>Feature sequence001 1342 1151 gene locus_tag LOCUS_00010 1342 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1908 1339 gene locus_tag LOCUS_00020 1908 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2382 1918 gene locus_tag LOCUS_00030 2382 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4206 2464 gene locus_tag LOCUS_00040 4206 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4763 4233 gene locus_tag LOCUS_00050 4763 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6308 4830 gene locus_tag LOCUS_00060 6308 4830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_00060 7075 6305 gene locus_tag LOCUS_00070 7075 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8546 7086 gene locus_tag LOCUS_00080 8546 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137309464.1 protein_id gnl|my_center|LOCUS_00080 9944 8550 gene locus_tag LOCUS_00090 9944 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10299 9976 gene locus_tag LOCUS_00100 10299 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10696 10430 gene locus_tag LOCUS_00110 10696 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12485 10866 gene locus_tag LOCUS_00120 12485 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13205 12501 gene locus_tag LOCUS_00130 13205 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235933774.1 protein_id gnl|my_center|LOCUS_00130 14182 13211 gene locus_tag LOCUS_00140 14182 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14754 14182 gene locus_tag LOCUS_00150 14754 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14779 14826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15570 15166 gene locus_tag LOCUS_00160 15570 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16277 15567 gene locus_tag LOCUS_00170 16277 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17167 16277 gene locus_tag LOCUS_00180 17167 16277 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_00180 18264 17167 gene locus_tag LOCUS_00190 18264 17167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19501 18479 gene locus_tag LOCUS_00200 19501 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21271 19523 gene locus_tag LOCUS_00210 gene arsA 21271 19523 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095196.1 protein_id gnl|my_center|LOCUS_00210 21819 21286 gene locus_tag LOCUS_00220 gene arsD 21819 21286 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705613.1 protein_id gnl|my_center|LOCUS_00220 21818 22192 gene locus_tag LOCUS_00230 21818 22192 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777081.1 protein_id gnl|my_center|LOCUS_00230 22349 23320 gene locus_tag LOCUS_00240 gene trxB 22349 23320 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 protein_id gnl|my_center|LOCUS_00240 23317 23640 gene locus_tag LOCUS_00250 gene trxA 23317 23640 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_00250 23637 24752 gene locus_tag LOCUS_00260 gene arsB 23637 24752 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029172.1 protein_id gnl|my_center|LOCUS_00260 24749 25741 gene locus_tag LOCUS_00270 24749 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25760 26164 gene locus_tag LOCUS_00280 25760 26164 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029173.1 protein_id gnl|my_center|LOCUS_00280 26860 30426 gene locus_tag LOCUS_00290 gene mobF 26860 30426 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 protein_id gnl|my_center|LOCUS_00290 30551 31684 gene locus_tag LOCUS_00300 30551 31684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33233 31755 gene locus_tag LOCUS_00310 33233 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33857 33522 gene locus_tag LOCUS_00320 33857 33522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 >Feature sequence002 4627 5499 gene locus_tag LOCUS_00330 4627 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5662 6828 gene locus_tag LOCUS_00340 5662 6828 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079771.1 protein_id gnl|my_center|LOCUS_00340 6917 7834 gene locus_tag LOCUS_00350 6917 7834 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803754.1 protein_id gnl|my_center|LOCUS_00350 7866 8042 gene locus_tag LOCUS_00360 7866 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 8039 8533 gene locus_tag LOCUS_00370 8039 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 8598 9032 gene locus_tag LOCUS_00380 gene arr 8598 9032 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727512.1 protein_id gnl|my_center|LOCUS_00380 10490 9054 gene locus_tag LOCUS_00390 10490 9054 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027739.1 protein_id gnl|my_center|LOCUS_00390 10757 11617 gene locus_tag LOCUS_00400 10757 11617 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_00400 11714 12520 gene locus_tag LOCUS_00410 11714 12520 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_00410 12695 12620 gene locus_tag LOCUS_t00010 12695 12620 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12866 12747 gene locus_tag LOCUS_00420 12866 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 12967 12893 gene locus_tag LOCUS_t00020 12967 12893 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 13673 13074 gene locus_tag LOCUS_00430 13673 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 16345 13670 gene locus_tag LOCUS_00440 gene gyrA 16345 13670 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399363.1 protein_id gnl|my_center|LOCUS_00440 18587 16473 gene locus_tag LOCUS_00450 gene gyrB 18587 16473 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_00450 19576 18950 gene locus_tag LOCUS_00460 19576 18950 CDS product DNA replication protein DciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726604.1 protein_id gnl|my_center|LOCUS_00460 20807 19566 gene locus_tag LOCUS_00470 gene recF 20807 19566 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_00470 22023 20893 gene locus_tag LOCUS_00480 gene dnaN 22023 20893 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_00480 24086 22545 gene locus_tag LOCUS_00490 24086 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 24532 24690 gene locus_tag LOCUS_00500 gene rpmH 24532 24690 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231070.1 protein_id gnl|my_center|LOCUS_00500 24705 25127 gene locus_tag LOCUS_00510 gene rnpA 24705 25127 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777158.1 protein_id gnl|my_center|LOCUS_00510 25124 25495 gene locus_tag LOCUS_00520 25124 25495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 25601 26845 gene locus_tag LOCUS_00530 25601 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 26894 27466 gene locus_tag LOCUS_00540 26894 27466 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_00540 27470 28339 gene locus_tag LOCUS_00550 27470 28339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 29774 30145 gene locus_tag LOCUS_00560 29774 30145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 30485 31462 gene locus_tag LOCUS_00570 30485 31462 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777153.1 protein_id gnl|my_center|LOCUS_00570 31459 32541 gene locus_tag LOCUS_00580 31459 32541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00580 >Feature sequence003 1125 469 gene locus_tag LOCUS_00590 1125 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 1437 1198 gene locus_tag LOCUS_00600 1437 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 1730 1434 gene locus_tag LOCUS_00610 1730 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2031 1723 gene locus_tag LOCUS_00620 2031 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 2226 2041 gene locus_tag LOCUS_00630 2226 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2690 2223 gene locus_tag LOCUS_00640 2690 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749536.1 protein_id gnl|my_center|LOCUS_00640 3070 2690 gene locus_tag LOCUS_00650 3070 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3578 3102 gene locus_tag LOCUS_00660 3578 3102 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_00660 4831 3581 gene locus_tag LOCUS_00670 gene dnaB 4831 3581 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082792.1 protein_id gnl|my_center|LOCUS_00670 5594 4824 gene locus_tag LOCUS_00680 5594 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 5770 5597 gene locus_tag LOCUS_00690 5770 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 5997 5764 gene locus_tag LOCUS_00700 5997 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 6386 5994 gene locus_tag LOCUS_00710 6386 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 7048 6383 gene locus_tag LOCUS_00720 7048 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 7500 7102 gene locus_tag LOCUS_00730 7500 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 7709 7497 gene locus_tag LOCUS_00740 7709 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 7819 8094 gene locus_tag LOCUS_00750 7819 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8633 8091 gene locus_tag LOCUS_00760 8633 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9454 8630 gene locus_tag LOCUS_00770 9454 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 9711 9451 gene locus_tag LOCUS_00780 9711 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 9965 9708 gene locus_tag LOCUS_00790 9965 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 10692 10030 gene locus_tag LOCUS_00800 10692 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 11014 10685 gene locus_tag LOCUS_00810 11014 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11405 11007 gene locus_tag LOCUS_00820 11405 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 11985 11398 gene locus_tag LOCUS_00830 11985 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 12548 11982 gene locus_tag LOCUS_00840 12548 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 13126 12917 gene locus_tag LOCUS_00850 13126 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 13571 13356 gene locus_tag LOCUS_00860 13571 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 13832 13587 gene locus_tag LOCUS_00870 13832 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 14125 13883 gene locus_tag LOCUS_00880 14125 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 14982 14125 gene locus_tag LOCUS_00890 14982 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 15976 14984 gene locus_tag LOCUS_00900 15976 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 16253 15978 gene locus_tag LOCUS_00910 16253 15978 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296457.1 protein_id gnl|my_center|LOCUS_00910 16444 17253 gene locus_tag LOCUS_00920 16444 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 17283 17696 gene locus_tag LOCUS_00930 17283 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 18289 17822 gene locus_tag LOCUS_00940 18289 17822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 18406 19026 gene locus_tag LOCUS_00950 18406 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 19273 19926 gene locus_tag LOCUS_00960 19273 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 19923 20330 gene locus_tag LOCUS_00970 19923 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 21744 20494 gene locus_tag LOCUS_00980 21744 20494 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_00980 21999 22976 gene locus_tag LOCUS_00990 21999 22976 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence004 2094 103 gene locus_tag LOCUS_01000 gene iolD 2094 103 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_01000 2890 2174 gene locus_tag LOCUS_01010 2890 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224910.1 protein_id gnl|my_center|LOCUS_01010 4028 3069 gene locus_tag LOCUS_01020 gene iolC 4028 3069 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729991.1 protein_id gnl|my_center|LOCUS_01020 4179 4916 gene locus_tag LOCUS_01030 4179 4916 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896033.1 protein_id gnl|my_center|LOCUS_01030 5075 6211 gene locus_tag LOCUS_01040 5075 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 6437 6688 gene locus_tag LOCUS_01050 6437 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 6885 6969 gene locus_tag LOCUS_t00030 6885 6969 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7448 8803 gene locus_tag LOCUS_01060 7448 8803 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026817.1 protein_id gnl|my_center|LOCUS_01060 8797 9687 gene locus_tag LOCUS_01070 8797 9687 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_01070 9684 10565 gene locus_tag LOCUS_01080 9684 10565 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_01080 10604 11893 gene locus_tag LOCUS_01090 10604 11893 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_01090 12025 13083 gene locus_tag LOCUS_01100 12025 13083 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989566.1 protein_id gnl|my_center|LOCUS_01100 13113 14225 gene locus_tag LOCUS_01110 13113 14225 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730052.1 protein_id gnl|my_center|LOCUS_01110 15223 14273 gene locus_tag LOCUS_01120 15223 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 15503 16234 gene locus_tag LOCUS_01130 15503 16234 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811419.1 protein_id gnl|my_center|LOCUS_01130 16231 16716 gene locus_tag LOCUS_01140 16231 16716 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776669.1 protein_id gnl|my_center|LOCUS_01140 16718 18115 gene locus_tag LOCUS_01150 16718 18115 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence005 1952 750 gene locus_tag LOCUS_01160 1952 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2716 1952 gene locus_tag LOCUS_01170 2716 1952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_01170 2962 5451 gene locus_tag LOCUS_01180 2962 5451 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222920.1 protein_id gnl|my_center|LOCUS_01180 7057 5498 gene locus_tag LOCUS_01190 7057 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 8172 7054 gene locus_tag LOCUS_01200 8172 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 10258 8225 gene locus_tag LOCUS_01210 10258 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 10488 10255 gene locus_tag LOCUS_01220 10488 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 10448 10621 gene locus_tag LOCUS_01230 10448 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 10809 12023 gene locus_tag LOCUS_01240 10809 12023 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_01240 13116 11935 gene locus_tag LOCUS_01250 13116 11935 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_01250 13136 14035 gene locus_tag LOCUS_01260 13136 14035 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086670594.1 protein_id gnl|my_center|LOCUS_01260 14032 15006 gene locus_tag LOCUS_01270 14032 15006 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_01270 17617 14921 gene locus_tag LOCUS_01280 17617 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence006 1193 570 gene locus_tag LOCUS_01290 1193 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2989 1634 gene locus_tag LOCUS_01300 2989 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 3509 3111 gene locus_tag LOCUS_01310 3509 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 4507 3506 gene locus_tag LOCUS_01320 4507 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6420 4660 gene locus_tag LOCUS_01330 6420 4660 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068031.1 protein_id gnl|my_center|LOCUS_01330 7265 6906 gene locus_tag LOCUS_01340 7265 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 7773 7279 gene locus_tag LOCUS_01350 7773 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7360 7366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8411 7770 gene locus_tag LOCUS_01360 8411 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 9441 8521 gene locus_tag LOCUS_01370 9441 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030179.1 protein_id gnl|my_center|LOCUS_01370 10676 9675 gene locus_tag LOCUS_01380 10676 9675 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211285741.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01380 11027 11212 gene locus_tag LOCUS_01390 11027 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 12470 11361 gene locus_tag LOCUS_01400 12470 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 14056 13118 gene locus_tag LOCUS_01410 14056 13118 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 protein_id gnl|my_center|LOCUS_01410 15117 15368 gene locus_tag LOCUS_01420 15117 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 15867 15427 gene locus_tag LOCUS_01430 15867 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 16991 16272 gene locus_tag LOCUS_01440 16991 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 >Feature sequence007 919 380 gene locus_tag LOCUS_01450 919 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1838 921 gene locus_tag LOCUS_01460 1838 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2425 2622 gene locus_tag LOCUS_01470 2425 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01470 2717 3508 gene locus_tag LOCUS_01480 2717 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4976 3666 gene locus_tag LOCUS_01490 4976 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4975 5238 gene locus_tag LOCUS_01500 4975 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 5566 6285 gene locus_tag LOCUS_01510 5566 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6533 6460 gene locus_tag LOCUS_t00040 6533 6460 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7967 6552 gene locus_tag LOCUS_01520 7967 6552 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_01520 9235 8069 gene locus_tag LOCUS_01530 9235 8069 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_01530 9499 9239 gene locus_tag LOCUS_01540 9499 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 9708 9496 gene locus_tag LOCUS_01550 9708 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 10121 9705 gene locus_tag LOCUS_01560 10121 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 10812 10174 gene locus_tag LOCUS_01570 10812 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 11098 11337 gene locus_tag LOCUS_01580 11098 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 11337 11534 gene locus_tag LOCUS_01590 11337 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 11602 11964 gene locus_tag LOCUS_01600 11602 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 11964 12161 gene locus_tag LOCUS_01610 11964 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 12238 12588 gene locus_tag LOCUS_01620 12238 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12585 12827 gene locus_tag LOCUS_01630 12585 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 12965 13306 gene locus_tag LOCUS_01640 12965 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13303 14115 gene locus_tag LOCUS_01650 13303 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 14183 14854 gene locus_tag LOCUS_01660 14183 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence008 210 1037 gene locus_tag LOCUS_01670 210 1037 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_01670 1087 3231 gene locus_tag LOCUS_01680 1087 3231 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_01680 3228 3806 gene locus_tag LOCUS_01690 3228 3806 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_01690 4373 13774 gene locus_tag LOCUS_01700 4373 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 <14914 14125 gene locus_tag LOCUS_01710 <14914 14125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974808.1:DUF2993 domain-containing protein >Feature sequence009 558 1478 gene locus_tag LOCUS_01720 558 1478 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_01720 1475 2548 gene locus_tag LOCUS_01730 1475 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2891 2631 gene locus_tag LOCUS_01740 2891 2631 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225295.1 protein_id gnl|my_center|LOCUS_01740 3314 2952 gene locus_tag LOCUS_01750 3314 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3652 3311 gene locus_tag LOCUS_01760 3652 3311 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876749.1 protein_id gnl|my_center|LOCUS_01760 5068 3665 gene locus_tag LOCUS_01770 gene mgtE 5068 3665 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898415.1 protein_id gnl|my_center|LOCUS_01770 5531 6463 gene locus_tag LOCUS_01780 5531 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5543 5559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6574 6501 gene locus_tag LOCUS_t00050 6574 6501 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6900 7973 gene locus_tag LOCUS_01790 6900 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 8022 12170 gene locus_tag LOCUS_01800 8022 12170 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383585.1 protein_id gnl|my_center|LOCUS_01800 13309 12302 gene locus_tag LOCUS_01810 13309 12302 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804785.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence010 1056 94 gene locus_tag LOCUS_01820 1056 94 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_01820 1469 3541 gene locus_tag LOCUS_01830 1469 3541 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 protein_id gnl|my_center|LOCUS_01830 4571 3546 gene locus_tag LOCUS_01840 4571 3546 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_01840 5033 6370 gene locus_tag LOCUS_01850 5033 6370 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973466.1 protein_id gnl|my_center|LOCUS_01850 6364 7296 gene locus_tag LOCUS_01860 6364 7296 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_01860 7293 8168 gene locus_tag LOCUS_01870 7293 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8179 10995 gene locus_tag LOCUS_01880 8179 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393207.1 protein_id gnl|my_center|LOCUS_01880 10985 12133 gene locus_tag LOCUS_01890 10985 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12130 12960 gene locus_tag LOCUS_01900 gene kduI 12130 12960 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010741491.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence011 3126 2074 gene locus_tag LOCUS_01910 3126 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4311 3292 gene locus_tag LOCUS_01920 4311 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4595 5566 gene locus_tag LOCUS_01930 4595 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5563 6906 gene locus_tag LOCUS_01940 5563 6906 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_01940 7131 7802 gene locus_tag LOCUS_01950 7131 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 7825 8364 gene locus_tag LOCUS_01960 7825 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8510 8839 gene locus_tag LOCUS_01970 8510 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 9139 9441 gene locus_tag LOCUS_01980 9139 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 9498 10016 gene locus_tag LOCUS_01990 9498 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10669 11337 gene locus_tag LOCUS_02000 10669 11337 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_02000 11943 11383 gene locus_tag LOCUS_02010 11943 11383 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_02010 13053 12262 gene locus_tag LOCUS_02020 13053 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence012 <1 580 gene locus_tag LOCUS_02030 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929921.1:serine O-acetyltransferase 1145 639 gene locus_tag LOCUS_02040 1145 639 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776814.1 protein_id gnl|my_center|LOCUS_02040 2240 1224 gene locus_tag LOCUS_02050 2240 1224 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804784.1 protein_id gnl|my_center|LOCUS_02050 2631 2233 gene locus_tag LOCUS_02060 2631 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 2709 3536 gene locus_tag LOCUS_02070 2709 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 4019 3552 gene locus_tag LOCUS_02080 4019 3552 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_02080 5175 4084 gene locus_tag LOCUS_02090 5175 4084 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_02090 5294 7369 gene locus_tag LOCUS_02100 5294 7369 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089548.1 protein_id gnl|my_center|LOCUS_02100 8043 7531 gene locus_tag LOCUS_02110 8043 7531 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_02110 8366 8040 gene locus_tag LOCUS_02120 8366 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 8572 9408 gene locus_tag LOCUS_02130 8572 9408 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729055.1 protein_id gnl|my_center|LOCUS_02130 10067 9435 gene locus_tag LOCUS_02140 10067 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 10675 10067 gene locus_tag LOCUS_02150 10675 10067 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_02150 11208 10672 gene locus_tag LOCUS_02160 11208 10672 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_02160 11349 12029 gene locus_tag LOCUS_02170 11349 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137447494.1 protein_id gnl|my_center|LOCUS_02170 >Feature sequence013 3137 36 gene locus_tag LOCUS_02180 3137 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3171 3611 gene locus_tag LOCUS_02190 3171 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4313 3804 gene locus_tag LOCUS_02200 4313 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5150 4404 gene locus_tag LOCUS_02210 5150 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5641 5228 gene locus_tag LOCUS_02220 5641 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 5991 5638 gene locus_tag LOCUS_02230 5991 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 6329 5988 gene locus_tag LOCUS_02240 6329 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 6739 6326 gene locus_tag LOCUS_02250 6739 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7134 6751 gene locus_tag LOCUS_02260 7134 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 8194 7196 gene locus_tag LOCUS_02270 8194 7196 CDS product DUF5309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093935635.1 protein_id gnl|my_center|LOCUS_02270 8791 8222 gene locus_tag LOCUS_02280 8791 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 9582 8878 gene locus_tag LOCUS_02290 9582 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 11035 9566 gene locus_tag LOCUS_02300 11035 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 12555 11032 gene locus_tag LOCUS_02310 12555 11032 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256853.1 protein_id gnl|my_center|LOCUS_02310 12712 12467 gene locus_tag LOCUS_02320 12712 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence014 1207 797 gene locus_tag LOCUS_02330 1207 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 1397 1906 gene locus_tag LOCUS_02340 1397 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 1903 3129 gene locus_tag LOCUS_02350 1903 3129 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401927.1 protein_id gnl|my_center|LOCUS_02350 4810 3206 gene locus_tag LOCUS_02360 4810 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02360 4828 4850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5797 5393 gene locus_tag LOCUS_02370 5797 5393 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897109.1 protein_id gnl|my_center|LOCUS_02370 5855 6211 gene locus_tag LOCUS_02380 5855 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6995 6360 gene locus_tag LOCUS_02390 gene upp 6995 6360 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803985.1 protein_id gnl|my_center|LOCUS_02390 6957 7535 gene locus_tag LOCUS_02400 6957 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 7942 7556 gene locus_tag LOCUS_02410 gene crcB 7942 7556 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531444.1 protein_id gnl|my_center|LOCUS_02410 8376 7939 gene locus_tag LOCUS_02420 8376 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9368 8373 gene locus_tag LOCUS_02430 9368 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_02430 9476 9563 gene locus_tag LOCUS_t00060 9476 9563 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10158 9646 gene locus_tag LOCUS_02440 10158 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10945 10301 gene locus_tag LOCUS_02450 10945 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11296 11000 gene locus_tag LOCUS_02460 11296 11000 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_02460 11470 12426 gene locus_tag LOCUS_02470 11470 12426 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence015 1176 142 gene locus_tag LOCUS_02480 1176 142 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 protein_id gnl|my_center|LOCUS_02480 1298 1786 gene locus_tag LOCUS_02490 1298 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 2896 1796 gene locus_tag LOCUS_02500 2896 1796 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929959.1 protein_id gnl|my_center|LOCUS_02500 3009 3911 gene locus_tag LOCUS_02510 3009 3911 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728589.1 protein_id gnl|my_center|LOCUS_02510 4857 3937 gene locus_tag LOCUS_02520 gene sigJ 4857 3937 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_02520 5029 5358 gene locus_tag LOCUS_02530 5029 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5355 6059 gene locus_tag LOCUS_02540 5355 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6719 6066 gene locus_tag LOCUS_02550 6719 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 6943 8676 gene locus_tag LOCUS_02560 gene poxB 6943 8676 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729435.1 protein_id gnl|my_center|LOCUS_02560 8689 9411 gene locus_tag LOCUS_02570 8689 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02570 9521 10375 gene locus_tag LOCUS_02580 9521 10375 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013925029.1 protein_id gnl|my_center|LOCUS_02580 10421 11074 gene locus_tag LOCUS_02590 10421 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 11516 11145 gene locus_tag LOCUS_02600 11516 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 <12495 11574 gene locus_tag LOCUS_02610 <12495 11574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229356.1:lipase family protein >Feature sequence016 1090 782 gene locus_tag LOCUS_02620 1090 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_02620 1275 1141 gene locus_tag LOCUS_02630 1275 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02630 2061 2606 gene locus_tag LOCUS_02640 2061 2606 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974845.1 protein_id gnl|my_center|LOCUS_02640 3090 2644 gene locus_tag LOCUS_02650 3090 2644 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_02650 3416 3165 gene locus_tag LOCUS_02660 3416 3165 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 protein_id gnl|my_center|LOCUS_02660 4888 3416 gene locus_tag LOCUS_02670 gene atpD 4888 3416 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_02670 5823 4933 gene locus_tag LOCUS_02680 5823 4933 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_02680 7454 5826 gene locus_tag LOCUS_02690 gene atpA 7454 5826 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_02690 8338 7526 gene locus_tag LOCUS_02700 8338 7526 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_02700 8922 8338 gene locus_tag LOCUS_02710 8922 8338 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775942.1 protein_id gnl|my_center|LOCUS_02710 9143 8922 gene locus_tag LOCUS_02720 9143 8922 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_02720 10046 9261 gene locus_tag LOCUS_02730 gene atpB 10046 9261 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775944.1 protein_id gnl|my_center|LOCUS_02730 10773 10291 gene locus_tag LOCUS_02740 10773 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 11953 10844 gene locus_tag LOCUS_02750 11953 10844 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence017 102 2555 gene locus_tag LOCUS_02760 102 2555 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02760 2552 4240 gene locus_tag LOCUS_02770 2552 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4237 4950 gene locus_tag LOCUS_02780 4237 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4947 6122 gene locus_tag LOCUS_02790 gene cas7e 4947 6122 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227612.1 protein_id gnl|my_center|LOCUS_02790 6119 6883 gene locus_tag LOCUS_02800 gene cas5e 6119 6883 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_02800 6880 7551 gene locus_tag LOCUS_02810 gene cas6e 6880 7551 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_02810 7548 8516 gene locus_tag LOCUS_02820 gene cas1e 7548 8516 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_02820 8513 8917 gene locus_tag LOCUS_02830 8513 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9012 9518 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgcatacgcggggagcac 9519 9669 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9674 10251 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaccatccccgcatacgcggggagcac 11889 10339 gene locus_tag LOCUS_02840 11889 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence018 <1 754 gene locus_tag LOCUS_02850 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000222918.1:FGGY-family carbohydrate kinase 751 1383 gene locus_tag LOCUS_02860 gene hxlA 751 1383 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776031.1 protein_id gnl|my_center|LOCUS_02860 1376 2332 gene locus_tag LOCUS_02870 gene ulaE 1376 2332 CDS product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949539.1 protein_id gnl|my_center|LOCUS_02870 2352 3029 gene locus_tag LOCUS_02880 2352 3029 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_02880 4195 3026 gene locus_tag LOCUS_02890 4195 3026 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027128.1 protein_id gnl|my_center|LOCUS_02890 4302 5591 gene locus_tag LOCUS_02900 4302 5591 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775732.1 protein_id gnl|my_center|LOCUS_02900 5588 6526 gene locus_tag LOCUS_02910 5588 6526 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829947.1 protein_id gnl|my_center|LOCUS_02910 6535 7362 gene locus_tag LOCUS_02920 6535 7362 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804058.1 protein_id gnl|my_center|LOCUS_02920 7367 9448 gene locus_tag LOCUS_02930 7367 9448 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_02930 8104 8120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9445 10656 gene locus_tag LOCUS_02940 9445 10656 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027463.1 protein_id gnl|my_center|LOCUS_02940 10656 11579 gene locus_tag LOCUS_02950 10656 11579 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068666.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence019 1684 788 gene locus_tag LOCUS_02960 1684 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 1778 3022 gene locus_tag LOCUS_02970 1778 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 3121 2930 gene locus_tag LOCUS_02980 3121 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3138 4277 gene locus_tag LOCUS_02990 3138 4277 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_02990 4274 5302 gene locus_tag LOCUS_03000 4274 5302 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742155.1 protein_id gnl|my_center|LOCUS_03000 5378 6373 gene locus_tag LOCUS_03010 gene rfbB 5378 6373 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080535.1 protein_id gnl|my_center|LOCUS_03010 6676 7722 gene locus_tag LOCUS_03020 6676 7722 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776104.1 protein_id gnl|my_center|LOCUS_03020 7746 8321 gene locus_tag LOCUS_03030 gene rfbC 7746 8321 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015242878.1 protein_id gnl|my_center|LOCUS_03030 9512 8328 gene locus_tag LOCUS_03040 gene manA 9512 8328 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803907.1 protein_id gnl|my_center|LOCUS_03040 9550 10728 gene locus_tag LOCUS_03050 9550 10728 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_03050 10725 11276 gene locus_tag LOCUS_03060 gene purE 10725 11276 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776122.1 protein_id gnl|my_center|LOCUS_03060 <12070 11303 gene locus_tag LOCUS_03070 <12070 11303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257054.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence020 538 1512 gene locus_tag LOCUS_03080 538 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1509 2504 gene locus_tag LOCUS_03090 1509 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03090 2401 2486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2501 2668 gene locus_tag LOCUS_03100 2501 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 2665 3756 gene locus_tag LOCUS_03110 2665 3756 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112992.1 protein_id gnl|my_center|LOCUS_03110 3753 4658 gene locus_tag LOCUS_03120 3753 4658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_03120 4637 5494 gene locus_tag LOCUS_03130 4637 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence021 83 667 gene locus_tag LOCUS_03140 83 667 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815675.1 protein_id gnl|my_center|LOCUS_03140 994 1188 gene locus_tag LOCUS_03150 gene infA 994 1188 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_03150 1192 1371 gene locus_tag LOCUS_03160 1192 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1560 1940 gene locus_tag LOCUS_03170 gene rpsM 1560 1940 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_03170 2034 2444 gene locus_tag LOCUS_03180 gene rpsK 2034 2444 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_03180 2563 3576 gene locus_tag LOCUS_03190 2563 3576 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_03190 3633 4223 gene locus_tag LOCUS_03200 3633 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4464 5939 gene locus_tag LOCUS_03210 4464 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 6765 6010 gene locus_tag LOCUS_03220 6765 6010 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_03220 6813 7649 gene locus_tag LOCUS_03230 gene truA 6813 7649 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_03230 8201 7734 gene locus_tag LOCUS_03240 8201 7734 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_03240 8578 9021 gene locus_tag LOCUS_03250 gene rplM 8578 9021 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_03250 9077 9562 gene locus_tag LOCUS_03260 gene rpsI 9077 9562 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_03260 9568 10947 gene locus_tag LOCUS_03270 gene glmM 9568 10947 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051299.