 protein_id gnl|my_center|LOCUS_51350 26686 25679 gene locus_tag LOCUS_51360 26686 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 28340 26739 gene locus_tag LOCUS_51370 28340 26739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974950.1 protein_id gnl|my_center|LOCUS_51370 29313 28519 gene locus_tag LOCUS_51380 29313 28519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930641.1 protein_id gnl|my_center|LOCUS_51380 30198 29317 gene locus_tag LOCUS_51390 30198 29317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064168.1 protein_id gnl|my_center|LOCUS_51390 31337 30276 gene locus_tag LOCUS_51400 31337 30276 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820140.1 protein_id gnl|my_center|LOCUS_51400 32486 31386 gene locus_tag LOCUS_51410 32486 31386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532646.1 protein_id gnl|my_center|LOCUS_51410 34102 32825 gene locus_tag LOCUS_51420 gene gabT 34102 32825 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_51420 35087 34167 gene locus_tag LOCUS_51430 35087 34167 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224019391.1 protein_id gnl|my_center|LOCUS_51430 35299 36504 gene locus_tag LOCUS_51440 35299 36504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921490.1 protein_id gnl|my_center|LOCUS_51440 36573 37115 gene locus_tag LOCUS_51450 36573 37115 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192889.1 protein_id gnl|my_center|LOCUS_51450 38475 37219 gene locus_tag LOCUS_51460 38475 37219 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 protein_id gnl|my_center|LOCUS_51460 38614 39057 gene locus_tag LOCUS_51470 38614 39057 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168297222.1 protein_id gnl|my_center|LOCUS_51470 40481 39369 gene locus_tag LOCUS_51480 40481 39369 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_51480 40556 41191 gene locus_tag LOCUS_51490 40556 41191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 42270 41509 gene locus_tag LOCUS_51500 42270 41509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811645.1 protein_id gnl|my_center|LOCUS_51500 43799 42285 gene locus_tag LOCUS_51510 43799 42285 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930009.1 protein_id gnl|my_center|LOCUS_51510 44822 43827 gene locus_tag LOCUS_51520 44822 43827 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973039.1 protein_id gnl|my_center|LOCUS_51520 45804 44800 gene locus_tag LOCUS_51530 45804 44800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_51530 46646 45804 gene locus_tag LOCUS_51540 46646 45804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389765.1 protein_id gnl|my_center|LOCUS_51540 47626 46658 gene locus_tag LOCUS_51550 47626 46658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968091.1 protein_id gnl|my_center|LOCUS_51550 49258 47642 gene locus_tag LOCUS_51560 49258 47642 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973036.1 protein_id gnl|my_center|LOCUS_51560 49791 49333 gene locus_tag LOCUS_51570 49791 49333 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809022.1 protein_id gnl|my_center|LOCUS_51570 50801 49788 gene locus_tag LOCUS_51580 50801 49788 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807522.1 protein_id gnl|my_center|LOCUS_51580 52304 51321 gene locus_tag LOCUS_51590 52304 51321 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 protein_id gnl|my_center|LOCUS_51590 52477 53454 gene locus_tag LOCUS_51600 52477 53454 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 protein_id gnl|my_center|LOCUS_51600 53451 54281 gene locus_tag LOCUS_51610 53451 54281 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_51610 54745 54320 gene locus_tag LOCUS_51620 54745 54320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 56129 54885 gene locus_tag LOCUS_51630 56129 54885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_51630 57128 56256 gene locus_tag LOCUS_51640 57128 56256 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 protein_id gnl|my_center|LOCUS_51640 57841 57131 gene locus_tag LOCUS_51650 57841 57131 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089781.1 protein_id gnl|my_center|LOCUS_51650 58086 58862 gene locus_tag LOCUS_51660 58086 58862 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036039.1 protein_id gnl|my_center|LOCUS_51660 59748 58942 gene locus_tag LOCUS_51670 59748 58942 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975110.1 protein_id gnl|my_center|LOCUS_51670 59880 60833 gene locus_tag LOCUS_51680 59880 60833 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252799.1 protein_id gnl|my_center|LOCUS_51680 62048 60879 gene locus_tag LOCUS_51690 62048 60879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 62375 63070 gene locus_tag LOCUS_51700 62375 63070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 63073 64545 gene locus_tag LOCUS_51710 63073 64545 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 protein_id gnl|my_center|LOCUS_51710 64877 66919 gene locus_tag LOCUS_51720 64877 66919 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338380.1 protein_id gnl|my_center|LOCUS_51720 66916 68556 gene locus_tag LOCUS_51730 66916 68556 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_51730 68682 69896 gene locus_tag LOCUS_51740 68682 69896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090589.1 protein_id gnl|my_center|LOCUS_51740 70177 70851 gene locus_tag LOCUS_51750 70177 70851 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230683.1 protein_id gnl|my_center|LOCUS_51750 70897 71763 gene locus_tag LOCUS_51760 70897 71763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 72696 72166 gene locus_tag LOCUS_51770 72696 72166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 73850 72693 gene locus_tag LOCUS_51780 73850 72693 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090569.1 protein_id gnl|my_center|LOCUS_51780 74057 74821 gene locus_tag LOCUS_51790 74057 74821 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_51790 74941 75993 gene locus_tag LOCUS_51800 74941 75993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339376.1 protein_id gnl|my_center|LOCUS_51800 76004 77113 gene locus_tag LOCUS_51810 76004 77113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_51810 77110 77976 gene locus_tag LOCUS_51820 77110 77976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_51820 77976 78755 gene locus_tag LOCUS_51830 77976 78755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724379.1 protein_id gnl|my_center|LOCUS_51830 79776 78769 gene locus_tag LOCUS_51840 79776 78769 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_51840 80642 79857 gene locus_tag LOCUS_51850 80642 79857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_51850 81610 80675 gene locus_tag LOCUS_51860 81610 80675 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088087.1 protein_id gnl|my_center|LOCUS_51860 82572 81613 gene locus_tag LOCUS_51870 82572 81613 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_51870 83154 82672 gene locus_tag LOCUS_51880 83154 82672 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467599.1 protein_id gnl|my_center|LOCUS_51880 83984 83175 gene locus_tag LOCUS_51890 83984 83175 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816500.1 protein_id gnl|my_center|LOCUS_51890 84789 84022 gene locus_tag LOCUS_51900 84789 84022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085710.1 protein_id gnl|my_center|LOCUS_51900 85513 84779 gene locus_tag LOCUS_51910 85513 84779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_51910 86532 85510 gene locus_tag LOCUS_51920 86532 85510 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_51920 87365 86532 gene locus_tag LOCUS_51930 87365 86532 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_51930 88699 87449 gene locus_tag LOCUS_51940 88699 87449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_51940 88910 89713 gene locus_tag LOCUS_51950 88910 89713 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383452.1 protein_id gnl|my_center|LOCUS_51950 89821 90960 gene locus_tag LOCUS_51960 89821 90960 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_51960 90966 91859 gene locus_tag LOCUS_51970 90966 91859 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097993.1 protein_id gnl|my_center|LOCUS_51970 92009 92275 gene locus_tag LOCUS_51980 92009 92275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 94696 92405 gene locus_tag LOCUS_51990 94696 92405 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529820.1 protein_id gnl|my_center|LOCUS_51990 95920 94898 gene locus_tag LOCUS_52000 95920 94898 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_52000 96375 95929 gene locus_tag LOCUS_52010 96375 95929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 97269 96409 gene locus_tag LOCUS_52020 97269 96409 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930246.1 protein_id gnl|my_center|LOCUS_52020 98528 97266 gene locus_tag LOCUS_52030 98528 97266 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_52030 99692 98592 gene locus_tag LOCUS_52040 99692 98592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 100800 99784 gene locus_tag LOCUS_52050 100800 99784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 101190 102275 gene locus_tag LOCUS_52060 gene ugpC 101190 102275 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086694.1 protein_id gnl|my_center|LOCUS_52060 102344 103627 gene locus_tag LOCUS_52070 102344 103627 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_52070 103633 104553 gene locus_tag LOCUS_52080 103633 104553 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_52080 104571 105380 gene locus_tag LOCUS_52090 104571 105380 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 protein_id gnl|my_center|LOCUS_52090 106098 105409 gene locus_tag LOCUS_52100 106098 105409 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577311.1 protein_id gnl|my_center|LOCUS_52100 108957 107116 gene locus_tag LOCUS_52110 108957 107116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 109322 110200 gene locus_tag LOCUS_52120 109322 110200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 110282 111322 gene locus_tag LOCUS_52130 110282 111322 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_52130 111291 112250 gene locus_tag LOCUS_52140 111291 112250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 112280 112987 gene locus_tag LOCUS_52150 112280 112987 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085895.1 protein_id gnl|my_center|LOCUS_52150 112984 113457 gene locus_tag LOCUS_52160 112984 113457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 113470 114078 gene locus_tag LOCUS_52170 113470 114078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 114079 116406 gene locus_tag LOCUS_52180 114079 116406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 116746 120162 gene locus_tag LOCUS_52190 116746 120162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 120159 120911 gene locus_tag LOCUS_52200 120159 120911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 121902 120937 gene locus_tag LOCUS_52210 121902 120937 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_52210 124239 122746 gene locus_tag LOCUS_52220 124239 122746 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035843.1 protein_id gnl|my_center|LOCUS_52220 125083 124331 gene locus_tag LOCUS_52230 125083 124331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086432.1 protein_id gnl|my_center|LOCUS_52230 125879 125091 gene locus_tag LOCUS_52240 125879 125091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284954.1 protein_id gnl|my_center|LOCUS_52240 127008 126721 gene locus_tag LOCUS_52250 127008 126721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 126892 127104 gene locus_tag LOCUS_52260 126892 127104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 127889 127101 gene locus_tag LOCUS_52270 127889 127101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 129122 128463 gene locus_tag LOCUS_52280 129122 128463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 130200 129862 gene locus_tag LOCUS_52290 130200 129862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 130393 130848 gene locus_tag LOCUS_52300 130393 130848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 132326 131301 gene locus_tag LOCUS_52310 132326 131301 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 protein_id gnl|my_center|LOCUS_52310 133322 132333 gene locus_tag LOCUS_52320 gene gmd 133322 132333 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918894.1 protein_id gnl|my_center|LOCUS_52320 135569 133569 gene locus_tag LOCUS_52330 135569 133569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 137830 135566 gene locus_tag LOCUS_52340 137830 135566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 138768 137827 gene locus_tag LOCUS_52350 138768 137827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 140531 139386 gene locus_tag LOCUS_52360 140531 139386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 141775 142668 gene locus_tag LOCUS_52370 141775 142668 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029280.1 protein_id gnl|my_center|LOCUS_52370 143003 142794 gene locus_tag LOCUS_52380 143003 142794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 143211 143138 gene locus_tag LOCUS_t00360 143211 143138 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 143459 145087 gene locus_tag LOCUS_52390 143459 145087 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085405.1 protein_id gnl|my_center|LOCUS_52390 145177 146535 gene locus_tag LOCUS_52400 145177 146535 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463861.1 protein_id gnl|my_center|LOCUS_52400 146690 148033 gene locus_tag LOCUS_52410 146690 148033 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463861.1 protein_id gnl|my_center|LOCUS_52410 148127 149233 gene locus_tag LOCUS_52420 148127 149233 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 protein_id gnl|my_center|LOCUS_52420 149252 150028 gene locus_tag LOCUS_52430 149252 150028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 150047 151192 gene locus_tag LOCUS_52440 150047 151192 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083611.1 protein_id gnl|my_center|LOCUS_52440 151243 151434 gene locus_tag LOCUS_52450 151243 151434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 >Feature sequence19 82 990 gene locus_tag LOCUS_52460 82 990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930233.1 protein_id gnl|my_center|LOCUS_52460 1679 999 gene locus_tag LOCUS_52470 1679 999 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918366.1 protein_id gnl|my_center|LOCUS_52470 1892 2278 gene locus_tag LOCUS_52480 1892 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 2443 3057 gene locus_tag LOCUS_52490 2443 3057 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921332.1 protein_id gnl|my_center|LOCUS_52490 4265 3327 gene locus_tag LOCUS_52500 4265 3327 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_52500 4405 4689 gene locus_tag LOCUS_52510 4405 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 4724 5290 gene locus_tag LOCUS_52520 4724 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 5462 5653 gene locus_tag LOCUS_52530 5462 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 6215 5700 gene locus_tag LOCUS_52540 6215 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 6885 6241 gene locus_tag LOCUS_52550 6885 6241 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_52550 7095 7619 gene locus_tag LOCUS_52560 7095 7619 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 protein_id gnl|my_center|LOCUS_52560 7720 10086 gene locus_tag LOCUS_52570 7720 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 11535 10141 gene locus_tag LOCUS_52580 11535 10141 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104315.1 protein_id gnl|my_center|LOCUS_52580 12398 11604 gene locus_tag LOCUS_52590 12398 11604 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388549.1 protein_id gnl|my_center|LOCUS_52590 13705 12668 gene locus_tag LOCUS_52600 13705 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 14795 13698 gene locus_tag LOCUS_52610 gene ugpC 14795 13698 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 protein_id gnl|my_center|LOCUS_52610 15599 14799 gene locus_tag LOCUS_52620 gene hpaI 15599 14799 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 protein_id gnl|my_center|LOCUS_52620 16815 15937 gene locus_tag LOCUS_52630 16815 15937 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175095.1 protein_id gnl|my_center|LOCUS_52630 17658 16825 gene locus_tag LOCUS_52640 17658 16825 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392694.1 protein_id gnl|my_center|LOCUS_52640 17753 18901 gene locus_tag LOCUS_52650 17753 18901 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812102.1 protein_id gnl|my_center|LOCUS_52650 20155 19112 gene locus_tag LOCUS_52660 20155 19112 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170959.1 protein_id gnl|my_center|LOCUS_52660 20434 21684 gene locus_tag LOCUS_52670 20434 21684 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_52670 22093 22983 gene locus_tag LOCUS_52680 22093 22983 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_52680 22995 23807 gene locus_tag LOCUS_52690 22995 23807 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346349.1 protein_id gnl|my_center|LOCUS_52690 23812 24228 gene locus_tag LOCUS_52700 23812 24228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 25860 24313 gene locus_tag LOCUS_52710 25860 24313 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186395.1 protein_id gnl|my_center|LOCUS_52710 26126 25920 gene locus_tag LOCUS_52720 26126 25920 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194775.1 protein_id gnl|my_center|LOCUS_52720 26879 26229 gene locus_tag LOCUS_52730 26879 26229 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977883.1 protein_id gnl|my_center|LOCUS_52730 27934 26942 gene locus_tag LOCUS_52740 27934 26942 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 protein_id gnl|my_center|LOCUS_52740 28785 27994 gene locus_tag LOCUS_52750 28785 27994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 protein_id gnl|my_center|LOCUS_52750 29675 28782 gene locus_tag LOCUS_52760 29675 28782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811610.1 protein_id gnl|my_center|LOCUS_52760 30796 29672 gene locus_tag LOCUS_52770 30796 29672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 protein_id gnl|my_center|LOCUS_52770 30937 31962 gene locus_tag LOCUS_52780 30937 31962 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384121.1 protein_id gnl|my_center|LOCUS_52780 32016 33050 gene locus_tag LOCUS_52790 32016 33050 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968140.1 protein_id gnl|my_center|LOCUS_52790 33115 33519 gene locus_tag LOCUS_52800 33115 33519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 33537 34277 gene locus_tag LOCUS_52810 33537 34277 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244654.1 protein_id gnl|my_center|LOCUS_52810 34812 34357 gene locus_tag LOCUS_52820 34812 34357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 35049 35630 gene locus_tag LOCUS_52830 35049 35630 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969653.1 protein_id gnl|my_center|LOCUS_52830 36913 36035 gene locus_tag LOCUS_52840 36913 36035 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533046.1 protein_id gnl|my_center|LOCUS_52840 37588 36917 gene locus_tag LOCUS_52850 37588 36917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_52850 37878 37573 gene locus_tag LOCUS_52860 37878 37573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 39068 37881 gene locus_tag LOCUS_52870 39068 37881 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383268.1 protein_id gnl|my_center|LOCUS_52870 40138 39065 gene locus_tag LOCUS_52880 40138 39065 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097690.1 protein_id gnl|my_center|LOCUS_52880 40219 41949 gene locus_tag LOCUS_52890 gene araD 40219 41949 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083210.1 protein_id gnl|my_center|LOCUS_52890 43042 42080 gene locus_tag LOCUS_52900 43042 42080 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139584.1 protein_id gnl|my_center|LOCUS_52900 43134 44021 gene locus_tag LOCUS_52910 43134 44021 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176728.1 protein_id gnl|my_center|LOCUS_52910 44976 44083 gene locus_tag LOCUS_52920 44976 44083 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967441.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52920 46277 45336 gene locus_tag LOCUS_52930 gene kdgD 46277 45336 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088612.1 protein_id gnl|my_center|LOCUS_52930 47299 46406 gene locus_tag LOCUS_52940 47299 46406 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088611.1 protein_id gnl|my_center|LOCUS_52940 48342 47350 gene locus_tag LOCUS_52950 48342 47350 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105417854.1 protein_id gnl|my_center|LOCUS_52950 48678 49172 gene locus_tag LOCUS_52960 48678 49172 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_52960 50064 49225 gene locus_tag LOCUS_52970 50064 49225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 50162 50758 gene locus_tag LOCUS_52980 50162 50758 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931155.1 protein_id gnl|my_center|LOCUS_52980 50924 51421 gene locus_tag LOCUS_52990 50924 51421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 53045 51495 gene locus_tag LOCUS_53000 53045 51495 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328096.1 protein_id gnl|my_center|LOCUS_53000 54380 53058 gene locus_tag LOCUS_53010 54380 53058 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529361.1 protein_id gnl|my_center|LOCUS_53010 56418 54469 gene locus_tag LOCUS_53020 56418 54469 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529362.1 protein_id gnl|my_center|LOCUS_53020 58152 57235 gene locus_tag LOCUS_53030 58152 57235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 protein_id gnl|my_center|LOCUS_53030 58289 59209 gene locus_tag LOCUS_53040 58289 59209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974644.1 protein_id gnl|my_center|LOCUS_53040 59453 61129 gene locus_tag LOCUS_53050 59453 61129 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389048.1 protein_id gnl|my_center|LOCUS_53050 61272 62186 gene locus_tag LOCUS_53060 61272 62186 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067112.1 protein_id gnl|my_center|LOCUS_53060 62407 62913 gene locus_tag LOCUS_53070 62407 62913 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 protein_id gnl|my_center|LOCUS_53070 62910 64481 gene locus_tag LOCUS_53080 62910 64481 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974089.1 protein_id gnl|my_center|LOCUS_53080 64492 67338 gene locus_tag LOCUS_53090 gene fdhF 64492 67338 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970349.1 protein_id gnl|my_center|LOCUS_53090 67345 68166 gene locus_tag LOCUS_53100 gene fdhD 67345 68166 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_53100 68163 68414 gene locus_tag LOCUS_53110 68163 68414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 69666 68722 gene locus_tag LOCUS_53120 69666 68722 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533364.1 protein_id gnl|my_center|LOCUS_53120 70718 69663 gene locus_tag LOCUS_53130 70718 69663 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530320.1 protein_id gnl|my_center|LOCUS_53130 70844 71269 gene locus_tag LOCUS_53140 70844 71269 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392404.1 protein_id gnl|my_center|LOCUS_53140 71981 71295 gene locus_tag LOCUS_53150 71981 71295 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929797.1 protein_id gnl|my_center|LOCUS_53150 72149 75547 gene locus_tag LOCUS_53160 72149 75547 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033458904.1 protein_id gnl|my_center|LOCUS_53160 75601 77055 gene locus_tag LOCUS_53170 75601 77055 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064621.1 protein_id gnl|my_center|LOCUS_53170 77982 77092 gene locus_tag LOCUS_53180 77982 77092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 78440 77994 gene locus_tag LOCUS_53190 gene tolR 78440 77994 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_53190 79081 78440 gene locus_tag LOCUS_53200 79081 78440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 81244 79100 gene locus_tag LOCUS_53210 81244 79100 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085247.1 protein_id gnl|my_center|LOCUS_53210 81877 82728 gene locus_tag LOCUS_53220 81877 82728 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090335.1 protein_id gnl|my_center|LOCUS_53220 83347 82748 gene locus_tag LOCUS_53230 83347 82748 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530116.1 protein_id gnl|my_center|LOCUS_53230 83409 84314 gene locus_tag LOCUS_53240 83409 84314 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530117.1 protein_id gnl|my_center|LOCUS_53240 84432 84734 gene locus_tag LOCUS_53250 84432 84734 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109030614.1 protein_id gnl|my_center|LOCUS_53250 84791 85009 gene locus_tag LOCUS_53260 84791 85009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 85033 85353 gene locus_tag LOCUS_53270 85033 85353 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974550.1 protein_id gnl|my_center|LOCUS_53270 85365 85793 gene locus_tag LOCUS_53280 85365 85793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 85905 86900 gene locus_tag LOCUS_53290 85905 86900 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 protein_id gnl|my_center|LOCUS_53290 87346 86960 gene locus_tag LOCUS_53300 87346 86960 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 protein_id gnl|my_center|LOCUS_53300 88704 87382 gene locus_tag LOCUS_53310 88704 87382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314759.1 protein_id gnl|my_center|LOCUS_53310 89183 88785 gene locus_tag LOCUS_53320 89183 88785 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972836.1 protein_id gnl|my_center|LOCUS_53320 89346 89771 gene locus_tag LOCUS_53330 89346 89771 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175078.1 protein_id gnl|my_center|LOCUS_53330 89841 90323 gene locus_tag LOCUS_53340 89841 90323 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085196.1 protein_id gnl|my_center|LOCUS_53340 91818 90385 gene locus_tag LOCUS_53350 91818 90385 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267663.1 protein_id gnl|my_center|LOCUS_53350 92317 91865 gene locus_tag LOCUS_53360 92317 91865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038926.1 protein_id gnl|my_center|LOCUS_53360 92987 92379 gene locus_tag LOCUS_53370 gene ssuE 92987 92379 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 protein_id gnl|my_center|LOCUS_53370 93786 92992 gene locus_tag LOCUS_53380 93786 92992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038928.1 protein_id gnl|my_center|LOCUS_53380 94625 93807 gene locus_tag LOCUS_53390 94625 93807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064578.1 protein_id gnl|my_center|LOCUS_53390 95704 94622 gene locus_tag LOCUS_53400 95704 94622 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064577.1 protein_id gnl|my_center|LOCUS_53400 96933 95815 gene locus_tag LOCUS_53410 96933 95815 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808035.1 protein_id gnl|my_center|LOCUS_53410 97165 97962 gene locus_tag LOCUS_53420 97165 97962 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665741.1 protein_id gnl|my_center|LOCUS_53420 98095 98706 gene locus_tag LOCUS_53430 98095 98706 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_53430 100248 98755 gene locus_tag LOCUS_53440 100248 98755 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_53440 101801 100398 gene locus_tag LOCUS_53450 101801 100398 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_53450 103852 101798 gene locus_tag LOCUS_53460 103852 101798 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385793.1 protein_id gnl|my_center|LOCUS_53460 105674 103839 gene locus_tag LOCUS_53470 105674 103839 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538197.1 protein_id gnl|my_center|LOCUS_53470 106974 105658 gene locus_tag LOCUS_53480 106974 105658 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112770.1 protein_id gnl|my_center|LOCUS_53480 107315 108037 gene locus_tag LOCUS_53490 107315 108037 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405525.1 protein_id gnl|my_center|LOCUS_53490 109168 108053 gene locus_tag LOCUS_53500 109168 108053 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_53500 109994 109530 gene locus_tag LOCUS_53510 109994 109530 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_53510 111995 110004 gene locus_tag LOCUS_53520 111995 110004 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975574.1 protein_id gnl|my_center|LOCUS_53520 113566 112004 gene locus_tag LOCUS_53530 113566 112004 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_53530 113681 114868 gene locus_tag LOCUS_53540 113681 114868 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_53540 115210 118653 gene locus_tag LOCUS_53550 115210 118653 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 protein_id gnl|my_center|LOCUS_53550 118683 119312 gene locus_tag LOCUS_53560 118683 119312 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853463.1 protein_id gnl|my_center|LOCUS_53560 120277 119324 gene locus_tag LOCUS_53570 120277 119324 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088162.1 protein_id gnl|my_center|LOCUS_53570 121549 120617 gene locus_tag LOCUS_53580 121549 120617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 122291 123721 gene locus_tag LOCUS_53590 122291 123721 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530546.1 protein_id gnl|my_center|LOCUS_53590 123785 123991 gene locus_tag LOCUS_53600 123785 123991 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 protein_id gnl|my_center|LOCUS_53600 125275 124004 gene locus_tag LOCUS_53610 125275 124004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 125670 126206 gene locus_tag LOCUS_53620 125670 126206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 126836 126252 gene locus_tag LOCUS_53630 126836 126252 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970153.1 protein_id gnl|my_center|LOCUS_53630 128160 127198 gene locus_tag LOCUS_53640 128160 127198 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_53640 128499 130715 gene locus_tag LOCUS_53650 128499 130715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 130931 131626 gene locus_tag LOCUS_53660 130931 131626 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529578.1 protein_id gnl|my_center|LOCUS_53660 131707 132078 gene locus_tag LOCUS_53670 131707 132078 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971212.1 protein_id gnl|my_center|LOCUS_53670 132094 132516 gene locus_tag LOCUS_53680 132094 132516 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 protein_id gnl|my_center|LOCUS_53680 133312 132599 gene locus_tag LOCUS_53690 133312 132599 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339314.1 protein_id gnl|my_center|LOCUS_53690 133471 134343 gene locus_tag LOCUS_53700 133471 134343 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562743.1 protein_id gnl|my_center|LOCUS_53700 134746 134420 gene locus_tag LOCUS_53710 134746 134420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 135954 134920 gene locus_tag LOCUS_53720 135954 134920 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339321.1 protein_id gnl|my_center|LOCUS_53720 136670 135951 gene locus_tag LOCUS_53730 gene pxpB 136670 135951 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087337.1 protein_id gnl|my_center|LOCUS_53730 137557 136850 gene locus_tag LOCUS_53740 137557 136850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085710.1 protein_id gnl|my_center|LOCUS_53740 138281 137547 gene locus_tag LOCUS_53750 138281 137547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_53750 139297 138278 gene locus_tag LOCUS_53760 139297 138278 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_53760 140175 139297 gene locus_tag LOCUS_53770 140175 139297 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_53770 141466 140210 gene locus_tag LOCUS_53780 141466 140210 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_53780 142246 141536 gene locus_tag LOCUS_53790 142246 141536 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085705.1 protein_id gnl|my_center|LOCUS_53790 143728 142661 gene locus_tag LOCUS_53800 143728 142661 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255173.1 protein_id gnl|my_center|LOCUS_53800 144786 143764 gene locus_tag LOCUS_53810 144786 143764 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912591.1 protein_id gnl|my_center|LOCUS_53810 145775 144873 gene locus_tag LOCUS_53820 145775 144873 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085704.1 protein_id gnl|my_center|LOCUS_53820 146557 146024 gene locus_tag LOCUS_53830 146557 146024 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083642.1 protein_id gnl|my_center|LOCUS_53830 148539 146659 gene locus_tag LOCUS_53840 148539 146659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 149333 148584 gene locus_tag LOCUS_53850 149333 148584 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 protein_id gnl|my_center|LOCUS_53850 149439 150326 gene locus_tag LOCUS_53860 149439 150326 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084956.1 protein_id gnl|my_center|LOCUS_53860 >Feature sequence20 774 310 gene locus_tag LOCUS_53870 774 310 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532169.1 protein_id gnl|my_center|LOCUS_53870 1109 4579 gene locus_tag LOCUS_53880 1109 4579 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171255.1 protein_id gnl|my_center|LOCUS_53880 5308 4754 gene locus_tag LOCUS_53890 5308 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 6523 5510 gene locus_tag LOCUS_53900 6523 5510 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_53900 6846 6523 gene locus_tag LOCUS_53910 6846 6523 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_53910 8052 6943 gene locus_tag LOCUS_53920 8052 6943 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087104.1 protein_id gnl|my_center|LOCUS_53920 8165 9418 gene locus_tag LOCUS_53930 gene tyrS 8165 9418 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087103.1 protein_id gnl|my_center|LOCUS_53930 9436 10056 gene locus_tag LOCUS_53940 9436 10056 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085290.1 protein_id gnl|my_center|LOCUS_53940 10521 10267 gene locus_tag LOCUS_53950 gene yoeB 10521 10267 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_53950 10772 10518 gene locus_tag LOCUS_53960 10772 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 11420 10842 gene locus_tag LOCUS_53970 gene leuD 11420 10842 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704819.1 protein_id gnl|my_center|LOCUS_53970 12814 11417 gene locus_tag LOCUS_53980 gene leuC 12814 11417 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_53980 13001 13807 gene locus_tag LOCUS_53990 13001 13807 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_53990 13947 15164 gene locus_tag LOCUS_54000 13947 15164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807943.1 protein_id gnl|my_center|LOCUS_54000 15262 16173 gene locus_tag LOCUS_54010 15262 16173 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_54010 16170 17171 gene locus_tag LOCUS_54020 16170 17171 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_54020 17171 17914 gene locus_tag LOCUS_54030 17171 17914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_54030 18296 18042 gene locus_tag LOCUS_54040 18296 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 18274 18987 gene locus_tag LOCUS_54050 18274 18987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103312601.1 protein_id gnl|my_center|LOCUS_54050 18990 20405 gene locus_tag LOCUS_54060 18990 20405 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225694.1 protein_id gnl|my_center|LOCUS_54060 20405 21289 gene locus_tag LOCUS_54070 20405 21289 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039143.1 protein_id gnl|my_center|LOCUS_54070 21286 22989 gene locus_tag LOCUS_54080 21286 22989 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_54080 22986 25049 gene locus_tag LOCUS_54090 22986 25049 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_54090 25049 25645 gene locus_tag LOCUS_54100 25049 25645 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_54100 25856 27259 gene locus_tag LOCUS_54110 25856 27259 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040324.1 protein_id gnl|my_center|LOCUS_54110 27249 29168 gene locus_tag LOCUS_54120 27249 29168 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_54120 29313 31043 gene locus_tag LOCUS_54130 29313 31043 CDS product Cache 3/Cache 2 fusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 protein_id gnl|my_center|LOCUS_54130 32530 31229 gene locus_tag LOCUS_54140 32530 31229 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529503.1 protein_id gnl|my_center|LOCUS_54140 33929 32646 gene locus_tag LOCUS_54150 33929 32646 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894844.1 protein_id gnl|my_center|LOCUS_54150 35279 33996 gene locus_tag LOCUS_54160 35279 33996 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894844.1 protein_id gnl|my_center|LOCUS_54160 35441 36466 gene locus_tag LOCUS_54170 35441 36466 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085022.1 protein_id gnl|my_center|LOCUS_54170 36495 38177 gene locus_tag LOCUS_54180 36495 38177 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_54180 38174 38395 gene locus_tag LOCUS_54190 38174 38395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 38648 39277 gene locus_tag LOCUS_54200 38648 39277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_54200 39280 39975 gene locus_tag LOCUS_54210 39280 39975 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_54210 40068 40568 gene locus_tag LOCUS_54220 40068 40568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 40847 41116 gene locus_tag LOCUS_54230 40847 41116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 41134 42261 gene locus_tag LOCUS_54240 41134 42261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 43633 42302 gene locus_tag LOCUS_54250 43633 42302 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531968.1 protein_id gnl|my_center|LOCUS_54250 43759 44304 gene locus_tag LOCUS_54260 43759 44304 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243242.1 protein_id gnl|my_center|LOCUS_54260 44680 45624 gene locus_tag LOCUS_54270 44680 45624 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 protein_id gnl|my_center|LOCUS_54270 45617 46369 gene locus_tag LOCUS_54280 45617 46369 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_54280 46366 47553 gene locus_tag LOCUS_54290 46366 47553 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_54290 47555 48325 gene locus_tag LOCUS_54300 47555 48325 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968532.1 protein_id gnl|my_center|LOCUS_54300 48336 49952 gene locus_tag LOCUS_54310 48336 49952 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218852620.1 protein_id gnl|my_center|LOCUS_54310 49949 50914 gene locus_tag LOCUS_54320 gene fabK 49949 50914 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925404.1 protein_id gnl|my_center|LOCUS_54320 50952 51800 gene locus_tag LOCUS_54330 50952 51800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 52535 51834 gene locus_tag LOCUS_54340 52535 51834 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086747.1 protein_id gnl|my_center|LOCUS_54340 53653 52532 gene locus_tag LOCUS_54350 53653 52532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 53875 53948 gene locus_tag LOCUS_t00370 53875 53948 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 54642 54208 gene locus_tag LOCUS_54360 54642 54208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 55027 55332 gene locus_tag LOCUS_54370 55027 55332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 55390 56022 gene locus_tag LOCUS_54380 55390 56022 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532483.1 protein_id gnl|my_center|LOCUS_54380 56618 57235 gene locus_tag LOCUS_54390 56618 57235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 57342 58808 gene locus_tag LOCUS_54400 57342 58808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209573.1 protein_id gnl|my_center|LOCUS_54400 58981 60015 gene locus_tag LOCUS_54410 58981 60015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54410 61018 60248 gene locus_tag LOCUS_54420 61018 60248 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_54420 61779 61015 gene locus_tag LOCUS_54430 61779 61015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54430 62616 61789 gene locus_tag LOCUS_54440 62616 61789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_54440 63308 62613 gene locus_tag LOCUS_54450 63308 62613 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966758.1 protein_id gnl|my_center|LOCUS_54450 64248 63319 gene locus_tag LOCUS_54460 64248 63319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 64347 65336 gene locus_tag LOCUS_54470 64347 65336 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_54470 65458 66231 gene locus_tag LOCUS_54480 65458 66231 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_54480 67928 66918 gene locus_tag LOCUS_54490 67928 66918 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532084.1 protein_id gnl|my_center|LOCUS_54490 68291 69562 gene locus_tag LOCUS_54500 68291 69562 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240833.1 protein_id gnl|my_center|LOCUS_54500 70559 69576 gene locus_tag LOCUS_54510 70559 69576 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811668.1 protein_id gnl|my_center|LOCUS_54510 70733 71515 gene locus_tag LOCUS_54520 70733 71515 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504113.1 protein_id gnl|my_center|LOCUS_54520 71598 72170 gene locus_tag LOCUS_54530 71598 72170 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_54530 72130 72342 gene locus_tag LOCUS_54540 72130 72342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 73817 72324 gene locus_tag LOCUS_54550 73817 72324 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266839.1 protein_id gnl|my_center|LOCUS_54550 74768 74109 gene locus_tag LOCUS_54560 gene plsY 74768 74109 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531489.1 protein_id gnl|my_center|LOCUS_54560 76538 74961 gene locus_tag LOCUS_54570 76538 74961 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_54570 77742 76552 gene locus_tag LOCUS_54580 77742 76552 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_54580 78923 77769 gene locus_tag LOCUS_54590 78923 77769 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090004.1 protein_id gnl|my_center|LOCUS_54590 79322 80059 gene locus_tag LOCUS_54600 79322 80059 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 protein_id gnl|my_center|LOCUS_54600 80116 80868 gene locus_tag LOCUS_54610 80116 80868 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194452.1 protein_id gnl|my_center|LOCUS_54610 81264 80875 gene locus_tag LOCUS_54620 81264 80875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 81700 81473 gene locus_tag LOCUS_54630 81700 81473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 82103 81861 gene locus_tag LOCUS_54640 82103 81861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 82030 83385 gene locus_tag LOCUS_54650 82030 83385 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983978.1 protein_id gnl|my_center|LOCUS_54650 84514 83405 gene locus_tag LOCUS_54660 84514 83405 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_54660 86367 84727 gene