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence022 517 1485 gene locus_tag LOCUS_03280 517 1485 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 protein_id gnl|my_center|LOCUS_03280 1482 2132 gene locus_tag LOCUS_03290 1482 2132 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803752.1 protein_id gnl|my_center|LOCUS_03290 2137 3246 gene locus_tag LOCUS_03300 2137 3246 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081179.1 protein_id gnl|my_center|LOCUS_03300 3295 4023 gene locus_tag LOCUS_03310 3295 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 4639 4295 gene locus_tag LOCUS_03320 4639 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 4831 5538 gene locus_tag LOCUS_03330 4831 5538 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228712.1 protein_id gnl|my_center|LOCUS_03330 5535 6818 gene locus_tag LOCUS_03340 5535 6818 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_03340 6837 7592 gene locus_tag LOCUS_03350 6837 7592 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650958.1 protein_id gnl|my_center|LOCUS_03350 8275 7520 gene locus_tag LOCUS_03360 8275 7520 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_03360 10340 8493 gene locus_tag LOCUS_03370 10340 8493 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804947.1 protein_id gnl|my_center|LOCUS_03370 10745 10530 gene locus_tag LOCUS_03380 10745 10530 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 protein_id gnl|my_center|LOCUS_03380 11221 10745 gene locus_tag LOCUS_03390 11221 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence023 665 1090 gene locus_tag LOCUS_03400 gene sdhC 665 1090 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_03400 1092 1547 gene locus_tag LOCUS_03410 gene sdhD 1092 1547 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776148.1 protein_id gnl|my_center|LOCUS_03410 1620 3398 gene locus_tag LOCUS_03420 gene sdhA 1620 3398 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776149.1 protein_id gnl|my_center|LOCUS_03420 3398 4165 gene locus_tag LOCUS_03430 3398 4165 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776150.1 protein_id gnl|my_center|LOCUS_03430 5499 4303 gene locus_tag LOCUS_03440 5499 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 6103 5528 gene locus_tag LOCUS_03450 6103 5528 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_03450 7119 6100 gene locus_tag LOCUS_03460 gene trpS 7119 6100 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 protein_id gnl|my_center|LOCUS_03460 7979 7230 gene locus_tag LOCUS_03470 7979 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7850 7868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8140 7976 gene locus_tag LOCUS_03480 8140 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8263 8694 gene locus_tag LOCUS_03490 8263 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 8727 9953 gene locus_tag LOCUS_03500 gene galK 8727 9953 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 protein_id gnl|my_center|LOCUS_03500 10284 10508 gene locus_tag LOCUS_03510 10284 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10489 10494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10540 11331 gene locus_tag LOCUS_03520 10540 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence024 <1 1401 gene locus_tag LOCUS_03530 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030063223.1:phage/plasmid primase, P4 family 1617 2075 gene locus_tag LOCUS_03540 1617 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2088 2684 gene locus_tag LOCUS_03550 2088 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2681 3616 gene locus_tag LOCUS_03560 2681 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 3755 4258 gene locus_tag LOCUS_03570 3755 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 4255 5481 gene locus_tag LOCUS_03580 4255 5481 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_03580 5507 7201 gene locus_tag LOCUS_03590 5507 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 7212 8291 gene locus_tag LOCUS_03600 7212 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 8469 8293 gene locus_tag LOCUS_03610 8469 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 8578 9360 gene locus_tag LOCUS_03620 8578 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 9375 10325 gene locus_tag LOCUS_03630 9375 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10396 10581 gene locus_tag LOCUS_03640 10396 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 10595 11032 gene locus_tag LOCUS_03650 10595 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 11029 11340 gene locus_tag LOCUS_03660 11029 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence025 465 1142 gene locus_tag LOCUS_03670 465 1142 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972189.1 protein_id gnl|my_center|LOCUS_03670 1139 1615 gene locus_tag LOCUS_03680 1139 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1615 2097 gene locus_tag LOCUS_03690 1615 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2130 2507 gene locus_tag LOCUS_03700 2130 2507 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092936.1 protein_id gnl|my_center|LOCUS_03700 3444 2500 gene locus_tag LOCUS_03710 3444 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4502 3645 gene locus_tag LOCUS_03720 4502 3645 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819301.1 protein_id gnl|my_center|LOCUS_03720 5015 4590 gene locus_tag LOCUS_03730 5015 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 5110 5418 gene locus_tag LOCUS_03740 5110 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 6099 5428 gene locus_tag LOCUS_03750 6099 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6255 7289 gene locus_tag LOCUS_03760 gene mgrA 6255 7289 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227010.1 protein_id gnl|my_center|LOCUS_03760 8012 7323 gene locus_tag LOCUS_03770 8012 7323 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930016.1 protein_id gnl|my_center|LOCUS_03770 9336 8005 gene locus_tag LOCUS_03780 9336 8005 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_03780 9500 10420 gene locus_tag LOCUS_03790 9500 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11182 10481 gene locus_tag LOCUS_03800 11182 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence026 1704 124 gene locus_tag LOCUS_03810 1704 124 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_03810 1941 3086 gene locus_tag LOCUS_03820 1941 3086 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461386.1 protein_id gnl|my_center|LOCUS_03820 3144 3902 gene locus_tag LOCUS_03830 3144 3902 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771718.1 protein_id gnl|my_center|LOCUS_03830 3917 4576 gene locus_tag LOCUS_03840 3917 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4578 5888 gene locus_tag LOCUS_03850 4578 5888 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461382.1 protein_id gnl|my_center|LOCUS_03850 5885 6172 gene locus_tag LOCUS_03860 5885 6172 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461381.1 protein_id gnl|my_center|LOCUS_03860 7106 6426 gene locus_tag LOCUS_03870 7106 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 7620 7126 gene locus_tag LOCUS_03880 7620 7126 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_03880 8232 7678 gene locus_tag LOCUS_03890 8232 7678 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224134.1 protein_id gnl|my_center|LOCUS_03890 8340 10103 gene locus_tag LOCUS_03900 8340 10103 CDS product 3-ketosteroid-delta-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728641.1 protein_id gnl|my_center|LOCUS_03900 11151 10171 gene locus_tag LOCUS_03910 11151 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence027 12 920 gene locus_tag LOCUS_03920 12 920 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978412.1 protein_id gnl|my_center|LOCUS_03920 950 1792 gene locus_tag LOCUS_03930 950 1792 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978411.1 protein_id gnl|my_center|LOCUS_03930 1795 4092 gene locus_tag LOCUS_03940 1795 4092 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027130.1 protein_id gnl|my_center|LOCUS_03940 4079 5176 gene locus_tag LOCUS_03950 4079 5176 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027128.1 protein_id gnl|my_center|LOCUS_03950 5295 5786 gene locus_tag LOCUS_03960 5295 5786 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_03960 5783 6907 gene locus_tag LOCUS_03970 5783 6907 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704265.1 protein_id gnl|my_center|LOCUS_03970 8142 6904 gene locus_tag LOCUS_03980 8142 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067991.1 protein_id gnl|my_center|LOCUS_03980 9452 8157 gene locus_tag LOCUS_03990 9452 8157 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222813.1 protein_id gnl|my_center|LOCUS_03990 11125 9650 gene locus_tag LOCUS_04000 11125 9650 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence028 4285 3437 gene locus_tag LOCUS_04010 4285 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4373 4939 gene locus_tag LOCUS_04020 4373 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 5053 6525 gene locus_tag LOCUS_04030 gene cls 5053 6525 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804433.1 protein_id gnl|my_center|LOCUS_04030 7247 6534 gene locus_tag LOCUS_04040 7247 6534 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_04040 7283 7843 gene locus_tag LOCUS_04050 7283 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7840 8379 gene locus_tag LOCUS_04060 7840 8379 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776020.1 protein_id gnl|my_center|LOCUS_04060 8496 9242 gene locus_tag LOCUS_04070 8496 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 10990 9290 gene locus_tag LOCUS_04080 10990 9290 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775784.1 protein_id gnl|my_center|LOCUS_04080 11232 11008 gene locus_tag LOCUS_04090 11232 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence029 887 180 gene locus_tag LOCUS_04100 887 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04100 1565 1041 gene locus_tag LOCUS_04110 1565 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04110 2597 1683 gene locus_tag LOCUS_04120 2597 1683 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776806.1 protein_id gnl|my_center|LOCUS_04120 3430 2594 gene locus_tag LOCUS_04130 3430 2594 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776805.1 protein_id gnl|my_center|LOCUS_04130 3921 5915 gene locus_tag LOCUS_04140 3921 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5963 6382 gene locus_tag LOCUS_04150 5963 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6489 6923 gene locus_tag LOCUS_04160 6489 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7068 10154 gene locus_tag LOCUS_04170 7068 10154 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence030 <1 6007 gene locus_tag LOCUS_04180 <1 6007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766191.1:family 43 glycosylhydrolase 6965 6102 gene locus_tag LOCUS_04190 6965 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 7095 7778 gene locus_tag LOCUS_04200 gene mtrA 7095 7778 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_04200 7762 9408 gene locus_tag LOCUS_04210 gene mtrB 7762 9408 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776080.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence031 601 188 gene locus_tag LOCUS_04220 601 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 713 961 gene locus_tag LOCUS_04230 713 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 1692 994 gene locus_tag LOCUS_04240 1692 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2272 1736 gene locus_tag LOCUS_04250 2272 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3866 2589 gene locus_tag LOCUS_04260 gene eno 3866 2589 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_04260 5179 4148 gene locus_tag LOCUS_04270 5179 4148 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_04270 5308 6672 gene locus_tag LOCUS_04280 5308 6672 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027554.1 protein_id gnl|my_center|LOCUS_04280 6669 7598 gene locus_tag LOCUS_04290 6669 7598 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977766.1 protein_id gnl|my_center|LOCUS_04290 7602 8483 gene locus_tag LOCUS_04300 7602 8483 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977767.1 protein_id gnl|my_center|LOCUS_04300 8542 10677 gene locus_tag LOCUS_04310 8542 10677 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027553.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence032 <1 1482 gene locus_tag LOCUS_04320 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009993979.1:anchored repeat ABC transporter, substrate-binding protein 1490 2572 gene locus_tag LOCUS_04330 1490 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2565 3329 gene locus_tag LOCUS_04340 2565 3329 CDS product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 protein_id gnl|my_center|LOCUS_04340 3313 4203 gene locus_tag LOCUS_04350 3313 4203 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_04350 4352 4909 gene locus_tag LOCUS_04360 4352 4909 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528197.1 protein_id gnl|my_center|LOCUS_04360 5632 4940 gene locus_tag LOCUS_04370 5632 4940 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114389.1 protein_id gnl|my_center|LOCUS_04370 6279 5629 gene locus_tag LOCUS_04380 6279 5629 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_04380 7383 6379 gene locus_tag LOCUS_04390 7383 6379 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_04390 7446 9215 gene locus_tag LOCUS_04400 7446 9215 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053142070.1 protein_id gnl|my_center|LOCUS_04400 9365 9592 gene locus_tag LOCUS_04410 9365 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9779 9695 gene locus_tag LOCUS_t00070 9779 9695 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10304 9828 gene locus_tag LOCUS_04420 gene bcp 10304 9828 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_04420 10568 10643 gene locus_tag LOCUS_t00080 10568 10643 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 1550 669 gene locus_tag LOCUS_04430 1550 669 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_04430 2623 1547 gene locus_tag LOCUS_04440 2623 1547 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_04440 3747 2620 gene locus_tag LOCUS_04450 3747 2620 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859750.1 protein_id gnl|my_center|LOCUS_04450 3962 7624 gene locus_tag LOCUS_04460 3962 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 8414 7725 gene locus_tag LOCUS_04470 8414 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 8492 9094 gene locus_tag LOCUS_04480 8492 9094 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_04480 9635 9132 gene locus_tag LOCUS_04490 9635 9132 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052361.1 protein_id gnl|my_center|LOCUS_04490 10863 9679 gene locus_tag LOCUS_04500 10863 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence034 422 108 gene locus_tag LOCUS_04510 422 108 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742202.1 protein_id gnl|my_center|LOCUS_04510 825 415 gene locus_tag LOCUS_04520 825 415 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225922.1 protein_id gnl|my_center|LOCUS_04520 942 2171 gene locus_tag LOCUS_04530 942 2171 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_04530 2168 3499 gene locus_tag LOCUS_04540 2168 3499 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_04540 4965 3538 gene locus_tag LOCUS_04550 4965 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5689 4967 gene locus_tag LOCUS_04560 5689 4967 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730369.1 protein_id gnl|my_center|LOCUS_04560 5814 6347 gene locus_tag LOCUS_04570 5814 6347 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 protein_id gnl|my_center|LOCUS_04570 6469 6543 gene locus_tag LOCUS_t00090 6469 6543 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6868 6545 gene locus_tag LOCUS_04580 6868 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 7849 6908 gene locus_tag LOCUS_04590 7849 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 8630 7983 gene locus_tag LOCUS_04600 8630 7983 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775846.1 protein_id gnl|my_center|LOCUS_04600 9025 8639 gene locus_tag LOCUS_04610 gene rsfS 9025 8639 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775847.1 protein_id gnl|my_center|LOCUS_04610 10122 9052 gene locus_tag LOCUS_04620 10122 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 10748 10119 gene locus_tag LOCUS_04630 gene nadD 10748 10119 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775849.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence035 3485 1965 gene locus_tag LOCUS_04640 gene mqo 3485 1965 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_04640 4137 3505 gene locus_tag LOCUS_04650 4137 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4474 4166 gene locus_tag LOCUS_04660 4474 4166 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402188.1 protein_id gnl|my_center|LOCUS_04660 5311 4637 gene locus_tag LOCUS_04670 5311 4637 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804387.1 protein_id gnl|my_center|LOCUS_04670 5375 6247 gene locus_tag LOCUS_04680 5375 6247 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_04680 6458 6946 gene locus_tag LOCUS_04690 6458 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7355 7074 gene locus_tag LOCUS_04700 7355 7074 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402188.1 protein_id gnl|my_center|LOCUS_04700 7756 7352 gene locus_tag LOCUS_04710 7756 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8167 7766 gene locus_tag LOCUS_04720 8167 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 8244 8477 gene locus_tag LOCUS_04730 8244 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8544 8819 gene locus_tag LOCUS_04740 8544 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 8982 9389 gene locus_tag LOCUS_04750 8982 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 9562 10242 gene locus_tag LOCUS_04760 9562 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence036 1024 212 gene locus_tag LOCUS_04770 1024 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 1590 1018 gene locus_tag LOCUS_04780 1590 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2565 1687 gene locus_tag LOCUS_04790 2565 1687 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223226.1 protein_id gnl|my_center|LOCUS_04790 4700 2562 gene locus_tag LOCUS_04800 4700 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4772 5377 gene locus_tag LOCUS_04810 4772 5377 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_04810 5915 5541 gene locus_tag LOCUS_04820 5915 5541 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169809.1 protein_id gnl|my_center|LOCUS_04820 8242 6071 gene locus_tag LOCUS_04830 8242 6071 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901403.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence037 1020 70 gene locus_tag LOCUS_04840 1020 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3263 1017 gene locus_tag LOCUS_04850 3263 1017 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 protein_id gnl|my_center|LOCUS_04850 4214 3333 gene locus_tag LOCUS_04860 4214 3333 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_04860 5137 4217 gene locus_tag LOCUS_04870 5137 4217 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_04870 6438 5149 gene locus_tag LOCUS_04880 6438 5149 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218106651.1 protein_id gnl|my_center|LOCUS_04880 6601 7665 gene locus_tag LOCUS_04890 6601 7665 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405541.1 protein_id gnl|my_center|LOCUS_04890 8648 7692 gene locus_tag LOCUS_04900 8648 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 8909 9250 gene locus_tag LOCUS_04910 8909 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 9741 9355 gene locus_tag LOCUS_04920 9741 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence038 3561 724 gene locus_tag LOCUS_04930 3561 724 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_04930 4533 3571 gene locus_tag LOCUS_04940 4533 3571 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411603.1 protein_id gnl|my_center|LOCUS_04940 4870 4541 gene locus_tag LOCUS_04950 4870 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5850 4870 gene locus_tag LOCUS_04960 5850 4870 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_04960 6799 5843 gene locus_tag LOCUS_04970 6799 5843 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_04970 7302 6811 gene locus_tag LOCUS_04980 7302 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7697 8131 gene locus_tag LOCUS_04990 7697 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 8637 8155 gene locus_tag LOCUS_05000 8637 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 9554 8640 gene locus_tag LOCUS_05010 gene hisG 9554 8640 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805206.1 protein_id gnl|my_center|LOCUS_05010 9814 9551 gene locus_tag LOCUS_05020 9814 9551 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 protein_id gnl|my_center|LOCUS_05020 10505 9837 gene locus_tag LOCUS_05030 10505 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05030 >Feature sequence039 382 179 gene locus_tag LOCUS_05040 382 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 576 893 gene locus_tag LOCUS_05050 576 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1420 3006 gene locus_tag LOCUS_05060 1420 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4239 3256 gene locus_tag LOCUS_05070 4239 3256 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_05070 4406 5293 gene locus_tag LOCUS_05080 4406 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5381 7537 gene locus_tag LOCUS_05090 5381 7537 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_05090 5639 5550 gene locus_tag LOCUS_t00100 5639 5550 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8567 7572 gene locus_tag LOCUS_05100 8567 7572 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_05100 9511 8609 gene locus_tag LOCUS_05110 9511 8609 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_05110 10389 9508 gene locus_tag LOCUS_05120 10389 9508 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence040 156 944 gene locus_tag LOCUS_05130 156 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 941 1681 gene locus_tag LOCUS_05140 941 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3001 1709 gene locus_tag LOCUS_05150 3001 1709 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_05150 3867 3085 gene locus_tag LOCUS_05160 3867 3085 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776010.1 protein_id gnl|my_center|LOCUS_05160 5119 3992 gene locus_tag LOCUS_05170 gene ugpC 5119 3992 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015140.1 protein_id gnl|my_center|LOCUS_05170 6145 5309 gene locus_tag LOCUS_05180 6145 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 7601 6138 gene locus_tag LOCUS_05190 7601 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 7639 9354 gene locus_tag LOCUS_05200 7639 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 <10052 9528 gene locus_tag LOCUS_05210 <10052 9528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776430.1:TrkA family potassium uptake protein >Feature sequence041 <1 1792 gene locus_tag LOCUS_05220 <1 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027769.1:HSP90 family protein 1789 3858 gene locus_tag LOCUS_05230 1789 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4151 3978 gene locus_tag LOCUS_05240 4151 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6571 4217 gene locus_tag LOCUS_05250 6571 4217 CDS product carbon starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905321.1 protein_id gnl|my_center|LOCUS_05250 <10023 6751 gene locus_tag LOCUS_05260 <10023 6751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775966.1:multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit >Feature sequence042 437 1003 gene locus_tag LOCUS_05270 437 1003 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777132.1 protein_id gnl|my_center|LOCUS_05270 1353 2093 gene locus_tag LOCUS_05280 1353 2093 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053191.1 protein_id gnl|my_center|LOCUS_05280 2090 3673 gene locus_tag LOCUS_05290 2090 3673 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804419.1 protein_id gnl|my_center|LOCUS_05290 3796 4875 gene locus_tag LOCUS_05300 3796 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4933 5226 gene locus_tag LOCUS_05310 4933 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5915 5601 gene locus_tag LOCUS_05320 5915 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6077 7519 gene locus_tag LOCUS_05330 6077 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7516 8109 gene locus_tag LOCUS_05340 7516 8109 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_05340 8121 9038 gene locus_tag LOCUS_05350 8121 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 9127 9789 gene locus_tag LOCUS_05360 9127 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence043 1031 66 gene locus_tag LOCUS_05370 1031 66 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055566.1 protein_id gnl|my_center|LOCUS_05370 2375 1095 gene locus_tag LOCUS_05380 2375 1095 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321046.1 protein_id gnl|my_center|LOCUS_05380 3852 3172 gene locus_tag LOCUS_05390 3852 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130168.1 protein_id gnl|my_center|LOCUS_05390 3907 4371 gene locus_tag LOCUS_05400 gene soxR 3907 4371 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_05400 6478 4400 gene locus_tag LOCUS_05410 6478 4400 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_05410 8469 6520 gene locus_tag LOCUS_05420 8469 6520 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 protein_id gnl|my_center|LOCUS_05420 8634 8650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence044 <1 1139 gene locus_tag LOCUS_05430 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073255020.1:dynamin family protein 1136 2851 gene locus_tag LOCUS_05440 1136 2851 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_05440 3056 3547 gene locus_tag LOCUS_05450 3056 3547 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804770.1 protein_id gnl|my_center|LOCUS_05450 3557 5161 gene locus_tag LOCUS_05460 3557 5161 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 protein_id gnl|my_center|LOCUS_05460 6268 5207 gene locus_tag LOCUS_05470 6268 5207 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_05470 6504 7838 gene locus_tag LOCUS_05480 6504 7838 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225265.1 protein_id gnl|my_center|LOCUS_05480 7885 8742 gene locus_tag LOCUS_05490 7885 8742 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969787.1 protein_id gnl|my_center|LOCUS_05490 8735 9631 gene locus_tag LOCUS_05500 8735 9631 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530524.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence045 <1 1707 gene locus_tag LOCUS_05510 <1 1707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296243.1:MobF family relaxase 1590 3296 gene locus_tag LOCUS_05520 1590 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3392 4282 gene locus_tag LOCUS_05530 3392 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4917 4387 gene locus_tag LOCUS_05540 4917 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 5251 4946 gene locus_tag LOCUS_05550 5251 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5936 5439 gene locus_tag LOCUS_05560 5936 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6118 5933 gene locus_tag LOCUS_05570 6118 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6504 6115 gene locus_tag LOCUS_05580 6504 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 6872 6501 gene locus_tag LOCUS_05590 6872 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7355 6888 gene locus_tag LOCUS_05600 7355 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8206 7430 gene locus_tag LOCUS_05610 8206 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 8525 8238 gene locus_tag LOCUS_05620 8525 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9004 8931 gene locus_tag LOCUS_t00110 9004 8931 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9410 9646 gene locus_tag LOCUS_05630 9410 9646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence046 1651 257 gene locus_tag LOCUS_05640 gene pntB 1651 257 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971522.1 protein_id gnl|my_center|LOCUS_05640 3213 1648 gene locus_tag LOCUS_05650 3213 1648 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031784.1 protein_id gnl|my_center|LOCUS_05650 3353 4255 gene locus_tag LOCUS_05660 3353 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4394 5887 gene locus_tag LOCUS_05670 4394 5887 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230704.1 protein_id gnl|my_center|LOCUS_05670 5884 6693 gene locus_tag LOCUS_05680 5884 6693 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417233.1 protein_id gnl|my_center|LOCUS_05680 7816 6737 gene locus_tag LOCUS_05690 7816 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8427 7813 gene locus_tag LOCUS_05700 8427 7813 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814716.1 protein_id gnl|my_center|LOCUS_05700 9461 8418 gene locus_tag LOCUS_05710 9461 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence047 604 1590 gene locus_tag LOCUS_05720 604 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1655 3184 gene locus_tag LOCUS_05730 1655 3184 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930183.1 protein_id gnl|my_center|LOCUS_05730 4278 3154 gene locus_tag LOCUS_05740 4278 3154 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804785.1 protein_id gnl|my_center|LOCUS_05740 4448 5701 gene locus_tag LOCUS_05750 4448 5701 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776906.1 protein_id gnl|my_center|LOCUS_05750 5753 6628 gene locus_tag LOCUS_05760 5753 6628 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_05760 6621 7505 gene locus_tag LOCUS_05770 6621 7505 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346349.1 protein_id gnl|my_center|LOCUS_05770 7509 7934 gene locus_tag LOCUS_05780 7509 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence048 207 1694 gene locus_tag LOCUS_05790 207 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2354 1779 gene locus_tag LOCUS_05800 2354 1779 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389798.1 protein_id gnl|my_center|LOCUS_05800 2483 3679 gene locus_tag LOCUS_05810 2483 3679 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_05810 3994 5823 gene locus_tag LOCUS_05820 gene metG 3994 5823 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_05820 5826 6782 gene locus_tag LOCUS_05830 5826 6782 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929928.1 protein_id gnl|my_center|LOCUS_05830 6903 7982 gene locus_tag LOCUS_05840 6903 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 7994 8917 gene locus_tag LOCUS_05850 gene rsmA 7994 8917 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_05850 9125 8964 gene locus_tag LOCUS_05860 9125 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence049 <1 953 gene locus_tag LOCUS_05870 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804838.1:carboxylate--amine ligase 1961 975 gene locus_tag LOCUS_05880 gene zapE 1961 975 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224547.1 protein_id gnl|my_center|LOCUS_05880 2082 2576 gene locus_tag LOCUS_05890 2082 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3181 2738 gene locus_tag LOCUS_05900 3181 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3318 4889 gene locus_tag LOCUS_05910 3318 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7225 4886 gene locus_tag LOCUS_05920 gene glgX 7225 4886 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804991.1 protein_id gnl|my_center|LOCUS_05920 7831 7316 gene locus_tag LOCUS_05930 7831 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 <9111 7878 gene locus_tag LOCUS_05940 <9111 7878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730823.1:alpha/beta hydrolase >Feature sequence050 1466 510 gene locus_tag LOCUS_05950 1466 510 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803804.1 protein_id gnl|my_center|LOCUS_05950 1680 2624 gene locus_tag LOCUS_05960 1680 2624 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728505.1 protein_id gnl|my_center|LOCUS_05960 2710 2979 gene locus_tag LOCUS_05970 gene rpsO 2710 2979 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111957.1 protein_id gnl|my_center|LOCUS_05970 3217 5445 gene locus_tag LOCUS_05980 3217 5445 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_05980 5448 7031 gene locus_tag LOCUS_05990 5448 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 7167 8213 gene locus_tag LOCUS_06000 gene mraY 7167 8213 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_06000 7186 7267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence051 3002 1878 gene locus_tag LOCUS_06010 3002 1878 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_06010 4170 3013 gene locus_tag LOCUS_06020 4170 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 5810 4167 gene locus_tag LOCUS_06030 5810 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 6913 5807 gene locus_tag LOCUS_06040 6913 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7509 6910 gene locus_tag LOCUS_06050 7509 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 8671 7529 gene locus_tag LOCUS_06060 8671 7529 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence052 1358 48 gene locus_tag LOCUS_06070 1358 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1500 2312 gene locus_tag LOCUS_06080 1500 2312 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_06080 2374 3156 gene locus_tag LOCUS_06090 2374 3156 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_06090 4110 3397 gene locus_tag LOCUS_06100 4110 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4885 4094 gene locus_tag LOCUS_06110 4885 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5475 5029 gene locus_tag LOCUS_06120 5475 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5598 7139 gene locus_tag LOCUS_06130 gene gltX 5598 7139 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994637.1 protein_id gnl|my_center|LOCUS_06130 7136 7891 gene locus_tag LOCUS_06140 7136 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 <8809 7916 gene locus_tag LOCUS_06150 <8809 7916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093456408.1:GTP-binding protein >Feature sequence053 50 820 gene locus_tag LOCUS_06160 gene hisF 50 820 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 protein_id gnl|my_center|LOCUS_06160 817 2697 gene locus_tag LOCUS_06170 817 2697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06170 2694 4493 gene locus_tag LOCUS_06180 2694 4493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_06180 5275 4628 gene locus_tag LOCUS_06190 5275 4628 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_06190 5374 5751 gene locus_tag LOCUS_06200 gene hisI 5374 5751 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813324.1 protein_id gnl|my_center|LOCUS_06200 5748 7316 gene locus_tag LOCUS_06210 gene trpE 5748 7316 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 protein_id gnl|my_center|LOCUS_06210 7313 7888 gene locus_tag LOCUS_06220 7313 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 7936 8235 gene locus_tag LOCUS_06230 7936 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence054 4273 11 gene locus_tag LOCUS_06240 4273 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4614 6935 gene locus_tag LOCUS_06250 4614 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7082 7885 gene locus_tag LOCUS_06260 7082 7885 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726668.1 protein_id gnl|my_center|LOCUS_06260 8061 8372 gene locus_tag LOCUS_06270 gene mihF 8061 8372 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence055 13 1695 gene locus_tag LOCUS_06280 13 1695 CDS product TIGR04028 family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804196.1 protein_id gnl|my_center|LOCUS_06280 1712 2647 gene locus_tag LOCUS_06290 1712 2647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015119.1 protein_id gnl|my_center|LOCUS_06290 2658 3596 gene locus_tag LOCUS_06300 2658 3596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804198.1 protein_id gnl|my_center|LOCUS_06300 3593 5347 gene locus_tag LOCUS_06310 3593 5347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804199.1 protein_id gnl|my_center|LOCUS_06310 5350 6372 gene locus_tag LOCUS_06320 5350 6372 CDS product putative FMN-dependent luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705510.1 protein_id gnl|my_center|LOCUS_06320 6369 7025 gene locus_tag LOCUS_06330 6369 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06330 7022 7651 gene locus_tag LOCUS_06340 7022 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06340 7663 8514 gene locus_tag LOCUS_06350 7663 8514 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228699.