locus_tag LOCUS_54670 86367 84727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 87112 86450 gene locus_tag LOCUS_54680 87112 86450 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528120.1 protein_id gnl|my_center|LOCUS_54680 87499 88587 gene locus_tag LOCUS_54690 87499 88587 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391749.1 protein_id gnl|my_center|LOCUS_54690 88735 89868 gene locus_tag LOCUS_54700 gene glf 88735 89868 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 protein_id gnl|my_center|LOCUS_54700 89937 91016 gene locus_tag LOCUS_54710 89937 91016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 91013 91972 gene locus_tag LOCUS_54720 91013 91972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890729.1 protein_id gnl|my_center|LOCUS_54720 92000 93421 gene locus_tag LOCUS_54730 92000 93421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391691.1 protein_id gnl|my_center|LOCUS_54730 94553 93435 gene locus_tag LOCUS_54740 94553 93435 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140478.1 protein_id gnl|my_center|LOCUS_54740 95424 94558 gene locus_tag LOCUS_54750 95424 94558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 96388 95492 gene locus_tag LOCUS_54760 96388 95492 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243172.1 protein_id gnl|my_center|LOCUS_54760 96991 98289 gene locus_tag LOCUS_54770 96991 98289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 98484 99152 gene locus_tag LOCUS_54780 gene rfbC 98484 99152 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063476367.1 protein_id gnl|my_center|LOCUS_54780 99167 100219 gene locus_tag LOCUS_54790 gene rfbB 99167 100219 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983494.1 protein_id gnl|my_center|LOCUS_54790 100232 101152 gene locus_tag LOCUS_54800 gene rfbD 100232 101152 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532724.1 protein_id gnl|my_center|LOCUS_54800 101149 102015 gene locus_tag LOCUS_54810 gene rfbA 101149 102015 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 protein_id gnl|my_center|LOCUS_54810 102964 102119 gene locus_tag LOCUS_54820 102964 102119 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437080.1 protein_id gnl|my_center|LOCUS_54820 104399 103080 gene locus_tag LOCUS_54830 104399 103080 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085477.1 protein_id gnl|my_center|LOCUS_54830 105026 104430 gene locus_tag LOCUS_54840 105026 104430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 107011 105587 gene locus_tag LOCUS_54850 107011 105587 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_54850 108458 107025 gene locus_tag LOCUS_54860 108458 107025 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966044.1 protein_id gnl|my_center|LOCUS_54860 108740 110314 gene locus_tag LOCUS_54870 108740 110314 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087817.1 protein_id gnl|my_center|LOCUS_54870 110857 110639 gene locus_tag LOCUS_54880 110857 110639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 111024 111428 gene locus_tag LOCUS_54890 111024 111428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 111589 111425 gene locus_tag LOCUS_54900 111589 111425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 111885 111640 gene locus_tag LOCUS_54910 111885 111640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 112010 112270 gene locus_tag LOCUS_54920 112010 112270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 112270 112473 gene locus_tag LOCUS_54930 112270 112473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 112496 113524 gene locus_tag LOCUS_54940 112496 113524 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391037.1 protein_id gnl|my_center|LOCUS_54940 114303 113521 gene locus_tag LOCUS_54950 gene otsB 114303 113521 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038195.1 protein_id gnl|my_center|LOCUS_54950 114565 114717 gene locus_tag LOCUS_54960 114565 114717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 114818 116887 gene locus_tag LOCUS_54970 114818 116887 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398395.1 protein_id gnl|my_center|LOCUS_54970 117001 117282 gene locus_tag LOCUS_54980 117001 117282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 118385 117480 gene locus_tag LOCUS_54990 118385 117480 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_54990 118911 118519 gene locus_tag LOCUS_55000 118911 118519 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067089.1 protein_id gnl|my_center|LOCUS_55000 119791 119027 gene locus_tag LOCUS_55010 119791 119027 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329317.1 protein_id gnl|my_center|LOCUS_55010 119676 119882 gene locus_tag LOCUS_55020 119676 119882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 119959 121788 gene locus_tag LOCUS_55030 119959 121788 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083348.1 protein_id gnl|my_center|LOCUS_55030 122184 122435 gene locus_tag LOCUS_55040 122184 122435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 124091 122442 gene locus_tag LOCUS_55050 124091 122442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 124667 124107 gene locus_tag LOCUS_55060 124667 124107 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090521.1 protein_id gnl|my_center|LOCUS_55060 124878 124657 gene locus_tag LOCUS_55070 124878 124657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 125084 125869 gene locus_tag LOCUS_55080 125084 125869 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529283.1 protein_id gnl|my_center|LOCUS_55080 126238 126071 gene locus_tag LOCUS_55090 126238 126071 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089300.1 protein_id gnl|my_center|LOCUS_55090 126886 127197 gene locus_tag LOCUS_55100 126886 127197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 128560 127208 gene locus_tag LOCUS_55110 128560 127208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 129086 128688 gene locus_tag LOCUS_55120 129086 128688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 129420 129088 gene locus_tag LOCUS_55130 129420 129088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 130660 129533 gene locus_tag LOCUS_55140 130660 129533 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084283.1 protein_id gnl|my_center|LOCUS_55140 130999 131457 gene locus_tag LOCUS_55150 130999 131457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 131751 131497 gene locus_tag LOCUS_55160 131751 131497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 131895 132203 gene locus_tag LOCUS_55170 131895 132203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 132913 134457 gene locus_tag LOCUS_55180 132913 134457 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_55180 134478 135665 gene locus_tag LOCUS_55190 134478 135665 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039013.1 protein_id gnl|my_center|LOCUS_55190 135861 136658 gene locus_tag LOCUS_55200 135861 136658 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085220.1 protein_id gnl|my_center|LOCUS_55200 136763 138304 gene locus_tag LOCUS_55210 gene glpD 136763 138304 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085223.1 protein_id gnl|my_center|LOCUS_55210 138301 139389 gene locus_tag LOCUS_55220 138301 139389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085224.1 protein_id gnl|my_center|LOCUS_55220 139386 140474 gene locus_tag LOCUS_55230 139386 140474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085225.1 protein_id gnl|my_center|LOCUS_55230 140477 141370 gene locus_tag LOCUS_55240 140477 141370 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085226.1 protein_id gnl|my_center|LOCUS_55240 141367 142158 gene locus_tag LOCUS_55250 141367 142158 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337643.1 protein_id gnl|my_center|LOCUS_55250 142158 142457 gene locus_tag LOCUS_55260 142158 142457 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719814.1 protein_id gnl|my_center|LOCUS_55260 142515 144269 gene locus_tag LOCUS_55270 142515 144269 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_55270 144732 145985 gene locus_tag LOCUS_55280 144732 145985 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_55280 146036 146317 gene locus_tag LOCUS_55290 146036 146317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55290 146681 146965 gene locus_tag LOCUS_55300 146681 146965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 147605 147033 gene locus_tag LOCUS_55310 147605 147033 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968511.1 protein_id gnl|my_center|LOCUS_55310 147704 149002 gene locus_tag LOCUS_55320 147704 149002 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 protein_id gnl|my_center|LOCUS_55320 >Feature sequence21 44 454 gene locus_tag LOCUS_55330 44 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 1356 451 gene locus_tag LOCUS_55340 1356 451 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368401.1 protein_id gnl|my_center|LOCUS_55340 1587 2822 gene locus_tag LOCUS_55350 1587 2822 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528501.1 protein_id gnl|my_center|LOCUS_55350 2815 4356 gene locus_tag LOCUS_55360 2815 4356 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_55360 6283 4403 gene locus_tag LOCUS_55370 6283 4403 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207907.1 protein_id gnl|my_center|LOCUS_55370 6558 8858 gene locus_tag LOCUS_55380 6558 8858 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967383.1 protein_id gnl|my_center|LOCUS_55380 8855 10177 gene locus_tag LOCUS_55390 8855 10177 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085214.1 protein_id gnl|my_center|LOCUS_55390 10177 12291 gene locus_tag LOCUS_55400 10177 12291 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967384.1 protein_id gnl|my_center|LOCUS_55400 12288 14156 gene locus_tag LOCUS_55410 12288 14156 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_55410 14835 14398 gene locus_tag LOCUS_55420 14835 14398 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 protein_id gnl|my_center|LOCUS_55420 16140 14995 gene locus_tag LOCUS_55430 16140 14995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 protein_id gnl|my_center|LOCUS_55430 16940 16137 gene locus_tag LOCUS_55440 16940 16137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530467.1 protein_id gnl|my_center|LOCUS_55440 17740 16937 gene locus_tag LOCUS_55450 17740 16937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527055.1 protein_id gnl|my_center|LOCUS_55450 18943 17867 gene locus_tag LOCUS_55460 18943 17867 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970935.1 protein_id gnl|my_center|LOCUS_55460 20310 19018 gene locus_tag LOCUS_55470 20310 19018 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731420.1 protein_id gnl|my_center|LOCUS_55470 20527 22383 gene locus_tag LOCUS_55480 20527 22383 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525188.1 protein_id gnl|my_center|LOCUS_55480 22465 22974 gene locus_tag LOCUS_55490 22465 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 23772 22999 gene locus_tag LOCUS_55500 23772 22999 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528131.1 protein_id gnl|my_center|LOCUS_55500 24311 25273 gene locus_tag LOCUS_55510 24311 25273 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973624.1 protein_id gnl|my_center|LOCUS_55510 25387 26688 gene locus_tag LOCUS_55520 25387 26688 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 protein_id gnl|my_center|LOCUS_55520 26752 27603 gene locus_tag LOCUS_55530 26752 27603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_55530 27697 29394 gene locus_tag LOCUS_55540 27697 29394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_55540 29578 29928 gene locus_tag LOCUS_55550 29578 29928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086330.1 protein_id gnl|my_center|LOCUS_55550 29925 32171 gene locus_tag LOCUS_55560 29925 32171 CDS product N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086331.1 protein_id gnl|my_center|LOCUS_55560 32208 33149 gene locus_tag LOCUS_55570 32208 33149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_55570 33206 34063 gene locus_tag LOCUS_55580 33206 34063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 protein_id gnl|my_center|LOCUS_55580 34063 35058 gene locus_tag LOCUS_55590 34063 35058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_55590 35055 36020 gene locus_tag LOCUS_55600 35055 36020 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086129.1 protein_id gnl|my_center|LOCUS_55600 36076 36744 gene locus_tag LOCUS_55610 gene eda 36076 36744 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958121.1 protein_id gnl|my_center|LOCUS_55610 37932 36763 gene locus_tag LOCUS_55620 37932 36763 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083825.1 protein_id gnl|my_center|LOCUS_55620 38273 39031 gene locus_tag LOCUS_55630 38273 39031 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086172.1 protein_id gnl|my_center|LOCUS_55630 39162 39818 gene locus_tag LOCUS_55640 39162 39818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 39927 40538 gene locus_tag LOCUS_55650 39927 40538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 40686 41333 gene locus_tag LOCUS_55660 40686 41333 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919535.1 protein_id gnl|my_center|LOCUS_55660 42154 41375 gene locus_tag LOCUS_55670 42154 41375 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_55670 42946 42338 gene locus_tag LOCUS_55680 42946 42338 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210333952.1 protein_id gnl|my_center|LOCUS_55680 43035 43787 gene locus_tag LOCUS_55690 43035 43787 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194452.1 protein_id gnl|my_center|LOCUS_55690 43842 44885 gene locus_tag LOCUS_55700 43842 44885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 protein_id gnl|my_center|LOCUS_55700 44941 46020 gene locus_tag LOCUS_55710 44941 46020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970338.1 protein_id gnl|my_center|LOCUS_55710 46017 47780 gene locus_tag LOCUS_55720 46017 47780 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 protein_id gnl|my_center|LOCUS_55720 48249 47785 gene locus_tag LOCUS_55730 48249 47785 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172194.1 protein_id gnl|my_center|LOCUS_55730 48384 49499 gene locus_tag LOCUS_55740 gene ald 48384 49499 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084547.1 protein_id gnl|my_center|LOCUS_55740 52111 49559 gene locus_tag LOCUS_55750 52111 49559 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 protein_id gnl|my_center|LOCUS_55750 52277 52486 gene locus_tag LOCUS_55760 52277 52486 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206222.1 protein_id gnl|my_center|LOCUS_55760 53121 52687 gene locus_tag LOCUS_55770 gene cueR 53121 52687 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811033.1 protein_id gnl|my_center|LOCUS_55770 54632 53346 gene locus_tag LOCUS_55780 54632 53346 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 protein_id gnl|my_center|LOCUS_55780 56289 54691 gene locus_tag LOCUS_55790 56289 54691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974950.1 protein_id gnl|my_center|LOCUS_55790 57966 56386 gene locus_tag LOCUS_55800 57966 56386 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089935.1 protein_id gnl|my_center|LOCUS_55800 58135 58407 gene locus_tag LOCUS_55810 58135 58407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 59291 58515 gene locus_tag LOCUS_55820 59291 58515 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 protein_id gnl|my_center|LOCUS_55820 60421 59288 gene locus_tag LOCUS_55830 60421 59288 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214492.1 protein_id gnl|my_center|LOCUS_55830 61455 60790 gene locus_tag LOCUS_55840 61455 60790 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940263.1 protein_id gnl|my_center|LOCUS_55840 61554 62999 gene locus_tag LOCUS_55850 61554 62999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205544.1 protein_id gnl|my_center|LOCUS_55850 63943 63023 gene locus_tag LOCUS_55860 63943 63023 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339276.1 protein_id gnl|my_center|LOCUS_55860 65040 64075 gene locus_tag LOCUS_55870 65040 64075 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808786.1 protein_id gnl|my_center|LOCUS_55870 66768 65101 gene locus_tag LOCUS_55880 gene ggt 66768 65101 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_55880 67563 66898 gene locus_tag LOCUS_55890 67563 66898 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368435.1 protein_id gnl|my_center|LOCUS_55890 68396 67572 gene locus_tag LOCUS_55900 68396 67572 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 protein_id gnl|my_center|LOCUS_55900 69175 68441 gene locus_tag LOCUS_55910 69175 68441 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894753.1 protein_id gnl|my_center|LOCUS_55910 70074 69283 gene locus_tag LOCUS_55920 70074 69283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724163.1 protein_id gnl|my_center|LOCUS_55920 70999 70106 gene locus_tag LOCUS_55930 70999 70106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339272.1 protein_id gnl|my_center|LOCUS_55930 72136 71003 gene locus_tag LOCUS_55940 72136 71003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339273.1 protein_id gnl|my_center|LOCUS_55940 73215 72202 gene locus_tag LOCUS_55950 73215 72202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339274.1 protein_id gnl|my_center|LOCUS_55950 74988 73588 gene locus_tag LOCUS_55960 74988 73588 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_55960 75219 76097 gene locus_tag LOCUS_55970 75219 76097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 76233 77135 gene locus_tag LOCUS_55980 76233 77135 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804426.1 protein_id gnl|my_center|LOCUS_55980 77300 77893 gene locus_tag LOCUS_55990 77300 77893 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532299.1 protein_id gnl|my_center|LOCUS_55990 78802 77909 gene locus_tag LOCUS_56000 78802 77909 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_56000 79372 79034 gene locus_tag LOCUS_56010 79372 79034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 79259 79828 gene locus_tag LOCUS_56020 79259 79828 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_56020 80021 80968 gene locus_tag LOCUS_56030 80021 80968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 81434 82786 gene locus_tag LOCUS_56040 gene rkpK 81434 82786 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327779.1 protein_id gnl|my_center|LOCUS_56040 82783 83898 gene locus_tag LOCUS_56050 82783 83898 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_56050 84717 84205 gene locus_tag LOCUS_56060 84717 84205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151649635.1 protein_id gnl|my_center|LOCUS_56060 86522 84717 gene locus_tag LOCUS_56070 86522 84717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965842.1 protein_id gnl|my_center|LOCUS_56070 86664 90692 gene locus_tag LOCUS_56080 86664 90692 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_56080 91672 90764 gene locus_tag LOCUS_56090 91672 90764 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065702830.1 protein_id gnl|my_center|LOCUS_56090 91715 92239 gene locus_tag LOCUS_56100 91715 92239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 92303 93163 gene locus_tag LOCUS_56110 92303 93163 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967356.1 protein_id gnl|my_center|LOCUS_56110 94107 93160 gene locus_tag LOCUS_56120 94107 93160 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529929.1 protein_id gnl|my_center|LOCUS_56120 94416 94117 gene locus_tag LOCUS_56130 94416 94117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 94316 95803 gene locus_tag LOCUS_56140 94316 95803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 protein_id gnl|my_center|LOCUS_56140 97092 96208 gene locus_tag LOCUS_56150 97092 96208 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_56150 97422 98153 gene locus_tag LOCUS_56160 97422 98153 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_56160 102131 98424 gene locus_tag LOCUS_56170 102131 98424 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_56170 106317 103189 gene locus_tag LOCUS_56180 106317 103189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 107412 106810 gene locus_tag LOCUS_56190 107412 106810 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311709.1 protein_id gnl|my_center|LOCUS_56190 107884 109287 gene locus_tag LOCUS_56200 107884 109287 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_56200 109579 112035 gene locus_tag LOCUS_56210 109579 112035 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087080.1 protein_id gnl|my_center|LOCUS_56210 112265 112651 gene locus_tag LOCUS_56220 112265 112651 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088081.1 protein_id gnl|my_center|LOCUS_56220 113993 112683 gene locus_tag LOCUS_56230 113993 112683 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972735.1 protein_id gnl|my_center|LOCUS_56230 113992 114213 gene locus_tag LOCUS_56240 113992 114213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 114311 115252 gene locus_tag LOCUS_56250 gene rocF 114311 115252 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088863.1 protein_id gnl|my_center|LOCUS_56250 115735 115265 gene locus_tag LOCUS_56260 115735 115265 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_56260 116702 115740 gene locus_tag LOCUS_56270 116702 115740 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090796.1 protein_id gnl|my_center|LOCUS_56270 116984 118081 gene locus_tag LOCUS_56280 116984 118081 CDS product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965728.1 protein_id gnl|my_center|LOCUS_56280 118365 119363 gene locus_tag LOCUS_56290 118365 119363 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_56290 119381 120811 gene locus_tag LOCUS_56300 119381 120811 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968790.1 protein_id gnl|my_center|LOCUS_56300 120888 122099 gene locus_tag LOCUS_56310 gene rocD 120888 122099 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398015.1 protein_id gnl|my_center|LOCUS_56310 123187 122111 gene locus_tag LOCUS_56320 123187 122111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 123818 123441 gene locus_tag LOCUS_56330 123818 123441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 124813 123821 gene locus_tag LOCUS_56340 124813 123821 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087563.1 protein_id gnl|my_center|LOCUS_56340 127544 124902 gene locus_tag LOCUS_56350 127544 124902 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399555.1 protein_id gnl|my_center|LOCUS_56350 128170 129138 gene locus_tag LOCUS_56360 gene prfB 128170 129138 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097531964.1 protein_id gnl|my_center|LOCUS_56360 130660 129197 gene locus_tag LOCUS_56370 130660 129197 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640209.1 protein_id gnl|my_center|LOCUS_56370 130716 131603 gene locus_tag LOCUS_56380 130716 131603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 131808 132575 gene locus_tag LOCUS_56390 131808 132575 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088049.1 protein_id gnl|my_center|LOCUS_56390 134012 132657 gene locus_tag LOCUS_56400 134012 132657 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_56400 >Feature sequence22 <1 935 gene locus_tag LOCUS_56410 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011199152.1:OmpA family protein 1060 1926 gene locus_tag LOCUS_56420 1060 1926 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920157.1 protein_id gnl|my_center|LOCUS_56420 2343 1939 gene locus_tag LOCUS_56430 2343 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 2840 2433 gene locus_tag LOCUS_56440 2840 2433 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268644.1 protein_id gnl|my_center|LOCUS_56440 3061 4449 gene locus_tag LOCUS_56450 3061 4449 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_56450 4446 5231 gene locus_tag LOCUS_56460 4446 5231 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_56460 5241 6599 gene locus_tag LOCUS_56470 5241 6599 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_56470 7375 6584 gene locus_tag LOCUS_56480 7375 6584 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_56480 7715 9052 gene locus_tag LOCUS_56490 7715 9052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201828.1 protein_id gnl|my_center|LOCUS_56490 9133 9624 gene locus_tag LOCUS_56500 gene tadA 9133 9624 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_56500 9698 11209 gene locus_tag LOCUS_56510 9698 11209 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_56510 11351 12097 gene locus_tag LOCUS_56520 11351 12097 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 protein_id gnl|my_center|LOCUS_56520 12111 12875 gene locus_tag LOCUS_56530 12111 12875 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966024.1 protein_id gnl|my_center|LOCUS_56530 13058 13447 gene locus_tag LOCUS_56540 13058 13447 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966125.1 protein_id gnl|my_center|LOCUS_56540 13941 13573 gene locus_tag LOCUS_56550 13941 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 14991 14089 gene locus_tag LOCUS_56560 14991 14089 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 protein_id gnl|my_center|LOCUS_56560 15329 14997 gene locus_tag LOCUS_56570 15329 14997 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_56570 16112 15336 gene locus_tag LOCUS_56580 16112 15336 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727456.1 protein_id gnl|my_center|LOCUS_56580 17302 16112 gene locus_tag LOCUS_56590 17302 16112 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727455.1 protein_id gnl|my_center|LOCUS_56590 18678 17299 gene locus_tag LOCUS_56600 18678 17299 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_56600 19526 18696 gene locus_tag LOCUS_56610 19526 18696 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086099.1 protein_id gnl|my_center|LOCUS_56610 20302 19523 gene locus_tag LOCUS_56620 20302 19523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226902.1 protein_id gnl|my_center|LOCUS_56620 21408 20395 gene locus_tag LOCUS_56630 21408 20395 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081482.1 protein_id gnl|my_center|LOCUS_56630 21597 22859 gene locus_tag LOCUS_56640 21597 22859 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_56640 23367 23215 gene locus_tag LOCUS_56650 23367 23215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 23326 24198 gene locus_tag LOCUS_56660 23326 24198 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113309.1 protein_id gnl|my_center|LOCUS_56660 24349 25344 gene locus_tag LOCUS_56670 24349 25344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 25492 26229 gene locus_tag LOCUS_56680 25492 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 26256 26702 gene locus_tag LOCUS_56690 26256 26702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 27480 26908 gene locus_tag LOCUS_56700 27480 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545718.1 protein_id gnl|my_center|LOCUS_56700 27637 28386 gene locus_tag LOCUS_56710 27637 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 28383 28592 gene locus_tag LOCUS_56720 28383 28592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 28708 29283 gene locus_tag LOCUS_56730 28708 29283 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992389.1 protein_id gnl|my_center|LOCUS_56730 29416 29796 gene locus_tag LOCUS_56740 29416 29796 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_56740 29833 30225 gene locus_tag LOCUS_56750 gene crcB 29833 30225 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085425.1 protein_id gnl|my_center|LOCUS_56750 30248 30643 gene locus_tag LOCUS_56760 30248 30643 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085424.1 protein_id gnl|my_center|LOCUS_56760 31188 30751 gene locus_tag LOCUS_56770 31188 30751 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383816.1 protein_id gnl|my_center|LOCUS_56770 31917 32228 gene locus_tag LOCUS_56780 31917 32228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528019.1 protein_id gnl|my_center|LOCUS_56780 32489 32776 gene locus_tag LOCUS_56790 32489 32776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 32867 33274 gene locus_tag LOCUS_56800 32867 33274 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171697.1 protein_id gnl|my_center|LOCUS_56800 33271 34698 gene locus_tag LOCUS_56810 33271 34698 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_56810 34695 37811 gene locus_tag LOCUS_56820 34695 37811 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_56820 38617 38042 gene locus_tag LOCUS_56830 38617 38042 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_56830 39053 38607 gene locus_tag LOCUS_56840 39053 38607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 42039 39163 gene locus_tag LOCUS_56850 42039 39163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 42423 42347 gene locus_tag LOCUS_t00380 42423 42347 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 43796 42408 gene locus_tag LOCUS_56860 43796 42408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 44563 43793 gene locus_tag LOCUS_56870 44563 43793 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_56870 45279 44725 gene locus_tag LOCUS_56880 45279 44725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 45620 45327 gene locus_tag LOCUS_56890 45620 45327 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175166.1 protein_id gnl|my_center|LOCUS_56890 46105 45647 gene locus_tag LOCUS_56900 46105 45647 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968682.1 protein_id gnl|my_center|LOCUS_56900 47423 46131 gene locus_tag LOCUS_56910 47423 46131 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973486.1 protein_id gnl|my_center|LOCUS_56910 49101 47554 gene locus_tag LOCUS_56920 49101 47554 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084999.1 protein_id gnl|my_center|LOCUS_56920 49400 49116 gene locus_tag LOCUS_56930 49400 49116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 50916 49492 gene locus_tag LOCUS_56940 gene puuE 50916 49492 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975644.1 protein_id gnl|my_center|LOCUS_56940 51323 50967 gene locus_tag LOCUS_56950 gene uraH 51323 50967 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 protein_id gnl|my_center|LOCUS_56950 51511 52914 gene locus_tag LOCUS_56960 51511 52914 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088903.1 protein_id gnl|my_center|LOCUS_56960 53916 52984 gene locus_tag LOCUS_56970 53916 52984 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975651.1 protein_id gnl|my_center|LOCUS_56970 54027 55244 gene locus_tag LOCUS_56980 54027 55244 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339433.1 protein_id gnl|my_center|LOCUS_56980 55343 56557 gene locus_tag LOCUS_56990 55343 56557 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920457.1 protein_id gnl|my_center|LOCUS_56990 56569 57798 gene locus_tag LOCUS_57000 56569 57798 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_57000 57992 58354 gene locus_tag LOCUS_57010 57992 58354 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 protein_id gnl|my_center|LOCUS_57010 58351 58878 gene locus_tag LOCUS_57020 58351 58878 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398896.1 protein_id gnl|my_center|LOCUS_57020 58882 59946 gene locus_tag LOCUS_57030 gene arsB 58882 59946 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 protein_id gnl|my_center|LOCUS_57030 59943 60344 gene locus_tag LOCUS_57040 gene arsC 59943 60344 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 protein_id gnl|my_center|LOCUS_57040 60423 60746 gene locus_tag LOCUS_57050 60423 60746 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172264.1 protein_id gnl|my_center|LOCUS_57050 60789 62177 gene locus_tag LOCUS_57060 60789 62177 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085876.1 protein_id gnl|my_center|LOCUS_57060 62181 63353 gene locus_tag LOCUS_57070 62181 63353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087808.1 protein_id gnl|my_center|LOCUS_57070 63976 63449 gene locus_tag LOCUS_57080 63976 63449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 67862 64443 gene locus_tag LOCUS_57090 67862 64443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 69050 68754 gene locus_tag LOCUS_57100 69050 68754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 70151 69060 gene locus_tag LOCUS_57110 70151 69060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530042.1 protein_id gnl|my_center|LOCUS_57110 70582 70160 gene locus_tag LOCUS_57120 70582 70160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 72102 70606 gene locus_tag LOCUS_57130 72102 70606 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530038.1 protein_id gnl|my_center|LOCUS_57130 73338 72541 gene locus_tag LOCUS_57140 73338 72541 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969397.1 protein_id gnl|my_center|LOCUS_57140 75224 73347 gene locus_tag LOCUS_57150 75224 73347 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087283.1 protein_id gnl|my_center|LOCUS_57150 76243 75230 gene locus_tag LOCUS_57160 76243 75230 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087282.1 protein_id gnl|my_center|LOCUS_57160 76493 77371 gene locus_tag LOCUS_57170 76493 77371 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974197.1 protein_id gnl|my_center|LOCUS_57170 77377 78546 gene locus_tag LOCUS_57180 77377 78546 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974196.1 protein_id gnl|my_center|LOCUS_57180 78543 80195 gene locus_tag LOCUS_57190 78543 80195 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967267.1 protein_id gnl|my_center|LOCUS_57190 80192 81064 gene locus_tag LOCUS_57200 80192 81064 CDS product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087478.1 protein_id gnl|my_center|LOCUS_57200 81376 82155 gene locus_tag LOCUS_57210 81376 82155 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529496.1 protein_id gnl|my_center|LOCUS_57210 82493 83005 gene locus_tag LOCUS_57220 82493 83005 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406469.1 protein_id gnl|my_center|LOCUS_57220 84619 83072 gene locus_tag LOCUS_57230 84619 83072 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083814.1 protein_id gnl|my_center|LOCUS_57230 85948 84722 gene locus_tag LOCUS_57240 85948 84722 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090553.1 protein_id gnl|my_center|LOCUS_57240 87108 86068 gene locus_tag LOCUS_57250 87108 86068 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090550.1 protein_id gnl|my_center|LOCUS_57250 88018 87113 gene locus_tag LOCUS_57260 88018 87113 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090549.1 protein_id gnl|my_center|LOCUS_57260 88856 88113 gene locus_tag LOCUS_57270 88856 88113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_57270 89670 88858 gene locus_tag LOCUS_57280 89670 88858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_57280 89920 90942 gene locus_tag LOCUS_57290 89920 90942 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087121.1 protein_id gnl|my_center|LOCUS_57290 91013 92266 gene locus_tag LOCUS_57300 91013 92266 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528114.1 protein_id gnl|my_center|LOCUS_57300 92757 92299 gene locus_tag LOCUS_57310 92757 92299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 93758 92754 gene locus_tag LOCUS_57320 93758 92754 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080843023.1 protein_id gnl|my_center|LOCUS_57320 94419 93775 gene locus_tag LOCUS_57330 94419 93775 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528009.1 protein_id gnl|my_center|LOCUS_57330 95136 94582 gene locus_tag LOCUS_57340 gene ogt 95136 94582 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211023.1 protein_id gnl|my_center|LOCUS_57340 95451 95747 gene locus_tag LOCUS_57350 95451 95747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 95999 97009 gene locus_tag LOCUS_57360 gene otsB 95999 97009 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338618.1 protein_id gnl|my_center|LOCUS_57360 97006 98790 gene locus_tag LOCUS_57370 97006 98790 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_57370 98979 101222 gene locus_tag LOCUS_57380 98979 101222 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 protein_id gnl|my_center|LOCUS_57380 102317 101265 gene locus_tag LOCUS_57390 102317 101265 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067571.1 protein_id gnl|my_center|LOCUS_57390 102503 103918 gene locus_tag LOCUS_57400 102503 103918 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175325.1 protein_id gnl|my_center|LOCUS_57400 105143 103920 gene locus_tag LOCUS_57410 105143 103920 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965436.1 protein_id gnl|my_center|LOCUS_57410 106547 105327 gene locus_tag LOCUS_57420 106547 105327 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965436.1 protein_id gnl|my_center|LOCUS_57420 106722 107993 gene locus_tag LOCUS_57430 106722 107993 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_57430 109256 107997 gene locus_tag LOCUS_57440 109256 107997 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967768.1 protein_id gnl|my_center|LOCUS_57440 110393 109392 gene locus_tag LOCUS_57450 gene pdxA 110393 109392 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339282.1 protein_id gnl|my_center|LOCUS_57450 111142 110390 gene locus_tag LOCUS_57460 111142 110390 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 protein_id gnl|my_center|LOCUS_57460 111497 112624 gene locus_tag LOCUS_57470 111497 112624 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393103.1 protein_id gnl|my_center|LOCUS_57470 112621 113376 gene locus_tag LOCUS_57480 112621 113376 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577311.1 protein_id gnl|my_center|LOCUS_57480 113435 114850 gene locus_tag LOCUS_57490 113435 114850 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086664.1 protein_id gnl|my_center|LOCUS_57490 114904 115884 gene locus_tag LOCUS_57500 114904 115884 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966280.1 protein_id gnl|my_center|LOCUS_57500 117295 115988 gene locus_tag LOCUS_57510 117295 115988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470612.1 protein_id gnl|my_center|LOCUS_57510 117747 117292 gene locus_tag LOCUS_57520 117747 117292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 117961 120603 gene locus_tag LOCUS_57530 117961 120603 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387934.1 protein_id gnl|my_center|LOCUS_57530 120809 121996 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtgccccgcctgcgcggggatgaaccg 122155 122430 gene locus_tag LOCUS_57540 122155 122430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 122448 122747 gene locus_tag LOCUS_57550 122448 122747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 123581 125221 gene locus_tag LOCUS_57560 gene casA 123581 125221 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387933.1 protein_id gnl|my_center|LOCUS_57560 125221 125817 gene locus_tag LOCUS_57570 125221 125817 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387932.1 protein_id gnl|my_center|LOCUS_57570 125814 126881 gene locus_tag LOCUS_57580 gene cas7e 125814 126881 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387931.1 protein_id gnl|my_center|LOCUS_57580 126886 127674 gene locus_tag LOCUS_57590 gene cas5e 126886 127674 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387930.1 protein_id gnl|my_center|LOCUS_57590 127671 128360 gene locus_tag LOCUS_57600 gene cas6e 127671 128360 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387929.1 protein_id gnl|my_center|LOCUS_57600 >Feature sequence23 1735 29 gene locus_tag LOCUS_57610 1735 29 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087216.1 protein_id gnl|my_center|LOCUS_57610 2766 1846 gene locus_tag LOCUS_57620 2766 1846 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973825.1 protein_id gnl|my_center|LOCUS_57620 2878 4032 gene locus_tag LOCUS_57630 gene phnW 2878 4032 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112368.1 protein_id gnl|my_center|LOCUS_57630 4043 5293 gene locus_tag LOCUS_57640 gene phnA 4043 5293 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061791.1 protein_id gnl|my_center|LOCUS_57640 5303 6784 gene locus_tag LOCUS_57650 gene phnY 5303 6784 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975823.1 protein_id gnl|my_center|LOCUS_57650 6900 7916 gene locus_tag LOCUS_57660 6900 7916 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975825.1 protein_id gnl|my_center|LOCUS_57660 7993 9135 gene locus_tag LOCUS_57670 7993 9135 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527142.1 protein_id gnl|my_center|LOCUS_57670 9132 10844 gene locus_tag LOCUS_57680 9132 10844 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061795.1 protein_id gnl|my_center|LOCUS_57680 10844 12235 gene locus_tag LOCUS_57690 10844 12235 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163929.1 protein_id gnl|my_center|LOCUS_57690 13524 12556 gene locus_tag LOCUS_57700 13524 12556 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083278.1 protein_id gnl|my_center|LOCUS_57700 14055 13576 gene locus_tag LOCUS_57710 gene bfr 14055 13576 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089420.1 protein_id gnl|my_center|LOCUS_57710 14495 14250 gene locus_tag LOCUS_57720 14495 14250 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089421.1 protein_id gnl|my_center|LOCUS_57720 14790 16967 gene locus_tag LOCUS_57730 14790 16967 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083277.1 protein_id gnl|my_center|LOCUS_57730 18094 17228 gene locus_tag LOCUS_57740 18094 17228 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 protein_id gnl|my_center|LOCUS_57740 18225 19565 gene locus_tag LOCUS_57750 18225 19565 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_57750 19562 20173 gene locus_tag LOCUS_57760 19562 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 20658 20218 gene locus_tag LOCUS_57770 20658 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 21489 20725 gene locus_tag LOCUS_57780 21489 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 21779 21519 gene locus_tag LOCUS_57790 21779 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 22446 21982 gene locus_tag LOCUS_57800 22446 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 22897 22439 gene locus_tag LOCUS_57810 22897 22439 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085348.1 protein_id gnl|my_center|LOCUS_57810 23455 22943 gene locus_tag LOCUS_57820 23455 22943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085349.1 protein_id gnl|my_center|LOCUS_57820 23622 24383 gene locus_tag LOCUS_57830 23622 24383 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 protein_id gnl|my_center|LOCUS_57830 24841 25635 gene locus_tag LOCUS_57840 24841 25635 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_57840 25651 25998 gene locus_tag LOCUS_57850 25651 25998 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_57850 26291 27940 gene locus_tag LOCUS_57860 26291 27940 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_57860 28212 29237 gene locus_tag LOCUS_57870 28212 29237 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530400.1 protein_id gnl|my_center|LOCUS_57870 29247 30482 gene locus_tag LOCUS_57880 29247 30482 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530399.1 protein_id gnl|my_center|LOCUS_57880 30479 31531 gene locus_tag LOCUS_57890 30479 31531 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530398.1 protein_id gnl|my_center|LOCUS_57890 31561 32310 gene locus_tag LOCUS_57900 31561 32310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809261.1 protein_id gnl|my_center|LOCUS_57900 33090 32320 gene locus_tag LOCUS_57910 33090 32320 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040014.1 protein_id gnl|my_center|LOCUS_57910 33620 34807 gene locus_tag LOCUS_57920 33620 34807 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_57920 34815 35588 gene locus_tag LOCUS_57930 34815 35588 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_57930 35594 36814 gene locus_tag LOCUS_57940 35594 36814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 36814 37944 gene locus_tag LOCUS_57950 36814 37944 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812489.1 protein_id gnl|my_center|LOCUS_57950 37941 38348 gene locus_tag LOCUS_57960 37941 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 38389 39312 gene locus_tag LOCUS_57970 gene ilvE 38389 39312 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930783.1 protein_id gnl|my_center|LOCUS_57970 39315 40400 gene locus_tag LOCUS_57980 39315 40400 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272527.1 protein_id gnl|my_center|LOCUS_57980 40417 42516 gene locus_tag LOCUS_57990 40417 42516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57990 42513 44081 gene locus_tag LOCUS_58000 42513 44081 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_58000 44124 44951 gene locus_tag LOCUS_58010 44124 44951 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_58010 46589 45039 gene locus_tag LOCUS_58020 46589 45039 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085355.1 protein_id gnl|my_center|LOCUS_58020 46813 47382 gene locus_tag LOCUS_58030 46813 47382 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243388.1 protein_id gnl|my_center|LOCUS_58030 47379 48191 gene locus_tag LOCUS_58040 47379 48191 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173440.1 protein_id gnl|my_center|LOCUS_58040 48359 48967 gene locus_tag LOCUS_58050 48359 48967 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439348.1 protein_id gnl|my_center|LOCUS_58050 49109 50194 gene locus_tag LOCUS_58060 gene aroC 49109 50194 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_58060 50276 51601 gene locus_tag LOCUS_58070 gene ribB 50276 51601 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392622.1 protein_id gnl|my_center|LOCUS_58070 52024 51620 gene locus_tag LOCUS_58080 52024 51620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 53009 52107 gene locus_tag LOCUS_58090 53009 52107 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212063.1 protein_id gnl|my_center|LOCUS_58090 54309 53023 gene locus_tag LOCUS_58100 54309 53023 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083413.1 protein_id gnl|my_center|LOCUS_58100 55309 54446 gene locus_tag LOCUS_58110 55309 54446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 56482 55607 gene locus_tag LOCUS_58120 56482 55607 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_58120 57536 56793 gene locus_tag LOCUS_58130 57536 56793 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532807.1 protein_id gnl|my_center|LOCUS_58130 59395 57611 gene locus_tag LOCUS_58140 59395 57611 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974690.1 protein_id gnl|my_center|LOCUS_58140 59619 60584 gene locus_tag LOCUS_58150 59619 60584 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085356.1 protein_id gnl|my_center|LOCUS_58150 61504 60596 gene locus_tag LOCUS_58160 61504 60596 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109209.1 protein_id gnl|my_center|LOCUS_58160 61828 61520 gene locus_tag LOCUS_58170 61828 61520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 61728 62909 gene locus_tag LOCUS_58180 61728 62909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246425.1 protein_id gnl|my_center|LOCUS_58180 62906 63529 gene locus_tag LOCUS_58190 62906 63529 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112463.1 protein_id gnl|my_center|LOCUS_58190 64746 63526 gene locus_tag LOCUS_58200 64746 63526 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085434.1 protein_id gnl|my_center|LOCUS_58200 65540 64743 gene locus_tag LOCUS_58210 65540 64743 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919201.1 protein_id gnl|my_center|LOCUS_58210 67309 65537 gene locus_tag LOCUS_58220 gene dxs 67309 65537 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532789.1 protein_id gnl|my_center|LOCUS_58220 67235 67447 gene locus_tag LOCUS_58230 67235 67447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 68621 67704 gene locus_tag LOCUS_58240 68621 67704 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 protein_id gnl|my_center|LOCUS_58240 69488 68700 gene locus_tag LOCUS_58250 69488 68700 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_58250 70194 69577 gene locus_tag LOCUS_58260 70194 69577 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_58260 71065 70247 gene locus_tag LOCUS_58270 71065 70247 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085427.1 protein_id gnl|my_center|LOCUS_58270 71289 72218 gene locus_tag LOCUS_58280 71289 72218 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_58280 72361 72609 gene locus_tag LOCUS_58290 72361 72609 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008132970.1 protein_id gnl|my_center|LOCUS_58290 73172 72630 gene locus_tag LOCUS_58300 73172 72630 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090472.1 protein_id gnl|my_center|LOCUS_58300 73239 73595 gene locus_tag LOCUS_58310 73239 73595 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_58310 73819 75429 gene locus_tag LOCUS_58320 73819 75429 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 protein_id gnl|my_center|LOCUS_58320 75519 76496 gene locus_tag LOCUS_58330 75519 76496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965796.1 protein_id gnl|my_center|LOCUS_58330 76506 77477 gene locus_tag LOCUS_58340 76506 77477 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085659.1 protein_id gnl|my_center|LOCUS_58340 78392 77496 gene locus_tag LOCUS_58350 78392 77496 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241247.1 protein_id gnl|my_center|LOCUS_58350 78549 78911 gene locus_tag LOCUS_58360 78549 78911 CDS product Atu4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971204.1 protein_id gnl|my_center|LOCUS_58360 78973 79713 gene locus_tag LOCUS_58370 78973 79713 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 protein_id gnl|my_center|LOCUS_58370 79840 81276 gene locus_tag LOCUS_58380 gene miaB 79840 81276 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 protein_id gnl|my_center|LOCUS_58380 81302 82387 gene locus_tag LOCUS_58390 81302 82387 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083616.1 protein_id gnl|my_center|LOCUS_58390 82384 82893 gene locus_tag LOCUS_58400 gene ybeY 82384 82893 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965162.1 protein_id gnl|my_center|LOCUS_58400 83009 84142 gene locus_tag LOCUS_58410 83009 84142 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083614.1 protein_id gnl|my_center|LOCUS_58410 84240 85844 gene locus_tag LOCUS_58420 gene lnt 84240 85844 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_58420 86056 86475 gene locus_tag LOCUS_58430 86056 86475 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327078.1 protein_id gnl|my_center|LOCUS_58430 86763 87974 gene locus_tag LOCUS_58440 gene metK 86763 87974 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327079.1 protein_id gnl|my_center|LOCUS_58440 88066 88761 gene locus_tag LOCUS_58450 88066 88761 CDS product tRNA (guanine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083610.1 protein_id gnl|my_center|LOCUS_58450 88822 89799 gene locus_tag LOCUS_58460 88822 89799 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_58460 89796 90566 gene locus_tag LOCUS_58470 89796 90566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719559.1 protein_id gnl|my_center|LOCUS_58470 90667 91839 gene locus_tag LOCUS_58480 90667 91839 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_58480 92920 91889 gene locus_tag LOCUS_58490 92920 91889 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_58490 94284 93190 gene locus_tag LOCUS_58500 94284 93190 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_58500 94545 95771 gene locus_tag LOCUS_58510 94545 95771 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965254.1 protein_id gnl|my_center|LOCUS_58510 96095 95805 gene locus_tag LOCUS_58520 96095 95805 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_58520 96340 96092 gene locus_tag LOCUS_58530 96340 96092 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527850.1 protein_id gnl|my_center|LOCUS_58530 96465 97541 gene locus_tag LOCUS_58540 96465 97541 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083959.1 protein_id gnl|my_center|LOCUS_58540 98884 97538 gene locus_tag LOCUS_58550 98884 97538 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083960.1 protein_id gnl|my_center|LOCUS_58550 99891 99004 gene locus_tag LOCUS_58560 99891 99004 CDS product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083513.1 protein_id gnl|my_center|LOCUS_58560 100382 100002 gene locus_tag LOCUS_58570 100382 100002 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 protein_id gnl|my_center|LOCUS_58570 100565 102016 gene locus_tag LOCUS_58580 100565 102016 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531228.1 protein_id gnl|my_center|LOCUS_58580 102795 102331 gene locus_tag LOCUS_58590 102795 102331 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_58590 103374 102829 gene locus_tag LOCUS_58600 103374 102829 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_58600 103397 104155 gene locus_tag LOCUS_58610 gene nth 103397 104155 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_58610 104280 105425 gene locus_tag LOCUS_58620 104280 105425 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_58620 105477 106703 gene locus_tag LOCUS_58630 105477 106703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965994.1 protein_id gnl|my_center|LOCUS_58630 106912 107781 gene locus_tag LOCUS_58640 106912 107781 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_58640 107792 108811 gene locus_tag LOCUS_58650 107792 108811 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_58650 108808 109530 gene locus_tag LOCUS_58660 108808 109530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_58660 109530 110234 gene locus_tag LOCUS_58670 109530 110234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_58670 111601 110369 gene locus_tag LOCUS_58680 111601 110369 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502893.1 protein_id gnl|my_center|LOCUS_58680 112745 111741 gene locus_tag LOCUS_58690 112745 111741 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_58690 114438 112789 gene locus_tag LOCUS_58700 114438 112789 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808776.1 protein_id gnl|my_center|LOCUS_58700 115502 114435 gene locus_tag LOCUS_58710 115502 114435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808774.1 protein_id gnl|my_center|LOCUS_58710 116302 115499 gene locus_tag LOCUS_58720 gene hisN 116302 115499 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528764.1 protein_id gnl|my_center|LOCUS_58720 117398 116463 gene locus_tag LOCUS_58730 117398 116463 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_58730 118345 117404 gene locus_tag LOCUS_58740 118345 117404 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974065.1 protein_id gnl|my_center|LOCUS_58740 118524 119291 gene locus_tag LOCUS_58750 118524 119291 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921845.1 protein_id gnl|my_center|LOCUS_58750 121533 119557 gene locus_tag LOCUS_58760 121533 119557 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_58760 121451 121783 gene locus_tag LOCUS_58770 121451 121783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 123150 121741 gene locus_tag LOCUS_58780 gene thrC 123150 121741 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921382.1 protein_id gnl|my_center|LOCUS_58780 123308 124018 gene locus_tag LOCUS_58790 123308 124018 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527996.1 protein_id gnl|my_center|LOCUS_58790 124884 124039 gene locus_tag LOCUS_58800 124884 124039 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189208.1 protein_id gnl|my_center|LOCUS_58800 124993 125069 gene locus_tag LOCUS_t00390 124993 125069 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence24 3191 1635 gene locus_tag LOCUS_58810 3191 1635 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_58810 4236 3235 gene locus_tag LOCUS_58820 4236 3235 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083809.1 protein_id gnl|my_center|LOCUS_58820 5255 4233 gene locus_tag LOCUS_58830 5255 4233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968089.1 protein_id gnl|my_center|LOCUS_58830 6159 5263 gene locus_tag LOCUS_58840 6159 5263 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 protein_id gnl|my_center|LOCUS_58840 7108 6167 gene locus_tag LOCUS_58850 7108 6167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_58850 7337 8368 gene locus_tag LOCUS_58860 7337 8368 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_58860 8358 9779 gene locus_tag LOCUS_58870 8358 9779 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965780.1 protein_id gnl|my_center|LOCUS_58870 9776 10834 gene locus_tag LOCUS_58880 9776 10834 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_58880 10893 11339 gene locus_tag LOCUS_58890 10893 11339 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088641.1 protein_id gnl|my_center|LOCUS_58890 11677 12402 gene locus_tag LOCUS_58900 11677 12402 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244084.1 protein_id gnl|my_center|LOCUS_58900 12504 13499 gene locus_tag LOCUS_58910 12504 13499 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969324.1 protein_id gnl|my_center|LOCUS_58910 13630 14214 gene locus_tag LOCUS_58920 13630 14214 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089572.1 protein_id gnl|my_center|LOCUS_58920 14226 15506 gene locus_tag LOCUS_58930 14226 15506 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 protein_id gnl|my_center|LOCUS_58930 15589 16341 gene locus_tag LOCUS_58940 15589 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 16450 17643 gene locus_tag LOCUS_58950 16450 17643 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_58950 17715 19139 gene locus_tag LOCUS_58960 17715 19139 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921638.1 protein_id gnl|my_center|LOCUS_58960 19206 20030 gene locus_tag LOCUS_58970 19206 20030 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921513.1 protein_id gnl|my_center|LOCUS_58970 20139 21143 gene locus_tag LOCUS_58980 20139 21143 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064228.1 protein_id gnl|my_center|LOCUS_58980 21805 21149 gene locus_tag LOCUS_58990 21805 21149 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255068.1 protein_id gnl|my_center|LOCUS_58990 25114 21923 gene locus_tag LOCUS_59000 25114 21923 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398234.1 protein_id gnl|my_center|LOCUS_59000 26284 25127 gene locus_tag LOCUS_59010 26284 25127 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255119.1 protein_id gnl|my_center|LOCUS_59010 27684 27004 gene locus_tag LOCUS_59020 27684 27004 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095818.1 protein_id gnl|my_center|LOCUS_59020 28628 27696 gene locus_tag LOCUS_59030 28628 27696 CDS product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 protein_id gnl|my_center|LOCUS_59030 30297 28669 gene locus_tag LOCUS_59040 30297 28669 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_59040 34221 30394 gene locus_tag LOCUS_59050 34221 30394 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538150.1 protein_id gnl|my_center|LOCUS_59050 35003 34218 gene locus_tag LOCUS_59060 35003 34218 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086029.1 protein_id gnl|my_center|LOCUS_59060 36006 35254 gene locus_tag LOCUS_59070 36006 35254 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_59070 37209 37306 gene locus_tag LOCUS_t00400 37209 37306 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38119 37478 gene locus_tag LOCUS_59080 38119 37478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 38817 38116 gene locus_tag LOCUS_59090 38817 38116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_59090 39560 38817 gene locus_tag LOCUS_59100 39560 38817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59100 40568 39564 gene locus_tag LOCUS_59110 40568 39564 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_59110 41502 40570 gene locus_tag LOCUS_59120 41502 40570 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040238.1 protein_id gnl|my_center|LOCUS_59120 42865 41570 gene locus_tag LOCUS_59130 42865 41570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 43022 43858 gene locus_tag LOCUS_59140 43022 43858 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919174.1 protein_id gnl|my_center|LOCUS_59140 43883 44707 gene locus_tag LOCUS_59150 43883 44707 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_59150 46040 44736 gene locus_tag LOCUS_59160 46040 44736 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112770.1 protein_id gnl|my_center|LOCUS_59160 47457 46243 gene locus_tag LOCUS_59170 gene phaZ 47457 46243 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 protein_id gnl|my_center|LOCUS_59170 47595 48251 gene locus_tag LOCUS_59180 47595 48251 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967666.1 protein_id gnl|my_center|LOCUS_59180 48790 48341 gene locus_tag LOCUS_59190 48790 48341 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143455.1 protein_id gnl|my_center|LOCUS_59190 49844 48876 gene locus_tag LOCUS_59200 49844 48876 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085682.1 protein_id gnl|my_center|LOCUS_59200 50651 49875 gene locus_tag LOCUS_59210 50651 49875 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967182.1 protein_id gnl|my_center|LOCUS_59210 51425 50763 gene locus_tag LOCUS_59220 51425 50763 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031861.1 protein_id gnl|my_center|LOCUS_59220 52525 51626 gene locus_tag LOCUS_59230 52525 51626 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970114.1 protein_id gnl|my_center|LOCUS_59230 52590 53228 gene locus_tag LOCUS_59240 52590 53228 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967188.1 protein_id gnl|my_center|LOCUS_59240 53438 54640 gene locus_tag LOCUS_59250 53438 54640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 54750 56210 gene locus_tag LOCUS_59260 54750 56210 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086120.1 protein_id gnl|my_center|LOCUS_59260 58037 56340 gene locus_tag LOCUS_59270 58037 56340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 protein_id gnl|my_center|LOCUS_59270 58882 58034 gene locus_tag LOCUS_59280 58882 58034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086123.1 protein_id gnl|my_center|LOCUS_59280 59922 58879 gene locus_tag LOCUS_59290 59922 58879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463752.1 protein_id gnl|my_center|LOCUS_59290 61532 59919 gene locus_tag LOCUS_59300 61532 59919 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086121.1 protein_id gnl|my_center|LOCUS_59300 62515 61754 gene locus_tag LOCUS_59310 62515 61754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086119.1 protein_id gnl|my_center|LOCUS_59310 63909 62563 gene locus_tag LOCUS_59320 63909 62563 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085694.1 protein_id gnl|my_center|LOCUS_59320 65262 64309 gene locus_tag LOCUS_59330 65262 64309 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086118.1 protein_id gnl|my_center|LOCUS_59330 65397 65669 gene locus_tag LOCUS_59340 65397 65669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 65912 66886 gene locus_tag LOCUS_59350 65912 66886 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808043.1 protein_id gnl|my_center|LOCUS_59350 66916 68184 gene locus_tag LOCUS_59360 66916 68184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 68219 69151 gene locus_tag LOCUS_59370 68219 69151 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969830.1 protein_id gnl|my_center|LOCUS_59370 69247 70533 gene locus_tag LOCUS_59380 69247 70533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 70589 71620 gene locus_tag LOCUS_59390 70589 71620 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975313.1 protein_id gnl|my_center|LOCUS_59390 75640 71648 gene locus_tag LOCUS_59400 75640 71648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 76697 75834 gene locus_tag LOCUS_59410 76697 75834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 78316 77525 gene locus_tag LOCUS_59420 78316 77525 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 protein_id gnl|my_center|LOCUS_59420 79140 78313 gene locus_tag LOCUS_59430 79140 78313 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086437.1 protein_id gnl|my_center|LOCUS_59430 79767 79153 gene locus_tag LOCUS_59440 79767 79153 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086438.1 protein_id gnl|my_center|LOCUS_59440 81537 79807 gene locus_tag LOCUS_59450 81537 79807 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086439.1 protein_id gnl|my_center|LOCUS_59450 83260 81551 gene locus_tag LOCUS_59460 83260 81551 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966193.1 protein_id gnl|my_center|LOCUS_59460 84078 83257 gene locus_tag LOCUS_59470 84078 83257 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086639.1 protein_id gnl|my_center|LOCUS_59470 86651 84120 gene locus_tag LOCUS_59480 86651 84120 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086442.1 protein_id gnl|my_center|LOCUS_59480 87517 86648 gene locus_tag LOCUS_59490 87517 86648 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_59490 88884 87625 gene locus_tag LOCUS_59500 88884 87625 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 protein_id gnl|my_center|LOCUS_59500 89083 90132 gene locus_tag LOCUS_59510 89083 90132 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921442.1 protein_id gnl|my_center|LOCUS_59510 90135 91007 gene locus_tag LOCUS_59520 90135 91007 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086446.1 protein_id gnl|my_center|LOCUS_59520 91061 91963 gene locus_tag LOCUS_59530 91061 91963 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 protein_id gnl|my_center|LOCUS_59530 91960 92808 gene locus_tag LOCUS_59540 91960 92808 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086448.1 protein_id gnl|my_center|LOCUS_59540 93676 92792 gene locus_tag LOCUS_59550 93676 92792 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532338.1 protein_id gnl|my_center|LOCUS_59550 93783 94757 gene locus_tag LOCUS_59560 93783 94757 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532339.1 protein_id gnl|my_center|LOCUS_59560 96157 94898 gene locus_tag LOCUS_59570 96157 94898 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083205.1 protein_id gnl|my_center|LOCUS_59570 96844 96320 gene locus_tag LOCUS_59580 96844 96320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 96969 98693 gene locus_tag LOCUS_59590 96969 98693 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 protein_id gnl|my_center|LOCUS_59590 98758 99765 gene locus_tag LOCUS_59600 98758 99765 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_59600 99875 101098 gene locus_tag LOCUS_59610 99875 101098 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384689.1 protein_id gnl|my_center|LOCUS_59610 101416 102291 gene locus_tag LOCUS_59620 101416 102291 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384688.1 protein_id gnl|my_center|LOCUS_59620 102288 103247 gene locus_tag LOCUS_59630 102288 103247 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384687.1 protein_id gnl|my_center|LOCUS_59630 103252 103980 gene locus_tag LOCUS_59640 103252 103980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384686.1 protein_id gnl|my_center|LOCUS_59640 103973 106237 gene locus_tag LOCUS_59650 103973 106237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 107206 106508 gene locus_tag LOCUS_59660 107206 106508 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174804.1 protein_id gnl|my_center|LOCUS_59660 108224 107217 gene locus_tag LOCUS_59670 108224 107217 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533060.1 protein_id gnl|my_center|LOCUS_59670 109360 108221 gene locus_tag LOCUS_59680 gene ugpC 109360 108221 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389015.1 protein_id gnl|my_center|LOCUS_59680 110212 109373 gene locus_tag LOCUS_59690 110212 109373 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_59690 111170 110214 gene locus_tag LOCUS_59700 111170 110214 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_59700 112411 111170 gene locus_tag LOCUS_59710 112411 111170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 112649 114355 gene locus_tag LOCUS_59720 112649 114355 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965811.1 protein_id gnl|my_center|LOCUS_59720 114733 116826 gene locus_tag LOCUS_59730 114733 116826 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_59730 116829 118562 gene locus_tag LOCUS_59740 116829 118562 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_59740 118564 119301 gene locus_tag LOCUS_59750 118564 119301 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_59750 119298 120296 gene locus_tag LOCUS_59760 119298 120296 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807397.1 protein_id gnl|my_center|LOCUS_59760 120293 121102 gene locus_tag LOCUS_59770 120293 121102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_59770 121102 121905 gene locus_tag LOCUS_59780 121102 121905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_59780 121902 122846 gene locus_tag LOCUS_59790 121902 122846 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089792.1 protein_id gnl|my_center|LOCUS_59790 >Feature sequence25 1004 165 gene locus_tag LOCUS_59800 1004 165 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161138491.1 protein_id gnl|my_center|LOCUS_59800 1314 2036 gene locus_tag LOCUS_59810 1314 2036 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090561.1 protein_id gnl|my_center|LOCUS_59810 2165 3097 gene locus_tag LOCUS_59820 2165 3097 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_59820 3468 3106 gene locus_tag LOCUS_59830 3468 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 4478 3717 gene locus_tag LOCUS_59840 4478 3717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_59840 5418 4489 gene locus_tag LOCUS_59850 5418 4489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_59850 5846 5517 gene locus_tag LOCUS_59860 5846 5517 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087106.1 protein_id gnl|my_center|LOCUS_59860 6812 5889 gene locus_tag LOCUS_59870 6812 5889 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014098.1 protein_id gnl|my_center|LOCUS_59870 7505 6867 gene locus_tag LOCUS_59880 7505 6867 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_59880 7659 8561 gene locus_tag LOCUS_59890 7659 8561 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_59890 8772 9995 gene locus_tag LOCUS_59900 8772 9995 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 protein_id gnl|my_center|LOCUS_59900 10020 10343 gene locus_tag LOCUS_59910 10020 10343 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083869.1 protein_id gnl|my_center|LOCUS_59910 10440 11690 gene locus_tag LOCUS_59920 10440 11690 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 protein_id gnl|my_center|LOCUS_59920 12158 12946 gene locus_tag LOCUS_59930 12158 12946 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929980.1 protein_id gnl|my_center|LOCUS_59930 14417 13305 gene locus_tag LOCUS_59940 14417 13305 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 protein_id gnl|my_center|LOCUS_59940 16905 14494 gene locus_tag LOCUS_59950 16905 14494 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_59950 17189 18346 gene locus_tag LOCUS_59960 17189 18346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_59960 18487 19368 gene locus_tag LOCUS_59970 18487 19368 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965993.1 protein_id gnl|my_center|LOCUS_59970 19365 20300 gene locus_tag LOCUS_59980 19365 20300 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_59980 20303 21097 gene locus_tag LOCUS_59990 20303 21097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583300.1 protein_id gnl|my_center|LOCUS_59990 21084 21803 gene locus_tag LOCUS_60000 21084 21803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_60000 21796 22560 gene locus_tag LOCUS_60010 21796 22560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_60010 22553 23320 gene locus_tag LOCUS_60020 22553 23320 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770277.1 protein_id gnl|my_center|LOCUS_60020 23561 24388 gene locus_tag LOCUS_60030 23561 24388 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089937.1 protein_id gnl|my_center|LOCUS_60030 24842 24483 gene locus_tag LOCUS_60040 24842 24483 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_60040 26217 25207 gene locus_tag LOCUS_60050 26217 25207 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531010.1 protein_id gnl|my_center|LOCUS_60050 26781 26527 gene locus_tag LOCUS_60060 26781 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 27092 28810 gene locus_tag LOCUS_60070 27092 28810 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525076.1 protein_id gnl|my_center|LOCUS_60070 28807 30144 gene locus_tag LOCUS_60080 28807 30144 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525075.1 protein_id gnl|my_center|LOCUS_60080 30463 30837 gene locus_tag LOCUS_60090 30463 30837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 30989 31747 gene locus_tag LOCUS_60100 30989 31747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 32095 32823 gene locus_tag LOCUS_60110 32095 32823 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530679.1 protein_id gnl|my_center|LOCUS_60110 32820 34076 gene locus_tag LOCUS_60120 32820 34076 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530678.1 protein_id gnl|my_center|LOCUS_60120 34545 35426 gene locus_tag LOCUS_60130 34545 35426 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328249.1 protein_id gnl|my_center|LOCUS_60130 35780 37426 gene locus_tag LOCUS_60140 35780 37426 CDS product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 protein_id gnl|my_center|LOCUS_60140 37571 38539 gene locus_tag LOCUS_60150 37571 38539 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_60150 38670 39338 gene locus_tag LOCUS_60160 38670 39338 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089987.1 protein_id gnl|my_center|LOCUS_60160 39434 40423 gene locus_tag LOCUS_60170 39434 40423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 41775 40438 gene locus_tag LOCUS_60180 41775 40438 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970550.1 protein_id gnl|my_center|LOCUS_60180 41927 42478 gene locus_tag LOCUS_60190 41927 42478 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180939484.1 protein_id gnl|my_center|LOCUS_60190 43283 42744 gene locus_tag LOCUS_60200 43283 42744 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390521.1 protein_id gnl|my_center|LOCUS_60200 43806 43300 gene locus_tag LOCUS_60210 43806 43300 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388927.1 protein_id gnl|my_center|LOCUS_60210 44033 45148 gene locus_tag LOCUS_60220 44033 45148 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_60220 46169 45405 gene locus_tag LOCUS_60230 46169 45405 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530316.1 protein_id gnl|my_center|LOCUS_60230 47494 46169 gene locus_tag LOCUS_60240 47494 46169 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530317.1 protein_id gnl|my_center|LOCUS_60240 48161 47511 gene locus_tag LOCUS_60250 48161 47511 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530318.1 protein_id gnl|my_center|LOCUS_60250 49065 48142 gene locus_tag LOCUS_60260 49065 48142 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530319.1 protein_id gnl|my_center|LOCUS_60260 50951 49416 gene locus_tag LOCUS_60270 50951 49416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_60270 51157 52503 gene locus_tag LOCUS_60280 51157 52503 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530208.1 protein_id gnl|my_center|LOCUS_60280 52906 54042 gene locus_tag LOCUS_60290 52906 54042 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 protein_id gnl|my_center|LOCUS_60290 55116 54100 gene locus_tag LOCUS_60300 55116 54100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 57172 55580 gene locus_tag LOCUS_60310 57172 55580 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086825.1 protein_id gnl|my_center|LOCUS_60310 57352 57795 gene locus_tag LOCUS_60320 57352 57795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 58586 57759 gene locus_tag LOCUS_60330 58586 57759 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089816.1 protein_id gnl|my_center|LOCUS_60330 59674 58583 gene locus_tag LOCUS_60340 59674 58583 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240161.1 protein_id gnl|my_center|LOCUS_60340 60585 59671 gene locus_tag LOCUS_60350 60585 59671 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089814.1 protein_id gnl|my_center|LOCUS_60350 60785 60594 gene locus_tag LOCUS_60360 60785 60594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 61192 63264 gene locus_tag LOCUS_60370 61192 63264 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920055.1 protein_id gnl|my_center|LOCUS_60370 63404 64636 gene locus_tag LOCUS_60380 63404 64636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 64677 65018 gene locus_tag LOCUS_60390 64677 65018 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_60390 65028 65567 gene locus_tag LOCUS_60400 gene hutX 65028 65567 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972342.1 protein_id gnl|my_center|LOCUS_60400 66290 65943 gene locus_tag LOCUS_60410 66290 65943 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039406410.1 protein_id gnl|my_center|LOCUS_60410 66733 66347 gene locus_tag LOCUS_60420 66733 66347 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889487.1 protein_id gnl|my_center|LOCUS_60420 67034 68644 gene locus_tag LOCUS_60430 67034 68644 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966127.1 protein_id gnl|my_center|LOCUS_60430 68670 70691 gene locus_tag LOCUS_60440 68670 70691 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965832.1 protein_id gnl|my_center|LOCUS_60440 70688 71320 gene locus_tag LOCUS_60450 70688 71320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 71507 72829 gene locus_tag LOCUS_60460 71507 72829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 74096 73191 gene locus_tag LOCUS_60470 74096 73191 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_60470 74862 74110 gene locus_tag LOCUS_60480 74862 74110 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 protein_id gnl|my_center|LOCUS_60480 75878 74859 gene locus_tag LOCUS_60490 75878 74859 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731241.1 protein_id gnl|my_center|LOCUS_60490 77237 75900 gene locus_tag LOCUS_60500 77237 75900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104204.1 protein_id gnl|my_center|LOCUS_60500 78061 77294 gene locus_tag LOCUS_60510 78061 77294 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533811.1 protein_id gnl|my_center|LOCUS_60510 79400 78468 gene locus_tag LOCUS_60520 79400 78468 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525204.1 protein_id gnl|my_center|LOCUS_60520 80352 79426 gene locus_tag LOCUS_60530 80352 79426 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331308.1 protein_id gnl|my_center|LOCUS_60530 83131 80612 gene locus_tag LOCUS_60540 83131 80612 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086442.1 protein_id gnl|my_center|LOCUS_60540 84014 83136 gene locus_tag LOCUS_60550 84014 83136 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_60550 85495 84242 gene locus_tag LOCUS_60560 85495 84242 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 protein_id gnl|my_center|LOCUS_60560 85646 86428 gene locus_tag LOCUS_60570 85646 86428 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725050.1 protein_id gnl|my_center|LOCUS_60570 86440 87216 gene locus_tag LOCUS_60580 86440 87216 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266698.1 protein_id gnl|my_center|LOCUS_60580 87307 88155 gene locus_tag LOCUS_60590 87307 88155 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529920.1 protein_id gnl|my_center|LOCUS_60590 88242 89636 gene locus_tag LOCUS_60600 88242 89636 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_60600 90442 89918 gene locus_tag LOCUS_60610 90442 89918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 90757 90518 gene locus_tag LOCUS_60620 90757 90518 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174267.1 protein_id gnl|my_center|LOCUS_60620 91170 90754 gene locus_tag LOCUS_60630 91170 90754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 91271 92284 gene locus_tag LOCUS_60640 91271 92284 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969001.1 protein_id gnl|my_center|LOCUS_60640 92405 93634 gene locus_tag LOCUS_60650 92405 93634 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967505.1 protein_id gnl|my_center|LOCUS_60650 95668 93641 gene locus_tag LOCUS_60660 95668 93641 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127577866.1 protein_id gnl|my_center|LOCUS_60660 95820 96572 gene locus_tag LOCUS_60670 95820 96572 CDS product biotin/lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088231.1 protein_id gnl|my_center|LOCUS_60670 96569 97123 gene locus_tag LOCUS_60680 96569 97123 CDS product DUF6505 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970359.1 protein_id gnl|my_center|LOCUS_60680 97120 98160 gene locus_tag LOCUS_60690 97120 98160 CDS product DUF6352 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970358.1 protein_id gnl|my_center|LOCUS_60690 98479 99009 gene locus_tag LOCUS_60700 98479 99009 CDS product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970357.1 protein_id gnl|my_center|LOCUS_60700 99006 99737 gene locus_tag LOCUS_60710 99006 99737 CDS product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088229.1 protein_id gnl|my_center|LOCUS_60710 99870 100697 gene locus_tag LOCUS_60720 99870 100697 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088228.1 protein_id gnl|my_center|LOCUS_60720 100732 100986 gene locus_tag LOCUS_60730 100732 100986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 100997 103951 gene locus_tag LOCUS_60740 100997 103951 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970353.1 protein_id gnl|my_center|LOCUS_60740 103968 104564 gene locus_tag LOCUS_60750 gene fdh3B 103968 104564 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970352.1 protein_id gnl|my_center|LOCUS_60750 104674 105708 gene locus_tag LOCUS_60760 104674 105708 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088223.1 protein_id gnl|my_center|LOCUS_60760 105839 106396 gene locus_tag LOCUS_60770 gene mobB 105839 106396 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812685.1 protein_id gnl|my_center|LOCUS_60770 106795 106403 gene locus_tag LOCUS_60780 106795 106403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 106924 108177 gene locus_tag LOCUS_60790 106924 108177 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_60790 108697 108494 gene locus_tag LOCUS_60800 108697 108494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 109396 108752 gene locus_tag LOCUS_60810 gene mobA 109396 108752 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_60810 110270 109389 gene locus_tag LOCUS_60820 gene fdhD 110270 109389 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966588.1 protein_id gnl|my_center|LOCUS_60820 111397 110267 gene locus_tag LOCUS_60830 111397 110267 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971088.1 protein_id gnl|my_center|LOCUS_60830 111956 111489 gene locus_tag LOCUS_60840 111956 111489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 112396 113889 gene locus_tag LOCUS_60850 gene guaB 112396 113889 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086749.1 protein_id gnl|my_center|LOCUS_60850 114324 114169 gene locus_tag LOCUS_60860 114324 114169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 114937 114458 gene locus_tag LOCUS_60870 114937 114458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 115121 115549 gene locus_tag LOCUS_60880 115121 115549 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527202.1 protein_id gnl|my_center|LOCUS_60880 115964 115623 gene locus_tag LOCUS_60890 115964 115623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 116785 116444 gene locus_tag LOCUS_60900 116785 116444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 117102 118337 gene locus_tag LOCUS_60910 117102 118337 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970205.1 protein_id gnl|my_center|LOCUS_60910 118436 119737 gene locus_tag LOCUS_60920 118436 119737 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086762.1 protein_id gnl|my_center|LOCUS_60920 >Feature sequence26 1227 118 gene locus_tag LOCUS_60930 1227 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_60930 8159 1686 gene locus_tag LOCUS_60940 8159 1686 CDS product kinesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531880.1 protein_id gnl|my_center|LOCUS_60940 8578 9240 gene locus_tag LOCUS_60950 8578 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 9701 10000 gene locus_tag LOCUS_60960 9701 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 10190 9981 gene locus_tag LOCUS_60970 10190 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 10363 10995 gene locus_tag LOCUS_60980 10363 10995 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400784.1 protein_id gnl|my_center|LOCUS_60980 11106 11384 gene locus_tag LOCUS_60990 11106 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 11536 11892 gene locus_tag LOCUS_61000 11536 11892 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531879.1 protein_id gnl|my_center|LOCUS_61000 12052 12372 gene locus_tag LOCUS_61010 12052 12372 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_61010 12449 13486 gene locus_tag LOCUS_61020 12449 13486 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088624.1 protein_id gnl|my_center|LOCUS_61020 13996 14865 gene locus_tag LOCUS_61030 13996 14865 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_61030 15279 15803 gene locus_tag LOCUS_61040 15279 15803 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_61040 15805 17244 gene locus_tag LOCUS_61050 15805 17244 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089988.1 protein_id gnl|my_center|LOCUS_61050 17241 18251 gene locus_tag LOCUS_61060 17241 18251 CDS product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089989.1 protein_id gnl|my_center|LOCUS_61060 18366 18800 gene locus_tag LOCUS_61070 18366 18800 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 protein_id gnl|my_center|LOCUS_61070 18832 19014 gene locus_tag LOCUS_61080 18832 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 19011 19472 gene locus_tag LOCUS_61090 19011 19472 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583880.1 protein_id gnl|my_center|LOCUS_61090 19498 19815 gene locus_tag LOCUS_61100 19498 19815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275347.1 protein_id gnl|my_center|LOCUS_61100 19979 20449 gene locus_tag LOCUS_61110 19979 20449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 21126 20512 gene locus_tag LOCUS_61120 21126 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 22628 21453 gene locus_tag LOCUS_61130 22628 21453 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089432.1 