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence056 <1 687 gene locus_tag LOCUS_06360 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266622.1:substrate-binding domain-containing protein 731 1831 gene locus_tag LOCUS_06370 731 1831 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612378.1 protein_id gnl|my_center|LOCUS_06370 1889 2896 gene locus_tag LOCUS_06380 1889 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2893 3987 gene locus_tag LOCUS_06390 2893 3987 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 protein_id gnl|my_center|LOCUS_06390 3984 4931 gene locus_tag LOCUS_06400 3984 4931 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_06400 4993 6645 gene locus_tag LOCUS_06410 4993 6645 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_06410 6710 7417 gene locus_tag LOCUS_06420 6710 7417 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612390.1 protein_id gnl|my_center|LOCUS_06420 7560 8588 gene locus_tag LOCUS_06430 7560 8588 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence057 1814 4033 gene locus_tag LOCUS_06440 1814 4033 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856231.1 protein_id gnl|my_center|LOCUS_06440 4060 5601 gene locus_tag LOCUS_06450 4060 5601 CDS product T2SS-translocated chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193152.1 protein_id gnl|my_center|LOCUS_06450 7975 5639 gene locus_tag LOCUS_06460 7975 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence058 1143 517 gene locus_tag LOCUS_06470 1143 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1349 3676 gene locus_tag LOCUS_06480 gene purL 1349 3676 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776349.1 protein_id gnl|my_center|LOCUS_06480 3882 5135 gene locus_tag LOCUS_06490 gene gdhA 3882 5135 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777042.1 protein_id gnl|my_center|LOCUS_06490 5140 5952 gene locus_tag LOCUS_06500 5140 5952 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 protein_id gnl|my_center|LOCUS_06500 7500 5995 gene locus_tag LOCUS_06510 7500 5995 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_06510 7645 8484 gene locus_tag LOCUS_06520 7645 8484 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972553.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence059 1871 144 gene locus_tag LOCUS_06530 1871 144 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227481.1 protein_id gnl|my_center|LOCUS_06530 2551 1868 gene locus_tag LOCUS_06540 2551 1868 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031480854.1 protein_id gnl|my_center|LOCUS_06540 5016 2608 gene locus_tag LOCUS_06550 gene ligA 5016 2608 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_06550 5211 5693 gene locus_tag LOCUS_06560 5211 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 5875 5657 gene locus_tag LOCUS_06570 5875 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 6270 5968 gene locus_tag LOCUS_06580 6270 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7588 6512 gene locus_tag LOCUS_06590 7588 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8187 7585 gene locus_tag LOCUS_06600 8187 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06600 >Feature sequence060 <1 706 gene locus_tag LOCUS_06610 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775924.1:VWA domain-containing protein note possible pseudo, internal stop codon 719 922 gene locus_tag LOCUS_06620 719 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 919 1941 gene locus_tag LOCUS_06630 919 1941 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775923.1 protein_id gnl|my_center|LOCUS_06630 2582 2773 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcagcagggcggcgagggcga 3835 3047 gene locus_tag LOCUS_06640 gene deoC 3835 3047 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309955.1 protein_id gnl|my_center|LOCUS_06640 5149 3974 gene locus_tag LOCUS_06650 5149 3974 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_06650 5779 5207 gene locus_tag LOCUS_06660 5779 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6729 5845 gene locus_tag LOCUS_06670 6729 5845 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_06670 <8591 6806 gene locus_tag LOCUS_06680 <8591 6806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228054.1:DUF3488 and transglutaminase-like domain-containing protein >Feature sequence061 2323 3285 gene locus_tag LOCUS_06690 2323 3285 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_06690 3299 4252 gene locus_tag LOCUS_06700 3299 4252 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_06700 4370 5962 gene locus_tag LOCUS_06710 4370 5962 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641586.1 protein_id gnl|my_center|LOCUS_06710 6046 6765 gene locus_tag LOCUS_06720 6046 6765 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence062 941 474 gene locus_tag LOCUS_06730 941 474 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_06730 960 3659 gene locus_tag LOCUS_06740 gene polA 960 3659 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_06740 3668 4834 gene locus_tag LOCUS_06750 3668 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5704 4889 gene locus_tag LOCUS_06760 5704 4889 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_06760 5932 7389 gene locus_tag LOCUS_06770 gene rpsA 5932 7389 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_06770 <8583 7562 gene locus_tag LOCUS_06780 <8583 7562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028245.1:iron uptake transporter deferrochelatase/peroxidase subunit >Feature sequence063 3253 284 gene locus_tag LOCUS_06790 3253 284 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_06790 3899 3468 gene locus_tag LOCUS_06800 3899 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6438 4015 gene locus_tag LOCUS_06810 6438 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6335 6559 gene locus_tag LOCUS_06820 6335 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 <8538 6843 gene locus_tag LOCUS_06830 <8538 6843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202161.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence064 324 6455 gene locus_tag LOCUS_06840 324 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence065 507 1112 gene locus_tag LOCUS_06850 507 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1240 4140 gene locus_tag LOCUS_06860 1240 4140 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138169592.1 protein_id gnl|my_center|LOCUS_06860 4183 5151 gene locus_tag LOCUS_06870 4183 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5214 5624 gene locus_tag LOCUS_06880 5214 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5695 6828 gene locus_tag LOCUS_06890 5695 6828 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819405.1 protein_id gnl|my_center|LOCUS_06890 7807 6866 gene locus_tag LOCUS_06900 7807 6866 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014310.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence066 <1 755 gene locus_tag LOCUS_06910 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681540.1:M20 family peptidase 1461 790 gene locus_tag LOCUS_06920 1461 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3206 1410 gene locus_tag LOCUS_06930 3206 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3502 3203 gene locus_tag LOCUS_06940 3502 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4004 3495 gene locus_tag LOCUS_06950 4004 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5456 4119 gene locus_tag LOCUS_06960 5456 4119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776507.1 protein_id gnl|my_center|LOCUS_06960 5665 7236 gene locus_tag LOCUS_06970 5665 7236 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776589.1 protein_id gnl|my_center|LOCUS_06970 <8449 7440 gene locus_tag LOCUS_06980 <8449 7440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950613.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence067 822 1640 gene locus_tag LOCUS_06990 822 1640 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804500.1 protein_id gnl|my_center|LOCUS_06990 3080 1683 gene locus_tag LOCUS_07000 3080 1683 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776300.1 protein_id gnl|my_center|LOCUS_07000 4190 3162 gene locus_tag LOCUS_07010 4190 3162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_07010 4215 4338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4588 5151 gene locus_tag LOCUS_07020 4588 5151 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224261.1 protein_id gnl|my_center|LOCUS_07020 5787 5170 gene locus_tag LOCUS_07030 5787 5170 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_07030 5977 7599 gene locus_tag LOCUS_07040 5977 7599 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168550.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence068 <1 509 gene locus_tag LOCUS_07050 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898320.1:single-stranded DNA-binding protein 569 808 gene locus_tag LOCUS_07060 gene rpsR 569 808 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_07060 827 1279 gene locus_tag LOCUS_07070 gene rplI 827 1279 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_07070 1327 2121 gene locus_tag LOCUS_07080 1327 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4740 2200 gene locus_tag LOCUS_07090 4740 2200 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390053.1 protein_id gnl|my_center|LOCUS_07090 5618 4740 gene locus_tag LOCUS_07100 5618 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 7282 5930 gene locus_tag LOCUS_07110 7282 5930 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence069 2673 1666 gene locus_tag LOCUS_07120 2673 1666 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_07120 2891 2676 gene locus_tag LOCUS_07130 2891 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2931 5264 gene locus_tag LOCUS_07140 2931 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5551 7281 gene locus_tag LOCUS_07150 5551 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence070 846 427 gene locus_tag LOCUS_07160 846 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1590 940 gene locus_tag LOCUS_07170 1590 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1661 2062 gene locus_tag LOCUS_07180 1661 2062 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_07180 2815 2087 gene locus_tag LOCUS_07190 2815 2087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 protein_id gnl|my_center|LOCUS_07190 3567 2812 gene locus_tag LOCUS_07200 3567 2812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229141.1 protein_id gnl|my_center|LOCUS_07200 3646 5115 gene locus_tag LOCUS_07210 3646 5115 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_07210 5229 6272 gene locus_tag LOCUS_07220 5229 6272 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775815.1 protein_id gnl|my_center|LOCUS_07220 6269 7252 gene locus_tag LOCUS_07230 6269 7252 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence071 131 1660 gene locus_tag LOCUS_07240 131 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2542 1700 gene locus_tag LOCUS_07250 gene rfbD 2542 1700 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_07250 3095 2595 gene locus_tag LOCUS_07260 3095 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3247 3537 gene locus_tag LOCUS_07270 3247 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3540 3776 gene locus_tag LOCUS_07280 3540 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4944 3724 gene locus_tag LOCUS_07290 gene glf 4944 3724 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_07290 5130 6092 gene locus_tag LOCUS_07300 5130 6092 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_07300 5989 6009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6133 7701 gene locus_tag LOCUS_07310 gene ahcY 6133 7701 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229742.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence072 660 1430 gene locus_tag LOCUS_07320 660 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1427 2182 gene locus_tag LOCUS_07330 1427 2182 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776564.1 protein_id gnl|my_center|LOCUS_07330 2340 2909 gene locus_tag LOCUS_07340 gene pyrE 2340 2909 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_07340 3943 2951 gene locus_tag LOCUS_07350 3943 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4508 3945 gene locus_tag LOCUS_07360 4508 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5303 4575 gene locus_tag LOCUS_07370 5303 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5474 6130 gene locus_tag LOCUS_07380 5474 6130 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 protein_id gnl|my_center|LOCUS_07380 6297 7316 gene locus_tag LOCUS_07390 gene fbaA 6297 7316 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776559.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence073 1384 2385 gene locus_tag LOCUS_07400 gene fba 1384 2385 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_07400 2502 3323 gene locus_tag LOCUS_07410 2502 3323 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_07410 3617 4924 gene locus_tag LOCUS_07420 3617 4924 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532948.1 protein_id gnl|my_center|LOCUS_07420 5004 5942 gene locus_tag LOCUS_07430 5004 5942 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 protein_id gnl|my_center|LOCUS_07430 5944 6849 gene locus_tag LOCUS_07440 5944 6849 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_07440 6958 7818 gene locus_tag LOCUS_07450 6958 7818 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431312.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence074 1591 3783 gene locus_tag LOCUS_07460 1591 3783 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225058.1 protein_id gnl|my_center|LOCUS_07460 3780 4961 gene locus_tag LOCUS_07470 3780 4961 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316201.1 protein_id gnl|my_center|LOCUS_07470 5942 4983 gene locus_tag LOCUS_07480 5942 4983 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_07480 7207 5939 gene locus_tag LOCUS_07490 gene serS 7207 5939 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence075 2407 1244 gene locus_tag LOCUS_07500 gene rhaI 2407 1244 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_07500 3911 3432 gene locus_tag LOCUS_07510 3911 3432 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_07510 4194 4916 gene locus_tag LOCUS_07520 4194 4916 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776890.1 protein_id gnl|my_center|LOCUS_07520 5013 6098 gene locus_tag LOCUS_07530 5013 6098 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 protein_id gnl|my_center|LOCUS_07530 6188 7219 gene locus_tag LOCUS_07540 6188 7219 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence076 1751 1170 gene locus_tag LOCUS_07550 1751 1170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_07550 2923 1748 gene locus_tag LOCUS_07560 2923 1748 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_07560 3834 2923 gene locus_tag LOCUS_07570 3834 2923 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_07570 3094 3131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4484 3831 gene locus_tag LOCUS_07580 4484 3831 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_07580 5107 4487 gene locus_tag LOCUS_07590 5107 4487 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_07590 7150 5117 gene locus_tag LOCUS_07600 gene thrS 7150 5117 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_07600 7339 7265 gene locus_tag LOCUS_t00120 7339 7265 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7415 7344 gene locus_tag LOCUS_t00130 7415 7344 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7530 7457 gene locus_tag LOCUS_t00140 7530 7457 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7834 7908 gene locus_tag LOCUS_t00150 7834 7908 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 <1 1687 gene locus_tag LOCUS_07610 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775906.1:acetolactate synthase large subunit 1690 2214 gene locus_tag LOCUS_07620 gene ilvN 1690 2214 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_07620 2254 3279 gene locus_tag LOCUS_07630 gene ilvC 2254 3279 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_07630 3316 3963 gene locus_tag LOCUS_07640 3316 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3960 4583 gene locus_tag LOCUS_07650 3960 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4672 5721 gene locus_tag LOCUS_07660 4672 5721 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_07660 5853 6965 gene locus_tag LOCUS_07670 5853 6965 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence078 793 11 gene locus_tag LOCUS_07680 793 11 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_07680 1410 790 gene locus_tag LOCUS_07690 1410 790 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_07690 2563 1475 gene locus_tag LOCUS_07700 2563 1475 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_07700 3860 2613 gene locus_tag LOCUS_07710 3860 2613 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777113.1 protein_id gnl|my_center|LOCUS_07710 4117 5211 gene locus_tag LOCUS_07720 4117 5211 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033373915.1 protein_id gnl|my_center|LOCUS_07720 5687 5226 gene locus_tag LOCUS_07730 5687 5226 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776155.1 protein_id gnl|my_center|LOCUS_07730 6136 5684 gene locus_tag LOCUS_07740 6136 5684 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776156.1 protein_id gnl|my_center|LOCUS_07740 6337 6167 gene locus_tag LOCUS_07750 gene rpmG 6337 6167 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814458.1 protein_id gnl|my_center|LOCUS_07750 6512 6436 gene locus_tag LOCUS_t00160 6512 6436 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6652 6579 gene locus_tag LOCUS_t00170 6652 6579 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6710 7768 gene locus_tag LOCUS_07760 gene rarD 6710 7768 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_07760 7812 7894 gene locus_tag LOCUS_t00180 7812 7894 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 <1 788 gene locus_tag LOCUS_07770 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002371682.1:DUF1116 domain-containing protein 806 1720 gene locus_tag LOCUS_07780 806 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1734 2255 gene locus_tag LOCUS_07790 1734 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2371 3306 gene locus_tag LOCUS_07800 gene arcC 2371 3306 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694569.1 protein_id gnl|my_center|LOCUS_07800 3396 4082 gene locus_tag LOCUS_07810 3396 4082 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227810.1 protein_id gnl|my_center|LOCUS_07810 4172 5365 gene locus_tag LOCUS_07820 4172 5365 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974080.1 protein_id gnl|my_center|LOCUS_07820 6038 5409 gene locus_tag LOCUS_07830 6038 5409 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_07830 7834 6035 gene locus_tag LOCUS_07840 gene treZ 7834 6035 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence080 3056 1368 gene locus_tag LOCUS_07850 3056 1368 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_07850 4047 3136 gene locus_tag LOCUS_07860 gene dapA 4047 3136 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_07860 5524 4067 gene locus_tag LOCUS_07870 5524 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5566 6141 gene locus_tag LOCUS_07880 5566 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6706 6170 gene locus_tag LOCUS_07890 6706 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 7434 6703 gene locus_tag LOCUS_07900 gene dapB 7434 6703 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence081 356 6 gene locus_tag LOCUS_07910 356 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 518 922 gene locus_tag LOCUS_07920 518 922 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895802.1 protein_id gnl|my_center|LOCUS_07920 2541 1021 gene locus_tag LOCUS_07930 gene glpK 2541 1021 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 protein_id gnl|my_center|LOCUS_07930 3545 2784 gene locus_tag LOCUS_07940 3545 2784 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_07940 5453 3699 gene locus_tag LOCUS_07950 5453 3699 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_07950 5584 6528 gene locus_tag LOCUS_07960 5584 6528 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462291.1 protein_id gnl|my_center|LOCUS_07960 7083 6586 gene locus_tag LOCUS_07970 7083 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence082 25 231 gene locus_tag LOCUS_07980 25 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1257 295 gene locus_tag LOCUS_07990 1257 295 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_07990 1436 2734 gene locus_tag LOCUS_08000 1436 2734 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804267.1 protein_id gnl|my_center|LOCUS_08000 2845 3783 gene locus_tag LOCUS_08010 2845 3783 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_08010 3783 4631 gene locus_tag LOCUS_08020 3783 4631 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_08020 4682 6067 gene locus_tag LOCUS_08030 4682 6067 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_08030 6757 6086 gene locus_tag LOCUS_08040 6757 6086 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978564.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence083 684 157 gene locus_tag LOCUS_08050 684 157 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391304.1 protein_id gnl|my_center|LOCUS_08050 853 1152 gene locus_tag LOCUS_08060 853 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1288 1845 gene locus_tag LOCUS_08070 1288 1845 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035327.1 protein_id gnl|my_center|LOCUS_08070 1879 2343 gene locus_tag LOCUS_08080 1879 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3528 2449 gene locus_tag LOCUS_08090 gene ychF 3528 2449 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776292.1 protein_id gnl|my_center|LOCUS_08090 3598 5064 gene locus_tag LOCUS_08100 3598 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5076 6515 gene locus_tag LOCUS_08110 gene xseA 5076 6515 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_08110 6530 6814 gene locus_tag LOCUS_08120 6530 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence084 1 2121 gene locus_tag LOCUS_08130 1 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3109 2249 gene locus_tag LOCUS_08140 3109 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3869 3102 gene locus_tag LOCUS_08150 3869 3102 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_08150 4855 3920 gene locus_tag LOCUS_08160 4855 3920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_08160 5674 4997 gene locus_tag LOCUS_08170 5674 4997 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_08170 7086 5671 gene locus_tag LOCUS_08180 7086 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence085 113 3325 gene locus_tag LOCUS_08190 113 3325 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406332.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08190 4384 3470 gene locus_tag LOCUS_08200 4384 3470 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_08200 5370 4381 gene locus_tag LOCUS_08210 5370 4381 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_08210 6976 5546 gene locus_tag LOCUS_08220 6976 5546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970996.1 protein_id gnl|my_center|LOCUS_08220 7682 7401 gene locus_tag LOCUS_08230 7682 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence086 233 1675 gene locus_tag LOCUS_08240 gene purB 233 1675 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_08240 3010 1820 gene locus_tag LOCUS_08250 3010 1820 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805155.1 protein_id gnl|my_center|LOCUS_08250 4014 3019 gene locus_tag LOCUS_08260 4014 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4180 4533 gene locus_tag LOCUS_08270 4180 4533 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063731.1 protein_id gnl|my_center|LOCUS_08270 4590 4979 gene locus_tag LOCUS_08280 4590 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence087 1 1536 gene locus_tag LOCUS_08290 1 1536 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 protein_id gnl|my_center|LOCUS_08290 1562 2260 gene locus_tag LOCUS_08300 1562 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2432 2692 gene locus_tag LOCUS_08310 gene rpsT 2432 2692 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_08310 3896 2889 gene locus_tag LOCUS_08320 3896 2889 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_08320 4007 4585 gene locus_tag LOCUS_08330 4007 4585 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_08330 4675 5457 gene locus_tag LOCUS_08340 4675 5457 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_08340 <7597 5408 gene locus_tag LOCUS_08350 <7597 5408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228464.1:ComEC/Rec2 family competence protein >Feature sequence088 742 1461 gene locus_tag LOCUS_08360 742 1461 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089169.1 protein_id gnl|my_center|LOCUS_08360 2018 2042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2112 3209 gene locus_tag LOCUS_08370 2112 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4135 3203 gene locus_tag LOCUS_08380 4135 3203 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993870.1 protein_id gnl|my_center|LOCUS_08380 5493 4300 gene locus_tag LOCUS_08390 5493 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5786 5466 gene locus_tag LOCUS_08400 5786 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5562 5572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence089 1443 652 gene locus_tag LOCUS_08410 1443 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2552 1866 gene locus_tag LOCUS_08420 2552 1866 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_08420 2819 2586 gene locus_tag LOCUS_08430 2819 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2785 3825 gene locus_tag LOCUS_08440 gene serC 2785 3825 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072623621.1 protein_id gnl|my_center|LOCUS_08440 5411 4104 gene locus_tag LOCUS_08450 5411 4104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_08450 5842 5408 gene locus_tag LOCUS_08460 5842 5408 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 protein_id gnl|my_center|LOCUS_08460 6841 6002 gene locus_tag LOCUS_08470 6841 6002 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 protein_id gnl|my_center|LOCUS_08470 7224 6841 gene locus_tag LOCUS_08480 7224 6841 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776599.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence090 593 1894 gene locus_tag LOCUS_08490 593 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2678 1920 gene locus_tag LOCUS_08500 2678 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3370 2672 gene locus_tag LOCUS_08510 3370 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3404 3844 gene locus_tag LOCUS_08520 3404 3844 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 protein_id gnl|my_center|LOCUS_08520 3920 4006 gene locus_tag LOCUS_t00190 3920 4006 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4269 4652 gene locus_tag LOCUS_08530 4269 4652 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528640.1 protein_id gnl|my_center|LOCUS_08530 4630 5982 gene locus_tag LOCUS_08540 4630 5982 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214468507.1 protein_id gnl|my_center|LOCUS_08540 6623 6234 gene locus_tag LOCUS_08550 6623 6234 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086131.1 protein_id gnl|my_center|LOCUS_08550 7155 6715 gene locus_tag LOCUS_08560 7155 6715 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730468.1 protein_id gnl|my_center|LOCUS_08560 7377 7523 gene locus_tag LOCUS_08570 7377 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence091 422 1114 gene locus_tag LOCUS_08580 422 1114 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_08580 1245 2168 gene locus_tag LOCUS_08590 1245 2168 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_08590 2732 2196 gene locus_tag LOCUS_08600 2732 2196 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_08600 2847 3629 gene locus_tag LOCUS_08610 2847 3629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804205.1 protein_id gnl|my_center|LOCUS_08610 3875 4927 gene locus_tag LOCUS_08620 3875 4927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777018.1 protein_id gnl|my_center|LOCUS_08620 4845 4768 gene locus_tag LOCUS_t00200 4845 4768 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4935 5942 gene locus_tag LOCUS_08630 4935 5942 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777017.1 protein_id gnl|my_center|LOCUS_08630 5935 6993 gene locus_tag LOCUS_08640 5935 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence092 <1 859 gene locus_tag LOCUS_08650 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021268755.1:error-prone DNA polymerase 2209 908 gene locus_tag LOCUS_08660 2209 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3337 2354 gene locus_tag LOCUS_08670 3337 2354 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_08670 3862 3344 gene locus_tag LOCUS_08680 3862 3344 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775666.1 protein_id gnl|my_center|LOCUS_08680 5101 3914 gene locus_tag LOCUS_08690 5101 3914 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 protein_id gnl|my_center|LOCUS_08690 5846 5148 gene locus_tag LOCUS_08700 5846 5148 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389616.1 protein_id gnl|my_center|LOCUS_08700 5985 6134 gene locus_tag LOCUS_08710 5985 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6115 6558 gene locus_tag LOCUS_08720 6115 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7186 6683 gene locus_tag LOCUS_08730 7186 6683 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226091.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence093 609 265 gene locus_tag LOCUS_08740 609 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4074 652 gene locus_tag LOCUS_08750 4074 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4953 4468 gene locus_tag LOCUS_08760 4953 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5181 6683 gene locus_tag LOCUS_08770 5181 6683 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225274.1 protein_id gnl|my_center|LOCUS_08770 6736 7308 gene locus_tag LOCUS_08780 6736 7308 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225273.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence094 170 895 gene locus_tag LOCUS_08790 170 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1631 975 gene locus_tag LOCUS_08800 1631 975 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811402.1 protein_id gnl|my_center|LOCUS_08800 1790 1635 gene locus_tag LOCUS_08810 1790 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2616 1837 gene locus_tag LOCUS_08820 2616 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08820 3320 2613 gene locus_tag LOCUS_08830 3320 2613 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_08830 3454 3705 gene locus_tag LOCUS_08840 3454 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4542 3862 gene locus_tag LOCUS_08850 4542 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4520 4708 gene locus_tag LOCUS_08860 4520 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5325 4792 gene locus_tag LOCUS_08870 5325 4792 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929825.1 protein_id gnl|my_center|LOCUS_08870 5475 6527 gene locus_tag LOCUS_08880 5475 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 <7431 6601 gene locus_tag LOCUS_08890 <7431 6601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030980.1:excinuclease ABC subunit UvrA >Feature sequence095 <1 583 gene locus_tag LOCUS_08900 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027462.1:glycoside hydrolase family 38 C-terminal domain-containing protein 772 1473 gene locus_tag LOCUS_08910 772 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2604 1522 gene locus_tag LOCUS_08920 2604 1522 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_08920 2572 2835 gene locus_tag LOCUS_08930 2572 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4373 2721 gene locus_tag LOCUS_08940 4373 2721 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_08940 6937 4370 gene locus_tag LOCUS_08950 6937 4370 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence096 1387 545 gene locus_tag LOCUS_08960 1387 545 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_08960 2324 1389 gene locus_tag LOCUS_08970 2324 1389 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 protein_id gnl|my_center|LOCUS_08970 3670 2321 gene locus_tag LOCUS_08980 3670 2321 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218106651.1 protein_id gnl|my_center|LOCUS_08980 4096 5394 gene locus_tag LOCUS_08990 4096 5394 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_08990 5428 6195 gene locus_tag LOCUS_09000 5428 6195 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975874.1 protein_id gnl|my_center|LOCUS_09000 6199 7206 gene locus_tag LOCUS_09010 6199 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence097 1279 56 gene locus_tag LOCUS_09020 1279 56 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803847.1 protein_id gnl|my_center|LOCUS_09020 3301 1481 gene locus_tag LOCUS_09030 3301 1481 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_09030 4282 3443 gene locus_tag LOCUS_09040 4282 3443 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584077.1 protein_id gnl|my_center|LOCUS_09040 5271 4279 gene locus_tag LOCUS_09050 5271 4279 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776905.1 protein_id gnl|my_center|LOCUS_09050 6593 5277 gene locus_tag LOCUS_09060 6593 5277 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970436.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence098 3376 827 gene locus_tag LOCUS_09070 3376 827 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_09070 3540 3953 gene locus_tag LOCUS_09080 3540 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3963 4121 gene locus_tag LOCUS_09090 3963 4121 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_09090 4121 4579 gene locus_tag LOCUS_09100 4121 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5372 4695 gene locus_tag LOCUS_09110 5372 4695 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_09110 5457 6116 gene locus_tag LOCUS_09120 gene nth 5457 6116 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_09120 7087 6176 gene locus_tag LOCUS_09130 7087 6176 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230544.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence099 294 1490 gene locus_tag LOCUS_09140 294 1490 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 protein_id gnl|my_center|LOCUS_09140 2118 1387 gene locus_tag LOCUS_09150 2118 1387 CDS product APH(3'') family aminoglycoside O-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110890.1 protein_id gnl|my_center|LOCUS_09150 2159 2839 gene locus_tag LOCUS_09160 2159 2839 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 protein_id gnl|my_center|LOCUS_09160 2853 2984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3791 3390 gene locus_tag LOCUS_09170 3791 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4045 3779 gene locus_tag LOCUS_09180 4045 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4143 4367 gene locus_tag LOCUS_09190 4143 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4962 4501 gene locus_tag LOCUS_09200 4962 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5403 5101 gene locus_tag LOCUS_09210 5403 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5603 6952 gene locus_tag LOCUS_09220 5603 6952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence100 319 50 gene locus_tag LOCUS_09230 319 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1558 416 gene locus_tag LOCUS_09240 1558 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1949 1737 gene locus_tag LOCUS_09250 1949 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3000 2155 gene locus_tag LOCUS_09260 3000 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 4020 3106 gene locus_tag LOCUS_09270 4020 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5014 4121 gene locus_tag LOCUS_09280 5014 4121 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 protein_id gnl|my_center|LOCUS_09280 5063 5242 gene locus_tag LOCUS_09290 5063 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 5302 6708 gene locus_tag LOCUS_09300 5302 6708 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence101 4203 3316 gene locus_tag LOCUS_09310 4203 3316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_09310 5129 4200 gene locus_tag LOCUS_09320 5129 4200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_09320 5364 5122 gene locus_tag LOCUS_09330 5364 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09330 6084 5401 gene locus_tag LOCUS_09340 6084 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09340 6905 6114 gene locus_tag LOCUS_09350 gene nagB 6905 6114 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052563.