protein_id gnl|my_center|LOCUS_61130 22939 22700 gene locus_tag LOCUS_61140 22939 22700 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521369.1 protein_id gnl|my_center|LOCUS_61140 23514 22939 gene locus_tag LOCUS_61150 23514 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 23589 24257 gene locus_tag LOCUS_61160 23589 24257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 24535 24344 gene locus_tag LOCUS_61170 24535 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 24720 24532 gene locus_tag LOCUS_61180 24720 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 26076 24814 gene locus_tag LOCUS_61190 26076 24814 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_61190 26471 26073 gene locus_tag LOCUS_61200 26471 26073 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_61200 27487 26903 gene locus_tag LOCUS_61210 27487 26903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 28335 27487 gene locus_tag LOCUS_61220 28335 27487 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_61220 28601 29959 gene locus_tag LOCUS_61230 28601 29959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 30032 31933 gene locus_tag LOCUS_61240 gene flgK 30032 31933 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088594.1 protein_id gnl|my_center|LOCUS_61240 31944 33530 gene locus_tag LOCUS_61250 31944 33530 CDS product flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088593.1 protein_id gnl|my_center|LOCUS_61250 34182 33811 gene locus_tag LOCUS_61260 gene flaF 34182 33811 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008554779.1 protein_id gnl|my_center|LOCUS_61260 34558 34145 gene locus_tag LOCUS_61270 gene flbT 34558 34145 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 protein_id gnl|my_center|LOCUS_61270 36001 34721 gene locus_tag LOCUS_61280 36001 34721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 36918 36499 gene locus_tag LOCUS_61290 36918 36499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 37202 38701 gene locus_tag LOCUS_61300 37202 38701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 38896 40449 gene locus_tag LOCUS_61310 38896 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 40654 42246 gene locus_tag LOCUS_61320 40654 42246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 42458 43897 gene locus_tag LOCUS_61330 42458 43897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 44790 44344 gene locus_tag LOCUS_61340 44790 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 45420 44941 gene locus_tag LOCUS_61350 45420 44941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088582.1 protein_id gnl|my_center|LOCUS_61350 45849 45481 gene locus_tag LOCUS_61360 45849 45481 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920439.1 protein_id gnl|my_center|LOCUS_61360 46952 45849 gene locus_tag LOCUS_61370 46952 45849 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 protein_id gnl|my_center|LOCUS_61370 47193 47621 gene locus_tag LOCUS_61380 47193 47621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 47811 48215 gene locus_tag LOCUS_61390 gene dksA 47811 48215 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 protein_id gnl|my_center|LOCUS_61390 48258 48764 gene locus_tag LOCUS_61400 48258 48764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 50573 48960 gene locus_tag LOCUS_61410 50573 48960 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_61410 51045 50680 gene locus_tag LOCUS_61420 51045 50680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 51505 51966 gene locus_tag LOCUS_61430 51505 51966 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968175.1 protein_id gnl|my_center|LOCUS_61430 52530 52096 gene locus_tag LOCUS_61440 52530 52096 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529131.1 protein_id gnl|my_center|LOCUS_61440 52668 53567 gene locus_tag LOCUS_61450 52668 53567 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529130.1 protein_id gnl|my_center|LOCUS_61450 53612 53962 gene locus_tag LOCUS_61460 53612 53962 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971755.1 protein_id gnl|my_center|LOCUS_61460 53959 54393 gene locus_tag LOCUS_61470 53959 54393 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531837.1 protein_id gnl|my_center|LOCUS_61470 54428 55048 gene locus_tag LOCUS_61480 54428 55048 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083439.1 protein_id gnl|my_center|LOCUS_61480 55442 55771 gene locus_tag LOCUS_61490 55442 55771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 55968 57521 gene locus_tag LOCUS_61500 55968 57521 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_61500 57624 58691 gene locus_tag LOCUS_61510 57624 58691 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083752.1 protein_id gnl|my_center|LOCUS_61510 59720 58734 gene locus_tag LOCUS_61520 59720 58734 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_61520 60686 59952 gene locus_tag LOCUS_61530 gene flgH 60686 59952 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_61530 61726 60710 gene locus_tag LOCUS_61540 gene flgA 61726 60710 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967164.1 protein_id gnl|my_center|LOCUS_61540 62525 61737 gene locus_tag LOCUS_61550 gene flgG 62525 61737 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919925.1 protein_id gnl|my_center|LOCUS_61550 63314 62538 gene locus_tag LOCUS_61560 gene flgF 63314 62538 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088570.1 protein_id gnl|my_center|LOCUS_61560 63641 64138 gene locus_tag LOCUS_61570 gene fliL 63641 64138 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088569.1 protein_id gnl|my_center|LOCUS_61570 64154 65314 gene locus_tag LOCUS_61580 gene fliM 64154 65314 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088568.1 protein_id gnl|my_center|LOCUS_61580 65314 65805 gene locus_tag LOCUS_61590 65314 65805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 65815 66555 gene locus_tag LOCUS_61600 65815 66555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088566.1 protein_id gnl|my_center|LOCUS_61600 66681 70340 gene locus_tag LOCUS_61610 66681 70340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967166.1 protein_id gnl|my_center|LOCUS_61610 70519 70758 gene locus_tag LOCUS_61620 70519 70758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 71069 70674 gene locus_tag LOCUS_61630 71069 70674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 71043 71219 gene locus_tag LOCUS_61640 71043 71219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 71236 71808 gene locus_tag LOCUS_61650 71236 71808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 72814 72092 gene locus_tag LOCUS_61660 gene fliP 72814 72092 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 protein_id gnl|my_center|LOCUS_61660 74282 73002 gene locus_tag LOCUS_61670 74282 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61670 74488 74892 gene locus_tag LOCUS_61680 gene flgB 74488 74892 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640104.1 protein_id gnl|my_center|LOCUS_61680 74906 75322 gene locus_tag LOCUS_61690 gene flgC 74906 75322 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 protein_id gnl|my_center|LOCUS_61690 75319 75642 gene locus_tag LOCUS_61700 gene fliE 75319 75642 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088556.1 protein_id gnl|my_center|LOCUS_61700 75752 76018 gene locus_tag LOCUS_61710 gene fliQ 75752 76018 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_61710 76074 76841 gene locus_tag LOCUS_61720 gene fliR 76074 76841 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_61720 76845 77915 gene locus_tag LOCUS_61730 gene flhB 76845 77915 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_61730 78595 77951 gene locus_tag LOCUS_61740 78595 77951 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338230.1 protein_id gnl|my_center|LOCUS_61740 79094 78702 gene locus_tag LOCUS_61750 79094 78702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 79387 80097 gene locus_tag LOCUS_61760 79387 80097 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 protein_id gnl|my_center|LOCUS_61760 80140 80676 gene locus_tag LOCUS_61770 80140 80676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 81289 81038 gene locus_tag LOCUS_61780 81289 81038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 81425 82363 gene locus_tag LOCUS_61790 81425 82363 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530654.1 protein_id gnl|my_center|LOCUS_61790 83314 82370 gene locus_tag LOCUS_61800 83314 82370 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090038.1 protein_id gnl|my_center|LOCUS_61800 84858 83320 gene locus_tag LOCUS_61810 84858 83320 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 protein_id gnl|my_center|LOCUS_61810 85415 85897 gene locus_tag LOCUS_61820 85415 85897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61820 86360 86599 gene locus_tag LOCUS_61830 86360 86599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 87464 87787 gene locus_tag LOCUS_61840 87464 87787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 88492 87902 gene locus_tag LOCUS_61850 88492 87902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 89253 88675 gene locus_tag LOCUS_61860 89253 88675 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_61860 90747 90097 gene locus_tag LOCUS_61870 90747 90097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 91194 93797 gene locus_tag LOCUS_61880 91194 93797 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088552.1 protein_id gnl|my_center|LOCUS_61880 94468 94088 gene locus_tag LOCUS_61890 94468 94088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 95013 94435 gene locus_tag LOCUS_61900 95013 94435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 96224 95229 gene locus_tag LOCUS_61910 96224 95229 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528305.1 protein_id gnl|my_center|LOCUS_61910 96340 97236 gene locus_tag LOCUS_61920 96340 97236 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067687.1 protein_id gnl|my_center|LOCUS_61920 99131 97473 gene locus_tag LOCUS_61930 99131 97473 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088540.1 protein_id gnl|my_center|LOCUS_61930 100392 99466 gene locus_tag LOCUS_61940 100392 99466 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_61940 101982 100654 gene locus_tag LOCUS_61950 101982 100654 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089450.1 protein_id gnl|my_center|LOCUS_61950 103080 102037 gene locus_tag LOCUS_61960 103080 102037 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_61960 104099 103077 gene locus_tag LOCUS_61970 104099 103077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_61970 104971 104096 gene locus_tag LOCUS_61980 104971 104096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089451.1 protein_id gnl|my_center|LOCUS_61980 105941 104991 gene locus_tag LOCUS_61990 105941 104991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_61990 107578 105968 gene locus_tag LOCUS_62000 107578 105968 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967661.1 protein_id gnl|my_center|LOCUS_62000 107877 108521 gene locus_tag LOCUS_62010 107877 108521 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089454.1 protein_id gnl|my_center|LOCUS_62010 109510 108518 gene locus_tag LOCUS_62020 109510 108518 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310098.1 protein_id gnl|my_center|LOCUS_62020 110056 110715 gene locus_tag LOCUS_62030 110056 110715 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554867.1 protein_id gnl|my_center|LOCUS_62030 110825 111076 gene locus_tag LOCUS_62040 110825 111076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398437.1 protein_id gnl|my_center|LOCUS_62040 112253 111120 gene locus_tag LOCUS_62050 112253 111120 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391134.1 protein_id gnl|my_center|LOCUS_62050 113758 112250 gene locus_tag LOCUS_62060 113758 112250 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968894.1 protein_id gnl|my_center|LOCUS_62060 114309 113755 gene locus_tag LOCUS_62070 114309 113755 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626155.1 protein_id gnl|my_center|LOCUS_62070 114931 114320 gene locus_tag LOCUS_62080 114931 114320 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389087.1 protein_id gnl|my_center|LOCUS_62080 115710 114928 gene locus_tag LOCUS_62090 115710 114928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337285.1 protein_id gnl|my_center|LOCUS_62090 116067 115849 gene locus_tag LOCUS_62100 116067 115849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 116644 116207 gene locus_tag LOCUS_62110 116644 116207 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383453.1 protein_id gnl|my_center|LOCUS_62110 116722 117552 gene locus_tag LOCUS_62120 116722 117552 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_62120 117949 119556 gene locus_tag LOCUS_62130 117949 119556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 >Feature sequence27 207 968 gene locus_tag LOCUS_62140 207 968 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061718.1 protein_id gnl|my_center|LOCUS_62140 965 2167 gene locus_tag LOCUS_62150 965 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 2164 3282 gene locus_tag LOCUS_62160 2164 3282 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086149.1 protein_id gnl|my_center|LOCUS_62160 3377 4855 gene locus_tag LOCUS_62170 3377 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 4852 5865 gene locus_tag LOCUS_62180 4852 5865 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_62180 5862 7340 gene locus_tag LOCUS_62190 5862 7340 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090851.1 protein_id gnl|my_center|LOCUS_62190 9022 7442 gene locus_tag LOCUS_62200 9022 7442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_62200 9109 9900 gene locus_tag LOCUS_62210 9109 9900 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 protein_id gnl|my_center|LOCUS_62210 10037 11590 gene locus_tag LOCUS_62220 10037 11590 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_62220 11578 12033 gene locus_tag LOCUS_62230 11578 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 13647 12043 gene locus_tag LOCUS_62240 13647 12043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 14787 13717 gene locus_tag LOCUS_62250 14787 13717 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085029.1 protein_id gnl|my_center|LOCUS_62250 16123 14792 gene locus_tag LOCUS_62260 16123 14792 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090300.1 protein_id gnl|my_center|LOCUS_62260 16517 17563 gene locus_tag LOCUS_62270 gene exoZ 16517 17563 CDS product exopolysaccharide production protein ExoZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850573.1 protein_id gnl|my_center|LOCUS_62270 18641 17589 gene locus_tag LOCUS_62280 18641 17589 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833065.1 protein_id gnl|my_center|LOCUS_62280 18783 19244 gene locus_tag LOCUS_62290 18783 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 20408 19575 gene locus_tag LOCUS_62300 gene map 20408 19575 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090891.1 protein_id gnl|my_center|LOCUS_62300 20600 21637 gene locus_tag LOCUS_62310 20600 21637 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081714208.1 protein_id gnl|my_center|LOCUS_62310 22144 21704 gene locus_tag LOCUS_62320 22144 21704 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 protein_id gnl|my_center|LOCUS_62320 22292 23209 gene locus_tag LOCUS_62330 22292 23209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_62330 23725 23219 gene locus_tag LOCUS_62340 23725 23219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 24803 23808 gene locus_tag LOCUS_62350 24803 23808 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020699611.1 protein_id gnl|my_center|LOCUS_62350 24992 25774 gene locus_tag LOCUS_62360 24992 25774 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338969.1 protein_id gnl|my_center|LOCUS_62360 25843 26757 gene locus_tag LOCUS_62370 25843 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338976.1 protein_id gnl|my_center|LOCUS_62370 26774 27700 gene locus_tag LOCUS_62380 26774 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 28717 28082 gene locus_tag LOCUS_62390 28717 28082 CDS product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971655.1 protein_id gnl|my_center|LOCUS_62390 31746 29227 gene locus_tag LOCUS_62400 gene leuS 31746 29227 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_62400 32996 32010 gene locus_tag LOCUS_62410 32996 32010 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 protein_id gnl|my_center|LOCUS_62410 33885 33094 gene locus_tag LOCUS_62420 33885 33094 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331744.1 protein_id gnl|my_center|LOCUS_62420 35248 34265 gene locus_tag LOCUS_62430 35248 34265 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_62430 35898 35278 gene locus_tag LOCUS_62440 35898 35278 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229040.1 protein_id gnl|my_center|LOCUS_62440 36770 35901 gene locus_tag LOCUS_62450 36770 35901 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020867621.1 protein_id gnl|my_center|LOCUS_62450 36927 37979 gene locus_tag LOCUS_62460 36927 37979 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_62460 39875 38283 gene locus_tag LOCUS_62470 39875 38283 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973887.1 protein_id gnl|my_center|LOCUS_62470 41131 39872 gene locus_tag LOCUS_62480 41131 39872 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435151.1 protein_id gnl|my_center|LOCUS_62480 41269 41928 gene locus_tag LOCUS_62490 41269 41928 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528496.1 protein_id gnl|my_center|LOCUS_62490 42889 42269 gene locus_tag LOCUS_62500 42889 42269 CDS product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528354.1 protein_id gnl|my_center|LOCUS_62500 43139 42879 gene locus_tag LOCUS_62510 43139 42879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 43635 43213 gene locus_tag LOCUS_62520 43635 43213 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090276.1 protein_id gnl|my_center|LOCUS_62520 44998 43745 gene locus_tag LOCUS_62530 44998 43745 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_62530 45594 45079 gene locus_tag LOCUS_62540 45594 45079 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930675.1 protein_id gnl|my_center|LOCUS_62540 45990 45640 gene locus_tag LOCUS_62550 45990 45640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 46730 45987 gene locus_tag LOCUS_62560 46730 45987 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185828.1 protein_id gnl|my_center|LOCUS_62560 47997 46714 gene locus_tag LOCUS_62570 gene soxC 47997 46714 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_62570 49726 48029 gene locus_tag LOCUS_62580 gene soxB 49726 48029 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_62580 50131 49802 gene locus_tag LOCUS_62590 gene soxZ 50131 49802 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_62590 50625 50161 gene locus_tag LOCUS_62600 gene soxY 50625 50161 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_62600 50813 51661 gene locus_tag LOCUS_62610 gene soxA 50813 51661 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_62610 51673 52317 gene locus_tag LOCUS_62620 gene soxX 51673 52317 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_62620 53091 52339 gene locus_tag LOCUS_62630 53091 52339 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086292.1 protein_id gnl|my_center|LOCUS_62630 53163 53546 gene locus_tag LOCUS_62640 53163 53546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_62640 53546 53923 gene locus_tag LOCUS_62650 53546 53923 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_62650 53972 55093 gene locus_tag LOCUS_62660 53972 55093 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_62660 55249 56151 gene locus_tag LOCUS_62670 55249 56151 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 protein_id gnl|my_center|LOCUS_62670 56181 56456 gene locus_tag LOCUS_62680 56181 56456 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140127.1 protein_id gnl|my_center|LOCUS_62680 56783 58531 gene locus_tag LOCUS_62690 56783 58531 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 protein_id gnl|my_center|LOCUS_62690 58565 60643 gene locus_tag LOCUS_62700 58565 60643 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_62700 60852 62216 gene locus_tag LOCUS_62710 60852 62216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531509.1 protein_id gnl|my_center|LOCUS_62710 63218 62259 gene locus_tag LOCUS_62720 63218 62259 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513572.1 protein_id gnl|my_center|LOCUS_62720 64425 63487 gene locus_tag LOCUS_62730 64425 63487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 64603 64529 gene locus_tag LOCUS_t00410 64603 64529 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 65619 64885 gene locus_tag LOCUS_62740 65619 64885 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255254.1 protein_id gnl|my_center|LOCUS_62740 66662 65730 gene locus_tag LOCUS_62750 66662 65730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 69766 66659 gene locus_tag LOCUS_62760 69766 66659 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901088.1 protein_id gnl|my_center|LOCUS_62760 70953 70063 gene locus_tag LOCUS_62770 70953 70063 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196715.1 protein_id gnl|my_center|LOCUS_62770 71312 70950 gene locus_tag LOCUS_62780 71312 70950 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 protein_id gnl|my_center|LOCUS_62780 73593 71494 gene locus_tag LOCUS_62790 gene recG 73593 71494 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087374.1 protein_id gnl|my_center|LOCUS_62790 73715 74014 gene locus_tag LOCUS_62800 73715 74014 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531907.1 protein_id gnl|my_center|LOCUS_62800 74014 77532 gene locus_tag LOCUS_62810 gene mfd 74014 77532 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087372.1 protein_id gnl|my_center|LOCUS_62810 77534 78121 gene locus_tag LOCUS_62820 77534 78121 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966788.1 protein_id gnl|my_center|LOCUS_62820 78260 78667 gene locus_tag LOCUS_62830 gene clpS 78260 78667 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548135.1 protein_id gnl|my_center|LOCUS_62830 78718 81198 gene locus_tag LOCUS_62840 gene clpA 78718 81198 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 protein_id gnl|my_center|LOCUS_62840 81574 82317 gene locus_tag LOCUS_62850 81574 82317 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087896.1 protein_id gnl|my_center|LOCUS_62850 82314 82664 gene locus_tag LOCUS_62860 82314 82664 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535005.1 protein_id gnl|my_center|LOCUS_62860 83104 82673 gene locus_tag LOCUS_62870 83104 82673 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087893.1 protein_id gnl|my_center|LOCUS_62870 83484 83182 gene locus_tag LOCUS_62880 83484 83182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 83921 83649 gene locus_tag LOCUS_62890 83921 83649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 84371 84084 gene locus_tag LOCUS_62900 84371 84084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 84672 84523 gene locus_tag LOCUS_62910 84672 84523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 84626 84913 gene locus_tag LOCUS_62920 84626 84913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 86142 84961 gene locus_tag LOCUS_62930 86142 84961 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_62930 86909 86154 gene locus_tag LOCUS_62940 86909 86154 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087891.1 protein_id gnl|my_center|LOCUS_62940 87367 86909 gene locus_tag LOCUS_62950 87367 86909 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_62950 87587 88414 gene locus_tag LOCUS_62960 87587 88414 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171560.1 protein_id gnl|my_center|LOCUS_62960 89955 88693 gene locus_tag LOCUS_62970 89955 88693 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531937.1 protein_id gnl|my_center|LOCUS_62970 90367 90065 gene locus_tag LOCUS_62980 90367 90065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 90462 90833 gene locus_tag LOCUS_62990 90462 90833 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 protein_id gnl|my_center|LOCUS_62990 90853 92226 gene locus_tag LOCUS_63000 90853 92226 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_63000 92666 93625 gene locus_tag LOCUS_63010 92666 93625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 93908 93741 gene locus_tag LOCUS_63020 gene rpmG 93908 93741 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975118.1 protein_id gnl|my_center|LOCUS_63020 95475 94018 gene locus_tag LOCUS_63030 gene cysG 95475 94018 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256894.1 protein_id gnl|my_center|LOCUS_63030 97154 95535 gene locus_tag LOCUS_63040 97154 95535 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087341.1 protein_id gnl|my_center|LOCUS_63040 98956 97151 gene locus_tag LOCUS_63050 98956 97151 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967420.1 protein_id gnl|my_center|LOCUS_63050 101576 99408 gene locus_tag LOCUS_63060 gene mdoH 101576 99408 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072171.1 protein_id gnl|my_center|LOCUS_63060 103132 101564 gene locus_tag LOCUS_63070 103132 101564 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 protein_id gnl|my_center|LOCUS_63070 104194 103217 gene locus_tag LOCUS_63080 104194 103217 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971854.1 protein_id gnl|my_center|LOCUS_63080 105109 104294 gene locus_tag LOCUS_63090 105109 104294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 106872 105208 gene locus_tag LOCUS_63100 gene pimA 106872 105208 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090544.1 protein_id gnl|my_center|LOCUS_63100 107811 106924 gene locus_tag LOCUS_63110 107811 106924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_63110 108326 107880 gene locus_tag LOCUS_63120 gene queF 108326 107880 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122403094.1 protein_id gnl|my_center|LOCUS_63120 108454 109737 gene locus_tag LOCUS_63130 gene eno 108454 109737 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087562.1 protein_id gnl|my_center|LOCUS_63130 110552 109860 gene locus_tag LOCUS_63140 110552 109860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 110824 111732 gene locus_tag LOCUS_63150 110824 111732 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_63150 111768 112085 gene locus_tag LOCUS_63160 111768 112085 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087554.1 protein_id gnl|my_center|LOCUS_63160 112281 113330 gene locus_tag LOCUS_63170 gene pdhA 112281 113330 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087551.1 protein_id gnl|my_center|LOCUS_63170 113327 113620 gene locus_tag LOCUS_63180 113327 113620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 113651 115039 gene locus_tag LOCUS_63190 113651 115039 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 protein_id gnl|my_center|LOCUS_63190 115053 115346 gene locus_tag LOCUS_63200 115053 115346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 115355 115747 gene locus_tag LOCUS_63210 115355 115747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 115769 117136 gene locus_tag LOCUS_63220 115769 117136 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975254.1 protein_id gnl|my_center|LOCUS_63220 117230 117670 gene locus_tag LOCUS_63230 117230 117670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 117670 118152 gene locus_tag LOCUS_63240 117670 118152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 118175 119614 gene locus_tag LOCUS_63250 gene lpdA 118175 119614 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969230.1 protein_id gnl|my_center|LOCUS_63250 >Feature sequence28 4785 5777 gene locus_tag LOCUS_63260 4785 5777 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087556.1 protein_id gnl|my_center|LOCUS_63260 7042 5894 gene locus_tag LOCUS_63270 gene dgoD 7042 5894 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 protein_id gnl|my_center|LOCUS_63270 8245 7058 gene locus_tag LOCUS_63280 8245 7058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971593.1 protein_id gnl|my_center|LOCUS_63280 9096 8266 gene locus_tag LOCUS_63290 9096 8266 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256603.1 protein_id gnl|my_center|LOCUS_63290 10001 9093 gene locus_tag LOCUS_63300 10001 9093 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971595.1 protein_id gnl|my_center|LOCUS_63300 11294 10050 gene locus_tag LOCUS_63310 11294 10050 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971596.1 protein_id gnl|my_center|LOCUS_63310 11462 12214 gene locus_tag LOCUS_63320 11462 12214 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561207.1 protein_id gnl|my_center|LOCUS_63320 12223 12999 gene locus_tag LOCUS_63330 12223 12999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 protein_id gnl|my_center|LOCUS_63330 13025 14071 gene locus_tag LOCUS_63340 13025 14071 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088034.1 protein_id gnl|my_center|LOCUS_63340 14073 15035 gene locus_tag LOCUS_63350 14073 15035 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_63350 15032 15670 gene locus_tag LOCUS_63360 15032 15670 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535375.1 protein_id gnl|my_center|LOCUS_63360 15705 16904 gene locus_tag LOCUS_63370 15705 16904 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210343307.1 protein_id gnl|my_center|LOCUS_63370 16946 17155 gene locus_tag LOCUS_63380 16946 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 17373 17678 gene locus_tag LOCUS_63390 17373 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 18234 17923 gene locus_tag LOCUS_63400 18234 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 18467 18919 gene locus_tag LOCUS_63410 18467 18919 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531558.1 protein_id gnl|my_center|LOCUS_63410 19652 19098 gene locus_tag LOCUS_63420 19652 19098 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191840.1 protein_id gnl|my_center|LOCUS_63420 19871 20638 gene locus_tag LOCUS_63430 19871 20638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_63430 20635 21378 gene locus_tag LOCUS_63440 20635 21378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384137.1 protein_id gnl|my_center|LOCUS_63440 21389 22597 gene locus_tag LOCUS_63450 21389 22597 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391164.1 protein_id gnl|my_center|LOCUS_63450 22619 23506 gene locus_tag LOCUS_63460 22619 23506 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_63460 23503 24462 gene locus_tag LOCUS_63470 23503 24462 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_63470 24459 26036 gene locus_tag LOCUS_63480 24459 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 26033 27019 gene locus_tag LOCUS_63490 26033 27019 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809375.1 protein_id gnl|my_center|LOCUS_63490 27332 28054 gene locus_tag LOCUS_63500 27332 28054 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_63500 28076 28567 gene locus_tag LOCUS_63510 28076 28567 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 protein_id gnl|my_center|LOCUS_63510 28646 30055 gene locus_tag LOCUS_63520 28646 30055 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_63520 31473 30169 gene locus_tag LOCUS_63530 gene gabT 31473 30169 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266223.1 protein_id gnl|my_center|LOCUS_63530 32688 31510 gene locus_tag LOCUS_63540 32688 31510 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017276276.1 protein_id gnl|my_center|LOCUS_63540 33062 32724 gene locus_tag LOCUS_63550 33062 32724 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227991.1 protein_id gnl|my_center|LOCUS_63550 33227 34684 gene locus_tag LOCUS_63560 gene gabD 33227 34684 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_63560 35061 34985 gene locus_tag LOCUS_t00420 35061 34985 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36815 35286 gene locus_tag LOCUS_63570 36815 35286 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_63570 38275 36851 gene locus_tag LOCUS_63580 38275 36851 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974297.1 protein_id gnl|my_center|LOCUS_63580 38539 39876 gene locus_tag LOCUS_63590 38539 39876 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089807.1 protein_id gnl|my_center|LOCUS_63590 40850 39888 gene locus_tag LOCUS_63600 40850 39888 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_63600 40978 41403 gene locus_tag LOCUS_63610 40978 41403 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231200.1 protein_id gnl|my_center|LOCUS_63610 41387 41848 gene locus_tag LOCUS_63620 41387 41848 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973783.1 protein_id gnl|my_center|LOCUS_63620 42580 41852 gene locus_tag LOCUS_63630 42580 41852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 43748 42714 gene locus_tag LOCUS_63640 43748 42714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 44455 43760 gene locus_tag LOCUS_63650 gene phnN 44455 43760 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084046.1 protein_id gnl|my_center|LOCUS_63650 45615 44458 gene locus_tag LOCUS_63660 45615 44458 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084045.1 protein_id gnl|my_center|LOCUS_63660 46345 45632 gene locus_tag LOCUS_63670 gene phnL 46345 45632 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965301.1 protein_id gnl|my_center|LOCUS_63670 47133 46357 gene locus_tag LOCUS_63680 gene phnK 47133 46357 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084043.1 protein_id gnl|my_center|LOCUS_63680 48017 47130 gene locus_tag LOCUS_63690 48017 47130 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969859.1 protein_id gnl|my_center|LOCUS_63690 49132 48014 gene locus_tag LOCUS_63700 49132 48014 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084041.1 protein_id gnl|my_center|LOCUS_63700 49721 49134 gene locus_tag LOCUS_63710 gene phnH 49721 49134 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965300.1 protein_id gnl|my_center|LOCUS_63710 50188 49721 gene locus_tag LOCUS_63720 gene phnG 50188 49721 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530625.1 protein_id gnl|my_center|LOCUS_63720 50368 51087 gene locus_tag LOCUS_63730 gene phnF 50368 51087 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970710.1 protein_id gnl|my_center|LOCUS_63730 52307 51426 gene locus_tag LOCUS_63740 gene phnE 52307 51426 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090667.1 protein_id gnl|my_center|LOCUS_63740 53200 52304 gene locus_tag LOCUS_63750 gene phnE 53200 52304 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090668.1 protein_id gnl|my_center|LOCUS_63750 54213 53293 gene locus_tag LOCUS_63760 gene phnD 54213 53293 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090669.1 protein_id gnl|my_center|LOCUS_63760 55056 54250 gene locus_tag LOCUS_63770 gene phnC 55056 54250 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090670.1 protein_id gnl|my_center|LOCUS_63770 55301 55921 gene locus_tag LOCUS_63780 55301 55921 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_63780 56045 58741 gene locus_tag LOCUS_63790 56045 58741 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039059.1 protein_id gnl|my_center|LOCUS_63790 59564 58791 gene locus_tag LOCUS_63800 59564 58791 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_63800 62507 59871 gene locus_tag LOCUS_63810 62507 59871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 62966 62640 gene locus_tag LOCUS_63820 62966 62640 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085802.1 protein_id gnl|my_center|LOCUS_63820 63673 63074 gene locus_tag LOCUS_63830 63673 63074 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089643.1 protein_id gnl|my_center|LOCUS_63830 63768 64961 gene locus_tag LOCUS_63840 63768 64961 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086726.1 protein_id gnl|my_center|LOCUS_63840 64976 66223 gene locus_tag LOCUS_63850 64976 66223 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930712.1 protein_id gnl|my_center|LOCUS_63850 68183 66270 gene locus_tag LOCUS_63860 gene ilvD 68183 66270 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807716.1 protein_id gnl|my_center|LOCUS_63860 68337 69296 gene locus_tag LOCUS_63870 68337 69296 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_63870 69520 70614 gene locus_tag LOCUS_63880 69520 70614 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_63880 70919 71584 gene locus_tag LOCUS_63890 70919 71584 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967643.1 protein_id gnl|my_center|LOCUS_63890 71605 72867 gene locus_tag LOCUS_63900 71605 72867 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086793.1 protein_id gnl|my_center|LOCUS_63900 72899 73951 gene locus_tag LOCUS_63910 72899 73951 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086792.1 protein_id gnl|my_center|LOCUS_63910 74023 75678 gene locus_tag LOCUS_63920 74023 75678 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_63920 75815 76930 gene locus_tag LOCUS_63930 75815 76930 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_63930 77857 76970 gene locus_tag LOCUS_63940 77857 76970 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930839.1 protein_id gnl|my_center|LOCUS_63940 77960 79066 gene locus_tag LOCUS_63950 77960 79066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 79082 80332 gene locus_tag LOCUS_63960 gene phnA 79082 80332 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 protein_id gnl|my_center|LOCUS_63960 80336 81787 gene locus_tag LOCUS_63970 gene phnY 80336 81787 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975823.1 protein_id gnl|my_center|LOCUS_63970 82162 83385 gene locus_tag LOCUS_63980 82162 83385 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948255.1 protein_id gnl|my_center|LOCUS_63980 83530 85842 gene locus_tag LOCUS_63990 83530 85842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 86454 85843 gene locus_tag LOCUS_64000 86454 85843 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243674.1 protein_id gnl|my_center|LOCUS_64000 89833 86711 gene locus_tag LOCUS_64010 89833 86711 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937745.1 protein_id gnl|my_center|LOCUS_64010 91048 89846 gene locus_tag LOCUS_64020 91048 89846 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531050.1 protein_id gnl|my_center|LOCUS_64020 91269 92162 gene locus_tag LOCUS_64030 gene paaX 91269 92162 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085674.1 protein_id gnl|my_center|LOCUS_64030 92273 93265 gene locus_tag LOCUS_64040 gene paaA 92273 93265 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172418.1 protein_id gnl|my_center|LOCUS_64040 93271 93558 gene locus_tag LOCUS_64050 gene paaB 93271 93558 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_64050 93571 94326 gene locus_tag LOCUS_64060 gene paaC 93571 94326 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_64060 94334 94840 gene locus_tag LOCUS_64070 gene paaJ 94334 94840 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_64070 94831 95940 gene locus_tag LOCUS_64080 gene paaK 94831 95940 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965787.1 protein_id gnl|my_center|LOCUS_64080 96909 96286 gene locus_tag LOCUS_64090 96909 96286 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 protein_id gnl|my_center|LOCUS_64090 98222 96912 gene locus_tag LOCUS_64100 gene paaF 98222 96912 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965786.1 protein_id gnl|my_center|LOCUS_64100 98686 98231 gene locus_tag LOCUS_64110 gene paaI 98686 98231 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 protein_id gnl|my_center|LOCUS_64110 99480 98683 gene locus_tag LOCUS_64120 gene paaG 99480 98683 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_64120 99689 100852 gene locus_tag LOCUS_64130 99689 100852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040052.1 protein_id gnl|my_center|LOCUS_64130 101091 101963 gene locus_tag LOCUS_64140 101091 101963 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_64140 101968 102966 gene locus_tag LOCUS_64150 101968 102966 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_64150 102963 103754 gene locus_tag LOCUS_64160 102963 103754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816696.1 protein_id gnl|my_center|LOCUS_64160 103741 104442 gene locus_tag LOCUS_64170 103741 104442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 protein_id gnl|my_center|LOCUS_64170 >Feature sequence29 110 532 gene locus_tag LOCUS_64180 110 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 1636 680 gene locus_tag LOCUS_64190 1636 680 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_64190 3011 1668 gene locus_tag LOCUS_64200 3011 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 3687 3612 gene locus_tag LOCUS_t00430 3687 3612 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4750 3980 gene locus_tag LOCUS_64210 4750 3980 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087467.1 protein_id gnl|my_center|LOCUS_64210 5031 5762 gene locus_tag LOCUS_64220 5031 5762 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537551.1 protein_id gnl|my_center|LOCUS_64220 5801 6274 gene locus_tag LOCUS_64230 5801 6274 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878483.1 protein_id gnl|my_center|LOCUS_64230 8217 6433 gene locus_tag LOCUS_64240 8217 6433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973999.1 protein_id gnl|my_center|LOCUS_64240 8480 9094 gene locus_tag LOCUS_64250 8480 9094 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_64250 9707 9075 gene locus_tag LOCUS_64260 9707 9075 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815883.1 protein_id gnl|my_center|LOCUS_64260 9888 10349 gene locus_tag LOCUS_64270 9888 10349 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084100.1 protein_id gnl|my_center|LOCUS_64270 10709 10356 gene locus_tag LOCUS_64280 10709 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 11119 10712 gene locus_tag LOCUS_64290 11119 10712 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530049.1 protein_id gnl|my_center|LOCUS_64290 11834 11223 gene locus_tag LOCUS_64300 11834 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171904.1 protein_id gnl|my_center|LOCUS_64300 11743 12030 gene locus_tag LOCUS_64310 11743 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 12317 12027 gene locus_tag LOCUS_64320 12317 12027 CDS product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530153.1 protein_id gnl|my_center|LOCUS_64320 13741 12464 gene locus_tag LOCUS_64330 13741 12464 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_64330 14251 16092 gene locus_tag LOCUS_64340 14251 16092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966424.1 protein_id gnl|my_center|LOCUS_64340 16789 16145 gene locus_tag LOCUS_64350 16789 16145 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967123.1 protein_id gnl|my_center|LOCUS_64350 17342 18049 gene locus_tag LOCUS_64360 17342 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64360 18478 18092 gene locus_tag LOCUS_64370 18478 18092 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967386.1 protein_id gnl|my_center|LOCUS_64370 20237 18591 gene locus_tag LOCUS_64380 20237 18591 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_64380 21877 20312 gene locus_tag LOCUS_64390 21877 20312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_64390 23333 21954 gene locus_tag LOCUS_64400 23333 21954 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_64400 23459 24244 gene locus_tag LOCUS_64410 23459 24244 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392302.1 protein_id gnl|my_center|LOCUS_64410 26323 24329 gene locus_tag LOCUS_64420 gene rpoD 26323 24329 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530149.1 protein_id gnl|my_center|LOCUS_64420 28487 26547 gene locus_tag LOCUS_64430 gene dnaG 28487 26547 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090085.1 protein_id gnl|my_center|LOCUS_64430 29399 28566 gene locus_tag LOCUS_64440 29399 28566 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 protein_id gnl|my_center|LOCUS_64440 30508 29576 gene locus_tag LOCUS_64450 30508 29576 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969186.1 protein_id gnl|my_center|LOCUS_64450 30648 31277 gene locus_tag LOCUS_64460 30648 31277 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 protein_id gnl|my_center|LOCUS_64460 33173 31584 gene locus_tag LOCUS_64470 33173 31584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_64470 35335 33311 gene locus_tag LOCUS_64480 35335 33311 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965108.1 protein_id gnl|my_center|LOCUS_64480 36064 35609 gene locus_tag LOCUS_64490 36064 35609 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 protein_id gnl|my_center|LOCUS_64490 36279 37718 gene locus_tag LOCUS_64500 36279 37718 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967275.1 protein_id gnl|my_center|LOCUS_64500 37775 39001 gene locus_tag LOCUS_64510 37775 39001 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967274.1 protein_id gnl|my_center|LOCUS_64510 39643 39029 gene locus_tag LOCUS_64520 39643 39029 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090153.1 protein_id gnl|my_center|LOCUS_64520 41790 39700 gene locus_tag LOCUS_64530 41790 39700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918991.1 protein_id gnl|my_center|LOCUS_64530 43050 41950 gene locus_tag LOCUS_64540 43050 41950 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_64540 44266 43043 gene locus_tag LOCUS_64550 44266 43043 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537225.1 protein_id gnl|my_center|LOCUS_64550 45333 44344 gene locus_tag LOCUS_64560 45333 44344 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808043.1 protein_id gnl|my_center|LOCUS_64560 45482 46684 gene locus_tag LOCUS_64570 45482 46684 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972134.1 protein_id gnl|my_center|LOCUS_64570 46798 47088 gene locus_tag LOCUS_64580 46798 47088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 47504 47085 gene locus_tag LOCUS_64590 47504 47085 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965285.1 protein_id gnl|my_center|LOCUS_64590 47467 48225 gene locus_tag LOCUS_64600 47467 48225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 49646 48234 gene locus_tag LOCUS_64610 49646 48234 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 protein_id gnl|my_center|LOCUS_64610 49988 52288 gene locus_tag LOCUS_64620 49988 52288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 52412 53491 gene locus_tag LOCUS_64630 52412 53491 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313891.1 protein_id gnl|my_center|LOCUS_64630 53700 58931 gene locus_tag LOCUS_64640 53700 58931 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355187.1 protein_id gnl|my_center|LOCUS_64640 59730 59029 gene locus_tag LOCUS_64650 59730 59029 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265880.1 protein_id gnl|my_center|LOCUS_64650 59812 60777 gene locus_tag LOCUS_64660 59812 60777 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252799.1 protein_id gnl|my_center|LOCUS_64660 61695 60808 gene locus_tag LOCUS_64670 61695 60808 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_64670 61830 62450 gene locus_tag LOCUS_64680 61830 62450 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 protein_id gnl|my_center|LOCUS_64680 63876 62575 gene locus_tag LOCUS_64690 63876 62575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704390.1 protein_id gnl|my_center|LOCUS_64690 64260 64889 gene locus_tag LOCUS_64700 64260 64889 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090175.1 protein_id gnl|my_center|LOCUS_64700 65030 65635 gene locus_tag LOCUS_64710 gene pth 65030 65635 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_64710 65722 66819 gene locus_tag LOCUS_64720 gene ychF 65722 66819 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 protein_id gnl|my_center|LOCUS_64720 66828 67319 gene locus_tag LOCUS_64730 66828 67319 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972161.1 protein_id gnl|my_center|LOCUS_64730 67312 67773 gene locus_tag LOCUS_64740 67312 67773 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090171.1 protein_id gnl|my_center|LOCUS_64740 67920 68384 gene locus_tag LOCUS_64750 67920 68384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 68581 69006 gene locus_tag LOCUS_64760 68581 69006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64760 69790 69245 gene locus_tag LOCUS_64770 69790 69245 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085277.1 protein_id gnl|my_center|LOCUS_64770 70789 69884 gene locus_tag LOCUS_64780 70789 69884 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529025.1 protein_id gnl|my_center|LOCUS_64780 70911 72086 gene locus_tag LOCUS_64790 70911 72086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529024.1 protein_id gnl|my_center|LOCUS_64790 72134 73057 gene locus_tag LOCUS_64800 72134 73057 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_64800 73582 73100 gene locus_tag LOCUS_64810 73582 73100 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_64810 74670 73654 gene locus_tag LOCUS_64820 74670 73654 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086660.1 protein_id gnl|my_center|LOCUS_64820 74863 75792 gene locus_tag LOCUS_64830 74863 75792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 76678 75809 gene locus_tag LOCUS_64840 76678 75809 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083781.1 protein_id gnl|my_center|LOCUS_64840 77598 76759 gene locus_tag LOCUS_64850 77598 76759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64850 78943 77630 gene locus_tag LOCUS_64860 78943 77630 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529985.1 protein_id gnl|my_center|LOCUS_64860 79515 78967 gene locus_tag LOCUS_64870 gene petA 79515 78967 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085272.1 protein_id gnl|my_center|LOCUS_64870 79871 80338 gene locus_tag LOCUS_64880 79871 80338 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969494.1 protein_id gnl|my_center|LOCUS_64880 81109 80396 gene locus_tag LOCUS_64890 81109 80396 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172604.1 protein_id gnl|my_center|LOCUS_64890 82953 81541 gene locus_tag LOCUS_64900 82953 81541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64900 83264 84046 gene locus_tag LOCUS_64910 83264 84046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 84178 85653 gene locus_tag LOCUS_64920 84178 85653 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929820.1 protein_id gnl|my_center|LOCUS_64920 85749 86495 gene locus_tag LOCUS_64930 85749 86495 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_64930 86486 87670 gene locus_tag LOCUS_64940 86486 87670 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978505.1 protein_id gnl|my_center|LOCUS_64940 87748 88134 gene locus_tag LOCUS_64950 87748 88134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 89098 88178 gene locus_tag LOCUS_64960 89098 88178 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967309.1 protein_id gnl|my_center|LOCUS_64960 89413 90411 gene locus_tag LOCUS_64970 89413 90411 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 protein_id gnl|my_center|LOCUS_64970 90362 91234 gene locus_tag LOCUS_64980 90362 91234 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063715.1 protein_id gnl|my_center|LOCUS_64980 91231 91977 gene locus_tag LOCUS_64990 91231 91977 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089937.1 protein_id gnl|my_center|LOCUS_64990 92007 93593 gene locus_tag LOCUS_65000 92007 93593 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_65000 >Feature sequence30 <1 987 gene locus_tag LOCUS_65010 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975329.1:SPOR domain-containing protein 991 2055 gene locus_tag LOCUS_65020 gene nagZ 991 2055 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_65020 2520 3344 gene locus_tag LOCUS_65030 2520 3344 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087521.1 protein_id gnl|my_center|LOCUS_65030 3415 4140 gene locus_tag LOCUS_65040 gene scpB 3415 4140 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171841.1 protein_id gnl|my_center|LOCUS_65040 4137 5261 gene locus_tag LOCUS_65050 4137 5261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328224.1 protein_id gnl|my_center|LOCUS_65050 5356 5625 gene locus_tag LOCUS_65060 5356 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 5699 6361 gene locus_tag LOCUS_65070 5699 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 6358 7242 gene locus_tag LOCUS_65080 gene tatC 6358 7242 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087517.1 protein_id gnl|my_center|LOCUS_65080 7336 8037 gene locus_tag LOCUS_65090 7336 8037 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086577.1 protein_id gnl|my_center|LOCUS_65090 8069 8917 gene locus_tag LOCUS_65100 8069 8917 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_65100 9435 9193 gene locus_tag LOCUS_65110 9435 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65110 9671 10543 gene locus_tag LOCUS_65120 9671 10543 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256001.1 protein_id gnl|my_center|LOCUS_65120 10553 10855 gene locus_tag LOCUS_65130 10553 10855 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972301.1 protein_id gnl|my_center|LOCUS_65130 10878 11471 gene locus_tag LOCUS_65140 10878 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65140 11526 11786 gene locus_tag LOCUS_65150 11526 11786 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066610.1 protein_id gnl|my_center|LOCUS_65150 11788 12093 gene locus_tag LOCUS_65160 11788 12093 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240195.1 protein_id gnl|my_center|LOCUS_65160 12185 13900 gene locus_tag LOCUS_65170 gene ureC 12185 13900 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969961.1 protein_id gnl|my_center|LOCUS_65170 14285 15094 gene locus_tag LOCUS_65180 14285 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 15036 15779 gene locus_tag LOCUS_65190 15036 15779 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 protein_id gnl|my_center|LOCUS_65190 15783 16418 gene locus_tag LOCUS_65200 gene ureG 15783 16418 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_65200 16539 18059 gene locus_tag LOCUS_65210 16539 18059 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528169.1 protein_id gnl|my_center|LOCUS_65210 18070 18453 gene locus_tag LOCUS_65220 18070 18453 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975573.1 protein_id gnl|my_center|LOCUS_65220 18603 18923 gene locus_tag LOCUS_65230 18603 18923 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012062.1 protein_id gnl|my_center|LOCUS_65230 19820 18978 gene locus_tag LOCUS_65240 19820 18978 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086558.1 protein_id gnl|my_center|LOCUS_65240 20067 21119 gene locus_tag LOCUS_65250 20067 21119 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_65250 21125 21634 gene locus_tag LOCUS_65260 21125 21634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 21631 22950 gene locus_tag LOCUS_65270 21631 22950 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_65270 23012 23857 gene locus_tag LOCUS_65280 23012 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 24251 23889 gene locus_tag LOCUS_65290 24251 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 24337 24801 gene locus_tag LOCUS_65300 24337 24801 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_65300 24812 25615 gene locus_tag LOCUS_65310 24812 25615 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_65310 26952 25864 gene locus_tag LOCUS_65320 26952 25864 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_65320 27092 27925 gene locus_tag LOCUS_65330 27092 27925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966017.1 protein_id gnl|my_center|LOCUS_65330 29087 28263 gene locus_tag LOCUS_65340 29087 28263 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086582.1 protein_id gnl|my_center|LOCUS_65340 29865 29095 gene locus_tag LOCUS_65350 29865 29095 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086581.1 protein_id gnl|my_center|LOCUS_65350 30148 30339 gene locus_tag LOCUS_65360 30148 30339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 30449 31090 gene locus_tag LOCUS_65370 30449 31090 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090153.1 protein_id gnl|my_center|LOCUS_65370 31102 31587 gene locus_tag LOCUS_65380 31102 31587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 31692 32024 gene locus_tag LOCUS_65390 31692 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 32056 33402 gene locus_tag LOCUS_65400 32056 33402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 33658 34371 gene locus_tag LOCUS_65410 gene lepB 33658 34371 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_65410 34379 35185 gene locus_tag LOCUS_65420 gene rnc 34379 35185 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087822.1 protein_id gnl|my_center|LOCUS_65420 35189 36097 gene locus_tag LOCUS_65430 gene era 35189 36097 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087821.1 protein_id gnl|my_center|LOCUS_65430 36094 36339 gene locus_tag LOCUS_65440 36094 36339 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393782.1 protein_id gnl|my_center|LOCUS_65440 39569 36573 gene locus_tag LOCUS_65450 39569 36573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 39696 40406 gene locus_tag LOCUS_65460 gene recO 39696 40406 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552519.1 protein_id gnl|my_center|LOCUS_65460 40505 41782 gene locus_tag LOCUS_65470 gene serS 40505 41782 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 protein_id gnl|my_center|LOCUS_65470 41782 42564 gene locus_tag LOCUS_65480 gene surE 41782 42564 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 protein_id gnl|my_center|LOCUS_65480 42578 43237 gene locus_tag LOCUS_65490 42578 43237 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087512.1 protein_id gnl|my_center|LOCUS_65490 43333 44958 gene locus_tag LOCUS_65500 43333 44958 CDS product LysM peptidoglycan-binding domain-containing M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087511.1 protein_id gnl|my_center|LOCUS_65500 46298 45405 gene locus_tag LOCUS_65510 46298 45405 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_65510 46594 46325 gene locus_tag LOCUS_65520 46594 46325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 46503 46832 gene locus_tag LOCUS_65530 gene yajC 46503 46832 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 protein_id gnl|my_center|LOCUS_65530 46892 48508 gene locus_tag LOCUS_65540 gene secD 46892 48508 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_65540 48533 49483 gene locus_tag LOCUS_65550 gene secF 48533 49483 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_65550 49485 49883 gene locus_tag LOCUS_65560 49485 49883 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971713.1 protein_id gnl|my_center|LOCUS_65560 50017 50913 gene locus_tag LOCUS_65570 50017 50913 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172317.1 protein_id gnl|my_center|LOCUS_65570 51096 50932 gene locus_tag LOCUS_65580 51096 50932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 54496 51575 gene locus_tag LOCUS_65590 gene uvrA 54496 51575 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087470.1 protein_id gnl|my_center|LOCUS_65590 54917 55441 gene locus_tag LOCUS_65600 54917 55441 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531834.1 protein_id gnl|my_center|LOCUS_65600 55456 55974 gene locus_tag LOCUS_65610 55456 55974 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142381.1 protein_id gnl|my_center|LOCUS_65610 56357 56752 gene locus_tag LOCUS_65620 56357 56752 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087465.1 protein_id gnl|my_center|LOCUS_65620 57454 56825 gene locus_tag LOCUS_65630 57454 56825 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969300.1 protein_id gnl|my_center|LOCUS_65630 57666 60425 gene locus_tag LOCUS_65640 gene gyrA 57666 60425 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_65640 61616 60672 gene locus_tag LOCUS_65650 gene gcvA 61616 60672 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200344113.1 protein_id gnl|my_center|LOCUS_65650 61698 63086 gene locus_tag LOCUS_65660 61698 63086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_65660 64358 63195 gene locus_tag LOCUS_65670 64358 63195 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089743.1 protein_id gnl|my_center|LOCUS_65670 64466 64984 gene locus_tag LOCUS_65680 gene coaD 64466 64984 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087462.1 protein_id gnl|my_center|LOCUS_65680 65007 65561 gene locus_tag LOCUS_65690 65007 65561 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_65690 65596 66096 gene locus_tag LOCUS_65700 65596 66096 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_65700 66162 67271 gene locus_tag LOCUS_65710 gene queA 66162 67271 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919461.1 protein_id gnl|my_center|LOCUS_65710 67271 68455 gene locus_tag LOCUS_65720 gene tgt 67271 68455 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975429.1 protein_id gnl|my_center|LOCUS_65720 69576 68752 gene locus_tag LOCUS_65730 69576 68752 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_65730 69738 70103 gene locus_tag LOCUS_65740 69738 70103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 70130 70402 gene locus_tag LOCUS_65750 70130 70402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 70997 70437 gene locus_tag LOCUS_65760 70997 70437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 71244 72524 gene locus_tag LOCUS_65770 71244 72524 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088821.1 protein_id gnl|my_center|LOCUS_65770 72809 73090 gene locus_tag LOCUS_65780 72809 73090 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_65780 73335 74030 gene locus_tag LOCUS_65790 73335 74030 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816755.1 protein_id gnl|my_center|LOCUS_65790 74930 74475 gene locus_tag LOCUS_65800 74930 74475 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088820.1 protein_id gnl|my_center|LOCUS_65800 75170 76171 gene locus_tag LOCUS_65810 75170 76171 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083775.1 protein_id gnl|my_center|LOCUS_65810 76207 76671 gene locus_tag LOCUS_65820 76207 76671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 76675 78177 gene locus_tag LOCUS_65830 76675 78177 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083773.1 protein_id gnl|my_center|LOCUS_65830 78283 78963 gene locus_tag LOCUS_65840 78283 78963 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 protein_id gnl|my_center|LOCUS_65840 80228 78999 gene locus_tag LOCUS_65850 80228 78999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063812.1 protein_id gnl|my_center|LOCUS_65850 80695 81294 gene locus_tag LOCUS_65860 80695 81294 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185918.1 protein_id gnl|my_center|LOCUS_65860 81456 83066 gene locus_tag LOCUS_65870 81456 83066 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819100.1 protein_id gnl|my_center|LOCUS_65870 83103 84089 gene locus_tag LOCUS_65880 83103 84089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_65880 84086 84925 gene locus_tag LOCUS_65890 84086 84925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_65890 84922 86541 gene locus_tag LOCUS_65900 84922 86541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399966.1 protein_id gnl|my_center|LOCUS_65900 86665 87282 gene locus_tag LOCUS_65910 86665 87282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 87391 87464 gene locus_tag LOCUS_t00440 87391 87464 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 87714 87526 gene locus_tag LOCUS_65920 87714 87526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 88040 88690 gene locus_tag LOCUS_65930 88040 88690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 >Feature sequence31 75 1586 gene locus_tag LOCUS_65940 75 1586 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090470.1 protein_id gnl|my_center|LOCUS_65940 1993 2430 gene locus_tag LOCUS_65950 1993 2430 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315456.1 protein_id gnl|my_center|LOCUS_65950 2444 4111 gene locus_tag LOCUS_65960 2444 4111 CDS product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971737.1 protein_id gnl|my_center|LOCUS_65960 5016 4129 gene locus_tag LOCUS_65970 5016 4129 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084315.1 protein_id gnl|my_center|LOCUS_65970 6054 5092 gene locus_tag LOCUS_65980 6054 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 6817 6059 gene locus_tag LOCUS_65990 6817 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 8505 6814 gene locus_tag LOCUS_66000 8505 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 8606 9646 gene locus_tag LOCUS_66010 8606 9646 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_66010 9733 10134 gene locus_tag LOCUS_66020 9733 10134 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_66020 10131 11195 gene locus_tag LOCUS_66030 10131 11195 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 protein_id gnl|my_center|LOCUS_66030 11192 12028 gene locus_tag LOCUS_66040 11192 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66040 12281 15829 gene locus_tag LOCUS_66050 12281 15829 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528208.1 protein_id gnl|my_center|LOCUS_66050 16817 15891 gene locus_tag LOCUS_66060 16817 15891 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385340.1 protein_id gnl|my_center|LOCUS_66060 16699 16929 gene locus_tag LOCUS_66070 16699 16929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 17008 17247 gene locus_tag LOCUS_66080 17008 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 18427 17279 gene locus_tag LOCUS_66090 18427 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 19314 18481 gene locus_tag LOCUS_66100 19314 18481 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088098.1 protein_id gnl|my_center|LOCUS_66100 20176 19433 gene locus_tag LOCUS_66110 20176 19433 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_66110 21105 20173 gene locus_tag LOCUS_66120 21105 20173 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919703.1 protein_id gnl|my_center|LOCUS_66120 21427 21702 gene locus_tag LOCUS_66130 21427 21702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 23618 21813 gene locus_tag LOCUS_66140 23618 21813 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086692.1 protein_id gnl|my_center|LOCUS_66140 23931 25148 gene locus_tag LOCUS_66150 23931 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 25183 26367 gene locus_tag LOCUS_66160 25183 26367 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_66160 26381 26788 gene locus_tag LOCUS_66170 26381 26788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 27613 26792 gene locus_tag LOCUS_66180 27613 26792 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_66180 28191 27694 gene locus_tag LOCUS_66190 28191 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151644554.1 protein_id gnl|my_center|LOCUS_66190 28742 28188 gene locus_tag LOCUS_66200 28742 28188 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966159.1 protein_id gnl|my_center|LOCUS_66200 29938 28883 gene locus_tag LOCUS_66210 29938 28883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 30657 30025 gene locus_tag LOCUS_66220 gene eda 30657 30025 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_66220 31113 30751 gene locus_tag LOCUS_66230 31113 30751 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085182.1 protein_id gnl|my_center|LOCUS_66230 31689 31210 gene locus_tag LOCUS_66240 31689 31210 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967454.1 protein_id gnl|my_center|LOCUS_66240 31808 32938 gene locus_tag LOCUS_66250 gene hppD 31808 32938 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083171.1 protein_id gnl|my_center|LOCUS_66250 34029 32947 gene locus_tag LOCUS_66260 34029 32947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083472.1 protein_id gnl|my_center|LOCUS_66260 35139 34138 gene locus_tag LOCUS_66270 35139 34138 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085657.1 protein_id gnl|my_center|LOCUS_66270 36119 35136 gene locus_tag LOCUS_66280 36119 35136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 protein_id gnl|my_center|LOCUS_66280 37084 36134 gene locus_tag LOCUS_66290 37084 36134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384486.1 protein_id gnl|my_center|LOCUS_66290 38075 37092 gene locus_tag LOCUS_66300 38075 37092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906119.1 protein_id gnl|my_center|LOCUS_66300 39824 38172 gene locus_tag LOCUS_66310 39824 38172 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384484.1 protein_id gnl|my_center|LOCUS_66310 40270 39971 gene locus_tag LOCUS_66320 40270 39971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 40725 40267 gene locus_tag LOCUS_66330 40725 40267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66330 42532 40820 gene locus_tag LOCUS_66340 42532 40820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 43026 42529 gene locus_tag LOCUS_66350 43026 42529 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456662.1 protein_id gnl|my_center|LOCUS_66350 44508 43084 gene locus_tag LOCUS_66360 44508 43084 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967050.1 protein_id gnl|my_center|LOCUS_66360 45872 44625 gene locus_tag LOCUS_66370 45872 44625 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_66370 46235 45882 gene locus_tag LOCUS_66380 46235 45882 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_66380 47640 46381 gene locus_tag LOCUS_66390 gene rlmN 47640 46381 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083356.1 protein_id gnl|my_center|LOCUS_66390 48331 48236 gene locus_tag LOCUS_t00450 48331 48236 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48812 49378 gene locus_tag LOCUS_66400 48812 49378 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_66400 50000 49362 gene locus_tag LOCUS_66410 50000 49362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66410 50189 50004 gene locus_tag LOCUS_66420 50189 50004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 51602 50193 gene locus_tag LOCUS_66430 gene leuC 51602 50193 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529677.1 protein_id gnl|my_center|LOCUS_66430 51850 52188 gene locus_tag LOCUS_66440 51850 52188 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088200.1 protein_id gnl|my_center|LOCUS_66440 53193 52231 gene locus_tag LOCUS_66450 gene argF 53193 52231 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 protein_id gnl|my_center|LOCUS_66450 54371 53190 gene locus_tag LOCUS_66460 54371 53190 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 protein_id gnl|my_center|LOCUS_66460 55511 54516 gene locus_tag LOCUS_66470 55511 54516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66470 55900 56436 gene locus_tag LOCUS_66480 55900 56436 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083916.1 protein_id gnl|my_center|LOCUS_66480 57451 56456 gene locus_tag LOCUS_66490 57451 56456 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064715.1 protein_id gnl|my_center|LOCUS_66490 58092 57448 gene locus_tag LOCUS_66500 58092 57448 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090480.1 protein_id gnl|my_center|LOCUS_66500 58268 59503 gene locus_tag LOCUS_66510 58268 59503 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085703.1 protein_id gnl|my_center|LOCUS_66510 59647 60462 gene locus_tag LOCUS_66520 gene dapB 59647 60462 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965144.1 protein_id gnl|my_center|LOCUS_66520 60476 61102 gene locus_tag LOCUS_66530 60476 61102 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083512.1 protein_id gnl|my_center|LOCUS_66530 62114 61143 gene locus_tag LOCUS_66540 62114 61143 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972392.1 protein_id gnl|my_center|LOCUS_66540 62353 62883 gene locus_tag LOCUS_66550 62353 62883 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087128.1 protein_id gnl|my_center|LOCUS_66550 63808 63002 gene locus_tag LOCUS_66560 63808 63002 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_66560 64202 63813 gene locus_tag LOCUS_66570 64202 63813 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 protein_id gnl|my_center|LOCUS_66570 64732 64259 gene locus_tag LOCUS_66580 64732 64259 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 protein_id gnl|my_center|LOCUS_66580 64848 65999 gene locus_tag LOCUS_66590 64848 65999 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243008.1 protein_id gnl|my_center|LOCUS_66590 66133 67143 gene locus_tag LOCUS_66600 66133 67143 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_66600 67536 67204 gene locus_tag LOCUS_66610 67536 67204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66610 68222 67641 gene locus_tag LOCUS_66620 68222 67641 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090485.1 protein_id gnl|my_center|LOCUS_66620 69483 68338 gene locus_tag LOCUS_66630 69483 68338 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090484.1 protein_id gnl|my_center|LOCUS_66630 70193 71983 gene locus_tag LOCUS_66640 70193 71983 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_66640 72166 73419 gene locus_tag LOCUS_66650 72166 73419 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089972.1 protein_id gnl|my_center|LOCUS_66650 73422 74660 gene locus_tag LOCUS_66660 73422 74660 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089973.1 protein_id gnl|my_center|LOCUS_66660 74698 75327 gene locus_tag LOCUS_66670 gene upp 74698 75327 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536149.1 protein_id gnl|my_center|LOCUS_66670 75402 76199 gene locus_tag LOCUS_66680 75402 76199 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967309.1 protein_id gnl|my_center|LOCUS_66680 77288 76413 gene locus_tag LOCUS_66690 77288 76413 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_66690 77398 78855 gene locus_tag LOCUS_66700 77398 78855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388869.1 protein_id gnl|my_center|LOCUS_66700 79608 78850 gene locus_tag LOCUS_66710 79608 78850 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706361.1 protein_id gnl|my_center|LOCUS_66710 79629 80252 gene locus_tag LOCUS_66720 79629 80252 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098828.1 protein_id gnl|my_center|LOCUS_66720 81422 80256 gene locus_tag LOCUS_66730 81422 80256 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534864.1 protein_id gnl|my_center|LOCUS_66730 82007 81474 gene locus_tag LOCUS_66740 82007 81474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 82250 82162 gene locus_tag LOCUS_t00460 82250 82162 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 83624 82722 gene locus_tag LOCUS_66750 83624 82722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_66750 84351 83698 gene locus_tag LOCUS_66760 84351 83698 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083415.1 protein_id gnl|my_center|LOCUS_66760 84499 84834 gene locus_tag LOCUS_66770 84499 84834 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919891.1 protein_id gnl|my_center|LOCUS_66770 85169 86122 gene locus_tag LOCUS_66780 85169 86122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113786.1 protein_id gnl|my_center|LOCUS_66780 86319 86243 gene locus_tag LOCUS_t00470 86319 86243 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 86534 86426 gene locus_tag LOCUS_r00010 86534 86426 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence32 1649 258 gene locus_tag LOCUS_66790 1649 258 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_66790 2603 1929 gene locus_tag LOCUS_66800 2603 1929 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526652.1 protein_id gnl|my_center|LOCUS_66800 4116 2806 gene locus_tag LOCUS_66810 gene rimO 4116 2806 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087346.1 protein_id gnl|my_center|LOCUS_66810 4337 4993 gene locus_tag LOCUS_66820 4337 4993 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968950.1 protein_id gnl|my_center|LOCUS_66820 5696 5211 gene locus_tag LOCUS_66830 5696 5211 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509099.1 protein_id gnl|my_center|LOCUS_66830 5923 6351 gene locus_tag LOCUS_66840 5923 6351 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970165.1 protein_id gnl|my_center|LOCUS_66840 6510 7718 gene locus_tag LOCUS_66850 6510 7718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975162.1 protein_id gnl|my_center|LOCUS_66850 7949 8038 gene locus_tag LOCUS_t00480 7949 8038 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8217 8639 gene locus_tag LOCUS_66860 gene arr 8217 8639 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028626.1 protein_id gnl|my_center|LOCUS_66860 9113 9748 gene locus_tag LOCUS_66870 9113 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 10059 10868 gene locus_tag LOCUS_66880 10059 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 10961 11959 gene locus_tag LOCUS_66890 10961 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 11990 12364 gene locus_tag LOCUS_66900 11990 12364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 12562 12879 gene locus_tag LOCUS_66910 12562 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 12980 13639 gene locus_tag LOCUS_66920 12980 13639 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 protein_id gnl|my_center|LOCUS_66920 14239 16380 gene locus_tag LOCUS_66930 14239 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 16383 17303 gene locus_tag LOCUS_66940 16383 17303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867634.1 protein_id gnl|my_center|LOCUS_66940 17300 18283 gene locus_tag LOCUS_66950 17300 18283 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_66950 18280 19035 gene locus_tag LOCUS_66960 18280 19035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_66960 20464 19175 gene locus_tag LOCUS_66970 20464 19175 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085015.1 protein_id gnl|my_center|LOCUS_66970 21099 20470 gene locus_tag LOCUS_66980 21099 20470 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966513.1 protein_id gnl|my_center|LOCUS_66980 21297 22328 gene locus_tag LOCUS_66990 21297 22328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443464.1 protein_id gnl|my_center|LOCUS_66990 22325 23146 gene locus_tag LOCUS_67000 22325 23146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811610.1 protein_id gnl|my_center|LOCUS_67000 23143 23952 gene locus_tag LOCUS_67010 23143 23952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811613.1 protein_id gnl|my_center|LOCUS_67010 23978 25027 gene locus_tag LOCUS_67020 23978 25027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811608.1 protein_id gnl|my_center|LOCUS_67020 25399 27420 gene locus_tag LOCUS_67030 25399 27420 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338380.1 protein_id gnl|my_center|LOCUS_67030 27417 29045 gene locus_tag LOCUS_67040 27417 29045 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_67040 29089 29403 gene locus_tag LOCUS_67050 29089 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 30816 29506 gene locus_tag LOCUS_67060 30816 29506 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972568.1 protein_id gnl|my_center|LOCUS_67060 31604 30813 gene locus_tag LOCUS_67070 gene cobA 31604 30813 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531077.1 protein_id gnl|my_center|LOCUS_67070 32643 31879 gene locus_tag LOCUS_67080 gene cobM 32643 31879 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337777.1 protein_id gnl|my_center|LOCUS_67080 33023 32640 gene locus_tag LOCUS_67090 33023 32640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 34270 33020 gene locus_tag LOCUS_67100 34270 33020 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531080.1 protein_id gnl|my_center|LOCUS_67100 34269 35033 gene locus_tag LOCUS_67110 34269 35033 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 protein_id gnl|my_center|LOCUS_67110 35770 35000 gene locus_tag LOCUS_67120 35770 35000 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970291.1 protein_id gnl|my_center|LOCUS_67120 36522 35767 gene locus_tag LOCUS_67130 36522 35767 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528814.1 protein_id gnl|my_center|LOCUS_67130 37174 36527 gene locus_tag LOCUS_67140 37174 36527 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_67140 38451 37171 gene locus_tag LOCUS_67150 gene cobG 38451 37171 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243256.1 protein_id gnl|my_center|LOCUS_67150 41753 38448 gene locus_tag LOCUS_67160 gene cobN 41753 38448 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972577.1 protein_id gnl|my_center|LOCUS_67160 42822 41773 gene locus_tag LOCUS_67170 gene cobW 42822 41773 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531087.1 protein_id gnl|my_center|LOCUS_67170 43347 43865 gene locus_tag LOCUS_67180 gene cobU 43347 43865 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_67180 43874 44485 gene locus_tag LOCUS_67190 gene cobO 43874 44485 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972580.1 protein_id gnl|my_center|LOCUS_67190 44803 45507 gene locus_tag LOCUS_67200 44803 45507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 45539 47011 gene locus_tag LOCUS_67210 45539 47011 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972581.1 protein_id gnl|my_center|LOCUS_67210 48273 47293 gene locus_tag LOCUS_67220 gene cbiB 48273 47293 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531121.1 protein_id gnl|my_center|LOCUS_67220 48272 49267 gene locus_tag LOCUS_67230 gene cobD 48272 49267 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531122.1 protein_id gnl|my_center|LOCUS_67230 50310 49273 gene locus_tag LOCUS_67240 50310 49273 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_67240 50617 51384 gene locus_tag LOCUS_67250 gene cobF 50617 51384 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389520.1 protein_id gnl|my_center|LOCUS_67250 51463 53007 gene locus_tag LOCUS_67260 gene garD 51463 53007 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088615.1 protein_id gnl|my_center|LOCUS_67260 53015 54313 gene locus_tag LOCUS_67270 53015 54313 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531061.1 protein_id gnl|my_center|LOCUS_67270 54516 55568 gene locus_tag LOCUS_67280 54516 55568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 55682 56839 gene locus_tag LOCUS_67290 55682 56839 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967564.1 protein_id gnl|my_center|LOCUS_67290 56836 57549 gene locus_tag LOCUS_67300 gene tmk 56836 57549 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087289.1 protein_id gnl|my_center|LOCUS_67300 57546 58595 gene locus_tag LOCUS_67310 57546 58595 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087288.1 protein_id gnl|my_center|LOCUS_67310 58619 60166 gene locus_tag LOCUS_67320 gene metG 58619 60166 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531575.1 protein_id gnl|my_center|LOCUS_67320 60166 60963 gene locus_tag LOCUS_67330 60166 60963 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_67330 60973 61773 gene locus_tag LOCUS_67340 60973 61773 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087285.1 protein_id gnl|my_center|LOCUS_67340 62340 62065 gene locus_tag LOCUS_67350 62340 62065 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083527.1 protein_id gnl|my_center|LOCUS_67350 62421 64859 gene locus_tag LOCUS_67360 62421 64859 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 protein_id gnl|my_center|LOCUS_67360 65711 65100 gene locus_tag LOCUS_67370 65711 65100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_67370 66716 65730 gene locus_tag LOCUS_67380 66716 65730 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313874.1 protein_id gnl|my_center|LOCUS_67380 67608 66727 gene locus_tag LOCUS_67390 67608 66727 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067080.1 protein_id gnl|my_center|LOCUS_67390 68641 67928 gene locus_tag LOCUS_67400 68641 67928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_67400 69425 68634 gene locus_tag LOCUS_67410 69425 68634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528529.1 protein_id gnl|my_center|LOCUS_67410 70664 69507 gene locus_tag LOCUS_67420 70664 69507 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 protein_id gnl|my_center|LOCUS_67420 71437 70667 gene locus_tag LOCUS_67430 71437 70667 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919681.1 protein_id gnl|my_center|LOCUS_67430 72586 71453 gene locus_tag LOCUS_67440 72586 71453 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895534.1 protein_id gnl|my_center|LOCUS_67440 74323 72656 gene locus_tag LOCUS_67450 74323 72656 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919679.1 protein_id gnl|my_center|LOCUS_67450 74518 75702 gene locus_tag LOCUS_67460 74518 75702 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083007.1 protein_id gnl|my_center|LOCUS_67460 >Feature sequence33 250 489 gene locus_tag LOCUS_67470 250 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 537 1619 gene locus_tag LOCUS_67480 537 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67480 2275 1955 gene locus_tag LOCUS_67490 2275 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67490 2586 2404 gene locus_tag LOCUS_67500 2586 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 3154 4068 gene locus_tag LOCUS_67510 3154 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 4078 5247 gene locus_tag LOCUS_67520 4078 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 5256 5447 gene locus_tag LOCUS_67530 5256 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 5686 7329 gene locus_tag LOCUS_67540 5686 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 7329 7787 gene locus_tag LOCUS_67550 7329 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 7851 8675 gene locus_tag LOCUS_67560 7851 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 8672 9220 gene locus_tag LOCUS_67570 8672 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 9226 9504 gene locus_tag LOCUS_67580 9226 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 9798 9724 gene locus_tag LOCUS_t00490 9798 9724 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10909 9896 gene locus_tag LOCUS_67590 10909 9896 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_67590 12291 10960 gene locus_tag LOCUS_67600 12291 10960 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975165.1 protein_id gnl|my_center|LOCUS_67600 13202 12288 gene locus_tag LOCUS_67610 13202 12288 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969490.1 protein_id gnl|my_center|LOCUS_67610 14236 13259 gene locus_tag LOCUS_67620 14236 13259 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 protein_id gnl|my_center|LOCUS_67620 15201 14251 gene locus_tag LOCUS_67630 gene dapA 15201 14251 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_67630 15413 16804 gene locus_tag LOCUS_67640 15413 16804 CDS product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086569.1 protein_id gnl|my_center|LOCUS_67640 16833 17147 gene locus_tag LOCUS_67650 16833 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67650 17242 18858 gene locus_tag