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence102 113 1819 gene locus_tag LOCUS_09360 113 1819 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804979.1 protein_id gnl|my_center|LOCUS_09360 1850 3010 gene locus_tag LOCUS_09370 1850 3010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804980.1 protein_id gnl|my_center|LOCUS_09370 3746 3018 gene locus_tag LOCUS_09380 3746 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3826 4698 gene locus_tag LOCUS_09390 3826 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 4695 5351 gene locus_tag LOCUS_09400 4695 5351 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_09400 6437 5412 gene locus_tag LOCUS_09410 6437 5412 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_09410 <7201 6510 gene locus_tag LOCUS_09420 <7201 6510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532766.1:protein-disulfide reductase DsbD family protein >Feature sequence103 2492 2121 gene locus_tag LOCUS_09430 2492 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4012 3479 gene locus_tag LOCUS_09440 4012 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5377 4139 gene locus_tag LOCUS_09450 5377 4139 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223883.1 protein_id gnl|my_center|LOCUS_09450 5552 6403 gene locus_tag LOCUS_09460 gene pdxY 5552 6403 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence104 422 1969 gene locus_tag LOCUS_09470 422 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2153 2494 gene locus_tag LOCUS_09480 gene rplS 2153 2494 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804624.1 protein_id gnl|my_center|LOCUS_09480 2574 3434 gene locus_tag LOCUS_09490 2574 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3431 4282 gene locus_tag LOCUS_09500 3431 4282 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804627.1 protein_id gnl|my_center|LOCUS_09500 4279 4581 gene locus_tag LOCUS_09510 4279 4581 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_09510 4865 5275 gene locus_tag LOCUS_09520 4865 5275 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_09520 5275 6834 gene locus_tag LOCUS_09530 5275 6834 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414700.1 protein_id gnl|my_center|LOCUS_09530 6114 6158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence105 318 1676 gene locus_tag LOCUS_09540 318 1676 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_09540 1769 2620 gene locus_tag LOCUS_09550 1769 2620 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237985.1 protein_id gnl|my_center|LOCUS_09550 2620 3462 gene locus_tag LOCUS_09560 2620 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 3459 4208 gene locus_tag LOCUS_09570 3459 4208 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_09570 4306 5250 gene locus_tag LOCUS_09580 4306 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5506 5225 gene locus_tag LOCUS_09590 5506 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5501 6712 gene locus_tag LOCUS_09600 gene xylB 5501 6712 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence106 683 949 gene locus_tag LOCUS_09610 683 949 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 protein_id gnl|my_center|LOCUS_09610 1107 1523 gene locus_tag LOCUS_09620 gene nrdI 1107 1523 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370076.1 protein_id gnl|my_center|LOCUS_09620 1493 3670 gene locus_tag LOCUS_09630 gene nrdE 1493 3670 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651373.1 protein_id gnl|my_center|LOCUS_09630 3823 4800 gene locus_tag LOCUS_09640 gene nrdF 3823 4800 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 protein_id gnl|my_center|LOCUS_09640 5674 4874 gene locus_tag LOCUS_09650 5674 4874 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978407.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence107 <1 631 gene locus_tag LOCUS_09660 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052046.1:methionine ABC transporter ATP-binding protein 628 1284 gene locus_tag LOCUS_09670 628 1284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057738.1 protein_id gnl|my_center|LOCUS_09670 1341 2228 gene locus_tag LOCUS_09680 1341 2228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_09680 2225 3028 gene locus_tag LOCUS_09690 2225 3028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_09690 3622 3095 gene locus_tag LOCUS_09700 3622 3095 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_09700 4111 5115 gene locus_tag LOCUS_09710 4111 5115 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_09710 7050 5173 gene locus_tag LOCUS_09720 7050 5173 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence108 603 190 gene locus_tag LOCUS_09730 603 190 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_09730 1489 689 gene locus_tag LOCUS_09740 1489 689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640613.1 protein_id gnl|my_center|LOCUS_09740 2514 1489 gene locus_tag LOCUS_09750 2514 1489 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_09750 2692 5268 gene locus_tag LOCUS_09760 2692 5268 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence109 363 1844 gene locus_tag LOCUS_09770 363 1844 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776067.1 protein_id gnl|my_center|LOCUS_09770 2220 1972 gene locus_tag LOCUS_09780 2220 1972 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_09780 2460 3005 gene locus_tag LOCUS_09790 2460 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5969 3048 gene locus_tag LOCUS_09800 5969 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence110 3602 615 gene locus_tag LOCUS_09810 3602 615 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_09810 4530 3679 gene locus_tag LOCUS_09820 4530 3679 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805140.1 protein_id gnl|my_center|LOCUS_09820 5471 4530 gene locus_tag LOCUS_09830 5471 4530 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_09830 <6980 5475 gene locus_tag LOCUS_09840 <6980 5475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486252.1:extracellular solute-binding protein >Feature sequence111 3380 2214 gene locus_tag LOCUS_09850 3380 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5060 4446 gene locus_tag LOCUS_09860 5060 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09860 5059 6543 gene locus_tag LOCUS_09870 5059 6543 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364052.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence112 456 815 gene locus_tag LOCUS_09880 456 815 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111747.1 protein_id gnl|my_center|LOCUS_09880 911 1723 gene locus_tag LOCUS_09890 gene trpC 911 1723 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_09890 1768 3054 gene locus_tag LOCUS_09900 gene trpB 1768 3054 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_09900 3051 3860 gene locus_tag LOCUS_09910 gene trpA 3051 3860 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805093.1 protein_id gnl|my_center|LOCUS_09910 3857 4855 gene locus_tag LOCUS_09920 gene lgt 3857 4855 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466801.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence113 102 1040 gene locus_tag LOCUS_09930 102 1040 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804031.1 protein_id gnl|my_center|LOCUS_09930 1167 2189 gene locus_tag LOCUS_09940 gene glsA 1167 2189 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816578.1 protein_id gnl|my_center|LOCUS_09940 2182 3846 gene locus_tag LOCUS_09950 2182 3846 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005179195.1 protein_id gnl|my_center|LOCUS_09950 5210 3861 gene locus_tag LOCUS_09960 5210 3861 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811699.1 protein_id gnl|my_center|LOCUS_09960 6016 5207 gene locus_tag LOCUS_09970 6016 5207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776543.1 protein_id gnl|my_center|LOCUS_09970 6497 6231 gene locus_tag LOCUS_09980 6497 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 6807 6487 gene locus_tag LOCUS_09990 6807 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence114 18 902 gene locus_tag LOCUS_10000 18 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 899 2290 gene locus_tag LOCUS_10010 899 2290 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_10010 2287 3228 gene locus_tag LOCUS_10020 2287 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3225 4538 gene locus_tag LOCUS_10030 gene nuoF 3225 4538 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence115 180 1535 gene locus_tag LOCUS_10040 180 1535 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775732.1 protein_id gnl|my_center|LOCUS_10040 1640 2500 gene locus_tag LOCUS_10050 1640 2500 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 protein_id gnl|my_center|LOCUS_10050 2497 3360 gene locus_tag LOCUS_10060 2497 3360 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804058.1 protein_id gnl|my_center|LOCUS_10060 3394 4428 gene locus_tag LOCUS_10070 3394 4428 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 protein_id gnl|my_center|LOCUS_10070 5164 4478 gene locus_tag LOCUS_10080 5164 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 <6714 5175 gene locus_tag LOCUS_10090 <6714 5175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020639906.1:alpha-galactosidase >Feature sequence116 3050 36 gene locus_tag LOCUS_10100 3050 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3084 3509 gene locus_tag LOCUS_10110 3084 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3675 3496 gene locus_tag LOCUS_10120 3675 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4238 3717 gene locus_tag LOCUS_10130 4238 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5055 4330 gene locus_tag LOCUS_10140 5055 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5533 5114 gene locus_tag LOCUS_10150 5533 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5697 5530 gene locus_tag LOCUS_10160 5697 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5797 5869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6275 5946 gene locus_tag LOCUS_10170 6275 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence117 967 1836 gene locus_tag LOCUS_10180 967 1836 CDS product chromosome condensation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000385090.1 protein_id gnl|my_center|LOCUS_10180 1953 2381 gene locus_tag LOCUS_10190 1953 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3857 2388 gene locus_tag LOCUS_10200 3857 2388 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224551.1 protein_id gnl|my_center|LOCUS_10200 3933 4166 gene locus_tag LOCUS_10210 3933 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 4959 4213 gene locus_tag LOCUS_10220 4959 4213 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_10220 5050 6024 gene locus_tag LOCUS_10230 5050 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 <6669 5987 gene locus_tag LOCUS_10240 <6669 5987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166233908.1:MFS transporter >Feature sequence118 2632 671 gene locus_tag LOCUS_10250 2632 671 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_10250 3507 2629 gene locus_tag LOCUS_10260 3507 2629 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976274.1 protein_id gnl|my_center|LOCUS_10260 4367 3504 gene locus_tag LOCUS_10270 4367 3504 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529388.1 protein_id gnl|my_center|LOCUS_10270 5778 4456 gene locus_tag LOCUS_10280 5778 4456 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225265.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence119 889 290 gene locus_tag LOCUS_10290 889 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3226 1115 gene locus_tag LOCUS_10300 gene fusA 3226 1115 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_10300 3554 4903 gene locus_tag LOCUS_10310 3554 4903 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727384.1 protein_id gnl|my_center|LOCUS_10310 4930 5214 gene locus_tag LOCUS_10320 4930 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077815.1 protein_id gnl|my_center|LOCUS_10320 5353 5625 gene locus_tag LOCUS_10330 5353 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence120 <1 1367 gene locus_tag LOCUS_10340 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083365834.1:M91 family zinc metallopeptidase 1364 2044 gene locus_tag LOCUS_10350 1364 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2314 2688 gene locus_tag LOCUS_10360 gene rpsL 2314 2688 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776386.1 protein_id gnl|my_center|LOCUS_10360 2688 3158 gene locus_tag LOCUS_10370 gene rpsG 2688 3158 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_10370 3304 5406 gene locus_tag LOCUS_10380 gene fusA 3304 5406 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence121 <1 2640 gene locus_tag LOCUS_10390 <1 2640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225652.1:RHS repeat-associated core domain-containing protein 2637 3206 gene locus_tag LOCUS_10400 2637 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3504 3860 gene locus_tag LOCUS_10410 3504 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3955 4332 gene locus_tag LOCUS_10420 3955 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4329 4946 gene locus_tag LOCUS_10430 4329 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 5021 5665 gene locus_tag LOCUS_10440 5021 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <6581 5711 gene locus_tag LOCUS_10450 <6581 5711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777114.1:hemolysin family protein >Feature sequence122 1240 296 gene locus_tag LOCUS_10460 1240 296 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_10460 1650 1237 gene locus_tag LOCUS_10470 1650 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2061 1702 gene locus_tag LOCUS_10480 2061 1702 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_10480 2176 2249 gene locus_tag LOCUS_t00210 2176 2249 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2300 2374 gene locus_tag LOCUS_t00220 2300 2374 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2429 2504 gene locus_tag LOCUS_t00230 2429 2504 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 258 4 gene locus_tag LOCUS_10490 258 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1300 221 gene locus_tag LOCUS_10500 1300 221 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776173.1 protein_id gnl|my_center|LOCUS_10500 2871 1297 gene locus_tag LOCUS_10510 gene nuoN 2871 1297 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_10510 3101 2868 gene locus_tag LOCUS_10520 3101 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4416 2986 gene locus_tag LOCUS_10530 4416 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 <6513 4432 gene locus_tag LOCUS_10540 <6513 4432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893421.1:NADH-quinone oxidoreductase subunit L >Feature sequence124 1870 20 gene locus_tag LOCUS_10550 1870 20 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 protein_id gnl|my_center|LOCUS_10550 3791 2097 gene locus_tag LOCUS_10560 3791 2097 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_10560 5047 3788 gene locus_tag LOCUS_10570 5047 3788 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_10570 5168 5704 gene locus_tag LOCUS_10580 5168 5704 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808172.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence125 432 46 gene locus_tag LOCUS_10590 gene rplT 432 46 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_10590 659 465 gene locus_tag LOCUS_10600 gene rpmI 659 465 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_10600 1815 835 gene locus_tag LOCUS_10610 1815 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1906 2136 gene locus_tag LOCUS_10620 1906 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2155 2233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2312 2578 gene locus_tag LOCUS_10630 2312 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3365 2571 gene locus_tag LOCUS_10640 3365 2571 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_10640 3499 4284 gene locus_tag LOCUS_10650 3499 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5219 4344 gene locus_tag LOCUS_10660 5219 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5976 5206 gene locus_tag LOCUS_10670 gene priA 5976 5206 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence126 <1 885 gene locus_tag LOCUS_10680 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144042.1:amidase family protein 1014 2015 gene locus_tag LOCUS_10690 1014 2015 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_10690 3168 2056 gene locus_tag LOCUS_10700 3168 2056 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803814.1 protein_id gnl|my_center|LOCUS_10700 3845 3141 gene locus_tag LOCUS_10710 3845 3141 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 protein_id gnl|my_center|LOCUS_10710 5127 3937 gene locus_tag LOCUS_10720 5127 3937 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803816.1 protein_id gnl|my_center|LOCUS_10720 <6389 5198 gene locus_tag LOCUS_10730 <6389 5198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803818.1:endo-1,4-beta-xylanase >Feature sequence127 <1 510 gene locus_tag LOCUS_10740 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776613.1:trehalose biosynthesis protein 512 2728 gene locus_tag LOCUS_10750 gene glgB 512 2728 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_10750 2791 3051 gene locus_tag LOCUS_10760 2791 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3027 3377 gene locus_tag LOCUS_10770 3027 3377 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_10770 4367 3402 gene locus_tag LOCUS_10780 4367 3402 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084659.1 protein_id gnl|my_center|LOCUS_10780 5396 4419 gene locus_tag LOCUS_10790 5396 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775932.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence128 218 2179 gene locus_tag LOCUS_10800 218 2179 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776537.1 protein_id gnl|my_center|LOCUS_10800 3019 2228 gene locus_tag LOCUS_10810 3019 2228 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 protein_id gnl|my_center|LOCUS_10810 4402 3104 gene locus_tag LOCUS_10820 4402 3104 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805035.1 protein_id gnl|my_center|LOCUS_10820 5900 4539 gene locus_tag LOCUS_10830 5900 4539 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence129 3311 561 gene locus_tag LOCUS_10840 3311 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4505 3501 gene locus_tag LOCUS_10850 4505 3501 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 protein_id gnl|my_center|LOCUS_10850 6164 4617 gene locus_tag LOCUS_10860 6164 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence130 430 1815 gene locus_tag LOCUS_10870 430 1815 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038047495.1 protein_id gnl|my_center|LOCUS_10870 2040 3044 gene locus_tag LOCUS_10880 2040 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5503 3188 gene locus_tag LOCUS_10890 5503 3188 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence131 592 1395 gene locus_tag LOCUS_10900 592 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1627 2028 gene locus_tag LOCUS_10910 1627 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2032 2271 gene locus_tag LOCUS_10920 2032 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4040 2364 gene locus_tag LOCUS_10930 4040 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4214 4966 gene locus_tag LOCUS_10940 4214 4966 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775964.1 protein_id gnl|my_center|LOCUS_10940 4983 5936 gene locus_tag LOCUS_10950 4983 5936 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775965.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence132 30 419 gene locus_tag LOCUS_10960 30 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 952 521 gene locus_tag LOCUS_10970 952 521 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727656.1 protein_id gnl|my_center|LOCUS_10970 1115 1918 gene locus_tag LOCUS_10980 1115 1918 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083453073.1 protein_id gnl|my_center|LOCUS_10980 1951 3192 gene locus_tag LOCUS_10990 gene rocD 1951 3192 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_10990 3298 6012 gene locus_tag LOCUS_11000 3298 6012 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731355.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence133 633 346 gene locus_tag LOCUS_11010 633 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 566 1519 gene locus_tag LOCUS_11020 566 1519 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 protein_id gnl|my_center|LOCUS_11020 1516 2604 gene locus_tag LOCUS_11030 1516 2604 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974571.1 protein_id gnl|my_center|LOCUS_11030 2597 3370 gene locus_tag LOCUS_11040 2597 3370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050162286.1 protein_id gnl|my_center|LOCUS_11040 5192 3399 gene locus_tag LOCUS_11050 5192 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5890 5189 gene locus_tag LOCUS_11060 5890 5189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence134 >Feature sequence135 2467 1094 gene locus_tag LOCUS_11070 2467 1094 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228450.1 protein_id gnl|my_center|LOCUS_11070 2604 3875 gene locus_tag LOCUS_11080 2604 3875 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_11080 3977 4987 gene locus_tag LOCUS_11090 3977 4987 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_11090 5682 4984 gene locus_tag LOCUS_11100 5682 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence136 421 1113 gene locus_tag LOCUS_11110 421 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1915 1304 gene locus_tag LOCUS_11120 1915 1304 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_11120 3051 1912 gene locus_tag LOCUS_11130 3051 1912 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230142.1 protein_id gnl|my_center|LOCUS_11130 3110 3499 gene locus_tag LOCUS_11140 3110 3499 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776463.1 protein_id gnl|my_center|LOCUS_11140 3496 3996 gene locus_tag LOCUS_11150 3496 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4126 5400 gene locus_tag LOCUS_11160 4126 5400 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence137 2074 137 gene locus_tag LOCUS_11170 2074 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2261 2303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3044 3370 gene locus_tag LOCUS_11180 3044 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4286 3375 gene locus_tag LOCUS_11190 4286 3375 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776562.1 protein_id gnl|my_center|LOCUS_11190 5235 4330 gene locus_tag LOCUS_11200 5235 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5337 5948 gene locus_tag LOCUS_11210 5337 5948 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229469.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence138 1936 842 gene locus_tag LOCUS_11220 1936 842 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_11220 3398 1998 gene locus_tag LOCUS_11230 3398 1998 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_11230 4622 3417 gene locus_tag LOCUS_11240 4622 3417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_11240 5624 4641 gene locus_tag LOCUS_11250 5624 4641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973627.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence139 1373 297 gene locus_tag LOCUS_11260 1373 297 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384492.1 protein_id gnl|my_center|LOCUS_11260 2152 1508 gene locus_tag LOCUS_11270 2152 1508 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230202.1 protein_id gnl|my_center|LOCUS_11270 2289 2543 gene locus_tag LOCUS_11280 2289 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2693 3055 gene locus_tag LOCUS_11290 2693 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3065 5824 gene locus_tag LOCUS_11300 3065 5824 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014439.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence140 227 1444 gene locus_tag LOCUS_11310 227 1444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_11310 1642 3651 gene locus_tag LOCUS_11320 1642 3651 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_11320 4770 3814 gene locus_tag LOCUS_11330 4770 3814 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_11330 4824 5297 gene locus_tag LOCUS_11340 4824 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5325 5561 gene locus_tag LOCUS_11350 gene vapB2 5325 5561 CDS product type II toxin-antitoxin system antitoxin VapB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401563.1 protein_id gnl|my_center|LOCUS_11350 5585 5953 gene locus_tag LOCUS_11360 5585 5953 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401566.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence141 1056 4 gene locus_tag LOCUS_11370 1056 4 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_11370 1735 1109 gene locus_tag LOCUS_11380 1735 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3594 1732 gene locus_tag LOCUS_11390 gene dnaK 3594 1732 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118161.1 protein_id gnl|my_center|LOCUS_11390 3831 4610 gene locus_tag LOCUS_11400 3831 4610 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_11400 5362 4607 gene locus_tag LOCUS_11410 5362 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence142 1239 712 gene locus_tag LOCUS_11420 1239 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1848 1249 gene locus_tag LOCUS_11430 1848 1249 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807283.1 protein_id gnl|my_center|LOCUS_11430 3873 2017 gene locus_tag LOCUS_11440 3873 2017 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775796.1 protein_id gnl|my_center|LOCUS_11440 4014 4844 gene locus_tag LOCUS_11450 4014 4844 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 protein_id gnl|my_center|LOCUS_11450 <5952 4859 gene locus_tag LOCUS_11460 <5952 4859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258585.1:glycoside hydrolase family 32 protein >Feature sequence143 <1 583 gene locus_tag LOCUS_11470 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777095.1:metal ABC transporter ATP-binding protein 580 1452 gene locus_tag LOCUS_11480 580 1452 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 protein_id gnl|my_center|LOCUS_11480 1511 2536 gene locus_tag LOCUS_11490 1511 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3414 2842 gene locus_tag LOCUS_11500 3414 2842 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_11500 3815 3411 gene locus_tag LOCUS_11510 3815 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4188 3844 gene locus_tag LOCUS_11520 4188 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4507 4178 gene locus_tag LOCUS_11530 4507 4178 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_11530 4650 4564 gene locus_tag LOCUS_t00240 4650 4564 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 2368 662 gene locus_tag LOCUS_11540 2368 662 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_11540 3336 2365 gene locus_tag LOCUS_11550 3336 2365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 protein_id gnl|my_center|LOCUS_11550 3626 3333 gene locus_tag LOCUS_11560 3626 3333 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223409.1 protein_id gnl|my_center|LOCUS_11560 4408 3626 gene locus_tag LOCUS_11570 4408 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4556 5350 gene locus_tag LOCUS_11580 4556 5350 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776540.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence145 1680 430 gene locus_tag LOCUS_11590 1680 430 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_11590 2704 1673 gene locus_tag LOCUS_11600 2704 1673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080423.1 protein_id gnl|my_center|LOCUS_11600 3873 2701 gene locus_tag LOCUS_11610 3873 2701 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence146 707 997 gene locus_tag LOCUS_11620 707 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1054 1479 gene locus_tag LOCUS_11630 1054 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1765 1689 gene locus_tag LOCUS_t00250 1765 1689 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2662 1868 gene locus_tag LOCUS_11640 2662 1868 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804385.1 protein_id gnl|my_center|LOCUS_11640 3268 2810 gene locus_tag LOCUS_11650 3268 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4855 3320 gene locus_tag LOCUS_11660 gene araA 4855 3320 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776919.1 protein_id gnl|my_center|LOCUS_11660 5606 4911 gene locus_tag LOCUS_11670 5606 4911 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence147 242 724 gene locus_tag LOCUS_11680 242 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 721 1332 gene locus_tag LOCUS_11690 721 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_11690 4999 1340 gene locus_tag LOCUS_11700 gene metH 4999 1340 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_11700 5678 5043 gene locus_tag LOCUS_11710 5678 5043 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence148 <1 1007 gene locus_tag LOCUS_11720 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043788179.1:YafY family protein 1319 1032 gene locus_tag LOCUS_11730 1319 1032 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312083.1 protein_id gnl|my_center|LOCUS_11730 2374 1388 gene locus_tag LOCUS_11740 2374 1388 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_11740 2645 2661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2680 3099 gene locus_tag LOCUS_11750 2680 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 3828 3148 gene locus_tag LOCUS_11760 3828 3148 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_11760 4244 3825 gene locus_tag LOCUS_11770 4244 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5065 4319 gene locus_tag LOCUS_11780 5065 4319 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence149 1829 4222 gene locus_tag LOCUS_11790 1829 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4962 4228 gene locus_tag LOCUS_11800 4962 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence150 1651 515 gene locus_tag LOCUS_11810 1651 515 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922787.1 protein_id gnl|my_center|LOCUS_11810 3754 1826 gene locus_tag LOCUS_11820 3754 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4575 3751 gene locus_tag LOCUS_11830 4575 3751 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803744.1 protein_id gnl|my_center|LOCUS_11830 5520 4579 gene locus_tag LOCUS_11840 5520 4579 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624137.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence151 636 139 gene locus_tag LOCUS_11850 636 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 629 2857 gene locus_tag LOCUS_11860 629 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3157 5553 gene locus_tag LOCUS_11870 3157 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence152 1069 305 gene locus_tag LOCUS_11880 gene lexA 1069 305 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 protein_id gnl|my_center|LOCUS_11880 1323 1694 gene locus_tag LOCUS_11890 1323 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1797 2288 gene locus_tag LOCUS_11900 gene nrdR 1797 2288 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_11900 3614 2409 gene locus_tag LOCUS_11910 gene serA 3614 2409 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_11910 5113 3701 gene locus_tag LOCUS_11920 5113 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 5279 5773 gene locus_tag LOCUS_11930 gene rbfA 5279 5773 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence153 1775 1089 gene locus_tag LOCUS_11940 1775 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1957 1775 gene locus_tag LOCUS_11950 gene rpmD 1957 1775 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727688.1 protein_id gnl|my_center|LOCUS_11950 2649 1957 gene locus_tag LOCUS_11960 2649 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3061 2678 gene locus_tag LOCUS_11970 gene rplR 3061 2678 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_11970 3594 3058 gene locus_tag LOCUS_11980 gene rplF 3594 3058 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776362.1 protein_id gnl|my_center|LOCUS_11980 4007 3609 gene locus_tag LOCUS_11990 gene rpsH 4007 3609 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_11990 4268 4083 gene locus_tag LOCUS_12000 4268 4083 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055692.1 protein_id gnl|my_center|LOCUS_12000 4866 4270 gene locus_tag LOCUS_12010 gene rplE 4866 4270 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_12010 5207 4866 gene locus_tag LOCUS_12020 gene rplX 5207 4866 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776365.1 protein_id gnl|my_center|LOCUS_12020 5579 5211 gene locus_tag LOCUS_12030 gene rplN 5579 5211 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055680.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence154 500 1927 gene locus_tag LOCUS_12040 500 1927 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978202.1 protein_id gnl|my_center|LOCUS_12040 2013 2966 gene locus_tag LOCUS_12050 2013 2966 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467636.1 protein_id gnl|my_center|LOCUS_12050 2966 3916 gene locus_tag LOCUS_12060 2966 3916 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_12060 3913 5184 gene locus_tag LOCUS_12070 3913 5184 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098730.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence155 387 1559 gene locus_tag LOCUS_12080 387 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1733 2863 gene locus_tag LOCUS_12090 gene trpS 1733 2863 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_12090 3612 2869 gene locus_tag LOCUS_12100 3612 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 4049 3660 gene locus_tag LOCUS_12110 4049 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence156 75 2006 gene locus_tag LOCUS_12120 75 2006 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_12120 2087 3091 gene locus_tag LOCUS_12130 2087 3091 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014235.1 protein_id gnl|my_center|LOCUS_12130 3109 4614 gene locus_tag LOCUS_12140 3109 4614 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014233.1 protein_id gnl|my_center|LOCUS_12140 4611 5381 gene locus_tag LOCUS_12150 4611 5381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530576.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12150 5378 5551 gene locus_tag LOCUS_12160 5378 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence157 <1 863 gene locus_tag LOCUS_12170 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726997.1:extracellular solute-binding protein 868 1812 gene locus_tag LOCUS_12180 868 1812 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624137.1 protein_id gnl|my_center|LOCUS_12180 1815 2621 gene locus_tag LOCUS_12190 1815 2621 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803744.1 protein_id gnl|my_center|LOCUS_12190 2663 3466 gene locus_tag LOCUS_12200 gene nagB 2663 3466 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804961.1 protein_id gnl|my_center|LOCUS_12200 3503 4804 gene locus_tag LOCUS_12210 gene licH 3503 4804 CDS product 6-phospho-beta-glucosidase LicH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244285.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence158 1587 10 gene locus_tag LOCUS_12220 gene ffh 1587 10 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804617.1 protein_id gnl|my_center|LOCUS_12220 3538 1664 gene locus_tag LOCUS_12230 3538 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3890 3552 gene locus_tag LOCUS_12240 3890 3552 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 protein_id gnl|my_center|LOCUS_12240 5220 3892 gene locus_tag LOCUS_12250 5220 3892 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014854.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence159 1127 570 gene locus_tag LOCUS_12260 gene efp 1127 570 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076127.1 protein_id gnl|my_center|LOCUS_12260 1626 1189 gene locus_tag LOCUS_12270 1626 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2321 1737 gene locus_tag LOCUS_12280 2321 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3480 2401 gene locus_tag LOCUS_12290 gene aroB 3480 2401 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_12290 4030 3473 gene locus_tag LOCUS_12300 4030 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5214 4027 gene locus_tag LOCUS_12310 gene aroC 5214 4027 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224602.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence160 1601 675 gene locus_tag LOCUS_12320 1601 675 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230918.1 protein_id gnl|my_center|LOCUS_12320 3334 1595 gene locus_tag LOCUS_12330 3334 1595 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929955.1 protein_id gnl|my_center|LOCUS_12330 <5633 3410 gene locus_tag LOCUS_12340 <5633 3410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184834092.1:LamG domain-containing protein >Feature sequence161 1255 1025 gene locus_tag LOCUS_12350 1255 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1200 2363 gene locus_tag LOCUS_12360 1200 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2434 3327 gene locus_tag LOCUS_12370 2434 3327 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_12370 3342 4157 gene locus_tag LOCUS_12380 3342 4157 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067990.1 protein_id gnl|my_center|LOCUS_12380 4210 4725 gene locus_tag LOCUS_12390 4210 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence162 2360 969 gene locus_tag LOCUS_12400 2360 969 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118145.1 protein_id gnl|my_center|LOCUS_12400 2644 2459 gene locus_tag LOCUS_12410 2644 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2745 4064 gene locus_tag LOCUS_12420 2745 4064 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_12420 4086 5114 gene locus_tag LOCUS_12430 4086 5114 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence163 1801 908 gene locus_tag LOCUS_12440 1801 908 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_12440 2751 1801 gene locus_tag LOCUS_12450 2751 1801 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_12450 4007 2748 gene locus_tag LOCUS_12460 4007 2748 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_12460 4166 5290 gene locus_tag LOCUS_12470 4166 5290 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484476.