LOCUS_67660 17242 18858 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083178.1 protein_id gnl|my_center|LOCUS_67660 18873 19100 gene locus_tag LOCUS_67670 18873 19100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 19290 22115 gene locus_tag LOCUS_67680 19290 22115 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 protein_id gnl|my_center|LOCUS_67680 22112 22654 gene locus_tag LOCUS_67690 22112 22654 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 protein_id gnl|my_center|LOCUS_67690 22668 23963 gene locus_tag LOCUS_67700 22668 23963 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266474.1 protein_id gnl|my_center|LOCUS_67700 24409 23972 gene locus_tag LOCUS_67710 24409 23972 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 protein_id gnl|my_center|LOCUS_67710 24504 25403 gene locus_tag LOCUS_67720 24504 25403 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967943.1 protein_id gnl|my_center|LOCUS_67720 25518 27017 gene locus_tag LOCUS_67730 25518 27017 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_67730 27789 27139 gene locus_tag LOCUS_67740 27789 27139 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_67740 28146 28544 gene locus_tag LOCUS_67750 28146 28544 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 protein_id gnl|my_center|LOCUS_67750 29641 28574 gene locus_tag LOCUS_67760 29641 28574 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085280.1 protein_id gnl|my_center|LOCUS_67760 30221 29661 gene locus_tag LOCUS_67770 30221 29661 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_67770 31450 30704 gene locus_tag LOCUS_67780 31450 30704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 33426 31447 gene locus_tag LOCUS_67790 33426 31447 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086576.1 protein_id gnl|my_center|LOCUS_67790 33677 34288 gene locus_tag LOCUS_67800 33677 34288 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170865.1 protein_id gnl|my_center|LOCUS_67800 35940 34333 gene locus_tag LOCUS_67810 gene cimA 35940 34333 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 protein_id gnl|my_center|LOCUS_67810 37444 36065 gene locus_tag LOCUS_67820 gene cysS 37444 36065 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086571.1 protein_id gnl|my_center|LOCUS_67820 38216 37683 gene locus_tag LOCUS_67830 38216 37683 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086924.1 protein_id gnl|my_center|LOCUS_67830 39430 38351 gene locus_tag LOCUS_67840 39430 38351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085638.1 protein_id gnl|my_center|LOCUS_67840 39693 41942 gene locus_tag LOCUS_67850 gene parC 39693 41942 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532278.1 protein_id gnl|my_center|LOCUS_67850 41996 43030 gene locus_tag LOCUS_67860 41996 43030 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_67860 44130 43318 gene locus_tag LOCUS_67870 44130 43318 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 protein_id gnl|my_center|LOCUS_67870 44295 44558 gene locus_tag LOCUS_67880 44295 44558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 44673 44918 gene locus_tag LOCUS_67890 44673 44918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 46145 44919 gene locus_tag LOCUS_67900 46145 44919 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_67900 47380 46142 gene locus_tag LOCUS_67910 47380 46142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67910 48773 47724 gene locus_tag LOCUS_67920 gene hemB 48773 47724 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_67920 49098 49292 gene locus_tag LOCUS_67930 49098 49292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67930 49388 50527 gene locus_tag LOCUS_67940 49388 50527 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_67940 50541 51656 gene locus_tag LOCUS_67950 50541 51656 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_67950 51653 52123 gene locus_tag LOCUS_67960 51653 52123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 52183 53070 gene locus_tag LOCUS_67970 gene mmsB 52183 53070 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 protein_id gnl|my_center|LOCUS_67970 53814 53209 gene locus_tag LOCUS_67980 53814 53209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 54501 55031 gene locus_tag LOCUS_67990 54501 55031 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_67990 55047 55181 gene locus_tag LOCUS_68000 55047 55181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 55607 55305 gene locus_tag LOCUS_68010 55607 55305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 56178 57428 gene locus_tag LOCUS_68020 56178 57428 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240833.1 protein_id gnl|my_center|LOCUS_68020 57481 57729 gene locus_tag LOCUS_68030 57481 57729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 59058 57811 gene locus_tag LOCUS_68040 59058 57811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 59837 59058 gene locus_tag LOCUS_68050 59837 59058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 60198 61505 gene locus_tag LOCUS_68060 60198 61505 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975013.1 protein_id gnl|my_center|LOCUS_68060 61521 62003 gene locus_tag LOCUS_68070 gene nrdR 61521 62003 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 protein_id gnl|my_center|LOCUS_68070 62051 63139 gene locus_tag LOCUS_68080 gene ribD 62051 63139 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087792.1 protein_id gnl|my_center|LOCUS_68080 63151 63765 gene locus_tag LOCUS_68090 63151 63765 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532248.1 protein_id gnl|my_center|LOCUS_68090 63793 64278 gene locus_tag LOCUS_68100 gene ribH 63793 64278 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087790.1 protein_id gnl|my_center|LOCUS_68100 64278 64760 gene locus_tag LOCUS_68110 gene nusB 64278 64760 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087789.1 protein_id gnl|my_center|LOCUS_68110 64907 65902 gene locus_tag LOCUS_68120 gene thiL 64907 65902 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_68120 >Feature sequence34 7757 8458 gene locus_tag LOCUS_68130 gene lexA 7757 8458 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 protein_id gnl|my_center|LOCUS_68130 10732 8465 gene locus_tag LOCUS_68140 10732 8465 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921625.1 protein_id gnl|my_center|LOCUS_68140 10886 12304 gene locus_tag LOCUS_68150 gene gltX 10886 12304 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087606.1 protein_id gnl|my_center|LOCUS_68150 12494 13792 gene locus_tag LOCUS_68160 gene gltA 12494 13792 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969265.1 protein_id gnl|my_center|LOCUS_68160 15372 14182 gene locus_tag LOCUS_68170 gene lpxB 15372 14182 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087615.1 protein_id gnl|my_center|LOCUS_68170 16304 15369 gene locus_tag LOCUS_68180 gene lpxI 16304 15369 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967850.1 protein_id gnl|my_center|LOCUS_68180 17173 16337 gene locus_tag LOCUS_68190 gene lpxA 17173 16337 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087617.1 protein_id gnl|my_center|LOCUS_68190 17637 17182 gene locus_tag LOCUS_68200 gene fabZ 17637 17182 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975310.1 protein_id gnl|my_center|LOCUS_68200 18706 17666 gene locus_tag LOCUS_68210 gene lpxD 18706 17666 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 protein_id gnl|my_center|LOCUS_68210 21285 18757 gene locus_tag LOCUS_68220 gene bamA 21285 18757 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966217.1 protein_id gnl|my_center|LOCUS_68220 22682 21516 gene locus_tag LOCUS_68230 gene rseP 22682 21516 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_68230 23908 22760 gene locus_tag LOCUS_68240 gene dxr 23908 22760 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087623.1 protein_id gnl|my_center|LOCUS_68240 24765 23917 gene locus_tag LOCUS_68250 24765 23917 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027545781.1 protein_id gnl|my_center|LOCUS_68250 25546 24770 gene locus_tag LOCUS_68260 25546 24770 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 protein_id gnl|my_center|LOCUS_68260 26136 25570 gene locus_tag LOCUS_68270 gene frr 26136 25570 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171750.1 protein_id gnl|my_center|LOCUS_68270 26907 26191 gene locus_tag LOCUS_68280 gene pyrH 26907 26191 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027545778.1 protein_id gnl|my_center|LOCUS_68280 28288 27365 gene locus_tag LOCUS_68290 gene tsf 28288 27365 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087628.1 protein_id gnl|my_center|LOCUS_68290 29423 28428 gene locus_tag LOCUS_68300 29423 28428 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087629.1 protein_id gnl|my_center|LOCUS_68300 30287 29619 gene locus_tag LOCUS_68310 30287 29619 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 protein_id gnl|my_center|LOCUS_68310 30413 30952 gene locus_tag LOCUS_68320 30413 30952 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_68320 31715 31173 gene locus_tag LOCUS_68330 31715 31173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 34752 31708 gene locus_tag LOCUS_68340 34752 31708 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930970.1 protein_id gnl|my_center|LOCUS_68340 35012 34749 gene locus_tag LOCUS_68350 35012 34749 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 protein_id gnl|my_center|LOCUS_68350 36275 35022 gene locus_tag LOCUS_68360 36275 35022 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821029.1 protein_id gnl|my_center|LOCUS_68360 36489 37367 gene locus_tag LOCUS_68370 gene purU 36489 37367 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970785.1 protein_id gnl|my_center|LOCUS_68370 38438 37635 gene locus_tag LOCUS_68380 38438 37635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 39445 38585 gene locus_tag LOCUS_68390 39445 38585 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_68390 40370 39459 gene locus_tag LOCUS_68400 40370 39459 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064556.1 protein_id gnl|my_center|LOCUS_68400 41219 40398 gene locus_tag LOCUS_68410 41219 40398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172112.1 protein_id gnl|my_center|LOCUS_68410 42096 41227 gene locus_tag LOCUS_68420 42096 41227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086069.1 protein_id gnl|my_center|LOCUS_68420 43136 42108 gene locus_tag LOCUS_68430 43136 42108 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086070.1 protein_id gnl|my_center|LOCUS_68430 44263 43154 gene locus_tag LOCUS_68440 44263 43154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086071.1 protein_id gnl|my_center|LOCUS_68440 44458 45855 gene locus_tag LOCUS_68450 44458 45855 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086065.1 protein_id gnl|my_center|LOCUS_68450 46154 47212 gene locus_tag LOCUS_68460 46154 47212 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086411.1 protein_id gnl|my_center|LOCUS_68460 47470 48546 gene locus_tag LOCUS_68470 47470 48546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_68470 48543 49379 gene locus_tag LOCUS_68480 48543 49379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525217.1 protein_id gnl|my_center|LOCUS_68480 49376 50176 gene locus_tag LOCUS_68490 49376 50176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025576071.1 protein_id gnl|my_center|LOCUS_68490 50465 51427 gene locus_tag LOCUS_68500 50465 51427 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038953.1 protein_id gnl|my_center|LOCUS_68500 51430 52341 gene locus_tag LOCUS_68510 gene puuE 51430 52341 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897147.1 protein_id gnl|my_center|LOCUS_68510 52344 52991 gene locus_tag LOCUS_68520 52344 52991 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090029.1 protein_id gnl|my_center|LOCUS_68520 54255 53335 gene locus_tag LOCUS_68530 54255 53335 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089943.1 protein_id gnl|my_center|LOCUS_68530 54423 55379 gene locus_tag LOCUS_68540 54423 55379 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089942.1 protein_id gnl|my_center|LOCUS_68540 55436 56266 gene locus_tag LOCUS_68550 55436 56266 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089941.1 protein_id gnl|my_center|LOCUS_68550 56263 57138 gene locus_tag LOCUS_68560 56263 57138 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172971.1 protein_id gnl|my_center|LOCUS_68560 57141 57908 gene locus_tag LOCUS_68570 57141 57908 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089939.1 protein_id gnl|my_center|LOCUS_68570 57939 58760 gene locus_tag LOCUS_68580 57939 58760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965486.1 protein_id gnl|my_center|LOCUS_68580 58846 59628 gene locus_tag LOCUS_68590 58846 59628 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089937.1 protein_id gnl|my_center|LOCUS_68590 >Feature sequence35 <1 1828 gene locus_tag LOCUS_68600 <1 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148161.1:two-partner secretion system adhesin CdrA 1864 3624 gene locus_tag LOCUS_68610 1864 3624 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067718.1 protein_id gnl|my_center|LOCUS_68610 3685 4293 gene locus_tag LOCUS_68620 3685 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68620 5624 4401 gene locus_tag LOCUS_68630 5624 4401 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_68630 6111 5626 gene locus_tag LOCUS_68640 gene moaC 6111 5626 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087579.1 protein_id gnl|my_center|LOCUS_68640 6850 6158 gene locus_tag LOCUS_68650 6850 6158 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 protein_id gnl|my_center|LOCUS_68650 8150 6957 gene locus_tag LOCUS_68660 8150 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 8458 8739 gene locus_tag LOCUS_68670 8458 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68670 10451 8832 gene locus_tag LOCUS_68680 10451 8832 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087362.1 protein_id gnl|my_center|LOCUS_68680 12373 10499 gene locus_tag LOCUS_68690 12373 10499 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967416.1 protein_id gnl|my_center|LOCUS_68690 12577 13392 gene locus_tag LOCUS_68700 12577 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 13648 14691 gene locus_tag LOCUS_68710 13648 14691 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256084.1 protein_id gnl|my_center|LOCUS_68710 14957 15289 gene locus_tag LOCUS_68720 gene hspQ 14957 15289 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161605.1 protein_id gnl|my_center|LOCUS_68720 15563 16558 gene locus_tag LOCUS_68730 15563 16558 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 protein_id gnl|my_center|LOCUS_68730 17815 16562 gene locus_tag LOCUS_68740 17815 16562 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087357.1 protein_id gnl|my_center|LOCUS_68740 17974 18687 gene locus_tag LOCUS_68750 17974 18687 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173978.1 protein_id gnl|my_center|LOCUS_68750 19359 20114 gene locus_tag LOCUS_68760 19359 20114 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971207.1 protein_id gnl|my_center|LOCUS_68760 20363 20719 gene locus_tag LOCUS_68770 gene uraH 20363 20719 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850504.1 protein_id gnl|my_center|LOCUS_68770 20716 22203 gene locus_tag LOCUS_68780 gene xdhA 20716 22203 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255385.1 protein_id gnl|my_center|LOCUS_68780 22193 24532 gene locus_tag LOCUS_68790 gene xdhB 22193 24532 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_68790 24537 25508 gene locus_tag LOCUS_68800 gene xdhC 24537 25508 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920471.1 protein_id gnl|my_center|LOCUS_68800 25544 26734 gene locus_tag LOCUS_68810 25544 26734 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528235.1 protein_id gnl|my_center|LOCUS_68810 26734 28005 gene locus_tag LOCUS_68820 26734 28005 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_68820 28273 29232 gene locus_tag LOCUS_68830 gene lipA 28273 29232 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531487.1 protein_id gnl|my_center|LOCUS_68830 29247 29774 gene locus_tag LOCUS_68840 29247 29774 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383204.1 protein_id gnl|my_center|LOCUS_68840 29779 30246 gene locus_tag LOCUS_68850 29779 30246 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087250.1 protein_id gnl|my_center|LOCUS_68850 30758 30264 gene locus_tag LOCUS_68860 30758 30264 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087256.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68860 32336 31143 gene locus_tag LOCUS_68870 32336 31143 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_68870 32594 33562 gene locus_tag LOCUS_68880 gene dusB 32594 33562 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161537076.1 protein_id gnl|my_center|LOCUS_68880 33559 34707 gene locus_tag LOCUS_68890 33559 34707 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_68890 34720 36162 gene locus_tag LOCUS_68900 gene ntrC 34720 36162 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 protein_id gnl|my_center|LOCUS_68900 36538 38784 gene locus_tag LOCUS_68910 36538 38784 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_68910 38805 40172 gene locus_tag LOCUS_68920 38805 40172 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_68920 40413 41270 gene locus_tag LOCUS_68930 40413 41270 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_68930 41436 41687 gene locus_tag LOCUS_68940 gene hfq 41436 41687 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007591126.1 protein_id gnl|my_center|LOCUS_68940 41709 43076 gene locus_tag LOCUS_68950 gene hflX 41709 43076 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244647.1 protein_id gnl|my_center|LOCUS_68950 43133 43603 gene locus_tag LOCUS_68960 43133 43603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68960 44833 43964 gene locus_tag LOCUS_68970 gene mazG 44833 43964 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 protein_id gnl|my_center|LOCUS_68970 45161 45538 gene locus_tag LOCUS_68980 45161 45538 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142140.1 protein_id gnl|my_center|LOCUS_68980 46266 45553 gene locus_tag LOCUS_68990 gene phoU 46266 45553 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974336.1 protein_id gnl|my_center|LOCUS_68990 47161 46343 gene locus_tag LOCUS_69000 gene pstB 47161 46343 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_69000 48013 47165 gene locus_tag LOCUS_69010 gene pstA 48013 47165 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521821.1 protein_id gnl|my_center|LOCUS_69010 49002 48022 gene locus_tag LOCUS_69020 gene pstC 49002 48022 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 protein_id gnl|my_center|LOCUS_69020 50155 49097 gene locus_tag LOCUS_69030 gene pstS 50155 49097 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_69030 51870 50575 gene locus_tag LOCUS_69040 51870 50575 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257157.1 protein_id gnl|my_center|LOCUS_69040 53226 51949 gene locus_tag LOCUS_69050 53226 51949 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310644.1 protein_id gnl|my_center|LOCUS_69050 54143 53292 gene locus_tag LOCUS_69060 54143 53292 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 protein_id gnl|my_center|LOCUS_69060 55083 54151 gene locus_tag LOCUS_69070 55083 54151 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 protein_id gnl|my_center|LOCUS_69070 56221 55076 gene locus_tag LOCUS_69080 56221 55076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 protein_id gnl|my_center|LOCUS_69080 >Feature sequence36 168 392 gene locus_tag LOCUS_69090 168 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69090 936 631 gene locus_tag LOCUS_69100 936 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 2100 1171 gene locus_tag LOCUS_69110 2100 1171 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_69110 2472 3038 gene locus_tag LOCUS_69120 2472 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69120 4371 3085 gene locus_tag LOCUS_69130 4371 3085 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170976.1 protein_id gnl|my_center|LOCUS_69130 4882 5448 gene locus_tag LOCUS_69140 4882 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69140 6024 5518 gene locus_tag LOCUS_69150 6024 5518 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086781.1 protein_id gnl|my_center|LOCUS_69150 6371 7600 gene locus_tag LOCUS_69160 6371 7600 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_69160 9540 7516 gene locus_tag LOCUS_69170 9540 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 10661 9597 gene locus_tag LOCUS_69180 10661 9597 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807287.1 protein_id gnl|my_center|LOCUS_69180 11724 10924 gene locus_tag LOCUS_69190 11724 10924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 protein_id gnl|my_center|LOCUS_69190 12578 11721 gene locus_tag LOCUS_69200 12578 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69200 13642 12581 gene locus_tag LOCUS_69210 13642 12581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_69210 14724 13663 gene locus_tag LOCUS_69220 14724 13663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968140.1 protein_id gnl|my_center|LOCUS_69220 16018 14813 gene locus_tag LOCUS_69230 gene iadA 16018 14813 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113054.1 protein_id gnl|my_center|LOCUS_69230 16656 16015 gene locus_tag LOCUS_69240 16656 16015 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479655.1 protein_id gnl|my_center|LOCUS_69240 18174 16660 gene locus_tag LOCUS_69250 gene argH 18174 16660 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_69250 19558 18188 gene locus_tag LOCUS_69260 19558 18188 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 protein_id gnl|my_center|LOCUS_69260 20451 19555 gene locus_tag LOCUS_69270 20451 19555 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975551.1 protein_id gnl|my_center|LOCUS_69270 20656 21651 gene locus_tag LOCUS_69280 gene hutG 20656 21651 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 protein_id gnl|my_center|LOCUS_69280 22055 21789 gene locus_tag LOCUS_69290 22055 21789 CDS product DUF6489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085662.1 protein_id gnl|my_center|LOCUS_69290 23453 22278 gene locus_tag LOCUS_69300 23453 22278 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085635.1 protein_id gnl|my_center|LOCUS_69300 23891 24808 gene locus_tag LOCUS_69310 23891 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 25084 26334 gene locus_tag LOCUS_69320 25084 26334 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 protein_id gnl|my_center|LOCUS_69320 26369 27256 gene locus_tag LOCUS_69330 26369 27256 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_69330 27253 28203 gene locus_tag LOCUS_69340 27253 28203 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_69340 28200 29564 gene locus_tag LOCUS_69350 28200 29564 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039264.1 protein_id gnl|my_center|LOCUS_69350 29561 30277 gene locus_tag LOCUS_69360 29561 30277 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390260.1 protein_id gnl|my_center|LOCUS_69360 30387 30722 gene locus_tag LOCUS_69370 30387 30722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 30875 31639 gene locus_tag LOCUS_69380 30875 31639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 31814 33697 gene locus_tag LOCUS_69390 31814 33697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 33727 34191 gene locus_tag LOCUS_69400 33727 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 36332 34251 gene locus_tag LOCUS_69410 36332 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 37808 36588 gene locus_tag LOCUS_69420 37808 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69420 38384 37917 gene locus_tag LOCUS_69430 38384 37917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69430 39216 38500 gene locus_tag LOCUS_69440 39216 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 43774 40307 gene locus_tag LOCUS_69450 43774 40307 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090318.1 protein_id gnl|my_center|LOCUS_69450 43942 44397 gene locus_tag LOCUS_69460 43942 44397 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090317.1 protein_id gnl|my_center|LOCUS_69460 45685 44711 gene locus_tag LOCUS_69470 45685 44711 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 protein_id gnl|my_center|LOCUS_69470 46560 45682 gene locus_tag LOCUS_69480 46560 45682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083243.1 protein_id gnl|my_center|LOCUS_69480 47396 46563 gene locus_tag LOCUS_69490 47396 46563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083244.1 protein_id gnl|my_center|LOCUS_69490 48498 47398 gene locus_tag LOCUS_69500 48498 47398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 49789 48569 gene locus_tag LOCUS_69510 49789 48569 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_69510 50760 49786 gene locus_tag LOCUS_69520 50760 49786 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089104.1 protein_id gnl|my_center|LOCUS_69520 51209 51523 gene locus_tag LOCUS_69530 51209 51523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 51523 52506 gene locus_tag LOCUS_69540 51523 52506 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_69540 52643 53656 gene locus_tag LOCUS_69550 52643 53656 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_69550 53653 54477 gene locus_tag LOCUS_69560 53653 54477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 protein_id gnl|my_center|LOCUS_69560 54470 55231 gene locus_tag LOCUS_69570 54470 55231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_69570 55257 56231 gene locus_tag LOCUS_69580 55257 56231 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_69580 >Feature sequence37 920 204 gene locus_tag LOCUS_69590 920 204 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085965.1 protein_id gnl|my_center|LOCUS_69590 2223 1018 gene locus_tag LOCUS_69600 2223 1018 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090589.1 protein_id gnl|my_center|LOCUS_69600 2425 4029 gene locus_tag LOCUS_69610 2425 4029 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_69610 4026 4829 gene locus_tag LOCUS_69620 4026 4829 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730661.1 protein_id gnl|my_center|LOCUS_69620 4826 5599 gene locus_tag LOCUS_69630 4826 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69630 6576 5800 gene locus_tag LOCUS_69640 6576 5800 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919678.1 protein_id gnl|my_center|LOCUS_69640 6746 8059 gene locus_tag LOCUS_69650 6746 8059 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_69650 8091 8825 gene locus_tag LOCUS_69660 8091 8825 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640338.1 protein_id gnl|my_center|LOCUS_69660 8907 10148 gene locus_tag LOCUS_69670 8907 10148 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086231.1 protein_id gnl|my_center|LOCUS_69670 10408 11280 gene locus_tag LOCUS_69680 10408 11280 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919672.1 protein_id gnl|my_center|LOCUS_69680 11297 13432 gene locus_tag LOCUS_69690 11297 13432 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921515.1 protein_id gnl|my_center|LOCUS_69690 13429 13968 gene locus_tag LOCUS_69700 13429 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 14030 15610 gene locus_tag LOCUS_69710 14030 15610 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533498.1 protein_id gnl|my_center|LOCUS_69710 15982 16632 gene locus_tag LOCUS_69720 15982 16632 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395908.1 protein_id gnl|my_center|LOCUS_69720 17525 16662 gene locus_tag LOCUS_69730 17525 16662 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530962.1 protein_id gnl|my_center|LOCUS_69730 17705 19342 gene locus_tag LOCUS_69740 17705 19342 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842967.1 protein_id gnl|my_center|LOCUS_69740 19462 20448 gene locus_tag LOCUS_69750 19462 20448 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 protein_id gnl|my_center|LOCUS_69750 20495 22168 gene locus_tag LOCUS_69760 20495 22168 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808140.1 protein_id gnl|my_center|LOCUS_69760 23028 22231 gene locus_tag LOCUS_69770 23028 22231 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970286.1 protein_id gnl|my_center|LOCUS_69770 23125 24090 gene locus_tag LOCUS_69780 23125 24090 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970287.1 protein_id gnl|my_center|LOCUS_69780 24552 24094 gene locus_tag LOCUS_69790 24552 24094 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329027.1 protein_id gnl|my_center|LOCUS_69790 24734 25960 gene locus_tag LOCUS_69800 24734 25960 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534205.1 protein_id gnl|my_center|LOCUS_69800 29113 26279 gene locus_tag LOCUS_69810 gene clpG 29113 26279 CDS product AAA family protein disaggregase ClpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895510.1 protein_id gnl|my_center|LOCUS_69810 30409 29306 gene locus_tag LOCUS_69820 30409 29306 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 protein_id gnl|my_center|LOCUS_69820 31526 30648 gene locus_tag LOCUS_69830 31526 30648 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808761.1 protein_id gnl|my_center|LOCUS_69830 31697 32971 gene locus_tag LOCUS_69840 gene phnA 31697 32971 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040446.1 protein_id gnl|my_center|LOCUS_69840 32968 34269 gene locus_tag LOCUS_69850 32968 34269 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808711.1 protein_id gnl|my_center|LOCUS_69850 34288 35820 gene locus_tag LOCUS_69860 34288 35820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665683.1 protein_id gnl|my_center|LOCUS_69860 35844 36737 gene locus_tag LOCUS_69870 35844 36737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808706.1 protein_id gnl|my_center|LOCUS_69870 36734 37642 gene locus_tag LOCUS_69880 36734 37642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040449.1 protein_id gnl|my_center|LOCUS_69880 37639 39255 gene locus_tag LOCUS_69890 37639 39255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064447.1 protein_id gnl|my_center|LOCUS_69890 40119 39283 gene locus_tag LOCUS_69900 40119 39283 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_69900 40379 41164 gene locus_tag LOCUS_69910 40379 41164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 41295 42593 gene locus_tag LOCUS_69920 41295 42593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 protein_id gnl|my_center|LOCUS_69920 42741 43688 gene locus_tag LOCUS_69930 gene pcaD 42741 43688 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_69930 43731 45380 gene locus_tag LOCUS_69940 43731 45380 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_69940 45423 46826 gene locus_tag LOCUS_69950 gene iaaH 45423 46826 CDS product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921522.1 protein_id gnl|my_center|LOCUS_69950 46933 47715 gene locus_tag LOCUS_69960 46933 47715 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_69960 48254 48934 gene locus_tag LOCUS_69970 48254 48934 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 protein_id gnl|my_center|LOCUS_69970 49183 50355 gene locus_tag LOCUS_69980 49183 50355 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900009.1 protein_id gnl|my_center|LOCUS_69980 >Feature sequence38 332 1264 gene locus_tag LOCUS_69990 332 1264 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633599.1 protein_id gnl|my_center|LOCUS_69990 1820 1512 gene locus_tag LOCUS_70000 1820 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 2654 1920 gene locus_tag LOCUS_70010 2654 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70010 2899 2651 gene locus_tag LOCUS_70020 2899 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 3099 3308 gene locus_tag LOCUS_70030 3099 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 3298 3693 gene locus_tag LOCUS_70040 3298 3693 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159854.1 protein_id gnl|my_center|LOCUS_70040 3693 4385 gene locus_tag LOCUS_70050 3693 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70050 5302 6504 gene locus_tag LOCUS_70060 gene repA 5302 6504 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974972.1 protein_id gnl|my_center|LOCUS_70060 6507 7523 gene locus_tag LOCUS_70070 gene repB 6507 7523 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969719.1 protein_id gnl|my_center|LOCUS_70070 7735 8949 gene locus_tag LOCUS_70080 gene repC 7735 8949 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974840.1 protein_id gnl|my_center|LOCUS_70080 9687 10169 gene locus_tag LOCUS_70090 9687 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70090 12314 10458 gene locus_tag LOCUS_70100 12314 10458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_70100 13195 12317 gene locus_tag LOCUS_70110 13195 12317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851055.1 protein_id gnl|my_center|LOCUS_70110 14141 13185 gene locus_tag LOCUS_70120 14141 13185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812302.1 protein_id gnl|my_center|LOCUS_70120 15678 14158 gene locus_tag LOCUS_70130 15678 14158 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812304.1 protein_id gnl|my_center|LOCUS_70130 16377 15706 gene locus_tag LOCUS_70140 16377 15706 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064837.1 protein_id gnl|my_center|LOCUS_70140 17612 16374 gene locus_tag LOCUS_70150 17612 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70150 18898 17639 gene locus_tag LOCUS_70160 18898 17639 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 protein_id gnl|my_center|LOCUS_70160 20555 19083 gene locus_tag LOCUS_70170 gene hydA 20555 19083 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086117.1 protein_id gnl|my_center|LOCUS_70170 21308 20682 gene locus_tag LOCUS_70180 21308 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 22723 21341 gene locus_tag LOCUS_70190 22723 21341 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 protein_id gnl|my_center|LOCUS_70190 23993 22713 gene locus_tag LOCUS_70200 23993 22713 CDS product hydantoinase/carbamoylase family amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075381701.1 protein_id gnl|my_center|LOCUS_70200 24976 24026 gene locus_tag LOCUS_70210 24976 24026 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_70210 26277 25003 gene locus_tag LOCUS_70220 26277 25003 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_70220 26194 26493 gene locus_tag LOCUS_70230 26194 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 27169 28005 gene locus_tag LOCUS_70240 27169 28005 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975549.1 protein_id gnl|my_center|LOCUS_70240 28014 28811 gene locus_tag LOCUS_70250 28014 28811 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061894.1 protein_id gnl|my_center|LOCUS_70250 28891 29691 gene locus_tag LOCUS_70260 28891 29691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975551.1 protein_id gnl|my_center|LOCUS_70260 29889 30761 gene locus_tag LOCUS_70270 29889 30761 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089937.1 protein_id gnl|my_center|LOCUS_70270 30808 32238 gene locus_tag LOCUS_70280 30808 32238 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 protein_id gnl|my_center|LOCUS_70280 33260 32361 gene locus_tag LOCUS_70290 33260 32361 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089943.1 protein_id gnl|my_center|LOCUS_70290 34232 33300 gene locus_tag LOCUS_70300 34232 33300 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815231.1 protein_id gnl|my_center|LOCUS_70300 34378 35388 gene locus_tag LOCUS_70310 34378 35388 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_70310 36276 35614 gene locus_tag LOCUS_70320 36276 35614 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966008.1 protein_id gnl|my_center|LOCUS_70320 37178 36342 gene locus_tag LOCUS_70330 37178 36342 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086114.1 protein_id gnl|my_center|LOCUS_70330 38621 37335 gene locus_tag LOCUS_70340 38621 37335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 40088 38784 gene locus_tag LOCUS_70350 40088 38784 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084785.1 protein_id gnl|my_center|LOCUS_70350 40342 40088 gene locus_tag LOCUS_70360 40342 40088 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626379.1 protein_id gnl|my_center|LOCUS_70360 41157 40888 gene locus_tag LOCUS_70370 41157 40888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70370 41568 41389 gene locus_tag LOCUS_70380 41568 41389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70380 42189 42476 gene locus_tag LOCUS_70390 42189 42476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 42786 42481 gene locus_tag LOCUS_70400 42786 42481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 42934 43173 gene locus_tag LOCUS_70410 42934 43173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 43255 45282 gene locus_tag LOCUS_70420 43255 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 45448 45888 gene locus_tag LOCUS_70430 45448 45888 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163163084.1 protein_id gnl|my_center|LOCUS_70430 45885 46127 gene locus_tag LOCUS_70440 45885 46127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 46469 46777 gene locus_tag LOCUS_70450 46469 46777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70450 48332 47001 gene locus_tag LOCUS_70460 48332 47001 CDS product IS701-like element ISBj9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 protein_id gnl|my_center|LOCUS_70460 48418 48927 gene locus_tag LOCUS_70470 48418 48927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 >Feature sequence39 196 2880 gene locus_tag LOCUS_70480 196 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70480 3801 3283 gene locus_tag LOCUS_70490 3801 3283 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845091.1 protein_id gnl|my_center|LOCUS_70490 4303 4007 gene locus_tag LOCUS_70500 4303 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 6376 5387 gene locus_tag LOCUS_70510 6376 5387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090640.1 protein_id gnl|my_center|LOCUS_70510 7396 6389 gene locus_tag LOCUS_70520 7396 6389 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966121.1 protein_id gnl|my_center|LOCUS_70520 8295 7393 gene locus_tag LOCUS_70530 8295 7393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 protein_id gnl|my_center|LOCUS_70530 9253 8300 gene locus_tag LOCUS_70540 9253 8300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 protein_id gnl|my_center|LOCUS_70540 11026 9368 gene locus_tag LOCUS_70550 11026 9368 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 protein_id gnl|my_center|LOCUS_70550 11541 12056 gene locus_tag LOCUS_70560 11541 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875932.1 protein_id gnl|my_center|LOCUS_70560 14688 12160 gene locus_tag LOCUS_70570 14688 12160 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974842.1 protein_id gnl|my_center|LOCUS_70570 15197 15021 gene locus_tag LOCUS_70580 15197 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 15625 15416 gene locus_tag LOCUS_70590 15625 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70590 15509 16303 gene locus_tag LOCUS_70600 gene dapF 15509 16303 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538114.1 protein_id gnl|my_center|LOCUS_70600 16569 16946 gene locus_tag LOCUS_70610 16569 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 17376 17104 gene locus_tag LOCUS_70620 17376 17104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 17260 17466 gene locus_tag LOCUS_70630 17260 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70630 17841 20585 gene locus_tag LOCUS_70640 gene bapA 17841 20585 CDS product autotransporter BapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930805.1 protein_id gnl|my_center|LOCUS_70640 21623 20724 gene locus_tag LOCUS_70650 21623 20724 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973782.1 protein_id gnl|my_center|LOCUS_70650 21764 22537 gene locus_tag LOCUS_70660 21764 22537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193030.1 protein_id gnl|my_center|LOCUS_70660 22648 22914 gene locus_tag LOCUS_70670 22648 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101434.1 protein_id gnl|my_center|LOCUS_70670 22925 24127 gene locus_tag LOCUS_70680 22925 24127 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 protein_id gnl|my_center|LOCUS_70680 24105 24728 gene locus_tag LOCUS_70690 24105 24728 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531871.1 protein_id gnl|my_center|LOCUS_70690 24856 26103 gene locus_tag LOCUS_70700 24856 26103 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240324.1 protein_id gnl|my_center|LOCUS_70700 26638 26246 gene locus_tag LOCUS_70710 26638 26246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70710 27450 26797 gene locus_tag LOCUS_70720 27450 26797 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327529.1 protein_id gnl|my_center|LOCUS_70720 29445 27622 gene locus_tag LOCUS_70730 29445 27622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 29987 30688 gene locus_tag LOCUS_70740 29987 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 31556 30807 gene locus_tag LOCUS_70750 31556 30807 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 protein_id gnl|my_center|LOCUS_70750 31929 32612 gene locus_tag LOCUS_70760 31929 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061377.1 protein_id gnl|my_center|LOCUS_70760 33820 32624 gene locus_tag LOCUS_70770 33820 32624 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970063.1 protein_id gnl|my_center|LOCUS_70770 34094 35707 gene locus_tag LOCUS_70780 34094 35707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70780 35710 36765 gene locus_tag LOCUS_70790 35710 36765 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809375.1 protein_id gnl|my_center|LOCUS_70790 38701 37148 gene locus_tag LOCUS_70800 38701 37148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70800 38865 39569 gene locus_tag LOCUS_70810 38865 39569 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228255.1 protein_id gnl|my_center|LOCUS_70810 39850 39653 gene locus_tag LOCUS_70820 39850 39653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 40663 39914 gene locus_tag LOCUS_70830 40663 39914 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530732.1 protein_id gnl|my_center|LOCUS_70830 41311 40862 gene locus_tag LOCUS_70840 41311 40862 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530741.1 protein_id gnl|my_center|LOCUS_70840 42428 41454 gene locus_tag LOCUS_70850 42428 41454 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087121.1 protein_id gnl|my_center|LOCUS_70850 43537 42584 gene locus_tag LOCUS_70860 43537 42584 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 protein_id gnl|my_center|LOCUS_70860 43606 44826 gene locus_tag LOCUS_70870 43606 44826 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976318.1 protein_id gnl|my_center|LOCUS_70870 >Feature sequence40 1948 1037 gene locus_tag LOCUS_70880 1948 1037 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807710.1 protein_id gnl|my_center|LOCUS_70880 2100 3026 gene locus_tag LOCUS_70890 2100 3026 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807706.1 protein_id gnl|my_center|LOCUS_70890 3173 4762 gene locus_tag LOCUS_70900 3173 4762 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807708.1 protein_id gnl|my_center|LOCUS_70900 4759 5781 gene locus_tag LOCUS_70910 4759 5781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_70910 