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence164 1355 219 gene locus_tag LOCUS_12480 1355 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1288 1482 gene locus_tag LOCUS_12490 1288 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1565 1637 gene locus_tag LOCUS_t00260 1565 1637 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1728 1801 gene locus_tag LOCUS_t00270 1728 1801 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2262 1873 gene locus_tag LOCUS_12500 2262 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 3094 2375 gene locus_tag LOCUS_12510 3094 2375 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_12510 3242 4723 gene locus_tag LOCUS_12520 gene leuC 3242 4723 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775884.1 protein_id gnl|my_center|LOCUS_12520 4758 5405 gene locus_tag LOCUS_12530 gene leuD 4758 5405 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence165 123 869 gene locus_tag LOCUS_12540 123 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1818 940 gene locus_tag LOCUS_12550 gene pyrF 1818 940 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_12550 5165 1815 gene locus_tag LOCUS_12560 gene carB 5165 1815 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805079.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence166 1491 19 gene locus_tag LOCUS_12570 1491 19 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973075.1 protein_id gnl|my_center|LOCUS_12570 2399 1545 gene locus_tag LOCUS_12580 2399 1545 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 protein_id gnl|my_center|LOCUS_12580 3328 2402 gene locus_tag LOCUS_12590 3328 2402 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144259.1 protein_id gnl|my_center|LOCUS_12590 4729 3395 gene locus_tag LOCUS_12600 4729 3395 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975589.1 protein_id gnl|my_center|LOCUS_12600 <5573 4773 gene locus_tag LOCUS_12610 <5573 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726988.1:CaiB/BaiF CoA-transferase family protein >Feature sequence167 1934 5539 gene locus_tag LOCUS_12620 1934 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence168 515 1459 gene locus_tag LOCUS_12630 515 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1551 2996 gene locus_tag LOCUS_12640 1551 2996 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225106.1 protein_id gnl|my_center|LOCUS_12640 3000 3935 gene locus_tag LOCUS_12650 3000 3935 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_12650 3932 4894 gene locus_tag LOCUS_12660 3932 4894 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150923540.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence169 2030 2677 gene locus_tag LOCUS_12670 2030 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3804 2683 gene locus_tag LOCUS_12680 3804 2683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_12680 5342 3801 gene locus_tag LOCUS_12690 5342 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence170 2192 1605 gene locus_tag LOCUS_12700 2192 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3411 2209 gene locus_tag LOCUS_12710 gene metK 3411 2209 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_12710 4909 3686 gene locus_tag LOCUS_12720 gene coaBC 4909 3686 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728784.1 protein_id gnl|my_center|LOCUS_12720 5223 4960 gene locus_tag LOCUS_12730 5223 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence171 5332 1073 gene locus_tag LOCUS_12740 gene hrpA 5332 1073 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence172 1588 698 gene locus_tag LOCUS_12750 gene sucD 1588 698 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_12750 2816 1635 gene locus_tag LOCUS_12760 gene sucC 2816 1635 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_12760 3079 2948 gene locus_tag LOCUS_12770 3079 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3299 3721 gene locus_tag LOCUS_12780 3299 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5112 3691 gene locus_tag LOCUS_12790 5112 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence173 395 180 gene locus_tag LOCUS_12800 gene rpmE 395 180 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_12800 2478 514 gene locus_tag LOCUS_12810 2478 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4782 2821 gene locus_tag LOCUS_12820 4782 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3777 3872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5443 4877 gene locus_tag LOCUS_12830 <5443 4877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189283905.1:homoserine dehydrogenase >Feature sequence174 1813 764 gene locus_tag LOCUS_12840 1813 764 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_12840 2598 1810 gene locus_tag LOCUS_12850 2598 1810 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_12850 3247 2666 gene locus_tag LOCUS_12860 3247 2666 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805021.1 protein_id gnl|my_center|LOCUS_12860 3511 3990 gene locus_tag LOCUS_12870 3511 3990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_12870 3987 5042 gene locus_tag LOCUS_12880 gene trpD 3987 5042 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence175 2763 5243 gene locus_tag LOCUS_12890 2763 5243 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence176 1275 97 gene locus_tag LOCUS_12900 gene fasR 1275 97 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_12900 4144 1394 gene locus_tag LOCUS_12910 gene aceE 4144 1394 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 protein_id gnl|my_center|LOCUS_12910 4291 4839 gene locus_tag LOCUS_12920 4291 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4983 5333 gene locus_tag LOCUS_12930 4983 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence177 1777 194 gene locus_tag LOCUS_12940 1777 194 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_12940 2033 1782 gene locus_tag LOCUS_12950 2033 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3244 2045 gene locus_tag LOCUS_12960 3244 2045 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776597.1 protein_id gnl|my_center|LOCUS_12960 4029 3241 gene locus_tag LOCUS_12970 gene tmk 4029 3241 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776596.1 protein_id gnl|my_center|LOCUS_12970 5163 4129 gene locus_tag LOCUS_12980 5163 4129 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776595.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence178 8 718 gene locus_tag LOCUS_12990 8 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 958 1404 gene locus_tag LOCUS_13000 958 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1458 1697 gene locus_tag LOCUS_13010 1458 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2431 1796 gene locus_tag LOCUS_13020 2431 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2966 2538 gene locus_tag LOCUS_13030 2966 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3592 3038 gene locus_tag LOCUS_13040 3592 3038 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 protein_id gnl|my_center|LOCUS_13040 4179 3598 gene locus_tag LOCUS_13050 4179 3598 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence179 1472 57 gene locus_tag LOCUS_13060 gene cysS 1472 57 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804883.1 protein_id gnl|my_center|LOCUS_13060 2057 1575 gene locus_tag LOCUS_13070 2057 1575 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804554.1 protein_id gnl|my_center|LOCUS_13070 2371 2054 gene locus_tag LOCUS_13080 2371 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2253 2723 gene locus_tag LOCUS_13090 2253 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3467 2754 gene locus_tag LOCUS_13100 3467 2754 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 protein_id gnl|my_center|LOCUS_13100 4807 3464 gene locus_tag LOCUS_13110 4807 3464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence180 532 158 gene locus_tag LOCUS_13120 532 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2253 700 gene locus_tag LOCUS_13130 gene lysS 2253 700 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_13130 3286 2246 gene locus_tag LOCUS_13140 gene panC 3286 2246 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804902.1 protein_id gnl|my_center|LOCUS_13140 3373 3482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5313 4270 gene locus_tag LOCUS_13150 5313 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence181 1289 879 gene locus_tag LOCUS_13160 1289 879 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112263.1 protein_id gnl|my_center|LOCUS_13160 1987 1427 gene locus_tag LOCUS_13170 1987 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13170 2413 2057 gene locus_tag LOCUS_13180 2413 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13180 3407 2499 gene locus_tag LOCUS_13190 3407 2499 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804432.1 protein_id gnl|my_center|LOCUS_13190 3655 4617 gene locus_tag LOCUS_13200 3655 4617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence182 938 1672 gene locus_tag LOCUS_13210 938 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3157 1841 gene locus_tag LOCUS_13220 gene tyrS 3157 1841 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_13220 3869 3225 gene locus_tag LOCUS_13230 3869 3225 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_13230 4734 3955 gene locus_tag LOCUS_13240 4734 3955 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027230.1 protein_id gnl|my_center|LOCUS_13240 <5277 4739 gene locus_tag LOCUS_13250 <5277 4739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898102.1:AAA family ATPase >Feature sequence183 291 1541 gene locus_tag LOCUS_13260 291 1541 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729172.1 protein_id gnl|my_center|LOCUS_13260 2371 1559 gene locus_tag LOCUS_13270 2371 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2886 2368 gene locus_tag LOCUS_13280 2886 2368 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_13280 3659 2997 gene locus_tag LOCUS_13290 3659 2997 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_13290 3803 5023 gene locus_tag LOCUS_13300 3803 5023 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776428.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence184 <1 830 gene locus_tag LOCUS_13310 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224391.1:3-oxosteroid 1-dehydrogenase 884 1879 gene locus_tag LOCUS_13320 884 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 4865 2007 gene locus_tag LOCUS_13330 4865 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence185 68 1120 gene locus_tag LOCUS_13340 68 1120 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731286.1 protein_id gnl|my_center|LOCUS_13340 1370 3904 gene locus_tag LOCUS_13350 1370 3904 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051721.1 protein_id gnl|my_center|LOCUS_13350 4651 3977 gene locus_tag LOCUS_13360 4651 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence186 1165 713 gene locus_tag LOCUS_13370 gene ybeY 1165 713 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_13370 2154 1162 gene locus_tag LOCUS_13380 2154 1162 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_13380 3281 2151 gene locus_tag LOCUS_13390 gene dnaJ 3281 2151 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_13390 4419 3367 gene locus_tag LOCUS_13400 gene hrcA 4419 3367 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence187 1248 358 gene locus_tag LOCUS_13410 1248 358 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_13410 2198 1251 gene locus_tag LOCUS_13420 2198 1251 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_13420 3509 2208 gene locus_tag LOCUS_13430 3509 2208 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218106651.1 protein_id gnl|my_center|LOCUS_13430 3691 4368 gene locus_tag LOCUS_13440 3691 4368 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227638.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence188 2520 82 gene locus_tag LOCUS_13450 2520 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence189 333 61 gene locus_tag LOCUS_13460 333 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13460 1295 603 gene locus_tag LOCUS_13470 1295 603 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_13470 1335 2696 gene locus_tag LOCUS_13480 1335 2696 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_13480 4427 2877 gene locus_tag LOCUS_13490 4427 2877 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389404.1 protein_id gnl|my_center|LOCUS_13490 <5164 4534 gene locus_tag LOCUS_13500 <5164 4534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014466562.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase >Feature sequence190 1946 729 gene locus_tag LOCUS_13510 gene caiB 1946 729 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349936.1 protein_id gnl|my_center|LOCUS_13510 3115 1982 gene locus_tag LOCUS_13520 gene caiA 3115 1982 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_13520 4197 3187 gene locus_tag LOCUS_13530 gene aes 4197 3187 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801788.1 protein_id gnl|my_center|LOCUS_13530 <5162 4200 gene locus_tag LOCUS_13540 <5162 4200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868824.1:MFS transporter >Feature sequence191 <1 1057 gene locus_tag LOCUS_13550 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042510662.1:iron chelate uptake ABC transporter family permease subunit 1054 1845 gene locus_tag LOCUS_13560 1054 1845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_13560 2726 1866 gene locus_tag LOCUS_13570 2726 1866 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_13570 3538 2726 gene locus_tag LOCUS_13580 3538 2726 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_13580 4518 3535 gene locus_tag LOCUS_13590 4518 3535 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence192 1445 501 gene locus_tag LOCUS_13600 1445 501 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_13600 2359 1442 gene locus_tag LOCUS_13610 2359 1442 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_13610 3374 2463 gene locus_tag LOCUS_13620 3374 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 3928 3371 gene locus_tag LOCUS_13630 3928 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13630 3382 3421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5110 3988 gene locus_tag LOCUS_13640 <5110 3988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027462.1:glycoside hydrolase family 38 C-terminal domain-containing protein >Feature sequence193 2 1597 gene locus_tag LOCUS_13650 2 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1678 2877 gene locus_tag LOCUS_13660 1678 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 <5055 3218 gene locus_tag LOCUS_13670 <5055 3218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977687.1:ABC transporter ATP-binding protein >Feature sequence194 1429 776 gene locus_tag LOCUS_13680 1429 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2379 1453 gene locus_tag LOCUS_13690 2379 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3550 2372 gene locus_tag LOCUS_13700 3550 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4423 3602 gene locus_tag LOCUS_13710 4423 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4932 4417 gene locus_tag LOCUS_13720 4932 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence195 1710 571 gene locus_tag LOCUS_13730 1710 571 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731046.1 protein_id gnl|my_center|LOCUS_13730 3164 1773 gene locus_tag LOCUS_13740 gene dacB 3164 1773 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113125.1 protein_id gnl|my_center|LOCUS_13740 3305 3826 gene locus_tag LOCUS_13750 3305 3826 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804890.1 protein_id gnl|my_center|LOCUS_13750 3866 3874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4367 3930 gene locus_tag LOCUS_13760 4367 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4793 4455 gene locus_tag LOCUS_13770 4793 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence196 4513 4208 gene locus_tag LOCUS_13780 4513 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence197 837 10 gene locus_tag LOCUS_13790 837 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1678 830 gene locus_tag LOCUS_13800 1678 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1971 2651 gene locus_tag LOCUS_13810 1971 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence198 1432 2823 gene locus_tag LOCUS_13820 1432 2823 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930026.1 protein_id gnl|my_center|LOCUS_13820 2820 3935 gene locus_tag LOCUS_13830 2820 3935 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930288.1 protein_id gnl|my_center|LOCUS_13830 3932 4849 gene locus_tag LOCUS_13840 3932 4849 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776594.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence199 883 1401 gene locus_tag LOCUS_13850 gene rplJ 883 1401 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_13850 1480 1869 gene locus_tag LOCUS_13860 gene rplL 1480 1869 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence200 2083 326 gene locus_tag LOCUS_13870 2083 326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803869.1 protein_id gnl|my_center|LOCUS_13870 3987 2080 gene locus_tag LOCUS_13880 3987 2080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803870.1 protein_id gnl|my_center|LOCUS_13880 4794 4228 gene locus_tag LOCUS_13890 4794 4228 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence201 <1 2414 gene locus_tag LOCUS_13900 <1 2414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030835.1:LuxR family transcriptional regulator 3218 2439 gene locus_tag LOCUS_13910 3218 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4864 3215 gene locus_tag LOCUS_13920 4864 3215 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence202 2015 1347 gene locus_tag LOCUS_13930 2015 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2094 3377 gene locus_tag LOCUS_13940 2094 3377 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804747.1 protein_id gnl|my_center|LOCUS_13940 3370 4077 gene locus_tag LOCUS_13950 3370 4077 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804746.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence203 713 120 gene locus_tag LOCUS_13960 713 120 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_13960 1360 710 gene locus_tag LOCUS_13970 1360 710 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_13970 2854 1499 gene locus_tag LOCUS_13980 2854 1499 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_13980 3671 2937 gene locus_tag LOCUS_13990 3671 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3698 3755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence204 595 2316 gene locus_tag LOCUS_14000 595 2316 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043792085.1 protein_id gnl|my_center|LOCUS_14000 2499 3491 gene locus_tag LOCUS_14010 2499 3491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_14010 3493 4608 gene locus_tag LOCUS_14020 3493 4608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803790.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence205 438 2252 gene locus_tag LOCUS_14030 438 2252 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_14030 2313 4253 gene locus_tag LOCUS_14040 2313 4253 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_14040 4320 4601 gene locus_tag LOCUS_14050 4320 4601 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence206 3846 1501 gene locus_tag LOCUS_14060 3846 1501 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_14060 4455 3925 gene locus_tag LOCUS_14070 4455 3925 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111371.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence207 587 2005 gene locus_tag LOCUS_14080 587 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2087 2374 gene locus_tag LOCUS_14090 2087 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2374 4746 gene locus_tag LOCUS_14100 2374 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence208 1745 939 gene locus_tag LOCUS_14110 1745 939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729788.1 protein_id gnl|my_center|LOCUS_14110 2743 1742 gene locus_tag LOCUS_14120 2743 1742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729787.1 protein_id gnl|my_center|LOCUS_14120 4451 2775 gene locus_tag LOCUS_14130 4451 2775 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence209 <1 594 gene locus_tag LOCUS_14140 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908614.1:carbonic anhydrase 746 1513 gene locus_tag LOCUS_14150 746 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2675 1644 gene locus_tag LOCUS_14160 2675 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3025 2672 gene locus_tag LOCUS_14170 3025 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4522 3146 gene locus_tag LOCUS_14180 4522 3146 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence210 484 2688 gene locus_tag LOCUS_14190 484 2688 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence211 1919 615 gene locus_tag LOCUS_14200 1919 615 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_14200 2359 1916 gene locus_tag LOCUS_14210 2359 1916 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_14210 3644 2349 gene locus_tag LOCUS_14220 3644 2349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_14220 <4847 3641 gene locus_tag LOCUS_14230 <4847 3641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776142.1:ABC transporter permease note possible pseudo, internal stop codon, frameshifted >Feature sequence212 1433 390 gene locus_tag LOCUS_14240 1433 390 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079997.1 protein_id gnl|my_center|LOCUS_14240 3617 1488 gene locus_tag LOCUS_14250 3617 1488 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_14250 3737 3952 gene locus_tag LOCUS_14260 3737 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_14260 3964 4728 gene locus_tag LOCUS_14270 3964 4728 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228176.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence213 1127 684 gene locus_tag LOCUS_14280 1127 684 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060114.1 protein_id gnl|my_center|LOCUS_14280 1293 1523 gene locus_tag LOCUS_14290 1293 1523 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_14290 2237 1650 gene locus_tag LOCUS_14300 2237 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14300 2280 2301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence214 1128 298 gene locus_tag LOCUS_14310 1128 298 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_14310 1632 1171 gene locus_tag LOCUS_14320 1632 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1802 3226 gene locus_tag LOCUS_14330 gene glnA 1802 3226 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence215 121 837 gene locus_tag LOCUS_14340 121 837 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775683.1 protein_id gnl|my_center|LOCUS_14340 3814 965 gene locus_tag LOCUS_14350 gene adhE 3814 965 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972432.1 protein_id gnl|my_center|LOCUS_14350 4452 4039 gene locus_tag LOCUS_14360 4452 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence216 1055 162 gene locus_tag LOCUS_14370 1055 162 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_14370 1236 3341 gene locus_tag LOCUS_14380 1236 3341 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053544642.1 protein_id gnl|my_center|LOCUS_14380 <4717 3458 gene locus_tag LOCUS_14390 <4717 3458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776348.1:acyl-CoA dehydrogenase >Feature sequence217 <1 1074 gene locus_tag LOCUS_14400 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230939.1:MaoC/PaaZ C-terminal domain-containing protein 1848 1147 gene locus_tag LOCUS_14410 1848 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223565.1 protein_id gnl|my_center|LOCUS_14410 4396 2582 gene locus_tag LOCUS_14420 4396 2582 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence218 <1 1423 gene locus_tag LOCUS_14430 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228110.1:MFS transporter 1556 3607 gene locus_tag LOCUS_14440 1556 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14440 >Feature sequence219 389 1282 gene locus_tag LOCUS_14450 389 1282 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326709.1 protein_id gnl|my_center|LOCUS_14450 2315 1329 gene locus_tag LOCUS_14460 2315 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3350 2367 gene locus_tag LOCUS_14470 3350 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4132 3347 gene locus_tag LOCUS_14480 4132 3347 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence220 302 955 gene locus_tag LOCUS_14490 302 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2367 928 gene locus_tag LOCUS_14500 2367 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3256 2357 gene locus_tag LOCUS_14510 3256 2357 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259408.1 protein_id gnl|my_center|LOCUS_14510 3354 3369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence221 <1 1667 gene locus_tag LOCUS_14520 <1 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805000.1:protein translocase subunit SecD 1667 2758 gene locus_tag LOCUS_14530 gene secF 1667 2758 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence222 <1 551 gene locus_tag LOCUS_14540 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404512.1:helicase-associated domain-containing protein 633 2330 gene locus_tag LOCUS_14550 633 2330 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897120.1 protein_id gnl|my_center|LOCUS_14550 2409 4484 gene locus_tag LOCUS_14560 2409 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence223 2041 2724 gene locus_tag LOCUS_14570 2041 2724 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_14570 2721 3893 gene locus_tag LOCUS_14580 gene ahcY 2721 3893 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 protein_id gnl|my_center|LOCUS_14580 <4688 3944 gene locus_tag LOCUS_14590 <4688 3944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000911797.1:SDR family oxidoreductase >Feature sequence224 288 1652 gene locus_tag LOCUS_14600 288 1652 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776865.1 protein_id gnl|my_center|LOCUS_14600 1713 2690 gene locus_tag LOCUS_14610 1713 2690 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 protein_id gnl|my_center|LOCUS_14610 2690 3577 gene locus_tag LOCUS_14620 2690 3577 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_14620 3581 4351 gene locus_tag LOCUS_14630 3581 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence225 3038 504 gene locus_tag LOCUS_14640 3038 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3790 3233 gene locus_tag LOCUS_14650 3790 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence226 640 1374 gene locus_tag LOCUS_14660 640 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1449 1640 gene locus_tag LOCUS_14670 1449 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3957 1699 gene locus_tag LOCUS_14680 3957 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence227 522 52 gene locus_tag LOCUS_14690 522 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14690 1004 513 gene locus_tag LOCUS_14700 1004 513 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_14700 1331 1014 gene locus_tag LOCUS_14710 1331 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3946 1397 gene locus_tag LOCUS_14720 3946 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence228 <1 851 gene locus_tag LOCUS_14730 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339288.1:ABC transporter ATP-binding protein 848 1795 gene locus_tag LOCUS_14740 848 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 2114 3415 gene locus_tag LOCUS_14750 2114 3415 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_14750 3450 3944 gene locus_tag LOCUS_14760 3450 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence229 4153 2816 gene locus_tag LOCUS_14770 gene glnA 4153 2816 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence230 1650 724 gene locus_tag LOCUS_14780 1650 724 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051555.1 protein_id gnl|my_center|LOCUS_14780 3055 1712 gene locus_tag LOCUS_14790 3055 1712 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068481.1 protein_id gnl|my_center|LOCUS_14790 3285 4259 gene locus_tag LOCUS_14800 3285 4259 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225264.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence231 1843 740 gene locus_tag LOCUS_14810 1843 740 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564740.1 protein_id gnl|my_center|LOCUS_14810 1972 2586 gene locus_tag LOCUS_14820 1972 2586 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805144.1 protein_id gnl|my_center|LOCUS_14820 4154 2583 gene locus_tag LOCUS_14830 4154 2583 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence232 2584 1484 gene locus_tag LOCUS_14840 2584 1484 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456695.1 protein_id gnl|my_center|LOCUS_14840 3735 2581 gene locus_tag LOCUS_14850 3735 2581 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222508.1 protein_id gnl|my_center|LOCUS_14850 <4528 3749 gene locus_tag LOCUS_14860 <4528 3749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052908.1:carbohydrate ABC transporter permease >Feature sequence233 1265 3247 gene locus_tag LOCUS_14870 1265 3247 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027129.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence234 374 1690 gene locus_tag LOCUS_14880 374 1690 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977908.1 protein_id gnl|my_center|LOCUS_14880 1762 2640 gene locus_tag LOCUS_14890 1762 2640 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804717.1 protein_id gnl|my_center|LOCUS_14890 2637 3560 gene locus_tag LOCUS_14900 2637 3560 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027464.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence235 1587 823 gene locus_tag LOCUS_14910 gene mntR 1587 823 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_14910 3140 1629 gene locus_tag LOCUS_14920 gene gatB 3140 1629 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775912.1 protein_id gnl|my_center|LOCUS_14920 <4478 3137 gene locus_tag LOCUS_14930 <4478 3137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775913.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence236 435 1352 gene locus_tag LOCUS_14940 435 1352 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729231.1 protein_id gnl|my_center|LOCUS_14940 1349 1681 gene locus_tag LOCUS_14950 1349 1681 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805149.1 protein_id gnl|my_center|LOCUS_14950 1695 2423 gene locus_tag LOCUS_14960 1695 2423 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495981.1 protein_id gnl|my_center|LOCUS_14960 2504 2995 gene locus_tag LOCUS_14970 2504 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2992 3774 gene locus_tag LOCUS_14980 2992 3774 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence237 2 340 gene locus_tag LOCUS_14990 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 344 1252 gene locus_tag LOCUS_15000 344 1252 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804137.1 protein_id gnl|my_center|LOCUS_15000 1253 2089 gene locus_tag LOCUS_15010 1253 2089 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804136.1 protein_id gnl|my_center|LOCUS_15010 2094 3074 gene locus_tag LOCUS_15020 2094 3074 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930131.1 protein_id gnl|my_center|LOCUS_15020 3210 3971 gene locus_tag LOCUS_15030 3210 3971 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence238 3486 1273 gene locus_tag LOCUS_15040 3486 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence239 1019 222 gene locus_tag LOCUS_15050 1019 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2786 1143 gene locus_tag LOCUS_15060 2786 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2968 3996 gene locus_tag LOCUS_15070 2968 3996 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893199.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence240 <1 737 gene locus_tag LOCUS_15080 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775710.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein 1361 861 gene locus_tag LOCUS_15090 1361 861 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_15090 1995 1513 gene locus_tag LOCUS_15100 gene def 1995 1513 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115099.1 protein_id gnl|my_center|LOCUS_15100 2985 1999 gene locus_tag LOCUS_15110 2985 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3077 3844 gene locus_tag LOCUS_15120 3077 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3806 3880 gene locus_tag LOCUS_t00280 3806 3880 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence241 1326 388 gene locus_tag LOCUS_15130 1326 388 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_15130 2303 1320 gene locus_tag LOCUS_15140 2303 1320 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_15140 <4385 2324 gene locus_tag LOCUS_15150 <4385 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031390.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence242 <1 862 gene locus_tag LOCUS_15160 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537723.1:ABC transporter permease 859 2490 gene locus_tag LOCUS_15170 859 2490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729789.1 protein_id gnl|my_center|LOCUS_15170 2568 4283 gene locus_tag LOCUS_15180 2568 4283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384278.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence243 1407 82 gene locus_tag LOCUS_15190 1407 82 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776124.1 protein_id gnl|my_center|LOCUS_15190 2120 1437 gene locus_tag LOCUS_15200 2120 1437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_15200 2409 2203 gene locus_tag LOCUS_15210 2409 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3665 2604 gene locus_tag LOCUS_15220 3665 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3882 4130 gene locus_tag LOCUS_15230 3882 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence244 718 266 gene locus_tag LOCUS_15240 718 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2115 715 gene locus_tag LOCUS_15250 2115 715 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_15250 2160 2612 gene locus_tag LOCUS_15260 gene rnhA 2160 2612 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_15260 2683 3798 gene locus_tag LOCUS_15270 2683 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence245 202 128 gene locus_tag LOCUS_t00290 202 128 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1379 327 gene locus_tag LOCUS_15280 1379 327 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896435.1 protein_id gnl|my_center|LOCUS_15280 2496 1387 gene locus_tag LOCUS_15290 2496 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4046 2493 gene locus_tag LOCUS_15300 gene der 4046 2493 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence246 194 117 gene locus_tag LOCUS_t00300 194 117 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1643 360 gene locus_tag LOCUS_15310 1643 360 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_15310 1710 3377 gene locus_tag LOCUS_15320 1710 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence247 939 553 gene locus_tag LOCUS_15330 939 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2077 1097 gene locus_tag LOCUS_15340 gene whiA 2077 1097 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_15340 3115 2144 gene locus_tag LOCUS_15350 gene yvcK 3115 2144 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805118.1 protein_id gnl|my_center|LOCUS_15350 4190 3120 gene locus_tag LOCUS_15360 gene rapZ 4190 3120 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence248 137 1903 gene locus_tag LOCUS_15370 gene leuA 137 1903 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_15370 2072 2785 gene locus_tag LOCUS_15380 gene recO 2072 2785 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_15380 2796 3671 gene locus_tag LOCUS_15390 2796 3671 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_15390 3668 4045 gene locus_tag LOCUS_15400 3668 4045 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898592.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence249 3714 133 gene locus_tag LOCUS_15410 gene dnaE 3714 133 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_15410 3853 4116 gene locus_tag LOCUS_15420 3853 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence250 2962 632 gene locus_tag LOCUS_15430 2962 632 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 protein_id gnl|my_center|LOCUS_15430 3047 3454 gene locus_tag LOCUS_15440 3047 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence251 1805 936 gene locus_tag LOCUS_15450 1805 936 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776152.1 protein_id gnl|my_center|LOCUS_15450 3082 1802 gene locus_tag LOCUS_15460 3082 1802 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265958.1 protein_id gnl|my_center|LOCUS_15460 3649 3269 gene locus_tag LOCUS_15470 3649 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 <4295 3646 gene locus_tag LOCUS_15480 <4295 3646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730463.1:methyltransferase domain-containing protein >Feature sequence252 <1 1189 gene locus_tag LOCUS_15490 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229500.1:ribulokinase 1215 1928 gene locus_tag LOCUS_15500 1215 1928 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705776.1 protein_id gnl|my_center|LOCUS_15500 1925 2527 gene locus_tag LOCUS_15510 1925 2527 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733192.1 protein_id gnl|my_center|LOCUS_15510 2553 3188 gene locus_tag LOCUS_15520 gene rpe 2553 3188 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837854.1 protein_id gnl|my_center|LOCUS_15520 4138 3185 gene locus_tag LOCUS_15530 4138 3185 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence253 999 361 gene locus_tag LOCUS_15540 999 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15540 2106 1336 gene locus_tag LOCUS_15550 2106 1336 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803797.1 protein_id gnl|my_center|LOCUS_15550 2574 3395 gene locus_tag LOCUS_15560 gene kduI 2574 3395 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972792.1 protein_id gnl|my_center|LOCUS_15560 3407 4228 gene locus_tag LOCUS_15570 gene kduD 3407 4228 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence254 <1 695 gene locus_tag LOCUS_15580 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776808.1:ABC transporter ATP-binding protein 692 1870 gene locus_tag LOCUS_15590 692 1870 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776809.1 protein_id gnl|my_center|LOCUS_15590 2646 2038 gene locus_tag LOCUS_15600 gene recR 2646 2038 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence255 3 941 gene locus_tag LOCUS_15610 3 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1004 2962 gene locus_tag LOCUS_15620 1004 2962 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185048585.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence256 542 1789 gene locus_tag LOCUS_15630 542 1789 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775327.1 protein_id gnl|my_center|LOCUS_15630 2070 1997 gene locus_tag LOCUS_t00310 2070 1997 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3921 2203 gene locus_tag LOCUS_15640 3921 2203 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930192.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence257 1077 64 gene locus_tag LOCUS_15650 1077 64 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_15650 1193 2002 gene locus_tag LOCUS_15660 1193 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2086 2838 gene locus_tag LOCUS_15670 2086 2838 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence258 <1 1096 gene locus_tag LOCUS_15680 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016325905.1:DNA repair protein RecN 1093 2274 gene locus_tag LOCUS_15690 gene steA 1093 2274 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_15690 2278 3468 gene locus_tag LOCUS_15700 2278 3468 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804977.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence259 <1 528 gene locus_tag LOCUS_15710 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776550.1:mycothiol synthase 574 2940 gene locus_tag LOCUS_15720 574 2940 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068706.1 protein_id gnl|my_center|LOCUS_15720 2955 4022 gene locus_tag LOCUS_15730 2955 4022 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence260 351 1142 gene locus_tag LOCUS_15740 351 1142 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_15740 1145 3007 gene locus_tag LOCUS_15750 1145 3007 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_15750 3088 3516 gene locus_tag LOCUS_15760 3088 3516 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence261 1555 428 gene locus_tag LOCUS_15770 1555 428 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_15770 1673 3070 gene locus_tag LOCUS_15780 1673 3070 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence262 3 1505 gene locus_tag LOCUS_15790 3 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1607 2230 gene locus_tag LOCUS_15800 1607 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15800 2252 2410 gene locus_tag LOCUS_15810 2252 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 <4160 2421 gene locus_tag LOCUS_15820 <4160 2421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030602.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein >Feature sequence263 1215 13 gene locus_tag LOCUS_15830 gene chvE 1215 13 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776912.1 protein_id gnl|my_center|LOCUS_15830 2638 1652 gene locus_tag LOCUS_15840 2638 1652 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_15840 3878 2661 gene locus_tag LOCUS_15850 3878 2661 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence264 <1 739 gene locus_tag LOCUS_15860 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531075.1:adenosylcobinamide-GDP ribazoletransferase 820 2511 gene locus_tag LOCUS_15870 820 2511 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776457.1 protein_id gnl|my_center|LOCUS_15870 3655 2573 gene locus_tag LOCUS_15880 3655 2573 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031554.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence265 2746 1271 gene locus_tag LOCUS_15890 2746 1271 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 protein_id gnl|my_center|LOCUS_15890 3299 2850 gene locus_tag LOCUS_15900 3299 2850 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013845.1 protein_id gnl|my_center|LOCUS_15900 <4157 3402 gene locus_tag LOCUS_15910 <4157 3402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804520.1:adenylosuccinate synthase >Feature sequence266 847 1686 gene locus_tag LOCUS_15920 847 1686 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_15920 1775 2392 gene locus_tag LOCUS_15930 1775 2392 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_15930 2473 3114 gene locus_tag LOCUS_15940 2473 3114 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_15940 2522 2553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence267 475 1452 gene locus_tag LOCUS_15950 475 1452 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_15950 1735 1544 gene locus_tag LOCUS_15960 gene rpmB 1735 1544 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence268 1876 176 gene locus_tag LOCUS_15970 1876 176 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878652.1 protein_id gnl|my_center|LOCUS_15970 2238 1876 gene locus_tag LOCUS_15980 2238 1876 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897863.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence269 3156 559 gene locus_tag LOCUS_15990 gene pepN 3156 559 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_15990 3350 4054 gene locus_tag LOCUS_16000 3350 4054 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027269.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence270 <1 948 gene locus_tag LOCUS_16010 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229874.1:HAMP domain-containing sensor histidine kinase 1079 2632 gene locus_tag LOCUS_16020 1079 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4045 2669 gene locus_tag LOCUS_16030 4045 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence271 <4116 1231 gene locus_tag LOCUS_16040 <4116 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028104.1:glutamate synthase large subunit >Feature sequence272 1749 3929 gene locus_tag LOCUS_16050 gene ftsH 1749 3929 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence273 <1 1647 gene locus_tag LOCUS_16060 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257409.1:maltodextrin glucosidase 1690 2934 gene locus_tag LOCUS_16070 1690 2934 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence274 1382 150 gene locus_tag LOCUS_16080 1382 150 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776525.1 protein_id gnl|my_center|LOCUS_16080 1581 2828 gene locus_tag LOCUS_16090 1581 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3176 3577 gene locus_tag LOCUS_16100 3176 3577 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence275 <4068 1567 gene locus_tag LOCUS_16110 <4068 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972444.1:nitrate reductase subunit alpha >Feature sequence276 1763 78 gene locus_tag LOCUS_16120 1763 78 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_16120 2267 1854 gene locus_tag LOCUS_16130 2267 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3889 2264 gene locus_tag LOCUS_16140 3889 2264 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776128.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence277 1891 113 gene locus_tag LOCUS_16150 1891 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2717 1899 gene locus_tag LOCUS_16160 2717 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3541 2714 gene locus_tag LOCUS_16170 3541 2714 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence278 1478 474 gene locus_tag LOCUS_16180 1478 474 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226432.1 protein_id gnl|my_center|LOCUS_16180 1582 3096 gene locus_tag LOCUS_16190 1582 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence279 1712 2560 gene locus_tag LOCUS_16200 1712 2560 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027038.1 protein_id gnl|my_center|LOCUS_16200 3408 2557 gene locus_tag LOCUS_16210 3408 2557 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728436.1 protein_id gnl|my_center|LOCUS_16210 <4025 3415 gene locus_tag LOCUS_16220 <4025 3415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011172461.1:SDR family oxidoreductase >Feature sequence280 1097 324 gene locus_tag LOCUS_16230 1097 324 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461748.1 protein_id gnl|my_center|LOCUS_16230 2557 1112 gene locus_tag LOCUS_16240 2557 1112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183207.1 protein_id gnl|my_center|LOCUS_16240 3469 2615 gene locus_tag LOCUS_16250 3469 2615 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_16250 <4025 3473 gene locus_tag LOCUS_16260 <4025 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001386575.1:crotonobetaine/carnitine-CoA ligase >Feature sequence281 298 1614 gene locus_tag LOCUS_16270 298 1614 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_16270 1687 2667 gene locus_tag LOCUS_16280 1687 2667 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_16280 2667 3572 gene locus_tag LOCUS_16290 2667 3572 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence282 2744 1608 gene locus_tag LOCUS_16300 2744 1608 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_16300 3109 2795 gene locus_tag LOCUS_16310 3109 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3891 3064 gene locus_tag LOCUS_16320 3891 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3260 3325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence283 <1 1012 gene locus_tag LOCUS_16330 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804013.1:23S rRNA (uracil(747)-C(5))-methyltransferase RlmC 1272 2117 gene locus_tag LOCUS_16340 1272 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2675 2250 gene locus_tag LOCUS_16350 2675 2250 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence284 53 724 gene locus_tag LOCUS_16360 53 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16360 1283 771 gene locus_tag LOCUS_16370 1283 771 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_16370 2064 1297 gene locus_tag LOCUS_16380 gene fabI 2064 1297 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_16380 2852 2133 gene locus_tag LOCUS_16390 2852 2133 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805189.1 protein_id gnl|my_center|LOCUS_16390 2921 3220 gene locus_tag LOCUS_16400 2921 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3217 3432 gene locus_tag LOCUS_16410 3217 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence285 744 196 gene locus_tag LOCUS_16420 744 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1934 741 gene locus_tag LOCUS_16430 1934 741 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_16430 3369 2035 gene locus_tag LOCUS_16440 3369 2035 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_16440 3502 3948 gene locus_tag LOCUS_16450 gene dps 3502 3948 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326579.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence286 1136 2872 gene locus_tag LOCUS_16460 1136 2872 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence287 240 908 gene locus_tag LOCUS_16470 240 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 901 3771 gene locus_tag LOCUS_16480 901 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence288 3030 1342 gene locus_tag LOCUS_16490 gene pgm 3030 1342 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence289 1488 2138 gene locus_tag LOCUS_16500 1488 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3298 2135 gene locus_tag LOCUS_16510 gene solA 3298 2135 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170765.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence290 <1 1365 gene locus_tag LOCUS_16520 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020639906.1:alpha-galactosidase >Feature sequence291 <1 784 gene locus_tag LOCUS_16530 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227095.1:ABC transporter ATP-binding protein 781 2919 gene locus_tag LOCUS_16540 781 2919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_16540 2916 3737 gene locus_tag LOCUS_16550 2916 3737 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence292 1060 260 gene locus_tag LOCUS_16560 1060 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229131.1 protein_id gnl|my_center|LOCUS_16560 2798 1068 gene locus_tag LOCUS_16570 2798 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence293 <1 662 gene locus_tag LOCUS_16580 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804257.1:GNAT family N-acetyltransferase 1530 592 gene locus_tag LOCUS_16590 1530 592 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_16590 1570 2082 gene locus_tag LOCUS_16600 1570 2082 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369894.1 protein_id gnl|my_center|LOCUS_16600 <3911 2280 gene locus_tag LOCUS_16610 <3911 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein >Feature sequence294 1136 2467 gene locus_tag LOCUS_16620 1136 2467 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence295 <1 730 gene locus_tag LOCUS_16630 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804470.1:DUF58 domain-containing protein 727 1356 gene locus_tag LOCUS_16640 727 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1360 2268 gene locus_tag LOCUS_16650 1360 2268 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_16650 2379 3506 gene locus_tag LOCUS_16660 2379 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence296 <1 1202 gene locus_tag LOCUS_16670 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805127.1:transketolase 1265 2800 gene locus_tag LOCUS_16680 gene zwf 1265 2800 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 protein_id gnl|my_center|LOCUS_16680 2797 3744 gene locus_tag LOCUS_16690 2797 3744 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122823891.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence297 286 444 gene locus_tag LOCUS_16700 286 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 481 3069 gene locus_tag LOCUS_16710 481 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence298 1125 2081 gene locus_tag LOCUS_16720 1125 2081 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_16720 2483 2280 gene locus_tag LOCUS_16730 2483 2280 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_16730 3688 2651 gene locus_tag LOCUS_16740 3688 2651 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence299 3443 1497 gene locus_tag LOCUS_16750 gene typA 3443 1497 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence300 1051 86 gene locus_tag LOCUS_16760 1051 86 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776412.1 protein_id gnl|my_center|LOCUS_16760 1127 2125 gene locus_tag LOCUS_16770 1127 2125 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776413.1 protein_id gnl|my_center|LOCUS_16770 3060 2173 gene locus_tag LOCUS_16780 3060 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3180 3275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence301 1864 1067 gene locus_tag LOCUS_16790 1864 1067 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_16790 2086 2856 gene locus_tag LOCUS_16800 2086 2856 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_16800 <3816 2853 gene locus_tag LOCUS_16810 <3816 2853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_123738087.1:MMPL family transporter >Feature sequence302 2298 1252 gene locus_tag LOCUS_16820 2298 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3587 2301 gene locus_tag LOCUS_16830 3587 2301 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence303 >Feature sequence304 53 733 gene locus_tag LOCUS_16840 53 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 775 1059 gene locus_tag LOCUS_16850 775 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence305 1593 688 gene locus_tag LOCUS_16860 1593 688 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037580.1 protein_id gnl|my_center|LOCUS_16860 2664 1603 gene locus_tag LOCUS_16870 2664 1603 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275332.1 protein_id gnl|my_center|LOCUS_16870 <3782 2707 gene locus_tag LOCUS_16880 <3782 2707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897559.1:DEAD/DEAH box helicase >Feature sequence306 3052 1046 gene locus_tag LOCUS_16890 3052 1046 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_16890 3101 3769 gene locus_tag LOCUS_16900 3101 3769 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence307 2138 1772 gene locus_tag LOCUS_tm00010 2138 1772 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2680 2276 gene locus_tag LOCUS_16910 2680 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777020.1 protein_id gnl|my_center|LOCUS_16910 3344 2826 gene locus_tag LOCUS_16920 gene smpB 3344 2826 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776046.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence308 1412 216 gene locus_tag LOCUS_16930 1412 216 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085778.1 protein_id gnl|my_center|LOCUS_16930 3511 1421 gene locus_tag LOCUS_16940 gene pta 3511 1421 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085777.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence309 704 712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 798 1505 gene locus_tag LOCUS_16950 798 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1502 3346 gene locus_tag LOCUS_16960 1502 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence310 968 585 gene locus_tag LOCUS_16970 968 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1315 995 gene locus_tag LOCUS_16980 1315 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1608 1318 gene locus_tag LOCUS_16990 1608 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1716 2153 gene locus_tag LOCUS_17000 1716 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2805 2320 gene locus_tag LOCUS_17010 2805 2320 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence311 280 711 gene locus_tag LOCUS_17020 280 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 930 1607 gene locus_tag LOCUS_17030 930 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2259 1810 gene locus_tag LOCUS_17040 2259 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2398 2817 gene locus_tag LOCUS_17050 2398 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3668 2805 gene locus_tag LOCUS_17060 3668 2805 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013320.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence312 1806 25 gene locus_tag LOCUS_17070 1806 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence313 <1 2063 gene locus_tag LOCUS_17080 <1 2063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_140398393.1:DUF4011 domain-containing protein 1978 2232 gene locus_tag LOCUS_17090 1978 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2785 2351 gene locus_tag LOCUS_17100 gene mscL 2785 2351 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815058.1 protein_id gnl|my_center|LOCUS_17100 <3736 2849 gene locus_tag LOCUS_17110 <3736 2849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230042.1:SAF domain-containing protein >Feature sequence314 485 1051 gene locus_tag LOCUS_17120 485 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1133 2815 gene locus_tag LOCUS_17130 gene ettA 1133 2815 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence315 90 1874 gene locus_tag LOCUS_17140 90 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 <3732 1944 gene locus_tag LOCUS_17150 <3732 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068348.1:transglutaminase domain-containing protein >Feature sequence316 651 1274 gene locus_tag LOCUS_17160 651 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1271 1672 gene locus_tag LOCUS_17170 1271 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3664 1688 gene locus_tag LOCUS_17180 3664 1688 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803839.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence317 308 475 gene locus_tag LOCUS_17190 308 475 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_17190 498 2150 gene locus_tag LOCUS_17200 498 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2823 2188 gene locus_tag LOCUS_17210 2823 2188 CDS product SAM-dependent O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911448.1 protein_id gnl|my_center|LOCUS_17210 2961 3554 gene locus_tag LOCUS_17220 gene sigE 2961 3554 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence318 1712 567 gene locus_tag LOCUS_17230 1712 567 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_17230 2763 1750 gene locus_tag LOCUS_17240 2763 1750 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110811.1 protein_id gnl|my_center|LOCUS_17240 3346 2813 gene locus_tag LOCUS_17250 3346 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence319 213 1172 gene locus_tag LOCUS_17260 gene rpsB 213 1172 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_17260 1221 2066 gene locus_tag LOCUS_17270 gene tsf 1221 2066 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_17270 2191 2913 gene locus_tag LOCUS_17280 gene pyrH 2191 2913 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_17280 2991 3548 gene locus_tag LOCUS_17290 gene frr 2991 3548 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence320 183 1412 gene locus_tag LOCUS_17300 183 1412 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775974.1 protein_id gnl|my_center|LOCUS_17300 1525 2895 gene locus_tag LOCUS_17310 1525 2895 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_17310 <3669 2945 gene locus_tag LOCUS_17320 <3669 2945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009993776.1:PASTA domain-containing protein >Feature sequence321 <1 2550 gene locus_tag LOCUS_17330 <1 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226661.1:VWA domain-containing protein 2563 3483 gene locus_tag LOCUS_17340 2563 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence322 692 189 gene locus_tag LOCUS_17350 692 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1340 705 gene locus_tag LOCUS_17360 1340 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1821 1603 gene locus_tag LOCUS_17370 1821 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2661 2011 gene locus_tag LOCUS_17380 2661 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3439 2591 gene locus_tag LOCUS_17390 3439 2591 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence323 940 56 gene locus_tag LOCUS_17400 940 56 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776274.1 protein_id gnl|my_center|LOCUS_17400 1623 937 gene locus_tag LOCUS_17410 1623 937 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776275.1 protein_id gnl|my_center|LOCUS_17410 2666 1737 gene locus_tag LOCUS_17420 2666 1737 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776276.1 protein_id gnl|my_center|LOCUS_17420 <3626 2849 gene locus_tag LOCUS_17430 <3626 2849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973246.1:amino acid ABC transporter ATP-binding protein >Feature sequence324 <1 622 gene locus_tag LOCUS_17440 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005086421.1:LLM class flavin-dependent oxidoreductase 686 1711 gene locus_tag LOCUS_17450 686 1711 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973052.1 protein_id gnl|my_center|LOCUS_17450 1776 2882 gene locus_tag LOCUS_17460 1776 2882 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089629.1 protein_id gnl|my_center|LOCUS_17460 <3626 2939 gene locus_tag LOCUS_17470 <3626 2939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028236.1:biliverdin-producing heme oxygenase >Feature sequence325 <1 696 gene locus_tag LOCUS_17480 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054756.1:valine--tRNA ligase 776 2599 gene locus_tag LOCUS_17490 776 2599 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_17490 2613 3056 gene locus_tag LOCUS_17500 2613 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3409 3113 gene locus_tag LOCUS_17510 3409 3113 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence326 181 105 gene locus_tag LOCUS_t00320 181 105 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3248 243 gene locus_tag LOCUS_17520 3248 243 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929964.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence327 3 248 gene locus_tag LOCUS_17530 3 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 381 1106 gene locus_tag LOCUS_17540 381 1106 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324691.1 protein_id gnl|my_center|LOCUS_17540 1321 1118 gene locus_tag LOCUS_17550 1321 1118 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_17550 1460 1936 gene locus_tag LOCUS_17560 1460 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1933 3096 gene locus_tag LOCUS_17570 gene purM 1933 3096 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_17570 3348 3154 gene locus_tag LOCUS_17580 3348 3154 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence328 119 1282 gene locus_tag LOCUS_17590 gene pstS 119 1282 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_17590 1327 2367 gene locus_tag LOCUS_17600 gene pstC 1327 2367 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776546.1 protein_id gnl|my_center|LOCUS_17600 2367 3299 gene locus_tag LOCUS_17610 gene pstA 2367 3299 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776545.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence329 <1 1144 gene locus_tag LOCUS_17620 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929854.1:sugar ABC transporter substrate-binding protein 1320 2267 gene locus_tag LOCUS_17630 1320 2267 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871104.1 protein_id gnl|my_center|LOCUS_17630 2264 3193 gene locus_tag LOCUS_17640 2264 3193 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977289.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence330 <1 579 gene locus_tag LOCUS_17650 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272771.1:pyridoxal phosphate-dependent aminotransferase 806 1249 gene locus_tag LOCUS_17660 806 1249 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079901.1 protein_id gnl|my_center|LOCUS_17660 1381 2853 gene locus_tag LOCUS_17670 1381 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence331 962 339 gene locus_tag LOCUS_17680 962 339 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066904909.1 protein_id gnl|my_center|LOCUS_17680 1992 1018 gene locus_tag LOCUS_17690 1992 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2699 1989 gene locus_tag LOCUS_17700 2699 1989 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_17700 3431 2778 gene locus_tag LOCUS_17710 3431 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence332 660 1907 gene locus_tag LOCUS_17720 660 1907 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776650.1 protein_id gnl|my_center|LOCUS_17720 2111 2680 gene locus_tag LOCUS_17730 2111 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 <3534 2834 gene locus_tag LOCUS_17740 <3534 2834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971514.1:histidine phosphatase family protein >Feature sequence333 758 1189 gene locus_tag LOCUS_17750 758 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1186 1497 gene locus_tag LOCUS_17760 1186 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1530 1877 gene locus_tag LOCUS_17770 1530 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2462 2755 gene locus_tag LOCUS_17780 2462 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2920 2846 gene locus_tag LOCUS_t00330 2920 2846 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <3524 2992 gene locus_tag LOCUS_17790 <3524 2992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226288.1:universal stress protein >Feature sequence334 535 2049 gene locus_tag LOCUS_17800 535 2049 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 protein_id gnl|my_center|LOCUS_17800 2889 2056 gene locus_tag LOCUS_17810 2889 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3400 2891 gene locus_tag LOCUS_17820 3400 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence335 59 1150 gene locus_tag LOCUS_17830 59 1150 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957686.1 protein_id gnl|my_center|LOCUS_17830 1346 2542 gene locus_tag LOCUS_17840 1346 2542 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732325.1 protein_id gnl|my_center|LOCUS_17840 <3513 2594 gene locus_tag LOCUS_17850 <3513 2594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037666873.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence336 <1 829 gene locus_tag LOCUS_17860 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014237.1:iron-siderophore ABC transporter substrate-binding protein 870 1673 gene locus_tag LOCUS_17870 870 1673 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978407.1 protein_id gnl|my_center|LOCUS_17870 1690 2304 gene locus_tag LOCUS_17880 gene rsmD 1690 2304 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_17880 2304 2711 gene locus_tag LOCUS_17890 2304 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2708 3385 gene locus_tag LOCUS_17900 2708 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence337 2194 668 gene locus_tag LOCUS_17910 gene fdrA 2194 668 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704654.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence338 1953 415 gene locus_tag LOCUS_17920 gene aglB 1953 415 CDS product cyclomaltodextrinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082380.1 protein_id gnl|my_center|LOCUS_17920 <3477 1946 gene locus_tag LOCUS_17930 <3477 1946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257409.1:maltodextrin glucosidase >Feature sequence339 1798 560 gene locus_tag LOCUS_17940 gene nhaA 1798 560 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_17940 1971 3353 gene locus_tag LOCUS_17950 1971 3353 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence340 489 1748 gene locus_tag LOCUS_17960 489 1748 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804800.1 protein_id gnl|my_center|LOCUS_17960 3464 1818 gene locus_tag LOCUS_17970 3464 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence341 <3457 2036 gene locus_tag LOCUS_17980 <3457 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728028.1:ATP-dependent DNA helicase AdnA >Feature sequence342 2803 1163 gene locus_tag LOCUS_17990 gene guaA 2803 1163 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_17990 3261 2842 gene locus_tag LOCUS_18000 3261 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence343 <1 570 gene locus_tag LOCUS_18010 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458966.1:EamA family transporter 687 2462 gene locus_tag LOCUS_18020 687 2462 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776135.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence344 1206 1835 gene locus_tag LOCUS_18030 gene purN 1206 1835 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence345 281 712 gene locus_tag LOCUS_18040 281 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2392 1151 gene locus_tag LOCUS_18050 2392 1151 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence346 1524 274 gene locus_tag LOCUS_18060 1524 274 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_18060 2533 1601 gene locus_tag LOCUS_18070 2533 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 <3414 2564 gene locus_tag LOCUS_18080 <3414 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068058.1:leucine--tRNA ligase >Feature sequence347 309 1103 gene locus_tag LOCUS_18090 gene nagR 309 1103 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_18090 2727 1153 gene locus_tag LOCUS_18100 gene guaB 2727 1153 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_18100 3049 3333 gene locus_tag LOCUS_18110 3049 3333 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence348 >Feature sequence349 >Feature sequence350 219 1202 gene locus_tag LOCUS_18120 219 1202 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_18120 1746 1219 gene locus_tag LOCUS_18130 1746 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2742 1888 gene locus_tag LOCUS_18140 2742 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 <3397 2739 gene locus_tag LOCUS_18150 <3397 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776192.1:phenylalanine--tRNA ligase subunit beta >Feature sequence351 1008 2168 gene locus_tag LOCUS_18160 1008 2168 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 protein_id gnl|my_center|LOCUS_18160 2209 3303 gene locus_tag LOCUS_18170 2209 3303 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803813.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence352 972 31 gene locus_tag LOCUS_18180 972 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1150 2325 gene locus_tag LOCUS_18190 1150 2325 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804632.1 protein_id gnl|my_center|LOCUS_18190 2751 3308 gene locus_tag LOCUS_18200 2751 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence353 1989 970 gene locus_tag LOCUS_18210 1989 970 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776398.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence354 47 748 gene locus_tag LOCUS_18220 47 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1857 721 gene locus_tag LOCUS_18230 1857 721 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_18230 1968 2438 gene locus_tag LOCUS_18240 1968 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2674 3240 gene locus_tag LOCUS_18250 2674 3240 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence355 <1 1605 gene locus_tag LOCUS_18260 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223495647.1:tetratricopeptide repeat protein 1607 2680 gene locus_tag LOCUS_18270 1607 2680 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390014.1 protein_id gnl|my_center|LOCUS_18270 2677 2853 gene locus_tag LOCUS_18280 2677 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence356 1055 294 gene locus_tag LOCUS_18290 1055 294 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805131.1 protein_id gnl|my_center|LOCUS_18290 1753 1052 gene locus_tag LOCUS_18300 1753 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2657 1746 gene locus_tag LOCUS_18310 2657 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18310 <3359 2641 gene locus_tag LOCUS_18320 <3359 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227804.1:ParA family protein >Feature sequence357 <3357 2676 gene locus_tag LOCUS_18330 <3357 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729459.1:AraC family transcriptional regulator >Feature sequence358 1 456 gene locus_tag LOCUS_18340 1 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2043 970 gene locus_tag LOCUS_18350 gene disA 2043 970 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_18350 <3357 2054 gene locus_tag LOCUS_18360 <3357 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028928.1:DNA repair protein RadA >Feature sequence359 1185 2585 gene locus_tag LOCUS_18370 gene gndA 1185 2585 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399773.1 protein_id gnl|my_center|LOCUS_18370 2595 3071 gene locus_tag LOCUS_18380 2595 3071 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence360 2156 405 gene locus_tag LOCUS_18390 2156 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence361 874 1182 gene locus_tag LOCUS_18400 gene rplU 874 1182 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_18400 1208 1474 gene locus_tag LOCUS_18410 gene rpmA 1208 1474 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_18410 1589 3103 gene locus_tag LOCUS_18420 gene obgE 1589 3103 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence362 1371 397 gene locus_tag LOCUS_18430 1371 397 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_18430 2776 1418 gene locus_tag LOCUS_18440 2776 1418 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_18440 3206 2877 gene locus_tag LOCUS_18450 gene trxA 3206 2877 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence363 333 258 gene locus_tag LOCUS_t00340 333 258 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1320 514 gene locus_tag LOCUS_18460 1320 514 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 protein_id gnl|my_center|LOCUS_18460 1465 1971 gene locus_tag LOCUS_18470 1465 1971 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466608.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence364 1604 402 gene locus_tag LOCUS_18480 gene uxuA 1604 402 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171409.1 protein_id gnl|my_center|LOCUS_18480 1667 2668 gene locus_tag LOCUS_18490 1667 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 3307 2669 gene locus_tag LOCUS_18500 3307 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence365 1184 231 gene locus_tag LOCUS_18510 gene xerD 1184 231 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_18510 2223 1192 gene locus_tag LOCUS_18520 2223 1192 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence366 1941 46 gene locus_tag LOCUS_18530 1941 46 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_18530 2243 1938 gene locus_tag LOCUS_18540 2243 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2595 2425 gene locus_tag LOCUS_18550 2595 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence367 316 687 gene locus_tag LOCUS_18560 gene erpA 316 687 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_18560 875 1861 gene locus_tag LOCUS_18570 875 1861 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_18570 2144 3049 gene locus_tag LOCUS_18580 gene coxB 2144 3049 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence368 2618 1854 gene locus_tag LOCUS_18590 2618 1854 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_18590 <3271 2615 gene locus_tag LOCUS_18600 <3271 2615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467674.1:glutamate racemase >Feature sequence369 583 1878 gene locus_tag LOCUS_18610 583 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226660.1 protein_id gnl|my_center|LOCUS_18610 2047 2364 gene locus_tag LOCUS_18620 2047 2364 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_18620 2875 2375 gene locus_tag LOCUS_18630 2875 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence370 56 1612 gene locus_tag LOCUS_18640 gene gguA 56 1612 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776911.1 protein_id gnl|my_center|LOCUS_18640 1609 2787 gene locus_tag LOCUS_18650 gene gguB 1609 2787 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776910.