5798 6634 gene locus_tag LOCUS_70920 5798 6634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_70920 6634 8292 gene locus_tag LOCUS_70930 6634 8292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965309.1 protein_id gnl|my_center|LOCUS_70930 8322 9296 gene locus_tag LOCUS_70940 8322 9296 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038808.1 protein_id gnl|my_center|LOCUS_70940 9304 9933 gene locus_tag LOCUS_70950 9304 9933 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807705.1 protein_id gnl|my_center|LOCUS_70950 10313 10071 gene locus_tag LOCUS_70960 10313 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70960 11259 11011 gene locus_tag LOCUS_70970 11259 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 11598 11362 gene locus_tag LOCUS_70980 11598 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 12246 12022 gene locus_tag LOCUS_70990 12246 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 12557 12333 gene locus_tag LOCUS_71000 12557 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 13413 12946 gene locus_tag LOCUS_71010 13413 12946 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_71010 13609 13436 gene locus_tag LOCUS_71020 13609 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71020 13574 13846 gene locus_tag LOCUS_71030 13574 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71030 13942 14823 gene locus_tag LOCUS_71040 gene czcD 13942 14823 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_71040 14948 15526 gene locus_tag LOCUS_71050 14948 15526 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529619.1 protein_id gnl|my_center|LOCUS_71050 15566 17110 gene locus_tag LOCUS_71060 15566 17110 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969972.1 protein_id gnl|my_center|LOCUS_71060 17415 18134 gene locus_tag LOCUS_71070 17415 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71070 18350 18877 gene locus_tag LOCUS_71080 18350 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 19761 19048 gene locus_tag LOCUS_71090 19761 19048 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 protein_id gnl|my_center|LOCUS_71090 21302 19866 gene locus_tag LOCUS_71100 21302 19866 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_71100 22104 21355 gene locus_tag LOCUS_71110 22104 21355 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_71110 23436 22150 gene locus_tag LOCUS_71120 23436 22150 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 protein_id gnl|my_center|LOCUS_71120 25106 23433 gene locus_tag LOCUS_71130 25106 23433 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089552.1 protein_id gnl|my_center|LOCUS_71130 26323 25103 gene locus_tag LOCUS_71140 26323 25103 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067365.1 protein_id gnl|my_center|LOCUS_71140 26724 26374 gene locus_tag LOCUS_71150 26724 26374 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808084.1 protein_id gnl|my_center|LOCUS_71150 27670 26753 gene locus_tag LOCUS_71160 27670 26753 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089553.1 protein_id gnl|my_center|LOCUS_71160 28008 28850 gene locus_tag LOCUS_71170 28008 28850 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089555.1 protein_id gnl|my_center|LOCUS_71170 28864 29529 gene locus_tag LOCUS_71180 28864 29529 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 protein_id gnl|my_center|LOCUS_71180 29526 30299 gene locus_tag LOCUS_71190 29526 30299 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063689905.1 protein_id gnl|my_center|LOCUS_71190 31654 30779 gene locus_tag LOCUS_71200 31654 30779 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085465.1 protein_id gnl|my_center|LOCUS_71200 31967 31680 gene locus_tag LOCUS_71210 31967 31680 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085458.1 protein_id gnl|my_center|LOCUS_71210 32722 31988 gene locus_tag LOCUS_71220 32722 31988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_71220 33446 32712 gene locus_tag LOCUS_71230 33446 32712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_71230 34420 33443 gene locus_tag LOCUS_71240 34420 33443 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_71240 35298 34417 gene locus_tag LOCUS_71250 35298 34417 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886926.1 protein_id gnl|my_center|LOCUS_71250 35728 35330 gene locus_tag LOCUS_71260 35728 35330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 37100 35859 gene locus_tag LOCUS_71270 37100 35859 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039280.1 protein_id gnl|my_center|LOCUS_71270 38123 37161 gene locus_tag LOCUS_71280 38123 37161 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827760.1 protein_id gnl|my_center|LOCUS_71280 39208 38222 gene locus_tag LOCUS_71290 39208 38222 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 protein_id gnl|my_center|LOCUS_71290 40155 39292 gene locus_tag LOCUS_71300 40155 39292 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827762.1 protein_id gnl|my_center|LOCUS_71300 40323 41069 gene locus_tag LOCUS_71310 40323 41069 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827764.1 protein_id gnl|my_center|LOCUS_71310 41187 41549 gene locus_tag LOCUS_71320 41187 41549 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226809.1 protein_id gnl|my_center|LOCUS_71320 >Feature sequence41 957 1136 gene locus_tag LOCUS_71330 957 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71330 1309 1596 gene locus_tag LOCUS_71340 1309 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 1586 2524 gene locus_tag LOCUS_71350 1586 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 2721 2521 gene locus_tag LOCUS_71360 2721 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 3076 2825 gene locus_tag LOCUS_71370 3076 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71370 3035 4504 gene locus_tag LOCUS_71380 3035 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71380 6219 4894 gene locus_tag LOCUS_71390 6219 4894 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 protein_id gnl|my_center|LOCUS_71390 7653 6712 gene locus_tag LOCUS_71400 7653 6712 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530419.1 protein_id gnl|my_center|LOCUS_71400 7804 8502 gene locus_tag LOCUS_71410 7804 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 8584 9570 gene locus_tag LOCUS_71420 8584 9570 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_71420 9581 10693 gene locus_tag LOCUS_71430 9581 10693 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456661.1 protein_id gnl|my_center|LOCUS_71430 10907 12253 gene locus_tag LOCUS_71440 10907 12253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113829.1 protein_id gnl|my_center|LOCUS_71440 13213 12425 gene locus_tag LOCUS_71450 13213 12425 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 protein_id gnl|my_center|LOCUS_71450 14433 13345 gene locus_tag LOCUS_71460 14433 13345 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385701.1 protein_id gnl|my_center|LOCUS_71460 16154 14430 gene locus_tag LOCUS_71470 16154 14430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537751.1 protein_id gnl|my_center|LOCUS_71470 16990 16133 gene locus_tag LOCUS_71480 16990 16133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538163.1 protein_id gnl|my_center|LOCUS_71480 17997 16987 gene locus_tag LOCUS_71490 17997 16987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705507.1 protein_id gnl|my_center|LOCUS_71490 19677 18037 gene locus_tag LOCUS_71500 19677 18037 CDS product TIGR04028 family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106753549.1 protein_id gnl|my_center|LOCUS_71500 20958 19744 gene locus_tag LOCUS_71510 20958 19744 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268537.1 protein_id gnl|my_center|LOCUS_71510 22051 20951 gene locus_tag LOCUS_71520 22051 20951 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268532.1 protein_id gnl|my_center|LOCUS_71520 23699 22848 gene locus_tag LOCUS_71530 23699 22848 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170158.1 protein_id gnl|my_center|LOCUS_71530 23927 23715 gene locus_tag LOCUS_71540 23927 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 25620 24052 gene locus_tag LOCUS_71550 25620 24052 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 protein_id gnl|my_center|LOCUS_71550 26291 27502 gene locus_tag LOCUS_71560 26291 27502 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 protein_id gnl|my_center|LOCUS_71560 27878 28834 gene locus_tag LOCUS_71570 27878 28834 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 protein_id gnl|my_center|LOCUS_71570 28911 30101 gene locus_tag LOCUS_71580 28911 30101 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382911.1 protein_id gnl|my_center|LOCUS_71580 30429 32168 gene locus_tag LOCUS_71590 30429 32168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 32397 32912 gene locus_tag LOCUS_71600 gene tsaA 32397 32912 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 protein_id gnl|my_center|LOCUS_71600 32909 33970 gene locus_tag LOCUS_71610 32909 33970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 34098 34397 gene locus_tag LOCUS_71620 34098 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 35068 34418 gene locus_tag LOCUS_71630 35068 34418 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463751.1 protein_id gnl|my_center|LOCUS_71630 35957 35271 gene locus_tag LOCUS_71640 35957 35271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 36581 36174 gene locus_tag LOCUS_71650 36581 36174 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_71650 37689 36730 gene locus_tag LOCUS_71660 37689 36730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 38862 37975 gene locus_tag LOCUS_71670 38862 37975 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174608.1 protein_id gnl|my_center|LOCUS_71670 40730 39120 gene locus_tag LOCUS_71680 gene aceB 40730 39120 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919633.1 protein_id gnl|my_center|LOCUS_71680 >Feature sequence42 322 1683 gene locus_tag LOCUS_71690 322 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 1769 3628 gene locus_tag LOCUS_71700 gene recQ 1769 3628 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969854.1 protein_id gnl|my_center|LOCUS_71700 4116 3889 gene locus_tag LOCUS_71710 4116 3889 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_71710 4417 4172 gene locus_tag LOCUS_71720 4417 4172 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433119.1 protein_id gnl|my_center|LOCUS_71720 5430 4588 gene locus_tag LOCUS_71730 5430 4588 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836266.1 protein_id gnl|my_center|LOCUS_71730 6008 5625 gene locus_tag LOCUS_71740 6008 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71740 6644 6243 gene locus_tag LOCUS_71750 6644 6243 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720981.1 protein_id gnl|my_center|LOCUS_71750 7393 6767 gene locus_tag LOCUS_71760 7393 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71760 7668 9215 gene locus_tag LOCUS_71770 7668 9215 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028169840.1 protein_id gnl|my_center|LOCUS_71770 10382 9444 gene locus_tag LOCUS_71780 10382 9444 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_71780 11226 10579 gene locus_tag LOCUS_71790 11226 10579 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526652.1 protein_id gnl|my_center|LOCUS_71790 11471 12427 gene locus_tag LOCUS_71800 11471 12427 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974453.1 protein_id gnl|my_center|LOCUS_71800 13229 12552 gene locus_tag LOCUS_71810 13229 12552 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971132.1 protein_id gnl|my_center|LOCUS_71810 13649 14221 gene locus_tag LOCUS_71820 13649 14221 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_71820 14258 15082 gene locus_tag LOCUS_71830 14258 15082 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620756.1 protein_id gnl|my_center|LOCUS_71830 15880 15224 gene locus_tag LOCUS_71840 15880 15224 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082920.1 protein_id gnl|my_center|LOCUS_71840 16028 16603 gene locus_tag LOCUS_71850 16028 16603 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087003.1 protein_id gnl|my_center|LOCUS_71850 16773 17747 gene locus_tag LOCUS_71860 16773 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71860 17744 19012 gene locus_tag LOCUS_71870 17744 19012 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_71870 19843 19394 gene locus_tag LOCUS_71880 gene rpiB 19843 19394 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_71880 20082 20324 gene locus_tag LOCUS_71890 20082 20324 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968496.1 protein_id gnl|my_center|LOCUS_71890 20324 20749 gene locus_tag LOCUS_71900 20324 20749 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_71900 21450 20935 gene locus_tag LOCUS_71910 21450 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71910 21503 21805 gene locus_tag LOCUS_71920 21503 21805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 22179 22643 gene locus_tag LOCUS_71930 22179 22643 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_71930 22656 23162 gene locus_tag LOCUS_71940 22656 23162 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_71940 23175 23705 gene locus_tag LOCUS_71950 23175 23705 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_71950 23875 25032 gene locus_tag LOCUS_71960 23875 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528767.1 protein_id gnl|my_center|LOCUS_71960 25045 25587 gene locus_tag LOCUS_71970 25045 25587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173398.1 protein_id gnl|my_center|LOCUS_71970 25841 25566 gene locus_tag LOCUS_71980 25841 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528769.1 protein_id gnl|my_center|LOCUS_71980 26722 26219 gene locus_tag LOCUS_71990 26722 26219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 27080 27385 gene locus_tag LOCUS_72000 27080 27385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 27624 28463 gene locus_tag LOCUS_72010 27624 28463 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 protein_id gnl|my_center|LOCUS_72010 29188 28643 gene locus_tag LOCUS_72020 29188 28643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 31075 29267 gene locus_tag LOCUS_72030 31075 29267 CDS product response regulator receiver domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530590.1 protein_id gnl|my_center|LOCUS_72030 34043 31068 gene locus_tag LOCUS_72040 34043 31068 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530591.1 protein_id gnl|my_center|LOCUS_72040 34771 34040 gene locus_tag LOCUS_72050 34771 34040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72050 34655 34954 gene locus_tag LOCUS_72060 34655 34954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72060 35476 35916 gene locus_tag LOCUS_72070 35476 35916 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_72070 36221 36051 gene locus_tag LOCUS_72080 36221 36051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72080 36386 36267 gene locus_tag LOCUS_72090 36386 36267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72090 38086 36536 gene locus_tag LOCUS_72100 gene guaA 38086 36536 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968497.1 protein_id gnl|my_center|LOCUS_72100 38652 38161 gene locus_tag LOCUS_72110 38652 38161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72110 >Feature sequence43 <1 3239 gene locus_tag LOCUS_72120 <1 3239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967015.1:autotransporter outer membrane beta-barrel domain-containing protein <1 277 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcggcggcggcggcggcgg 4090 3293 gene locus_tag LOCUS_72130 4090 3293 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 protein_id gnl|my_center|LOCUS_72130 4878 4093 gene locus_tag LOCUS_72140 4878 4093 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727772.1 protein_id gnl|my_center|LOCUS_72140 5749 4880 gene locus_tag LOCUS_72150 5749 4880 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893017.1 protein_id gnl|my_center|LOCUS_72150 6708 5911 gene locus_tag LOCUS_72160 6708 5911 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530269.1 protein_id gnl|my_center|LOCUS_72160 6840 7700 gene locus_tag LOCUS_72170 6840 7700 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530268.1 protein_id gnl|my_center|LOCUS_72170 7740 8540 gene locus_tag LOCUS_72180 7740 8540 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530267.1 protein_id gnl|my_center|LOCUS_72180 8599 10107 gene locus_tag LOCUS_72190 8599 10107 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530266.1 protein_id gnl|my_center|LOCUS_72190 10104 10742 gene locus_tag LOCUS_72200 10104 10742 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530265.1 protein_id gnl|my_center|LOCUS_72200 12771 10768 gene locus_tag LOCUS_72210 12771 10768 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974731.1 protein_id gnl|my_center|LOCUS_72210 14492 12768 gene locus_tag LOCUS_72220 14492 12768 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970431.1 protein_id gnl|my_center|LOCUS_72220 14679 15641 gene locus_tag LOCUS_72230 14679 15641 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258670.1 protein_id gnl|my_center|LOCUS_72230 16557 15670 gene locus_tag LOCUS_72240 16557 15670 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338243.1 protein_id gnl|my_center|LOCUS_72240 17416 16733 gene locus_tag LOCUS_72250 17416 16733 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_72250 17710 18033 gene locus_tag LOCUS_72260 17710 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72260 19550 18141 gene locus_tag LOCUS_72270 19550 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72270 20482 20051 gene locus_tag LOCUS_72280 20482 20051 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163086.1 protein_id gnl|my_center|LOCUS_72280 21077 20610 gene locus_tag LOCUS_72290 21077 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72290 21648 22721 gene locus_tag LOCUS_72300 21648 22721 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089417.1 protein_id gnl|my_center|LOCUS_72300 22896 24239 gene locus_tag LOCUS_72310 22896 24239 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463825.1 protein_id gnl|my_center|LOCUS_72310 24239 25675 gene locus_tag LOCUS_72320 24239 25675 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857632.1 protein_id gnl|my_center|LOCUS_72320 27054 25672 gene locus_tag LOCUS_72330 27054 25672 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388455.1 protein_id gnl|my_center|LOCUS_72330 28097 27180 gene locus_tag LOCUS_72340 28097 27180 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919349.1 protein_id gnl|my_center|LOCUS_72340 28732 29130 gene locus_tag LOCUS_72350 28732 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 29289 29519 gene locus_tag LOCUS_72360 29289 29519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72360 30575 29535 gene locus_tag LOCUS_72370 30575 29535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72370 31774 30665 gene locus_tag LOCUS_72380 31774 30665 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_72380 31972 32955 gene locus_tag LOCUS_72390 31972 32955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 32952 33440 gene locus_tag LOCUS_72400 32952 33440 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088787.1 protein_id gnl|my_center|LOCUS_72400 33427 35541 gene locus_tag LOCUS_72410 33427 35541 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088788.1 protein_id gnl|my_center|LOCUS_72410 37085 35841 gene locus_tag LOCUS_72420 37085 35841 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727702.1 protein_id gnl|my_center|LOCUS_72420 >Feature sequence44 239 742 gene locus_tag LOCUS_72430 239 742 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086883.1 protein_id gnl|my_center|LOCUS_72430 739 1911 gene locus_tag LOCUS_72440 739 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 2268 2951 gene locus_tag LOCUS_72450 2268 2951 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090575.1 protein_id gnl|my_center|LOCUS_72450 4899 2989 gene locus_tag LOCUS_72460 4899 2989 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086892.1 protein_id gnl|my_center|LOCUS_72460 5165 5590 gene locus_tag LOCUS_72470 5165 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 5708 6406 gene locus_tag LOCUS_72480 5708 6406 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530368.1 protein_id gnl|my_center|LOCUS_72480 6863 6561 gene locus_tag LOCUS_72490 6863 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72490 7120 7545 gene locus_tag LOCUS_72500 gene ndk 7120 7545 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086893.1 protein_id gnl|my_center|LOCUS_72500 7743 9845 gene locus_tag LOCUS_72510 7743 9845 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532465.1 protein_id gnl|my_center|LOCUS_72510 10397 9879 gene locus_tag LOCUS_72520 10397 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 11408 10821 gene locus_tag LOCUS_72530 gene purN 11408 10821 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171111.1 protein_id gnl|my_center|LOCUS_72530 12481 11405 gene locus_tag LOCUS_72540 gene purM 12481 11405 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086899.1 protein_id gnl|my_center|LOCUS_72540 12766 15063 gene locus_tag LOCUS_72550 12766 15063 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086918.1 protein_id gnl|my_center|LOCUS_72550 15206 16756 gene locus_tag LOCUS_72560 15206 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72560 17484 17023 gene locus_tag LOCUS_72570 17484 17023 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704690.1 protein_id gnl|my_center|LOCUS_72570 17551 18033 gene locus_tag LOCUS_72580 17551 18033 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087153.1 protein_id gnl|my_center|LOCUS_72580 20217 18049 gene locus_tag LOCUS_72590 20217 18049 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966353.1 protein_id gnl|my_center|LOCUS_72590 20906 20376 gene locus_tag LOCUS_72600 20906 20376 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809303.1 protein_id gnl|my_center|LOCUS_72600 21505 20903 gene locus_tag LOCUS_72610 21505 20903 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809301.1 protein_id gnl|my_center|LOCUS_72610 21626 22552 gene locus_tag LOCUS_72620 21626 22552 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 protein_id gnl|my_center|LOCUS_72620 22796 23683 gene locus_tag LOCUS_72630 gene dapA 22796 23683 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_72630 23683 24156 gene locus_tag LOCUS_72640 gene smpB 23683 24156 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_72640 24179 24562 gene locus_tag LOCUS_72650 24179 24562 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703163.1 protein_id gnl|my_center|LOCUS_72650 25372 24656 gene locus_tag LOCUS_72660 25372 24656 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172643.1 protein_id gnl|my_center|LOCUS_72660 25848 25561 gene locus_tag LOCUS_72670 25848 25561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 26626 25988 gene locus_tag LOCUS_72680 26626 25988 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_72680 27291 26632 gene locus_tag LOCUS_72690 27291 26632 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209601352.1 protein_id gnl|my_center|LOCUS_72690 27498 28007 gene locus_tag LOCUS_72700 27498 28007 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086970.1 protein_id gnl|my_center|LOCUS_72700 28439 28828 gene locus_tag LOCUS_72710 gene rpoZ 28439 28828 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008133017.1 protein_id gnl|my_center|LOCUS_72710 29036 31213 gene locus_tag LOCUS_72720 29036 31213 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087826.1 protein_id gnl|my_center|LOCUS_72720 31614 32207 gene locus_tag LOCUS_72730 gene pyrE 31614 32207 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_72730 32204 32653 gene locus_tag LOCUS_72740 32204 32653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 32655 33059 gene locus_tag LOCUS_72750 gene acpS 32655 33059 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 protein_id gnl|my_center|LOCUS_72750 33245 33628 gene locus_tag LOCUS_72760 33245 33628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72760 34805 33879 gene locus_tag LOCUS_72770 34805 33879 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_72770 34978 35415 gene locus_tag LOCUS_72780 34978 35415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72780 35503 36750 gene locus_tag LOCUS_72790 gene cfa1 35503 36750 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330709.1 protein_id gnl|my_center|LOCUS_72790 36735 37010 gene locus_tag LOCUS_72800 36735 37010 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_72800 >Feature sequence45 2448 1282 gene locus_tag LOCUS_72810 2448 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72810 3782 3138 gene locus_tag LOCUS_72820 3782 3138 CDS product DUF1109 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087694.1 protein_id gnl|my_center|LOCUS_72820 4336 3779 gene locus_tag LOCUS_72830 4336 3779 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171699.1 protein_id gnl|my_center|LOCUS_72830 4794 5066 gene locus_tag LOCUS_72840 4794 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72840 5206 5553 gene locus_tag LOCUS_72850 5206 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72850 5644 6048 gene locus_tag LOCUS_72860 5644 6048 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171697.1 protein_id gnl|my_center|LOCUS_72860 6048 7469 gene locus_tag LOCUS_72870 6048 7469 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_72870 7466 10642 gene locus_tag LOCUS_72880 7466 10642 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_72880 10575 10769 gene locus_tag LOCUS_72890 10575 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72890 12521 11298 gene locus_tag LOCUS_72900 12521 11298 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890808.1 protein_id gnl|my_center|LOCUS_72900 12697 12524 gene locus_tag LOCUS_72910 12697 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72910 13446 12769 gene locus_tag LOCUS_72920 13446 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 13811 13443 gene locus_tag LOCUS_72930 13811 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72930 16544 14064 gene locus_tag LOCUS_72940 16544 14064 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_72940 17276 16626 gene locus_tag LOCUS_72950 17276 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72950 18057 17323 gene locus_tag LOCUS_72960 18057 17323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_72960 19312 18050 gene locus_tag LOCUS_72970 19312 18050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021143.1 protein_id gnl|my_center|LOCUS_72970 20523 19324 gene locus_tag LOCUS_72980 20523 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72980 20720 21121 gene locus_tag LOCUS_72990 20720 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72990 21516 22865 gene locus_tag LOCUS_73000 21516 22865 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965648.1 protein_id gnl|my_center|LOCUS_73000 23027 24109 gene locus_tag LOCUS_73010 23027 24109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73010 24100 24378 gene locus_tag LOCUS_73020 24100 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73020 24871 24707 gene locus_tag LOCUS_73030 24871 24707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73030 25386 24889 gene locus_tag LOCUS_73040 25386 24889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73040 26853 25414 gene locus_tag LOCUS_73050 gene merA 26853 25414 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031938.1 protein_id gnl|my_center|LOCUS_73050 27175 26867 gene locus_tag LOCUS_73060 27175 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 27431 27144 gene locus_tag LOCUS_73070 27431 27144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73070 27877 27449 gene locus_tag LOCUS_73080 gene merT 27877 27449 CDS product mercuric ion transporter MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294667.1 protein_id gnl|my_center|LOCUS_73080 27972 28394 gene locus_tag LOCUS_73090 27972 28394 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105578.1 protein_id gnl|my_center|LOCUS_73090 28981 28586 gene locus_tag LOCUS_73100 28981 28586 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388781.1 protein_id gnl|my_center|LOCUS_73100 29135 29650 gene locus_tag LOCUS_73110 29135 29650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73110 29652 31049 gene locus_tag LOCUS_73120 29652 31049 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315176.1 protein_id gnl|my_center|LOCUS_73120 31272 31054 gene locus_tag LOCUS_73130 31272 31054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73130 31187 32194 gene locus_tag LOCUS_73140 31187 32194 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210030.1 protein_id gnl|my_center|LOCUS_73140 32242 32718 gene locus_tag LOCUS_73150 32242 32718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 32840 33583 gene locus_tag LOCUS_73160 32840 33583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73160 33690 34880 gene locus_tag LOCUS_73170 33690 34880 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 protein_id gnl|my_center|LOCUS_73170 >Feature sequence46 1401 55 gene locus_tag LOCUS_73180 1401 55 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_73180 1643 2665 gene locus_tag LOCUS_73190 1643 2665 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089395.1 protein_id gnl|my_center|LOCUS_73190 2656 2853 gene locus_tag LOCUS_73200 gene thiS 2656 2853 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089396.1 protein_id gnl|my_center|LOCUS_73200 2858 3640 gene locus_tag LOCUS_73210 2858 3640 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089397.1 protein_id gnl|my_center|LOCUS_73210 3627 4235 gene locus_tag LOCUS_73220 3627 4235 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089398.1 protein_id gnl|my_center|LOCUS_73220 4307 5206 gene locus_tag LOCUS_73230 4307 5206 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 protein_id gnl|my_center|LOCUS_73230 6227 5514 gene locus_tag LOCUS_73240 6227 5514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407872.1 protein_id gnl|my_center|LOCUS_73240 8080 6233 gene locus_tag LOCUS_73250 8080 6233 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247367.1 protein_id gnl|my_center|LOCUS_73250 9010 8087 gene locus_tag LOCUS_73260 9010 8087 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_73260 10331 9102 gene locus_tag LOCUS_73270 10331 9102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_73270 10679 11428 gene locus_tag LOCUS_73280 10679 11428 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808041.1 protein_id gnl|my_center|LOCUS_73280 11439 12128 gene locus_tag LOCUS_73290 11439 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73290 12154 13311 gene locus_tag LOCUS_73300 12154 13311 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_73300 13316 15073 gene locus_tag LOCUS_73310 13316 15073 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089544.1 protein_id gnl|my_center|LOCUS_73310 15872 15090 gene locus_tag LOCUS_73320 15872 15090 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_73320 16035 17243 gene locus_tag LOCUS_73330 16035 17243 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 protein_id gnl|my_center|LOCUS_73330 18627 17584 gene locus_tag LOCUS_73340 18627 17584 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463757.1 protein_id gnl|my_center|LOCUS_73340 20246 18630 gene locus_tag LOCUS_73350 20246 18630 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085806.1 protein_id gnl|my_center|LOCUS_73350 20477 21400 gene locus_tag LOCUS_73360 20477 21400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 22373 21675 gene locus_tag LOCUS_73370 22373 21675 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_73370 23739 22387 gene locus_tag LOCUS_73380 gene hemN 23739 22387 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390257.1 protein_id gnl|my_center|LOCUS_73380 23987 25642 gene locus_tag LOCUS_73390 gene ccoN 23987 25642 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085548.1 protein_id gnl|my_center|LOCUS_73390 25654 26391 gene locus_tag LOCUS_73400 gene ccoO 25654 26391 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085549.1 protein_id gnl|my_center|LOCUS_73400 26406 26561 gene locus_tag LOCUS_73410 26406 26561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73410 26564 27445 gene locus_tag LOCUS_73420 gene ccoP 26564 27445 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_73420 27641 29101 gene locus_tag LOCUS_73430 gene ccoG 27641 29101 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088522.1 protein_id gnl|my_center|LOCUS_73430 29127 29639 gene locus_tag LOCUS_73440 29127 29639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73440 29636 31888 gene locus_tag LOCUS_73450 29636 31888 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085554.1 protein_id gnl|my_center|LOCUS_73450 31903 32133 gene locus_tag LOCUS_73460 31903 32133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 32585 32073 gene locus_tag LOCUS_73470 32585 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73470 32695 33423 gene locus_tag LOCUS_73480 32695 33423 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088802.1 protein_id gnl|my_center|LOCUS_73480 >Feature sequence47 <1 1634 gene locus_tag LOCUS_73490 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148161.1:two-partner secretion system adhesin CdrA 3363 1756 gene locus_tag LOCUS_73500 3363 1756 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_73500 3697 3377 gene locus_tag LOCUS_73510 3697 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 5118 3694 gene locus_tag LOCUS_73520 5118 3694 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946170.1 protein_id gnl|my_center|LOCUS_73520 6484 5150 gene locus_tag LOCUS_73530 6484 5150 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_73530 6647 7981 gene locus_tag LOCUS_73540 6647 7981 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_73540 9036 8011 gene locus_tag LOCUS_73550 9036 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73550 10729 9533 gene locus_tag LOCUS_73560 10729 9533 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965859.1 protein_id gnl|my_center|LOCUS_73560 11467 10880 gene locus_tag LOCUS_73570 11467 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528402.1 protein_id gnl|my_center|LOCUS_73570 12294 11758 gene locus_tag LOCUS_73580 12294 11758 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_73580 13410 12502 gene locus_tag LOCUS_73590 13410 12502 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_73590 13774 13547 gene locus_tag LOCUS_73600 13774 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73600 15042 13945 gene locus_tag LOCUS_73610 15042 13945 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456185.1 protein_id gnl|my_center|LOCUS_73610 15824 15234 gene locus_tag LOCUS_73620 15824 15234 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921238.1 protein_id gnl|my_center|LOCUS_73620 16147 15821 gene locus_tag LOCUS_73630 16147 15821 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921237.1 protein_id gnl|my_center|LOCUS_73630 16428 16216 gene locus_tag LOCUS_73640 16428 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73640 18978 16513 gene locus_tag LOCUS_73650 18978 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73650 22348 19307 gene locus_tag LOCUS_73660 22348 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_73660 23496 22636 gene locus_tag LOCUS_73670 23496 22636 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339386.1 protein_id gnl|my_center|LOCUS_73670 24941 23493 gene locus_tag LOCUS_73680 24941 23493 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966044.1 protein_id gnl|my_center|LOCUS_73680 26644 24938 gene locus_tag LOCUS_73690 26644 24938 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339388.1 protein_id gnl|my_center|LOCUS_73690 26908 27987 gene locus_tag LOCUS_73700 26908 27987 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064867.1 protein_id gnl|my_center|LOCUS_73700 28665 27868 gene locus_tag LOCUS_73710 28665 27868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811613.1 protein_id gnl|my_center|LOCUS_73710 29507 28671 gene locus_tag LOCUS_73720 29507 28671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811610.1 protein_id gnl|my_center|LOCUS_73720 30682 29504 gene locus_tag LOCUS_73730 30682 29504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811606.1 protein_id gnl|my_center|LOCUS_73730 31784 30753 gene locus_tag LOCUS_73740 31784 30753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811608.1 protein_id gnl|my_center|LOCUS_73740 32141 33154 gene locus_tag LOCUS_73750 32141 33154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73750 >Feature sequence48 1797 301 gene locus_tag LOCUS_73760 1797 301 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921534.1 protein_id gnl|my_center|LOCUS_73760 2676 2227 gene locus_tag LOCUS_73770 2676 2227 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089457.1 protein_id gnl|my_center|LOCUS_73770 3723 2872 gene locus_tag LOCUS_73780 3723 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 protein_id gnl|my_center|LOCUS_73780 4582 3734 gene locus_tag LOCUS_73790 4582 3734 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 protein_id gnl|my_center|LOCUS_73790 5856 4852 gene locus_tag LOCUS_73800 5856 4852 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 protein_id gnl|my_center|LOCUS_73800 6958 6158 gene locus_tag LOCUS_73810 6958 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_73810 7423 8442 gene locus_tag LOCUS_73820 7423 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 9244 8774 gene locus_tag LOCUS_73830 9244 8774 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974190.1 protein_id gnl|my_center|LOCUS_73830 9407 9712 gene locus_tag LOCUS_73840 9407 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73840 9709 10257 gene locus_tag LOCUS_73850 9709 10257 CDS product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688125.1 protein_id gnl|my_center|LOCUS_73850 10250 10663 gene locus_tag LOCUS_73860 10250 10663 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688107.1 protein_id gnl|my_center|LOCUS_73860 11143 12879 gene locus_tag LOCUS_73870 11143 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 13845 12949 gene locus_tag LOCUS_73880 13845 12949 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971237.1 protein_id gnl|my_center|LOCUS_73880 14456 13890 gene locus_tag LOCUS_73890 14456 13890 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973222.1 protein_id gnl|my_center|LOCUS_73890 16294 14579 gene locus_tag LOCUS_73900 16294 14579 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047161.1 protein_id gnl|my_center|LOCUS_73900 16659 17123 gene locus_tag LOCUS_73910 16659 17123 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557493.1 protein_id gnl|my_center|LOCUS_73910 17497 17165 gene locus_tag LOCUS_73920 17497 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73920 20021 17976 gene locus_tag LOCUS_73930 20021 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73930 20323 20790 gene locus_tag LOCUS_73940 20323 20790 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_73940 21077 21322 gene locus_tag LOCUS_73950 21077 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 21620 22993 gene locus_tag LOCUS_73960 21620 22993 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982254.1 protein_id gnl|my_center|LOCUS_73960 23264 23013 gene locus_tag LOCUS_73970 23264 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 23854 24237 gene locus_tag LOCUS_73980 23854 24237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73980 24538 24290 gene locus_tag LOCUS_73990 24538 24290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73990 25849 24644 gene locus_tag LOCUS_74000 25849 24644 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267844.1 protein_id gnl|my_center|LOCUS_74000 26068 26544 gene locus_tag LOCUS_74010 26068 26544 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810437.1 protein_id gnl|my_center|LOCUS_74010 26547 27470 gene locus_tag LOCUS_74020 26547 27470 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008837649.1 protein_id gnl|my_center|LOCUS_74020 27481 27813 gene locus_tag LOCUS_74030 27481 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74030 27821 28546 gene locus_tag LOCUS_74040 27821 28546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74040 29027 28560 gene locus_tag LOCUS_74050 29027 28560 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939050.1 protein_id gnl|my_center|LOCUS_74050 29329 29568 gene locus_tag LOCUS_74060 29329 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74060 30121 29789 gene locus_tag LOCUS_74070 30121 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74070 30589 31497 gene locus_tag LOCUS_74080 30589 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338976.1 protein_id gnl|my_center|LOCUS_74080 31626 32390 gene locus_tag LOCUS_74090 31626 32390 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111362.1 protein_id gnl|my_center|LOCUS_74090 >Feature sequence49 393 2090 gene locus_tag LOCUS_74100 393 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74100 2101 10659 gene locus_tag LOCUS_74110 2101 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74110 10786 11406 gene locus_tag LOCUS_74120 10786 11406 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_74120 12282 11416 gene locus_tag LOCUS_74130 12282 11416 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_74130 12374 13171 gene locus_tag LOCUS_74140 12374 13171 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_74140 13829 13443 gene locus_tag LOCUS_74150 13829 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 15022 13829 gene locus_tag LOCUS_74160 15022 13829 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 protein_id gnl|my_center|LOCUS_74160 15915 15196 gene locus_tag LOCUS_74170 15915 15196 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_74170 16390 16956 gene locus_tag LOCUS_74180 16390 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 16925 18253 gene locus_tag LOCUS_74190 16925 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531618.1 protein_id gnl|my_center|LOCUS_74190 18264 19493 gene locus_tag LOCUS_74200 18264 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975959.1 protein_id gnl|my_center|LOCUS_74200 19923 19711 gene locus_tag LOCUS_74210 19923 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74210 20049 20399 gene locus_tag LOCUS_74220 20049 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 20402 22576 gene locus_tag LOCUS_74230 20402 22576 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397216.1 protein_id gnl|my_center|LOCUS_74230 22579 22839 gene locus_tag LOCUS_74240 22579 22839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74240 22870 23880 gene locus_tag LOCUS_74250 22870 23880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 23896 24855 gene locus_tag LOCUS_74260 23896 24855 CDS product DUF5309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975968.1 protein_id gnl|my_center|LOCUS_74260 25100 24924 gene locus_tag LOCUS_74270 25100 24924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74270 25303 25683 gene locus_tag LOCUS_74280 25303 25683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74280 25683 25988 gene locus_tag LOCUS_74290 25683 25988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74290 25988 26590 gene locus_tag LOCUS_74300 25988 26590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328778.1 protein_id gnl|my_center|LOCUS_74300 26587 27240 gene locus_tag LOCUS_74310 26587 