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence371 1220 369 gene locus_tag LOCUS_18660 1220 369 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776970.1 protein_id gnl|my_center|LOCUS_18660 1881 1234 gene locus_tag LOCUS_18670 1881 1234 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_18670 3049 2036 gene locus_tag LOCUS_18680 3049 2036 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence372 1055 750 gene locus_tag LOCUS_18690 gene rplW 1055 750 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_18690 1702 1052 gene locus_tag LOCUS_18700 gene rplD 1702 1052 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_18700 2357 1704 gene locus_tag LOCUS_18710 gene rplC 2357 1704 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_18710 2677 2369 gene locus_tag LOCUS_18720 gene rpsJ 2677 2369 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence373 1366 179 gene locus_tag LOCUS_18730 1366 179 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_18730 1497 2624 gene locus_tag LOCUS_18740 gene thrC 1497 2624 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251155.1 protein_id gnl|my_center|LOCUS_18740 <3243 2642 gene locus_tag LOCUS_18750 <3243 2642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538108.1:GntR family transcriptional regulator >Feature sequence374 1834 1007 gene locus_tag LOCUS_18760 1834 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2836 1991 gene locus_tag LOCUS_18770 2836 1991 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138735.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence375 623 970 gene locus_tag LOCUS_18780 623 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18780 971 1339 gene locus_tag LOCUS_18790 971 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18790 1381 2466 gene locus_tag LOCUS_18800 1381 2466 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_18800 3166 2558 gene locus_tag LOCUS_18810 3166 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence376 40 1083 gene locus_tag LOCUS_18820 gene fmt 40 1083 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728792.1 protein_id gnl|my_center|LOCUS_18820 1080 2522 gene locus_tag LOCUS_18830 1080 2522 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence377 1728 403 gene locus_tag LOCUS_18840 1728 403 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731068.1 protein_id gnl|my_center|LOCUS_18840 <3228 1767 gene locus_tag LOCUS_18850 <3228 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731067.1:non-ribosomal peptide synthetase >Feature sequence378 879 379 gene locus_tag LOCUS_18860 gene tsaE 879 379 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_18860 2195 876 gene locus_tag LOCUS_18870 gene alr 2195 876 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_18870 <3223 2192 gene locus_tag LOCUS_18880 <3223 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052234.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase >Feature sequence379 2373 610 gene locus_tag LOCUS_18890 gene argS 2373 610 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence380 459 1949 gene locus_tag LOCUS_18900 459 1949 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226341.1 protein_id gnl|my_center|LOCUS_18900 2013 2276 gene locus_tag LOCUS_18910 2013 2276 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224593.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence381 2982 835 gene locus_tag LOCUS_18920 2982 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1912 1924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence382 733 1794 gene locus_tag LOCUS_18930 733 1794 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 protein_id gnl|my_center|LOCUS_18930 1808 2398 gene locus_tag LOCUS_18940 1808 2398 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222739.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence383 1424 507 gene locus_tag LOCUS_18950 1424 507 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_18950 3048 1426 gene locus_tag LOCUS_18960 3048 1426 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence384 1799 1374 gene locus_tag LOCUS_18970 gene ndk 1799 1374 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_18970 2324 1806 gene locus_tag LOCUS_18980 2324 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3106 2321 gene locus_tag LOCUS_18990 gene dhaM 3106 2321 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence385 <1 512 gene locus_tag LOCUS_19000 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878220.1:multidrug effflux MFS transporter 1193 525 gene locus_tag LOCUS_19010 1193 525 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_19010 1228 1680 gene locus_tag LOCUS_19020 1228 1680 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_19020 3108 1699 gene locus_tag LOCUS_19030 3108 1699 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804806.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence386 342 2237 gene locus_tag LOCUS_19040 gene lepA 342 2237 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence387 1909 890 gene locus_tag LOCUS_19050 1909 890 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence388 2355 484 gene locus_tag LOCUS_19060 2355 484 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804840.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence389 1 357 gene locus_tag LOCUS_19070 1 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 354 2336 gene locus_tag LOCUS_19080 354 2336 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878409.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence390 1569 1693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1755 2003 gene locus_tag LOCUS_19090 1755 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence391 414 1502 gene locus_tag LOCUS_19100 gene rsgA 414 1502 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_19100 1499 2299 gene locus_tag LOCUS_19110 gene hisN 1499 2299 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081049.1 protein_id gnl|my_center|LOCUS_19110 2947 2342 gene locus_tag LOCUS_19120 2947 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence392 945 484 gene locus_tag LOCUS_19130 945 484 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_19130 1044 1889 gene locus_tag LOCUS_19140 1044 1889 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence393 1698 799 gene locus_tag LOCUS_19150 1698 799 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence394 329 754 gene locus_tag LOCUS_19160 329 754 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895859.1 protein_id gnl|my_center|LOCUS_19160 2349 853 gene locus_tag LOCUS_19170 2349 853 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence395 508 2757 gene locus_tag LOCUS_19180 508 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence396 302 1456 gene locus_tag LOCUS_19190 302 1456 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_19190 1850 2860 gene locus_tag LOCUS_19200 1850 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence397 >Feature sequence398 >Feature sequence399 195 1004 gene locus_tag LOCUS_19210 195 1004 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804566.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence400 <1 664 gene locus_tag LOCUS_19220 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976879.1:6-phosphogluconolactonase 1214 861 gene locus_tag LOCUS_19230 1214 861 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_19230 1486 1241 gene locus_tag LOCUS_19240 gene secG 1486 1241 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 protein_id gnl|my_center|LOCUS_19240 1853 1584 gene locus_tag LOCUS_19250 1853 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19250 1887 1970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3067 2434 gene locus_tag LOCUS_19260 <3067 2434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013363499.1:phosphoglycerate kinase >Feature sequence401 2 997 gene locus_tag LOCUS_19270 2 997 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_19270 1645 1043 gene locus_tag LOCUS_19280 1645 1043 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_19280 1905 2399 gene locus_tag LOCUS_19290 1905 2399 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013921.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence402 1022 2815 gene locus_tag LOCUS_19300 1022 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence403 513 1301 gene locus_tag LOCUS_19310 513 1301 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384273.1 protein_id gnl|my_center|LOCUS_19310 2015 1302 gene locus_tag LOCUS_19320 2015 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2276 2052 gene locus_tag LOCUS_19330 2276 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2782 2441 gene locus_tag LOCUS_19340 2782 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence404 729 2549 gene locus_tag LOCUS_19350 729 2549 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 protein_id gnl|my_center|LOCUS_19350 2705 2866 gene locus_tag LOCUS_19360 2705 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2875 3036 gene locus_tag LOCUS_19370 2875 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776783.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence405 1110 1625 gene locus_tag LOCUS_19380 1110 1625 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776234.1 protein_id gnl|my_center|LOCUS_19380 2254 1631 gene locus_tag LOCUS_19390 2254 1631 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814656.1 protein_id gnl|my_center|LOCUS_19390 <3045 2254 gene locus_tag LOCUS_19400 <3045 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390200.1:DUF4037 domain-containing protein >Feature sequence406 943 2352 gene locus_tag LOCUS_19410 gene pdxR 943 2352 CDS product pyridoxine biosynthesis transcriptional regulator PdxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013887.1 protein_id gnl|my_center|LOCUS_19410 <3035 2437 gene locus_tag LOCUS_19420 <3035 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975536.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence407 1440 700 gene locus_tag LOCUS_19430 1440 700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_19430 <3034 2055 gene locus_tag LOCUS_19440 <3034 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776241.1:GH92 family glycosyl hydrolase >Feature sequence408 854 471 gene locus_tag LOCUS_19450 854 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1922 927 gene locus_tag LOCUS_19460 gene nusA 1922 927 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_19460 2501 1998 gene locus_tag LOCUS_19470 gene rimP 2501 1998 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence409 686 51 gene locus_tag LOCUS_19480 686 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 699 718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 921 1145 gene locus_tag LOCUS_19490 921 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1588 2229 gene locus_tag LOCUS_19500 1588 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2310 2906 gene locus_tag LOCUS_19510 2310 2906 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776436.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence410 426 58 gene locus_tag LOCUS_19520 426 58 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228109.1 protein_id gnl|my_center|LOCUS_19520 1477 479 gene locus_tag LOCUS_19530 gene coaA 1477 479 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence411 >Feature sequence412 <1 1076 gene locus_tag LOCUS_19540 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804639.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 1073 1639 gene locus_tag LOCUS_19550 1073 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1650 2942 gene locus_tag LOCUS_19560 1650 2942 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence413 789 1307 gene locus_tag LOCUS_19570 789 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19570 1259 1492 gene locus_tag LOCUS_19580 1259 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence414 1285 95 gene locus_tag LOCUS_19590 1285 95 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_19590 1215 1478 gene locus_tag LOCUS_19600 1215 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1477 1550 gene locus_tag LOCUS_t00350 1477 1550 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1642 1887 gene locus_tag LOCUS_19610 gene secE 1642 1887 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053057.1 protein_id gnl|my_center|LOCUS_19610 1965 2750 gene locus_tag LOCUS_19620 gene nusG 1965 2750 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence415 2526 967 gene locus_tag LOCUS_19630 2526 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence416 2669 1587 gene locus_tag LOCUS_19640 2669 1587 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence417 588 1070 gene locus_tag LOCUS_19650 gene sepF 588 1070 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804707.1 protein_id gnl|my_center|LOCUS_19650 1133 1423 gene locus_tag LOCUS_19660 1133 1423 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804708.1 protein_id gnl|my_center|LOCUS_19660 1591 2241 gene locus_tag LOCUS_19670 1591 2241 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804709.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence418 >Feature sequence419 <1 2606 gene locus_tag LOCUS_19680 <1 2606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007057489.1:ATP-dependent chaperone ClpB >Feature sequence420 940 1380 gene locus_tag LOCUS_19690 940 1380 CDS product OsmC family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803963.1 protein_id gnl|my_center|LOCUS_19690 2875 1643 gene locus_tag LOCUS_19700 gene coaE 2875 1643 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence421 2 256 gene locus_tag LOCUS_19710 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence422 1 807 gene locus_tag LOCUS_19720 1 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 804 1238 gene locus_tag LOCUS_19730 804 1238 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_19730 2473 1850 gene locus_tag LOCUS_19740 2473 1850 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence423 417 1895 gene locus_tag LOCUS_19750 417 1895 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_19750 2294 1944 gene locus_tag LOCUS_19760 2294 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2545 2291 gene locus_tag LOCUS_19770 2545 2291 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_19770 2591 2776 gene locus_tag LOCUS_19780 2591 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence424 1091 2323 gene locus_tag LOCUS_19790 1091 2323 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_19790 <2959 2418 gene locus_tag LOCUS_19800 <2959 2418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050717203.1:DUF5107 domain-containing protein >Feature sequence425 1594 632 gene locus_tag LOCUS_19810 1594 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1878 1666 gene locus_tag LOCUS_19820 1878 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence426 290 1273 gene locus_tag LOCUS_19830 290 1273 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_19830 1270 2535 gene locus_tag LOCUS_19840 1270 2535 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence427 1759 416 gene locus_tag LOCUS_19850 1759 416 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_19850 <2951 1848 gene locus_tag LOCUS_19860 <2951 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972895.1:ribonuclease D >Feature sequence428 88 711 gene locus_tag LOCUS_19870 88 711 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 protein_id gnl|my_center|LOCUS_19870 865 2094 gene locus_tag LOCUS_19880 gene macA 865 2094 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 protein_id gnl|my_center|LOCUS_19880 2091 2849 gene locus_tag LOCUS_19890 2091 2849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence429 >Feature sequence430 274 1068 gene locus_tag LOCUS_19900 274 1068 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804344.1 protein_id gnl|my_center|LOCUS_19900 1255 1183 gene locus_tag LOCUS_t00360 1255 1183 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2764 1289 gene locus_tag LOCUS_19910 2764 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence431 1694 225 gene locus_tag LOCUS_19920 1694 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2941 1694 gene locus_tag LOCUS_19930 gene mltG 2941 1694 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence432 >Feature sequence433 1705 695 gene locus_tag LOCUS_19940 1705 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 <2912 1774 gene locus_tag LOCUS_19950 <2912 1774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545399.1:ABC transporter permease >Feature sequence434 117 1169 gene locus_tag LOCUS_19960 117 1169 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_19960 1163 2101 gene locus_tag LOCUS_19970 1163 2101 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence435 261 1937 gene locus_tag LOCUS_19980 261 1937 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975849.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence436 1129 758 gene locus_tag LOCUS_19990 1129 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1312 1683 gene locus_tag LOCUS_20000 1312 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20000 <2895 2235 gene locus_tag LOCUS_20010 <2895 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296643.1:4-amino-4-deoxychorismate synthase >Feature sequence437 <1 761 gene locus_tag LOCUS_20020 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104530.1:phosphoenolpyruvate-utilizing N-terminal domain-containing protein 940 1968 gene locus_tag LOCUS_20030 940 1968 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 protein_id gnl|my_center|LOCUS_20030 2384 2617 gene locus_tag LOCUS_20040 2384 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence438 >Feature sequence439 542 99 gene locus_tag LOCUS_20050 542 99 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229003.1 protein_id gnl|my_center|LOCUS_20050 625 993 gene locus_tag LOCUS_20060 625 993 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence440 1492 527 gene locus_tag LOCUS_20070 1492 527 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210221.1 protein_id gnl|my_center|LOCUS_20070 <2869 1536 gene locus_tag LOCUS_20080 <2869 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028557.1:sugar ABC transporter ATP-binding protein >Feature sequence441 36 1346 gene locus_tag LOCUS_20090 36 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2462 1374 gene locus_tag LOCUS_20100 2462 1374 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence442 447 1472 gene locus_tag LOCUS_20110 447 1472 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_20110 2131 1496 gene locus_tag LOCUS_20120 2131 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2247 2579 gene locus_tag LOCUS_20130 2247 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence443 1439 585 gene locus_tag LOCUS_20140 1439 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1941 1492 gene locus_tag LOCUS_20150 gene nrdI 1941 1492 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384395.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence444 354 1088 gene locus_tag LOCUS_20160 354 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1799 1122 gene locus_tag LOCUS_20170 1799 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1951 1796 gene locus_tag LOCUS_20180 1951 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence445 <1 1492 gene locus_tag LOCUS_20190 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080659.1:ATP-binding protein 1489 2181 gene locus_tag LOCUS_20200 1489 2181 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_20200 <2823 2198 gene locus_tag LOCUS_20210 <2823 2198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776854.1:Rv2578c family radical SAM protein >Feature sequence446 1451 129 gene locus_tag LOCUS_20220 1451 129 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence447 835 503 gene locus_tag LOCUS_20230 835 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20230 1708 902 gene locus_tag LOCUS_20240 1708 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20240 2046 2489 gene locus_tag LOCUS_20250 2046 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence448 <1 816 gene locus_tag LOCUS_20260 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805006.1:histidine--tRNA ligase 2709 895 gene locus_tag LOCUS_20270 2709 895 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805008.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence449 212 1759 gene locus_tag LOCUS_20280 212 1759 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929956.1 protein_id gnl|my_center|LOCUS_20280 2107 1805 gene locus_tag LOCUS_20290 2107 1805 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_20290 2508 2113 gene locus_tag LOCUS_20300 2508 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2537 2734 gene locus_tag LOCUS_20310 2537 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence450 325 1245 gene locus_tag LOCUS_20320 325 1245 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_20320 2306 1362 gene locus_tag LOCUS_20330 2306 1362 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803844.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence451 341 1645 gene locus_tag LOCUS_20340 341 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_20340 1642 2646 gene locus_tag LOCUS_20350 1642 2646 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence452 1365 337 gene locus_tag LOCUS_20360 gene ppk2 1365 337 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416928.1 protein_id gnl|my_center|LOCUS_20360 1529 2044 gene locus_tag LOCUS_20370 1529 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence453 <1 657 gene locus_tag LOCUS_20380 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775728.1:deoxyguanosinetriphosphate triphosphohydrolase 707 1501 gene locus_tag LOCUS_20390 707 1501 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence454 <1 828 gene locus_tag LOCUS_20400 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930218.1:quinone-dependent dihydroorotate dehydrogenase 1527 889 gene locus_tag LOCUS_20410 1527 889 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence455 1133 2566 gene locus_tag LOCUS_20420 1133 2566 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777115.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence456 402 1928 gene locus_tag LOCUS_20430 402 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence457 1894 2 gene locus_tag LOCUS_20440 1894 2 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_20440 2579 1887 gene locus_tag LOCUS_20450 2579 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence458 483 1241 gene locus_tag LOCUS_20460 483 1241 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_20460 2603 1296 gene locus_tag LOCUS_20470 2603 1296 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728677.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence459 <1 712 gene locus_tag LOCUS_20480 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776672.1:penicillin-binding transpeptidase domain-containing protein 709 2217 gene locus_tag LOCUS_20490 709 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence460 1227 1769 gene locus_tag LOCUS_20500 1227 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence461 1659 304 gene locus_tag LOCUS_20510 1659 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2645 1677 gene locus_tag LOCUS_20520 2645 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence462 <1 2151 gene locus_tag LOCUS_20530 <1 2151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775403.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence463 233 1036 gene locus_tag LOCUS_20540 233 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 1061 1684 gene locus_tag LOCUS_20550 1061 1684 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971767.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence464 1498 2499 gene locus_tag LOCUS_20560 1498 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence465 <1 1257 gene locus_tag LOCUS_20570 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028182.1:leucyl aminopeptidase >Feature sequence466 <1 1108 gene locus_tag LOCUS_20580 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106977887.1:GTP 3',8-cyclase MoaA 2227 1142 gene locus_tag LOCUS_20590 2227 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2585 2325 gene locus_tag LOCUS_20600 2585 2325 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804483.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence467 1159 2412 gene locus_tag LOCUS_20610 gene glgA 1159 2412 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence468 2 472 gene locus_tag LOCUS_20620 2 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 834 469 gene locus_tag LOCUS_20630 834 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 917 1019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1966 1217 gene locus_tag LOCUS_20640 1966 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 <2687 2010 gene locus_tag LOCUS_20650 <2687 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973615.1:ABC transporter permease >Feature sequence469 1192 152 gene locus_tag LOCUS_20660 1192 152 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014888.1 protein_id gnl|my_center|LOCUS_20660 2003 1185 gene locus_tag LOCUS_20670 2003 1185 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence470 1451 81 gene locus_tag LOCUS_20680 1451 81 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_20680 1563 2291 gene locus_tag LOCUS_20690 1563 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence471 <1 825 gene locus_tag LOCUS_20700 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929983.1:histidinol-phosphate transaminase 822 1505 gene locus_tag LOCUS_20710 gene hisB 822 1505 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776207.1 protein_id gnl|my_center|LOCUS_20710 1575 1922 gene locus_tag LOCUS_20720 1575 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence472 1108 326 gene locus_tag LOCUS_20730 1108 326 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_20730 1829 1095 gene locus_tag LOCUS_20740 1829 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2338 2018 gene locus_tag LOCUS_20750 2338 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence473 1158 160 gene locus_tag LOCUS_20760 gene dhaK 1158 160 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229495.1 protein_id gnl|my_center|LOCUS_20760 2361 1318 gene locus_tag LOCUS_20770 2361 1318 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence474 <1 1365 gene locus_tag LOCUS_20780 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803820.1:extracellular solute-binding protein >Feature sequence475 64 999 gene locus_tag LOCUS_20790 64 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1046 1747 gene locus_tag LOCUS_20800 1046 1747 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804265.1 protein_id gnl|my_center|LOCUS_20800 <2658 1752 gene locus_tag LOCUS_20810 <2658 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030685.1:alditol oxidase >Feature sequence476 >Feature sequence477 241 816 gene locus_tag LOCUS_20820 241 816 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_20820 813 1997 gene locus_tag LOCUS_20830 813 1997 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390077.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence478 1332 205 gene locus_tag LOCUS_20840 gene dapD 1332 205 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930176.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence479 1224 532 gene locus_tag LOCUS_20850 1224 532 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_20850 2059 1271 gene locus_tag LOCUS_20860 2059 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2133 2576 gene locus_tag LOCUS_20870 gene arfB 2133 2576 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence480 638 681 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 735 914 gene locus_tag LOCUS_20880 735 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1017 2555 gene locus_tag LOCUS_20890 1017 2555 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205623.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence481 1063 119 gene locus_tag LOCUS_20900 1063 119 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_20900 2131 1331 gene locus_tag LOCUS_20910 2131 1331 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803894.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence482 <1 1268 gene locus_tag LOCUS_20920 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228093.1:crosslink repair DNA glycosylase YcaQ family protein >Feature sequence483 >Feature sequence484 1173 4 gene locus_tag LOCUS_20930 1173 4 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812727.1 protein_id gnl|my_center|LOCUS_20930 2201 1170 gene locus_tag LOCUS_20940 2201 1170 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence485 2351 939 gene locus_tag LOCUS_20950 2351 939 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729325.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence486 234 836 gene locus_tag LOCUS_20960 234 836 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_20960 863 1432 gene locus_tag LOCUS_20970 863 1432 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908623.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence487 1675 749 gene locus_tag LOCUS_20980 1675 749 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961378.1 protein_id gnl|my_center|LOCUS_20980 <2595 1746 gene locus_tag LOCUS_20990 <2595 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532946.1:carbohydrate ABC transporter permease >Feature sequence488 >Feature sequence489 <1 537 gene locus_tag LOCUS_21000 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038480.1:DegV family protein 615 989 gene locus_tag LOCUS_21010 615 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 998 1297 gene locus_tag LOCUS_21020 998 1297 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805050.1 protein_id gnl|my_center|LOCUS_21020 1898 1416 gene locus_tag LOCUS_21030 1898 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1988 2497 gene locus_tag LOCUS_21040 gene dut 1988 2497 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence490 >Feature sequence491 2493 199 gene locus_tag LOCUS_21050 2493 199 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence492 92 1129 gene locus_tag LOCUS_21060 92 1129 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636535.1 protein_id gnl|my_center|LOCUS_21060 2534 1122 gene locus_tag LOCUS_21070 2534 1122 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence493 29 775 gene locus_tag LOCUS_21080 29 775 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_21080 1460 672 gene locus_tag LOCUS_21090 1460 672 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783114.1 protein_id gnl|my_center|LOCUS_21090 1855 1457 gene locus_tag LOCUS_21100 1855 1457 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_21100 <2557 1857 gene locus_tag LOCUS_21110 <2557 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805053.1:DUF3710 domain-containing protein >Feature sequence494 >Feature sequence495 649 62 gene locus_tag LOCUS_21120 649 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1475 804 gene locus_tag LOCUS_21130 1475 804 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_21130 <2543 1472 gene locus_tag LOCUS_21140 <2543 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228285.1:histidine kinase >Feature sequence496 1034 315 gene locus_tag LOCUS_21150 1034 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2373 1036 gene locus_tag LOCUS_21160 2373 1036 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence497 471 1508 gene locus_tag LOCUS_21170 gene pitH 471 1508 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_21170 2120 1518 gene locus_tag LOCUS_21180 2120 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence498 493 963 gene locus_tag LOCUS_21190 493 963 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085354.1 protein_id gnl|my_center|LOCUS_21190 1251 2012 gene locus_tag LOCUS_21200 1251 2012 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence499 <1 1132 gene locus_tag LOCUS_21210 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003912345.1:HNH endonuclease signature motif containing protein 1129 1812 gene locus_tag LOCUS_21220 1129 1812 CDS product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777101.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence500 >Feature sequence501 <1 626 gene locus_tag LOCUS_21230 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051905.1:HAD-IIB family hydrolase 640 2352 gene locus_tag LOCUS_21240 640 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence502 506 1207 gene locus_tag LOCUS_21250 506 1207 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_21250 1228 1635 gene locus_tag LOCUS_21260 1228 1635 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence503 >Feature sequence504 <1 740 gene locus_tag LOCUS_21270 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068337.1:permease-like cell division protein FtsX 751 2217 gene locus_tag LOCUS_21280 751 2217 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139721929.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence505 867 55 gene locus_tag LOCUS_21290 867 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2480 864 gene locus_tag LOCUS_21300 gene aspS 2480 864 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence506 <2480 440 gene locus_tag LOCUS_21310 <2480 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582331.1:glycoside hydrolase family 31 protein >Feature sequence507 >Feature sequence508 <1 1497 gene locus_tag LOCUS_21320 <1 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583124.1:DUF4914 family protein 1591 2082 gene locus_tag LOCUS_21330 1591 2082 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence509 <1 1593 gene locus_tag LOCUS_21340 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989371.1:alpha-glucosidase 1725 1904 gene locus_tag LOCUS_21350 1725 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence510 397 1002 gene locus_tag LOCUS_21360 397 1002 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_21360 1028 1720 gene locus_tag LOCUS_21370 1028 1720 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence511 <1 511 gene locus_tag LOCUS_21380 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776900.1:LacI family DNA-binding transcriptional regulator 2294 498 gene locus_tag LOCUS_21390 2294 498 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence512 <1 1049 gene locus_tag LOCUS_21400 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082543.1:xylan alpha-(1->2)-glucuronosidase 1415 1068 gene locus_tag LOCUS_21410 1415 1068 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 protein_id gnl|my_center|LOCUS_21410 2252 1425 gene locus_tag LOCUS_21420 gene rhaD 2252 1425 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476558.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence513 523 1440 gene locus_tag LOCUS_21430 523 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1577 2362 gene locus_tag LOCUS_21440 1577 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence514 1752 139 gene locus_tag LOCUS_21450 1752 139 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_21450 1709 1927 gene locus_tag LOCUS_21460 1709 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence515 <1 1066 gene locus_tag LOCUS_21470 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742066.1:MoxR family ATPase >Feature sequence516 635 1819 gene locus_tag LOCUS_21480 635 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1845 2219 gene locus_tag LOCUS_21490 1845 2219 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531287.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence517 2125 1226 gene locus_tag LOCUS_21500 2125 1226 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404795.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence518 <1 736 gene locus_tag LOCUS_21510 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327228.1:NAD(+) diphosphatase 740 1366 gene locus_tag LOCUS_21520 740 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1652 1386 gene locus_tag LOCUS_21530 1652 1386 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence519 1481 273 gene locus_tag LOCUS_21540 1481 273 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037578.1 protein_id gnl|my_center|LOCUS_21540 <2422 1520 gene locus_tag LOCUS_21550 <2422 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037579.1:NAD(P)-dependent oxidoreductase >Feature sequence520 1948 1319 gene locus_tag LOCUS_21560 1948 1319 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence521 1432 533 gene locus_tag LOCUS_21570 1432 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 <2406 1443 gene locus_tag LOCUS_21580 <2406 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002359867.1:glycoside hydrolase family 88 protein >Feature sequence522 >Feature sequence523 1885 1007 gene locus_tag LOCUS_21590 1885 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence524 <1 1079 gene locus_tag LOCUS_21600 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332588.1:SdrD B-like domain-containing protein 2278 1145 gene locus_tag LOCUS_21610 2278 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence525 >Feature sequence526 1430 42 gene locus_tag LOCUS_21620 gene hemL 1430 42 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_21620 2386 1418 gene locus_tag LOCUS_21630 gene hemB 2386 1418 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776657.