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975958.1 protein_id gnl|my_center|LOCUS_74310 27242 28903 gene locus_tag LOCUS_74320 27242 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937999.1 protein_id gnl|my_center|LOCUS_74320 28900 29442 gene locus_tag LOCUS_74330 28900 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74330 29363 30346 gene locus_tag LOCUS_74340 29363 30346 CDS product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531595.1 protein_id gnl|my_center|LOCUS_74340 30339 31316 gene locus_tag LOCUS_74350 30339 31316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 >Feature sequence50 100 1296 gene locus_tag LOCUS_74360 100 1296 CDS product IS256-like element ISRm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969783.1 protein_id gnl|my_center|LOCUS_74360 1743 2045 gene locus_tag LOCUS_74370 1743 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74370 2553 2305 gene locus_tag LOCUS_74380 2553 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74380 2575 3084 gene locus_tag LOCUS_74390 2575 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74390 3615 3965 gene locus_tag LOCUS_74400 3615 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525337.1 protein_id gnl|my_center|LOCUS_74400 5142 4105 gene locus_tag LOCUS_74410 gene arsK 5142 4105 CDS product arsenite efflux MFS transporter ArsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530554.1 protein_id gnl|my_center|LOCUS_74410 6456 6118 gene locus_tag LOCUS_74420 6456 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74420 7898 6711 gene locus_tag LOCUS_74430 7898 6711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087808.1 protein_id gnl|my_center|LOCUS_74430 9332 7902 gene locus_tag LOCUS_74440 9332 7902 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085876.1 protein_id gnl|my_center|LOCUS_74440 9705 9376 gene locus_tag LOCUS_74450 9705 9376 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172264.1 protein_id gnl|my_center|LOCUS_74450 10535 9774 gene locus_tag LOCUS_74460 gene arsH 10535 9774 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992287.1 protein_id gnl|my_center|LOCUS_74460 11520 10648 gene locus_tag LOCUS_74470 gene phnE 11520 10648 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090667.1 protein_id gnl|my_center|LOCUS_74470 12413 11517 gene locus_tag LOCUS_74480 gene phnE 12413 11517 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090668.1 protein_id gnl|my_center|LOCUS_74480 13327 12428 gene locus_tag LOCUS_74490 gene phnD 13327 12428 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090669.1 protein_id gnl|my_center|LOCUS_74490 14342 13407 gene locus_tag LOCUS_74500 gene phnD 14342 13407 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090669.1 protein_id gnl|my_center|LOCUS_74500 15170 14364 gene locus_tag LOCUS_74510 gene phnC 15170 14364 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090670.1 protein_id gnl|my_center|LOCUS_74510 15808 15407 gene locus_tag LOCUS_74520 15808 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74520 16662 15826 gene locus_tag LOCUS_74530 gene pstB 16662 15826 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_74530 18463 16703 gene locus_tag LOCUS_74540 gene pstA 18463 16703 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_74540 21091 18476 gene locus_tag LOCUS_74550 21091 18476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74550 22177 21185 gene locus_tag LOCUS_74560 gene pstS 22177 21185 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_74560 22779 22195 gene locus_tag LOCUS_74570 22779 22195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74570 22697 22882 gene locus_tag LOCUS_74580 22697 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74580 23291 25378 gene locus_tag LOCUS_74590 23291 25378 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123659250.1 protein_id gnl|my_center|LOCUS_74590 25375 26919 gene locus_tag LOCUS_74600 25375 26919 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368616.1 protein_id gnl|my_center|LOCUS_74600 >Feature sequence51 972 298 gene locus_tag LOCUS_74610 gene lipB 972 298 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088013.1 protein_id gnl|my_center|LOCUS_74610 1056 1298 gene locus_tag LOCUS_74620 1056 1298 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088012.1 protein_id gnl|my_center|LOCUS_74620 1854 1366 gene locus_tag LOCUS_74630 gene ruvX 1854 1366 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971538.1 protein_id gnl|my_center|LOCUS_74630 1965 2663 gene locus_tag LOCUS_74640 1965 2663 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256572.1 protein_id gnl|my_center|LOCUS_74640 3604 2972 gene locus_tag LOCUS_74650 gene folE 3604 2972 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495569.1 protein_id gnl|my_center|LOCUS_74650 3839 4288 gene locus_tag LOCUS_74660 3839 4288 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_74660 5715 4564 gene locus_tag LOCUS_74670 5715 4564 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_74670 5784 6155 gene locus_tag LOCUS_74680 5784 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74680 6925 6143 gene locus_tag LOCUS_74690 6925 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74690 7069 9036 gene locus_tag LOCUS_74700 gene thrS 7069 9036 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531976.1 protein_id gnl|my_center|LOCUS_74700 10462 9395 gene locus_tag LOCUS_74710 10462 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088297.1 protein_id gnl|my_center|LOCUS_74710 10676 11254 gene locus_tag LOCUS_74720 10676 11254 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534715.1 protein_id gnl|my_center|LOCUS_74720 11259 11891 gene locus_tag LOCUS_74730 11259 11891 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_74730 12749 12006 gene locus_tag LOCUS_74740 12749 12006 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 protein_id gnl|my_center|LOCUS_74740 12849 13745 gene locus_tag LOCUS_74750 12849 13745 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974533.1 protein_id gnl|my_center|LOCUS_74750 14730 13861 gene locus_tag LOCUS_74760 14730 13861 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_74760 15228 14734 gene locus_tag LOCUS_74770 15228 14734 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_74770 15325 16392 gene locus_tag LOCUS_74780 15325 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 16508 17701 gene locus_tag LOCUS_74790 16508 17701 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088267.1 protein_id gnl|my_center|LOCUS_74790 18366 17797 gene locus_tag LOCUS_74800 18366 17797 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088266.1 protein_id gnl|my_center|LOCUS_74800 18923 18378 gene locus_tag LOCUS_74810 18923 18378 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_74810 19779 18997 gene locus_tag LOCUS_74820 19779 18997 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967522.1 protein_id gnl|my_center|LOCUS_74820 20678 19932 gene locus_tag LOCUS_74830 20678 19932 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_74830 22828 20801 gene locus_tag LOCUS_74840 22828 20801 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_74840 24194 23292 gene locus_tag LOCUS_74850 24194 23292 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087556.1 protein_id gnl|my_center|LOCUS_74850 24535 24460 gene locus_tag LOCUS_t00500 24535 24460 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24957 24709 gene locus_tag LOCUS_74860 24957 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74860 25306 25046 gene locus_tag LOCUS_74870 25306 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74870 25599 25375 gene locus_tag LOCUS_74880 25599 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74880 26376 26152 gene locus_tag LOCUS_74890 26376 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74890 27228 27004 gene locus_tag LOCUS_74900 27228 27004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74900 >Feature sequence52 178 339 gene locus_tag LOCUS_74910 178 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74910 336 794 gene locus_tag LOCUS_74920 336 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 2038 1049 gene locus_tag LOCUS_74930 2038 1049 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_74930 3100 2090 gene locus_tag LOCUS_74940 3100 2090 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087659.1 protein_id gnl|my_center|LOCUS_74940 4073 3093 gene locus_tag LOCUS_74950 4073 3093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087660.1 protein_id gnl|my_center|LOCUS_74950 4891 4070 gene locus_tag LOCUS_74960 4891 4070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087661.1 protein_id gnl|my_center|LOCUS_74960 5837 4902 gene locus_tag LOCUS_74970 5837 4902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967052.1 protein_id gnl|my_center|LOCUS_74970 7522 5918 gene locus_tag LOCUS_74980 7522 5918 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087663.1 protein_id gnl|my_center|LOCUS_74980 8687 7806 gene locus_tag LOCUS_74990 8687 7806 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_74990 8832 9533 gene locus_tag LOCUS_75000 8832 9533 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226990.1 protein_id gnl|my_center|LOCUS_75000 9608 10582 gene locus_tag LOCUS_75010 9608 10582 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 protein_id gnl|my_center|LOCUS_75010 11757 10603 gene locus_tag LOCUS_75020 11757 10603 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_75020 13331 11754 gene locus_tag LOCUS_75030 13331 11754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086708.1 protein_id gnl|my_center|LOCUS_75030 13728 13381 gene locus_tag LOCUS_75040 13728 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_75040 15071 13734 gene locus_tag LOCUS_75050 15071 13734 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_75050 15219 16127 gene locus_tag LOCUS_75060 15219 16127 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132519030.1 protein_id gnl|my_center|LOCUS_75060 16203 18863 gene locus_tag LOCUS_75070 16203 18863 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393613.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_75070 18860 20080 gene locus_tag LOCUS_75080 18860 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_75080 20787 20050 gene locus_tag LOCUS_75090 20787 20050 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_75090 21181 22407 gene locus_tag LOCUS_75100 21181 22407 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064291.1 protein_id gnl|my_center|LOCUS_75100 22492 23004 gene locus_tag LOCUS_75110 22492 23004 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064292.1 protein_id gnl|my_center|LOCUS_75110 23118 23417 gene locus_tag LOCUS_75120 23118 23417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75120 24751 23486 gene locus_tag LOCUS_75130 24751 23486 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_75130 25254 25036 gene locus_tag LOCUS_75140 25254 25036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75140 >Feature sequence53 3073 1319 gene locus_tag LOCUS_75150 gene argS 3073 1319 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967253.1 protein_id gnl|my_center|LOCUS_75150 4321 3104 gene locus_tag LOCUS_75160 4321 3104 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531289.1 protein_id gnl|my_center|LOCUS_75160 4469 4798 gene locus_tag LOCUS_75170 gene erpA 4469 4798 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_75170 5695 5090 gene locus_tag LOCUS_75180 5695 5090 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038740.1 protein_id gnl|my_center|LOCUS_75180 5782 6564 gene locus_tag LOCUS_75190 gene xth 5782 6564 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 protein_id gnl|my_center|LOCUS_75190 7554 8810 gene locus_tag LOCUS_75200 7554 8810 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_75200 8823 11930 gene locus_tag LOCUS_75210 8823 11930 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_75210 11973 15263 gene locus_tag LOCUS_75220 11973 15263 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521877.1 protein_id gnl|my_center|LOCUS_75220 15471 16985 gene locus_tag LOCUS_75230 15471 16985 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_75230 17758 17366 gene locus_tag LOCUS_75240 17758 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75240 19218 17830 gene locus_tag LOCUS_75250 19218 17830 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971719.1 protein_id gnl|my_center|LOCUS_75250 20012 19227 gene locus_tag LOCUS_75260 20012 19227 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967247.1 protein_id gnl|my_center|LOCUS_75260 21771 20032 gene locus_tag LOCUS_75270 gene ilvD 21771 20032 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087531.1 protein_id gnl|my_center|LOCUS_75270 >Feature sequence54 1318 2340 gene locus_tag LOCUS_75280 1318 2340 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529023.1 protein_id gnl|my_center|LOCUS_75280 3342 2359 gene locus_tag LOCUS_75290 3342 2359 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188904.1 protein_id gnl|my_center|LOCUS_75290 3710 3339 gene locus_tag LOCUS_75300 3710 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75300 3898 5805 gene locus_tag LOCUS_75310 3898 5805 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087463.1 protein_id gnl|my_center|LOCUS_75310 5994 6491 gene locus_tag LOCUS_75320 5994 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75320 6673 7875 gene locus_tag LOCUS_75330 6673 7875 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975891.1 protein_id gnl|my_center|LOCUS_75330 7984 8190 gene locus_tag LOCUS_75340 7984 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75340 8229 11000 gene locus_tag LOCUS_75350 gene ppc 8229 11000 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_75350 11191 11487 gene locus_tag LOCUS_75360 11191 11487 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530150.1 protein_id gnl|my_center|LOCUS_75360 11684 12514 gene locus_tag LOCUS_75370 11684 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_75370 13413 12496 gene locus_tag LOCUS_75380 13413 12496 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 protein_id gnl|my_center|LOCUS_75380 13535 14278 gene locus_tag LOCUS_75390 13535 14278 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975354.1 protein_id gnl|my_center|LOCUS_75390 14952 14686 gene locus_tag LOCUS_75400 gene minE 14952 14686 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530672.1 protein_id gnl|my_center|LOCUS_75400 15764 14949 gene locus_tag LOCUS_75410 gene minD 15764 14949 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530671.1 protein_id gnl|my_center|LOCUS_75410 16541 15783 gene locus_tag LOCUS_75420 gene minC 16541 15783 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530670.1 protein_id gnl|my_center|LOCUS_75420 17270 16791 gene locus_tag LOCUS_75430 17270 16791 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068728.1 protein_id gnl|my_center|LOCUS_75430 17442 17906 gene locus_tag LOCUS_75440 17442 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75440 18092 19105 gene locus_tag LOCUS_75450 18092 19105 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083073.1 protein_id gnl|my_center|LOCUS_75450 19364 19564 gene locus_tag LOCUS_75460 19364 19564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75460 20291 19602 gene locus_tag LOCUS_75470 20291 19602 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392579.1 protein_id gnl|my_center|LOCUS_75470 21248 20337 gene locus_tag LOCUS_75480 21248 20337 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170938.1 protein_id gnl|my_center|LOCUS_75480 21331 22059 gene locus_tag LOCUS_75490 21331 22059 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_75490 >Feature sequence55 <1 714 gene locus_tag LOCUS_75500 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175552028.1:calcium-binding protein 2585 1080 gene locus_tag LOCUS_75510 2585 1080 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189292.1 protein_id gnl|my_center|LOCUS_75510 4081 2756 gene locus_tag LOCUS_75520 4081 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75520 4815 4078 gene locus_tag LOCUS_75530 4815 4078 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_75530 5187 5765 gene locus_tag LOCUS_75540 5187 5765 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206280.1 protein_id gnl|my_center|LOCUS_75540 6330 5827 gene locus_tag LOCUS_75550 6330 5827 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197050165.1 protein_id gnl|my_center|LOCUS_75550 6629 8959 gene locus_tag LOCUS_75560 6629 8959 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_75560 9229 9564 gene locus_tag LOCUS_75570 9229 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75570 9720 10127 gene locus_tag LOCUS_75580 9720 10127 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090276.1 protein_id gnl|my_center|LOCUS_75580 10242 10508 gene locus_tag LOCUS_75590 10242 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75590 10892 11119 gene locus_tag LOCUS_75600 10892 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75600 11810 13090 gene locus_tag LOCUS_75610 11810 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75610 13666 13364 gene locus_tag LOCUS_75620 13666 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75620 14202 13849 gene locus_tag LOCUS_75630 14202 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75630 14343 14777 gene locus_tag LOCUS_75640 14343 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75640 15581 15393 gene locus_tag LOCUS_75650 15581 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75650 16200 15907 gene locus_tag LOCUS_75660 16200 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75660 16624 16226 gene locus_tag LOCUS_75670 16624 16226 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968682.1 protein_id gnl|my_center|LOCUS_75670 18027 16711 gene locus_tag LOCUS_75680 18027 16711 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244411.1 protein_id gnl|my_center|LOCUS_75680 19576 18140 gene locus_tag LOCUS_75690 19576 18140 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084999.1 protein_id gnl|my_center|LOCUS_75690 20548 20255 gene locus_tag LOCUS_75700 20548 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75700 >Feature sequence56 1364 402 gene locus_tag LOCUS_75710 1364 402 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_75710 2103 1468 gene locus_tag LOCUS_75720 2103 1468 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_75720 2857 2126 gene locus_tag LOCUS_75730 2857 2126 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_75730 3132 4367 gene locus_tag LOCUS_75740 3132 4367 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_75740 5406 4477 gene locus_tag LOCUS_75750 5406 4477 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_75750 5566 6837 gene locus_tag LOCUS_75760 5566 6837 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807966.1 protein_id gnl|my_center|LOCUS_75760 6963 8159 gene locus_tag LOCUS_75770 6963 8159 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023546.1 protein_id gnl|my_center|LOCUS_75770 10347 8269 gene locus_tag LOCUS_75780 10347 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75780 12017 13471 gene locus_tag LOCUS_75790 12017 13471 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_75790 13695 14948 gene locus_tag LOCUS_75800 13695 14948 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 protein_id gnl|my_center|LOCUS_75800 15732 15070 gene locus_tag LOCUS_75810 15732 15070 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_75810 16114 17154 gene locus_tag LOCUS_75820 16114 17154 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529584.1 protein_id gnl|my_center|LOCUS_75820 17154 17888 gene locus_tag LOCUS_75830 17154 17888 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_75830 17903 18772 gene locus_tag LOCUS_75840 gene sseA 17903 18772 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_75840 >Feature sequence57 205 612 gene locus_tag LOCUS_75850 205 612 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729616.1 protein_id gnl|my_center|LOCUS_75850 651 1478 gene locus_tag LOCUS_75860 gene fabG 651 1478 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_75860 1489 2280 gene locus_tag LOCUS_75870 1489 2280 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174808.1 protein_id gnl|my_center|LOCUS_75870 2277 3425 gene locus_tag LOCUS_75880 2277 3425 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135174843.1 protein_id gnl|my_center|LOCUS_75880 3562 4359 gene locus_tag LOCUS_75890 gene allE 3562 4359 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083085.1 protein_id gnl|my_center|LOCUS_75890 4973 4623 gene locus_tag LOCUS_75900 4973 4623 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083650.1 protein_id gnl|my_center|LOCUS_75900 5838 5074 gene locus_tag LOCUS_75910 5838 5074 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529655.1 protein_id gnl|my_center|LOCUS_75910 6171 7346 gene locus_tag LOCUS_75920 6171 7346 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_75920 8150 10837 gene locus_tag LOCUS_75930 gene mgtA 8150 10837 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112338.1 protein_id gnl|my_center|LOCUS_75930 10984 11451 gene locus_tag LOCUS_75940 10984 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 11508 12884 gene locus_tag LOCUS_75950 11508 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75950 13901 13179 gene locus_tag LOCUS_75960 13901 13179 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379556.1 protein_id gnl|my_center|LOCUS_75960 14619 13909 gene locus_tag LOCUS_75970 14619 13909 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104269.1 protein_id gnl|my_center|LOCUS_75970 15317 14619 gene locus_tag LOCUS_75980 15317 14619 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104270.1 protein_id gnl|my_center|LOCUS_75980 16354 15524 gene locus_tag LOCUS_75990 16354 15524 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810423.1 protein_id gnl|my_center|LOCUS_75990 17586 16378 gene locus_tag LOCUS_76000 17586 16378 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399197.1 protein_id gnl|my_center|LOCUS_76000 18311 17589 gene locus_tag LOCUS_76010 18311 17589 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175134.1 protein_id gnl|my_center|LOCUS_76010 >Feature sequence58 432 507 gene locus_tag LOCUS_t00510 432 507 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 603 1361 gene locus_tag LOCUS_76020 gene ehuB 603 1361 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459280.1 protein_id gnl|my_center|LOCUS_76020 1576 1773 gene locus_tag LOCUS_76030 gene secE 1576 1773 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523719.1 protein_id gnl|my_center|LOCUS_76030 1787 2317 gene locus_tag LOCUS_76040 gene nusG 1787 2317 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088165.1 protein_id gnl|my_center|LOCUS_76040 2479 2907 gene locus_tag LOCUS_76050 gene rplK 2479 2907 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088164.1 protein_id gnl|my_center|LOCUS_76050 2912 3604 gene locus_tag LOCUS_76060 gene rplA 2912 3604 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536190.1 protein_id gnl|my_center|LOCUS_76060 4239 4757 gene locus_tag LOCUS_76070 gene rplJ 4239 4757 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_249163115.1 protein_id gnl|my_center|LOCUS_76070 4809 5180 gene locus_tag LOCUS_76080 gene rplL 4809 5180 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_76080 5462 9589 gene locus_tag LOCUS_76090 gene rpoB 5462 9589 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088159.1 protein_id gnl|my_center|LOCUS_76090 9711 13916 gene locus_tag LOCUS_76100 gene rpoC 9711 13916 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088158.1 protein_id gnl|my_center|LOCUS_76100 13987 14202 gene locus_tag LOCUS_76110 13987 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76110 14615 14223 gene locus_tag LOCUS_76120 14615 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76120 15299 15670 gene locus_tag LOCUS_76130 gene rpsL 15299 15670 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008087.1 protein_id gnl|my_center|LOCUS_76130 15754 16224 gene locus_tag LOCUS_76140 gene rpsG 15754 16224 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088154.1 protein_id gnl|my_center|LOCUS_76140 16264 18339 gene locus_tag LOCUS_76150 gene fusA 16264 18339 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088153.1 protein_id gnl|my_center|LOCUS_76150 >Feature sequence59 294 70 gene locus_tag LOCUS_76160 294 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76160 839 576 gene locus_tag LOCUS_76170 839 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76170 2795 1173 gene locus_tag LOCUS_76180 2795 1173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526206.1 protein_id gnl|my_center|LOCUS_76180 3224 3676 gene locus_tag LOCUS_76190 3224 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76190 5678 4056 gene locus_tag LOCUS_76200 5678 4056 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526206.1 protein_id gnl|my_center|LOCUS_76200 6105 6491 gene locus_tag LOCUS_76210 6105 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76210 7288 6455 gene locus_tag LOCUS_76220 gene rlmB 7288 6455 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921492.1 protein_id gnl|my_center|LOCUS_76220 7431 7515 gene locus_tag LOCUS_t00520 7431 7515 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9235 7598 gene locus_tag LOCUS_76230 9235 7598 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 protein_id gnl|my_center|LOCUS_76230 10188 9232 gene locus_tag LOCUS_76240 10188 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76240 10506 11408 gene locus_tag LOCUS_76250 10506 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76250 11648 12967 gene locus_tag LOCUS_76260 11648 12967 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967692.1 protein_id gnl|my_center|LOCUS_76260 12972 13757 gene locus_tag LOCUS_76270 12972 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76270 14601 13702 gene locus_tag LOCUS_76280 14601 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76280 15887 14589 gene locus_tag LOCUS_76290 15887 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76290 17113 15884 gene locus_tag LOCUS_76300 17113 15884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76300 >Feature sequence60 1084 104 gene locus_tag LOCUS_76310 1084 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76310 1651 1088 gene locus_tag LOCUS_76320 1651 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76320 2982 1675 gene locus_tag LOCUS_76330 2982 1675 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931161.1 protein_id gnl|my_center|LOCUS_76330 4821 3049 gene locus_tag LOCUS_76340 4821 3049 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_76340 6893 4833 gene locus_tag LOCUS_76350 6893 4833 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_76350 7922 7008 gene locus_tag LOCUS_76360 7922 7008 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307641.1 protein_id gnl|my_center|LOCUS_76360 9353 8022 gene locus_tag LOCUS_76370 9353 8022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531507.1 protein_id gnl|my_center|LOCUS_76370 9537 10706 gene locus_tag LOCUS_76380 gene cyoA 9537 10706 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082981.1 protein_id gnl|my_center|LOCUS_76380 10725 12734 gene locus_tag LOCUS_76390 gene cyoB 10725 12734 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531505.1 protein_id gnl|my_center|LOCUS_76390 12746 13369 gene locus_tag LOCUS_76400 gene cyoC 12746 13369 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531504.1 protein_id gnl|my_center|LOCUS_76400 13366 13740 gene locus_tag LOCUS_76410 gene cyoD 13366 13740 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531503.1 protein_id gnl|my_center|LOCUS_76410 13788 14564 gene locus_tag LOCUS_76420 13788 14564 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531502.1 protein_id gnl|my_center|LOCUS_76420 14557 15957 gene locus_tag LOCUS_76430 14557 15957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175152.1 protein_id gnl|my_center|LOCUS_76430 15947 16480 gene locus_tag LOCUS_76440 15947 16480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082987.1 protein_id gnl|my_center|LOCUS_76440 >Feature sequence61 835 149 gene locus_tag LOCUS_76450 835 149 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921418.1 protein_id gnl|my_center|LOCUS_76450 2308 986 gene locus_tag LOCUS_76460 2308 986 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530314.1 protein_id gnl|my_center|LOCUS_76460 2662 3633 gene locus_tag LOCUS_76470 2662 3633 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167770862.1 protein_id gnl|my_center|LOCUS_76470 3642 4463 gene locus_tag LOCUS_76480 3642 4463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965193.1 protein_id gnl|my_center|LOCUS_76480 4465 5250 gene locus_tag LOCUS_76490 4465 5250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083741.1 protein_id gnl|my_center|LOCUS_76490 5270 5782 gene locus_tag LOCUS_76500 5270 5782 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027542149.1 protein_id gnl|my_center|LOCUS_76500 5920 6861 gene locus_tag LOCUS_76510 5920 6861 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920493.1 protein_id gnl|my_center|LOCUS_76510 7810 7070 gene locus_tag LOCUS_76520 7810 7070 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_76520 8690 7815 gene locus_tag LOCUS_76530 8690 7815 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762766.1 protein_id gnl|my_center|LOCUS_76530 9445 8696 gene locus_tag LOCUS_76540 9445 8696 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104116.1 protein_id gnl|my_center|LOCUS_76540 10423 9548 gene locus_tag LOCUS_76550 10423 9548 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 protein_id gnl|my_center|LOCUS_76550 10802 12079 gene locus_tag LOCUS_76560 10802 12079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267750.1 protein_id gnl|my_center|LOCUS_76560 12114 12875 gene locus_tag LOCUS_76570 gene fabG 12114 12875 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807992.1 protein_id gnl|my_center|LOCUS_76570 12914 13813 gene locus_tag LOCUS_76580 12914 13813 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729776.1 protein_id gnl|my_center|LOCUS_76580 >Feature sequence62 308 2503 gene locus_tag LOCUS_76590 308 2503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114020.1 protein_id gnl|my_center|LOCUS_76590 2572 3555 gene locus_tag LOCUS_76600 2572 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76600 3614 5698 gene locus_tag LOCUS_76610 3614 5698 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_76610 8036 5763 gene locus_tag LOCUS_76620 gene metE 8036 5763 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216166.1 protein_id gnl|my_center|LOCUS_76620 8888 11773 gene locus_tag LOCUS_76630 8888 11773 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224745.1 protein_id gnl|my_center|LOCUS_76630 11892 13019 gene locus_tag LOCUS_76640 11892 13019 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224744.1 protein_id gnl|my_center|LOCUS_76640 >Feature sequence63 476 748 gene locus_tag LOCUS_76650 476 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76650 1338 931 gene locus_tag LOCUS_76660 gene arsC 1338 931 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530551.1 protein_id gnl|my_center|LOCUS_76660 2659 1388 gene locus_tag LOCUS_76670 gene arsJ 2659 1388 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_76670 3704 2661 gene locus_tag LOCUS_76680 3704 2661 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_76680 4846 3764 gene locus_tag LOCUS_76690 gene arsB 4846 3764 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 protein_id gnl|my_center|LOCUS_76690 5377 4850 gene locus_tag LOCUS_76700 5377 4850 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_76700 5726 5370 gene locus_tag LOCUS_76710 5726 5370 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 protein_id gnl|my_center|LOCUS_76710 5886 6794 gene locus_tag LOCUS_76720 5886 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76720 6791 8221 gene locus_tag LOCUS_76730 6791 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76730 8211 9527 gene locus_tag LOCUS_76740 8211 9527 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_76740 9701 10225 gene locus_tag LOCUS_76750 9701 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76750 10241 12703 gene locus_tag LOCUS_76760 10241 12703 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_76760 >Feature sequence64 1038 154 gene locus_tag LOCUS_76770 1038 154 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_76770 1149 1526 gene locus_tag LOCUS_76780 1149 1526 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_76780 2303 1572 gene locus_tag LOCUS_76790 2303 1572 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537566.1 protein_id gnl|my_center|LOCUS_76790 2438 3436 gene locus_tag LOCUS_76800 2438 3436 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 protein_id gnl|my_center|LOCUS_76800 3462 4574 gene locus_tag LOCUS_76810 3462 4574 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 protein_id gnl|my_center|LOCUS_76810 4607 5608 gene locus_tag LOCUS_76820 4607 5608 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_76820 5605 6516 gene locus_tag LOCUS_76830 5605 6516 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085817.1 protein_id gnl|my_center|LOCUS_76830 7204 6554 gene locus_tag LOCUS_76840 7204 6554 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 protein_id gnl|my_center|LOCUS_76840 7396 7253 gene locus_tag LOCUS_76850 7396 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76850 7719 7429 gene locus_tag LOCUS_76860 7719 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_76860 8740 7736 gene locus_tag LOCUS_76870 8740 7736 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_76870 9563 8751 gene locus_tag LOCUS_76880 9563 8751 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807500.1 protein_id gnl|my_center|LOCUS_76880 10222 9560 gene locus_tag LOCUS_76890 10222 9560 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 protein_id gnl|my_center|LOCUS_76890 10938 10222 gene locus_tag LOCUS_76900 10938 10222 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090326.1 protein_id gnl|my_center|LOCUS_76900 11751 10966 gene locus_tag LOCUS_76910 11751 10966 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554722.1 protein_id gnl|my_center|LOCUS_76910 >Feature sequence65 389 315 gene locus_tag LOCUS_t00530 389 315 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 562 834 gene locus_tag LOCUS_76920 562 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76920 1791 853 gene locus_tag LOCUS_76930 1791 853 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_76930 2036 1963 gene locus_tag LOCUS_t00540 2036 1963 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2233 2898 gene locus_tag LOCUS_76940 2233 2898 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_76940 3059 4474 gene locus_tag LOCUS_76950 3059 4474 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_76950 4691 5338 gene locus_tag LOCUS_76960 4691 5338 CDS product DUF2497 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967575.1 protein_id gnl|my_center|LOCUS_76960 6777 5563 gene locus_tag LOCUS_76970 6777 5563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_76970 6910 9621 gene locus_tag LOCUS_76980 6910 9621 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087247.1 protein_id gnl|my_center|LOCUS_76980 9626 10468 gene locus_tag LOCUS_76990 9626 10468 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_76990 10465 11208 gene locus_tag LOCUS_77000 10465 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77000 >Feature sequence66 794 39 gene locus_tag LOCUS_77010 794 39 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 protein_id gnl|my_center|LOCUS_77010 1946 1284 gene locus_tag LOCUS_77020 1946 1284 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532980.1 protein_id gnl|my_center|LOCUS_77020 3278 2292 gene locus_tag LOCUS_77030 3278 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77030 3355 4566 gene locus_tag LOCUS_77040 3355 4566 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088637.1 protein_id gnl|my_center|LOCUS_77040 5558 4575 gene locus_tag LOCUS_77050 5558 4575 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088636.1 protein_id gnl|my_center|LOCUS_77050 6615 5560 gene locus_tag LOCUS_77060 6615 5560 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970412.1 protein_id gnl|my_center|LOCUS_77060 6756 7910 gene locus_tag LOCUS_77070 6756 7910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088806.1 protein_id gnl|my_center|LOCUS_77070 7912 8679 gene locus_tag LOCUS_77080 7912 8679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173242.1 protein_id gnl|my_center|LOCUS_77080 8699 9958 gene locus_tag LOCUS_77090 8699 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77090 10156 10719 gene locus_tag LOCUS_77100 10156 10719 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315372.1 protein_id gnl|my_center|LOCUS_77100 >Feature sequence67 544 143 gene locus_tag LOCUS_77110 544 143 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074025552.1 protein_id gnl|my_center|LOCUS_77110 1616 558 gene locus_tag LOCUS_77120 1616 558 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_77120 2043 1645 gene locus_tag LOCUS_77130 2043 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77130 2324 3286 gene locus_tag LOCUS_77140 2324 3286 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533320.1 protein_id gnl|my_center|LOCUS_77140 3345 4328 gene locus_tag LOCUS_77150 gene nadA 3345 4328 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 protein_id gnl|my_center|LOCUS_77150 4325 5863 gene locus_tag LOCUS_77160 4325 5863 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 protein_id gnl|my_center|LOCUS_77160 5863 6714 gene locus_tag LOCUS_77170 gene nadC 5863 6714 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533323.1 protein_id gnl|my_center|LOCUS_77170 7530 6733 gene locus_tag LOCUS_77180 7530 6733 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173266.1 protein_id gnl|my_center|LOCUS_77180 8741 7653 gene locus_tag LOCUS_77190 8741 7653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971966.1 protein_id gnl|my_center|LOCUS_77190 >Feature sequence68 160 1089 gene locus_tag LOCUS_77200 160 1089 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087195.1 protein_id gnl|my_center|LOCUS_77200 1231 2451 gene locus_tag LOCUS_77210 1231 2451 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064885.1 protein_id gnl|my_center|LOCUS_77210 3778 4953 gene locus_tag LOCUS_77220 3778 4953 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966592.1 protein_id gnl|my_center|LOCUS_77220 5519 5142 gene locus_tag LOCUS_77230 5519 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77230 5818 7935 gene locus_tag LOCUS_77240 5818 7935 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085247.1 protein_id gnl|my_center|LOCUS_77240 8028 8366 gene locus_tag LOCUS_77250 8028 8366 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097074.1 protein_id gnl|my_center|LOCUS_77250 >Feature sequence69 1748 213 gene locus_tag LOCUS_77260 1748 213 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_77260 3383 1827 gene locus_tag LOCUS_77270 3383 1827 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_77270 4043 3450 gene locus_tag LOCUS_77280 4043 3450 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_77280 4192 5385 gene locus_tag LOCUS_77290 4192 5385 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111467.1 protein_id gnl|my_center|LOCUS_77290 5394 5837 gene locus_tag LOCUS_77300 5394 5837 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_77300 >Feature sequence70 379 471 gene locus_tag LOCUS_t00550 379 471 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 824 1180 gene locus_tag LOCUS_77310 824 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77310 1921 2388 gene locus_tag LOCUS_77320 1921 2388 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 protein_id gnl|my_center|LOCUS_77320 2579 3604 gene locus_tag LOCUS_77330 2579 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77330 3609 4358 gene locus_tag LOCUS_77340 gene ssuC 3609 4358 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_77340 4346 5113 gene locus_tag LOCUS_77350 4346 5113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537702.1 protein_id gnl|my_center|LOCUS_77350 >Feature sequence71 1 237 gene locus_tag LOCUS_77360 1 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77360 669 1067 gene locus_tag LOCUS_77370 669 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77370 1462 1196 gene locus_tag LOCUS_77380 gene fliQ 1462 1196 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_77380 2543 2875 gene locus_tag LOCUS_77390 2543 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77390 3276 3560 gene locus_tag LOCUS_77400 3276 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77400 3557 3754 gene locus_tag LOCUS_77410 3557 3754 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393808.1 protein_id gnl|my_center|LOCUS_77410 5283 3751 gene locus_tag LOCUS_77420 5283 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77420 >Feature sequence72 734 1162 gene locus_tag LOCUS_77430 734 1162 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388781.1 protein_id gnl|my_center|LOCUS_77430 1607 1356 gene locus_tag LOCUS_77440 1607 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77440 1512 1826 gene locus_tag LOCUS_77450 1512 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77450 2178 3116 gene locus_tag LOCUS_77460 2178 3116 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_77460 3113 4327 gene locus_tag LOCUS_77470 3113 4327 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398440.1 protein_id gnl|my_center|LOCUS_77470 4469 5002 gene locus_tag LOCUS_77480 4469 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77480 >Feature sequence73 1202 219 gene locus_tag LOCUS_77490 1202 219 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344324.1 protein_id gnl|my_center|LOCUS_77490 1992 1333 gene locus_tag LOCUS_77500 1992 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77500 2203 3036 gene locus_tag LOCUS_77510 2203 3036 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086314.1 protein_id gnl|my_center|LOCUS_77510 >Feature sequence74 688 326 gene locus_tag LOCUS_77520 688 326 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265525.1 protein_id gnl|my_center|LOCUS_77520 1928 954 gene locus_tag LOCUS_77530 1928 954 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111932.1 protein_id gnl|my_center|LOCUS_77530 2044 2547 gene locus_tag LOCUS_77540 2044 2547 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577593.1 protein_id gnl|my_center|LOCUS_77540 2924 2848 gene locus_tag LOCUS_t00560 2924 2848 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3125 2976 gene locus_tag LOCUS_77550 3125 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77550 3236 3160 gene locus_tag LOCUS_t00570 3236 3160 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence75 536 1666 gene locus_tag LOCUS_77560 536 1666 CDS product RHE_PE00001 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221101572.1 protein_id gnl|my_center|LOCUS_77560 >Feature sequence76 >Feature sequence77 492 298 gene locus_tag LOCUS_77570 492 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77570 1116 511 gene locus_tag LOCUS_77580 1116 511 CDS product DUF1419 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974880.1 protein_id gnl|my_center|LOCUS_77580 >Feature sequence78 >Feature sequence79 503 18 gene locus_tag LOCUS_77590 503 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_77590 960 586 gene locus_tag LOCUS_77600 960 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_77600