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence527 <1 972 gene locus_tag LOCUS_21640 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226673.1:phage tail sheath family protein 1000 1452 gene locus_tag LOCUS_21650 1000 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1449 1934 gene locus_tag LOCUS_21660 1449 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_21660 1931 2089 gene locus_tag LOCUS_21670 1931 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence528 1896 1105 gene locus_tag LOCUS_21680 1896 1105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_21680 2036 2320 gene locus_tag LOCUS_21690 2036 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence529 1110 550 gene locus_tag LOCUS_21700 1110 550 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_21700 <2377 1100 gene locus_tag LOCUS_21710 <2377 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974731.1:putative baseplate assembly protein >Feature sequence530 <1 1851 gene locus_tag LOCUS_21720 <1 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003642848.1:heavy metal translocating P-type ATPase 2212 1946 gene locus_tag LOCUS_21730 2212 1946 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence531 594 259 gene locus_tag LOCUS_21740 594 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 871 939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1377 1547 gene locus_tag LOCUS_21750 1377 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 <2368 1678 gene locus_tag LOCUS_21760 <2368 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930019.1:folate-binding protein YgfZ >Feature sequence532 329 1612 gene locus_tag LOCUS_21770 gene ftsW 329 1612 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence533 >Feature sequence534 >Feature sequence535 254 1747 gene locus_tag LOCUS_21780 254 1747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 protein_id gnl|my_center|LOCUS_21780 2345 1851 gene locus_tag LOCUS_21790 2345 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence536 1291 2154 gene locus_tag LOCUS_21800 gene iolB 1291 2154 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729993.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence537 <1 1230 gene locus_tag LOCUS_21810 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227103.1:YibE/F family protein 1385 1669 gene locus_tag LOCUS_21820 1385 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1772 2287 gene locus_tag LOCUS_21830 1772 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence538 1 420 gene locus_tag LOCUS_21840 1 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 417 1595 gene locus_tag LOCUS_21850 417 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence539 434 607 gene locus_tag LOCUS_21860 434 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2196 646 gene locus_tag LOCUS_21870 gene miaB 2196 646 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence540 112 1083 gene locus_tag LOCUS_21880 gene pip 112 1083 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925856.1 protein_id gnl|my_center|LOCUS_21880 1131 2213 gene locus_tag LOCUS_21890 1131 2213 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence541 <1 561 gene locus_tag LOCUS_21900 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728286.1:electron transfer flavoprotein subunit beta/FixA family protein 558 1457 gene locus_tag LOCUS_21910 558 1457 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877364.1 protein_id gnl|my_center|LOCUS_21910 1575 2129 gene locus_tag LOCUS_21920 1575 2129 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226947.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence542 >Feature sequence543 36 1187 gene locus_tag LOCUS_21930 gene fucO 36 1187 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052368.1 protein_id gnl|my_center|LOCUS_21930 <2324 1275 gene locus_tag LOCUS_21940 <2324 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223998.1:alpha-hydroxy acid oxidase >Feature sequence544 <1 991 gene locus_tag LOCUS_21950 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028108.1:ADP-ribosylglycohydrolase family protein 1676 1131 gene locus_tag LOCUS_21960 1676 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21960 >Feature sequence545 2203 1217 gene locus_tag LOCUS_21970 2203 1217 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence546 613 2118 gene locus_tag LOCUS_21980 613 2118 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019261882.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence547 <1 1153 gene locus_tag LOCUS_21990 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257890.1:sugar ABC transporter permease 1150 2040 gene locus_tag LOCUS_22000 1150 2040 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052908.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence548 <1 1439 gene locus_tag LOCUS_22010 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950676.1:CYTH and CHAD domain-containing protein <2310 1436 gene locus_tag LOCUS_22020 <2310 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225280.1:MFS transporter >Feature sequence549 603 40 gene locus_tag LOCUS_22030 603 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 719 1375 gene locus_tag LOCUS_22040 719 1375 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776347.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence550 <1 1590 gene locus_tag LOCUS_22050 <1 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218916596.1:multicopper oxidase domain-containing protein >Feature sequence551 269 2008 gene locus_tag LOCUS_22060 269 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence552 1551 451 gene locus_tag LOCUS_22070 gene recA 1551 451 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_22070 2158 1928 gene locus_tag LOCUS_22080 2158 1928 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence553 1265 399 gene locus_tag LOCUS_22090 1265 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence554 554 1177 gene locus_tag LOCUS_22100 554 1177 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728328.1 protein_id gnl|my_center|LOCUS_22100 1229 1417 gene locus_tag LOCUS_22110 gene rpmF 1229 1417 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_22110 1426 2148 gene locus_tag LOCUS_22120 gene rnc 1426 2148 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence555 >Feature sequence556 >Feature sequence557 <1 687 gene locus_tag LOCUS_22130 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003911572.1:inositol monophosphatase family protein 1724 744 gene locus_tag LOCUS_22140 1724 744 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032836384.1 protein_id gnl|my_center|LOCUS_22140 <2263 1721 gene locus_tag LOCUS_22150 <2263 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929929.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence558 1994 867 gene locus_tag LOCUS_22160 gene prfB 1994 867 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence559 1096 287 gene locus_tag LOCUS_22170 1096 287 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_22170 1887 1111 gene locus_tag LOCUS_22180 1887 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence560 329 529 gene locus_tag LOCUS_22190 329 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 526 1665 gene locus_tag LOCUS_22200 526 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence561 <1 1810 gene locus_tag LOCUS_22210 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804696.1:penicillin-binding protein 2 >Feature sequence562 >Feature sequence563 210 611 gene locus_tag LOCUS_22220 210 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1413 568 gene locus_tag LOCUS_22230 gene prmC 1413 568 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775948.1 protein_id gnl|my_center|LOCUS_22230 <2248 1535 gene locus_tag LOCUS_22240 <2248 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973637.1:peptide chain release factor 1 >Feature sequence564 314 135 gene locus_tag LOCUS_22250 314 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 576 304 gene locus_tag LOCUS_22260 576 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 872 666 gene locus_tag LOCUS_22270 872 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence565 >Feature sequence566 >Feature sequence567 1260 232 gene locus_tag LOCUS_22280 1260 232 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775708.1 protein_id gnl|my_center|LOCUS_22280 <2233 1331 gene locus_tag LOCUS_22290 <2233 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775707.1:ACP S-malonyltransferase >Feature sequence568 1712 1764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence569 >Feature sequence570 508 1770 gene locus_tag LOCUS_22300 508 1770 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence571 >Feature sequence572 414 196 gene locus_tag LOCUS_22310 414 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1369 461 gene locus_tag LOCUS_22320 1369 461 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 protein_id gnl|my_center|LOCUS_22320 2208 1369 gene locus_tag LOCUS_22330 2208 1369 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence573 77 1669 gene locus_tag LOCUS_22340 gene crtI 77 1669 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_22340 <2206 1682 gene locus_tag LOCUS_22350 <2206 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014896.1:LLM class flavin-dependent oxidoreductase >Feature sequence574 313 930 gene locus_tag LOCUS_22360 313 930 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence575 <2190 857 gene locus_tag LOCUS_22370 <2190 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224909.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase >Feature sequence576 861 373 gene locus_tag LOCUS_22380 861 373 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence577 1986 1390 gene locus_tag LOCUS_22390 gene pth 1986 1390 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence578 302 1132 gene locus_tag LOCUS_22400 302 1132 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203416553.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence579 >Feature sequence580 >Feature sequence581 950 975 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence582 <1 1324 gene locus_tag LOCUS_22410 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729974.1:S9 family peptidase 1888 1460 gene locus_tag LOCUS_22420 1888 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence583 >Feature sequence584 >Feature sequence585 663 25 gene locus_tag LOCUS_22430 663 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1172 660 gene locus_tag LOCUS_22440 1172 660 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 protein_id gnl|my_center|LOCUS_22440 1667 1203 gene locus_tag LOCUS_22450 1667 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence586 1266 577 gene locus_tag LOCUS_22460 1266 577 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776653.1 protein_id gnl|my_center|LOCUS_22460 <2136 1263 gene locus_tag LOCUS_22470 <2136 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776652.1:protoporphyrinogen oxidase >Feature sequence587 >Feature sequence588 <1 1175 gene locus_tag LOCUS_22480 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224700.1:cysteine desulfurase 1180 1707 gene locus_tag LOCUS_22490 1180 1707 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_22490 1704 2048 gene locus_tag LOCUS_22500 1704 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence589 993 1688 gene locus_tag LOCUS_22510 993 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence590 16 1179 gene locus_tag LOCUS_22520 16 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1289 1939 gene locus_tag LOCUS_22530 1289 1939 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence591 1324 41 gene locus_tag LOCUS_22540 1324 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 <2119 1449 gene locus_tag LOCUS_22550 <2119 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257892.1:LacI family DNA-binding transcriptional regulator >Feature sequence592 <2104 1324 gene locus_tag LOCUS_22560 <2104 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027465.1:LacI family DNA-binding transcriptional regulator >Feature sequence593 57 884 gene locus_tag LOCUS_22570 57 884 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098886.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence594 1787 450 gene locus_tag LOCUS_22580 1787 450 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776346.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence595 <2098 69 gene locus_tag LOCUS_22590 <2098 69 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803808.1:alpha-xylosidase >Feature sequence596 >Feature sequence597 424 1863 gene locus_tag LOCUS_22600 gene argG 424 1863 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226260.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence598 <1 879 gene locus_tag LOCUS_22610 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230150.1:ABC transporter permease 1726 953 gene locus_tag LOCUS_22620 1726 953 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804593.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence599 >Feature sequence600 <1 1090 gene locus_tag LOCUS_22630 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929912.1:succinyl-diaminopimelate desuccinylase 1148 1948 gene locus_tag LOCUS_22640 1148 1948 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence601 1088 1004 gene locus_tag LOCUS_t00370 1088 1004 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence602 <1 1241 gene locus_tag LOCUS_22650 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896840.1:FAD-dependent oxidoreductase >Feature sequence603 942 283 gene locus_tag LOCUS_22660 942 283 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_22660 1025 1699 gene locus_tag LOCUS_22670 1025 1699 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814444.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence604 >Feature sequence605 <2072 135 gene locus_tag LOCUS_22680 <2072 135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226676.1:ATP-binding protein >Feature sequence606 <1 719 gene locus_tag LOCUS_22690 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728103.1:YggS family pyridoxal phosphate-dependent enzyme 716 1582 gene locus_tag LOCUS_22700 gene pdxK 716 1582 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063849.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence607 >Feature sequence608 1412 393 gene locus_tag LOCUS_22710 1412 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence609 >Feature sequence610 433 5 gene locus_tag LOCUS_22720 433 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1354 647 gene locus_tag LOCUS_22730 1354 647 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence611 >Feature sequence612 <2042 127 gene locus_tag LOCUS_22740 <2042 127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775818.1:extracellular solute-binding protein >Feature sequence613 727 1215 gene locus_tag LOCUS_22750 727 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 <2038 1294 gene locus_tag LOCUS_22760 <2038 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805026.1:ROK family glucokinase >Feature sequence614 84 890 gene locus_tag LOCUS_22770 84 890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence615 <1 1497 gene locus_tag LOCUS_22780 <1 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226349.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1530 1988 gene locus_tag LOCUS_22790 1530 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence616 306 608 gene locus_tag LOCUS_22800 306 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 675 1694 gene locus_tag LOCUS_22810 675 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence617 346 1752 gene locus_tag LOCUS_22820 346 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence618 2 292 gene locus_tag LOCUS_22830 2 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 378 1154 gene locus_tag LOCUS_22840 378 1154 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071158.1 protein_id gnl|my_center|LOCUS_22840 1228 1521 gene locus_tag LOCUS_22850 1228 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence619 434 1396 gene locus_tag LOCUS_22860 434 1396 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_22860 <2000 1438 gene locus_tag LOCUS_22870 <2000 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142819.1:zinc-binding dehydrogenase >Feature sequence620 <1999 1261 gene locus_tag LOCUS_22880 <1999 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776590.1:phosphatase PAP2 family protein >Feature sequence621 306 845 gene locus_tag LOCUS_22890 306 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 845 1411 gene locus_tag LOCUS_22900 gene comE 845 1411 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence622 >Feature sequence623 >Feature sequence624 >Feature sequence625 >Feature sequence626 1487 474 gene locus_tag LOCUS_22910 gene mvaD 1487 474 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence627 778 242 gene locus_tag LOCUS_22920 778 242 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_22920 1308 775 gene locus_tag LOCUS_22930 1308 775 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728592.1 protein_id gnl|my_center|LOCUS_22930 <1956 1305 gene locus_tag LOCUS_22940 <1956 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803877.1:LLM class flavin-dependent oxidoreductase >Feature sequence628 1948 959 gene locus_tag LOCUS_22950 1948 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence629 >Feature sequence630 1824 1567 gene locus_tag LOCUS_22960 1824 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence631 32 1867 gene locus_tag LOCUS_22970 32 1867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence632 1199 432 gene locus_tag LOCUS_22980 1199 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence633 714 759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence634 1263 358 gene locus_tag LOCUS_22990 1263 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence635 <1 868 gene locus_tag LOCUS_23000 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004113800.1:carbohydrate ABC transporter permease >Feature sequence636 392 1840 gene locus_tag LOCUS_23010 392 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence637 830 45 gene locus_tag LOCUS_23020 830 45 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_23020 926 1159 gene locus_tag LOCUS_23030 926 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 <1895 1191 gene locus_tag LOCUS_23040 <1895 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005085258.1:3-methyl-2-oxobutanoate hydroxymethyltransferase >Feature sequence638 >Feature sequence639 <1888 999 gene locus_tag LOCUS_23050 <1888 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804139.1:LacI family DNA-binding transcriptional regulator >Feature sequence640 <1 1747 gene locus_tag LOCUS_23060 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776591.1:type I DNA topoisomerase >Feature sequence641 >Feature sequence642 1135 416 gene locus_tag LOCUS_23070 1135 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 <1878 1200 gene locus_tag LOCUS_23080 <1878 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222694.1:DinB family protein >Feature sequence643 <1 1018 gene locus_tag LOCUS_23090 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803826.1:xylose isomerase >Feature sequence644 641 183 gene locus_tag LOCUS_23100 641 183 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_23100 1047 694 gene locus_tag LOCUS_23110 1047 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence645 941 273 gene locus_tag LOCUS_23120 941 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence646 >Feature sequence647 1849 107 gene locus_tag LOCUS_23130 1849 107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence648 1077 466 gene locus_tag LOCUS_23140 1077 466 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_23140 1735 1070 gene locus_tag LOCUS_23150 1735 1070 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence649 1007 537 gene locus_tag LOCUS_23160 gene rbfA 1007 537 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_23160 <1850 1004 gene locus_tag LOCUS_23170 <1850 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152204006.1:translation initiation factor IF-2 >Feature sequence650 1683 724 gene locus_tag LOCUS_23180 gene miaA 1683 724 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence651 <1 629 gene locus_tag LOCUS_23190 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228372.1:serpin family protein 1186 674 gene locus_tag LOCUS_23200 1186 674 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296703.1 protein_id gnl|my_center|LOCUS_23200 1839 1312 gene locus_tag LOCUS_23210 1839 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence652 >Feature sequence653 1323 241 gene locus_tag LOCUS_23220 1323 241 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804219.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence654 <1834 724 gene locus_tag LOCUS_23230 <1834 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804697.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence655 <1833 890 gene locus_tag LOCUS_23240 <1833 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776181.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ >Feature sequence656 363 1049 gene locus_tag LOCUS_23250 363 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1069 1749 gene locus_tag LOCUS_23260 1069 1749 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence657 >Feature sequence658 599 1750 gene locus_tag LOCUS_23270 599 1750 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence659 587 853 gene locus_tag LOCUS_23280 587 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 868 1212 gene locus_tag LOCUS_23290 gene mazF6 868 1212 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence660 864 349 gene locus_tag LOCUS_23300 864 349 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296550.1 protein_id gnl|my_center|LOCUS_23300 1646 861 gene locus_tag LOCUS_23310 1646 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence661 <1812 717 gene locus_tag LOCUS_23320 <1812 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000945924.1:beta-glucuronidase >Feature sequence662 1597 302 gene locus_tag LOCUS_23330 1597 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence663 >Feature sequence664 1023 58 gene locus_tag LOCUS_23340 1023 58 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_23340 <1792 1020 gene locus_tag LOCUS_23350 <1792 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804683.1:ATP-dependent DNA helicase >Feature sequence665 1590 484 gene locus_tag LOCUS_23360 1590 484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066696.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence666 1308 1223 gene locus_tag LOCUS_t00380 1308 1223 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence667 466 1152 gene locus_tag LOCUS_23370 466 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence668 2 256 gene locus_tag LOCUS_23380 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 313 1077 gene locus_tag LOCUS_23390 313 1077 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227040.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence669 1071 67 gene locus_tag LOCUS_23400 gene trxB 1071 67 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence670 <1 795 gene locus_tag LOCUS_23410 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005115881.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence671 215 1756 gene locus_tag LOCUS_23420 215 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence672 <1 1396 gene locus_tag LOCUS_23430 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775859.1:thiol reductant ABC exporter subunit CydD >Feature sequence673 794 171 gene locus_tag LOCUS_23440 794 171 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_23440 1318 791 gene locus_tag LOCUS_23450 1318 791 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence674 1081 545 gene locus_tag LOCUS_23460 1081 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence675 <1 524 gene locus_tag LOCUS_23470 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201420258.1:CynX/NimT family MFS transporter 496 1089 gene locus_tag LOCUS_23480 496 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence676 >Feature sequence677 >Feature sequence678 <1 549 gene locus_tag LOCUS_23490 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013921.1:septum formation family protein 683 1186 gene locus_tag LOCUS_23500 683 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1189 1713 gene locus_tag LOCUS_23510 1189 1713 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804678.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence679 1085 72 gene locus_tag LOCUS_23520 1085 72 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_23520 <1736 1117 gene locus_tag LOCUS_23530 <1736 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803957.1:VTC domain-containing protein >Feature sequence680 670 308 gene locus_tag LOCUS_23540 670 308 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_23540 <1731 667 gene locus_tag LOCUS_23550 <1731 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974386.1:geranylgeranyl reductase family protein >Feature sequence681 835 1557 gene locus_tag LOCUS_23560 835 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence682 >Feature sequence683 406 1665 gene locus_tag LOCUS_23570 406 1665 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837051.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence684 518 90 gene locus_tag LOCUS_23580 gene mraZ 518 90 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_23580 1451 1059 gene locus_tag LOCUS_23590 1451 1059 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence685 >Feature sequence686 >Feature sequence687 >Feature sequence688 1711 263 gene locus_tag LOCUS_23600 gene lnt 1711 263 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence689 >Feature sequence690 >Feature sequence691 >Feature sequence692 >Feature sequence693 >Feature sequence694 >Feature sequence695 1512 652 gene locus_tag LOCUS_23610 1512 652 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence696 182 457 gene locus_tag LOCUS_23620 182 457 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776288.1 protein_id gnl|my_center|LOCUS_23620 624 1025 gene locus_tag LOCUS_23630 624 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 <1672 1097 gene locus_tag LOCUS_23640 <1672 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228470.1:RecQ family ATP-dependent DNA helicase >Feature sequence697 <1671 21 gene locus_tag LOCUS_23650 <1671 21 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730214.1:arginine--tRNA ligase >Feature sequence698 102 190 gene locus_tag LOCUS_t00390 102 190 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence699 213 494 gene locus_tag LOCUS_23660 gene rpsS 213 494 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 protein_id gnl|my_center|LOCUS_23660 548 907 gene locus_tag LOCUS_23670 gene rplV 548 907 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence700 <1 594 gene locus_tag LOCUS_23680 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218916598.1:ABC transporter ATP-binding protein 591 1499 gene locus_tag LOCUS_23690 591 1499 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803792.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence701 <1656 160 gene locus_tag LOCUS_23700 <1656 160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226475.1:M3 family metallopeptidase >Feature sequence702 191 937 gene locus_tag LOCUS_23710 gene narJ 191 937 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014185.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence703 2 577 gene locus_tag LOCUS_23720 2 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 <1642 594 gene locus_tag LOCUS_23730 <1642 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005070771.1:LuxR family transcriptional regulator >Feature sequence704 >Feature sequence705 >Feature sequence706 <1 931 gene locus_tag LOCUS_23740 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091304903.1:DUF11 domain-containing protein 1418 963 gene locus_tag LOCUS_23750 1418 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence707 <1632 463 gene locus_tag LOCUS_23760 <1632 463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223580.1:dihydroxy-acid dehydratase >Feature sequence708 1250 69 gene locus_tag LOCUS_23770 gene dinB 1250 69 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226402.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence709 <1623 697 gene locus_tag LOCUS_23780 <1623 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896017.1:FAD-dependent oxidoreductase >Feature sequence710 <1 808 gene locus_tag LOCUS_23790 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193499286.1:DUF4081 domain-containing GNAT family N-acetyltransferase >Feature sequence711 <1 953 gene locus_tag LOCUS_23800 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804694.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 950 1336 gene locus_tag LOCUS_23810 950 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence712 136 897 gene locus_tag LOCUS_23820 136 897 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728586.1 protein_id gnl|my_center|LOCUS_23820 <1611 894 gene locus_tag LOCUS_23830 <1611 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050298568.1:enterochelin esterase >Feature sequence713 1340 84 gene locus_tag LOCUS_23840 1340 84 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence714 >Feature sequence715 435 1073 gene locus_tag LOCUS_23850 gene msrA 435 1073 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence716 >Feature sequence717 >Feature sequence718 >Feature sequence719 <1 692 gene locus_tag LOCUS_23860 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030437.1:Fpg/Nei family DNA glycosylase 1280 966 gene locus_tag LOCUS_23870 1280 966 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804673.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence720 <1 552 gene locus_tag LOCUS_23880 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226259.1:aminoglycoside phosphotransferase family protein 557 1270 gene locus_tag LOCUS_23890 557 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence721 <1 631 gene locus_tag LOCUS_23900 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742122.1:o-succinylbenzoate--CoA ligase 634 1428 gene locus_tag LOCUS_23910 634 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence722 <1568 848 gene locus_tag LOCUS_23920 <1568 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775661.1:undecaprenyl-diphosphate phosphatase >Feature sequence723 1102 206 gene locus_tag LOCUS_23930 1102 206 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence724 779 258 gene locus_tag LOCUS_23940 779 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 <1565 786 gene locus_tag LOCUS_23950 <1565 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029396.1:MFS transporter >Feature sequence725 >Feature sequence726 1530 610 gene locus_tag LOCUS_23960 1530 610 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence727 <1 1378 gene locus_tag LOCUS_23970 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876865.1:MMPL family transporter >Feature sequence728 974 492 gene locus_tag LOCUS_23980 gene greA 974 492 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence729 1208 207 gene locus_tag LOCUS_23990 1208 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence730 <1529 455 gene locus_tag LOCUS_24000 <1529 455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878492.1:CotH kinase family protein >Feature sequence731 <1 1486 gene locus_tag LOCUS_24010 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006311047.1:altronate dehydratase family protein >Feature sequence732 >Feature sequence733 1004 1351 gene locus_tag LOCUS_24020 1004 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence734 >Feature sequence735 <1 1017 gene locus_tag LOCUS_24030 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093456948.1:trypsin-like peptidase domain-containing protein 1014 1373 gene locus_tag LOCUS_24040 1014 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence736 <1507 131 gene locus_tag LOCUS_24050 <1507 131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776429.1:potassium transporter TrkG >Feature sequence737 >Feature sequence738 >Feature sequence739 1080 766 gene locus_tag LOCUS_24060 1080 766 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence740 >Feature sequence741 404 48 gene locus_tag LOCUS_24070 404 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 518 1081 gene locus_tag LOCUS_24080 518 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence742 1108 347 gene locus_tag LOCUS_24090 1108 347 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence743 <1 1054 gene locus_tag LOCUS_24100 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804649.1:proline--tRNA ligase >Feature sequence744 <1485 58 gene locus_tag LOCUS_24110 <1485 58 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229782.1:AlkA N-terminal domain-containing protein >Feature sequence745 658 1317 gene locus_tag LOCUS_24120 658 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162098243.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence746 >Feature sequence747 481 780 gene locus_tag LOCUS_24130 481 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 781 1395 gene locus_tag LOCUS_24140 781 1395 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776025.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence748 >Feature sequence749 >Feature sequence750 >Feature sequence751 <1 1263 gene locus_tag LOCUS_24150 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775673.1:replication-associated recombination protein A >Feature sequence752 705 265 gene locus_tag LOCUS_24160 705 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 <1455 715 gene locus_tag LOCUS_24170 <1455 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227555.1:formate/nitrite transporter family protein >Feature sequence753 708 1271 gene locus_tag LOCUS_24180 708 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence754 388 825 gene locus_tag LOCUS_24190 388 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence755 742 212 gene locus_tag LOCUS_24200 742 212 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230160.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence756 4 327 gene locus_tag LOCUS_24210 4 327 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence757 <1439 462 gene locus_tag LOCUS_24220 <1439 462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068577.1:phosphoenolpyruvate carboxylase >Feature sequence758 899 510 gene locus_tag LOCUS_24230 899 510 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence759 >Feature sequence760 628 555 gene locus_tag LOCUS_t00400 628 555 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 701 1360 gene locus_tag LOCUS_24240 701 1360 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence761 >Feature sequence762 <1 519 gene locus_tag LOCUS_24250 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767913.1:CapA family protein 591 1253 gene locus_tag LOCUS_24260 591 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence763 >Feature sequence764 <1417 164 gene locus_tag LOCUS_24270 <1417 164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461246.1:N,N'-diacetylchitobiose phosphorylase >Feature sequence765 >Feature sequence766 3 272 gene locus_tag LOCUS_24280 3 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 269 673 gene locus_tag LOCUS_24290 269 673 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729322.1 protein_id gnl|my_center|LOCUS_24290 809 735 gene locus_tag LOCUS_t00410 809 735 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 934 1007 gene locus_tag LOCUS_t00420 934 1007 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence767 809 192 gene locus_tag LOCUS_24300 gene ruvA 809 192 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_24300 <1410 863 gene locus_tag LOCUS_24310 <1410 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907745.1:crossover junction endodeoxyribonuclease RuvC >Feature sequence768 >Feature sequence769 673 338 gene locus_tag LOCUS_24320 673 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence770 >Feature sequence771 460 840 gene locus_tag LOCUS_24330 460 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence772 >Feature sequence773 <1399 257 gene locus_tag LOCUS_24340 <1399 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977903.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence774 >Feature sequence775 <1 1257 gene locus_tag LOCUS_24350 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977340.1:dihydroorotase >Feature sequence776 <1 784 gene locus_tag LOCUS_24360 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003862391.1:thymidylate synthase 784 1356 gene locus_tag LOCUS_24370 gene dfrA 784 1356 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414073.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence777 1009 431 gene locus_tag LOCUS_24380 1009 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence778 >Feature sequence779 565 801 gene locus_tag LOCUS_24390 565 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence780 <1376 35 gene locus_tag LOCUS_24400 <1376 35 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229244.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence781 >Feature sequence782 152 1012 gene locus_tag LOCUS_24410 152 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence783 >Feature sequence784 <1371 828 gene locus_tag LOCUS_24420 <1371 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805074.1:bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR >Feature sequence785 >Feature sequence786 >Feature sequence787 1168 548 gene locus_tag LOCUS_24430 1168 548 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114630.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence788 >Feature sequence789 <1 883 gene locus_tag LOCUS_24440 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775863.1:bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase >Feature sequence790 <1356 307 gene locus_tag LOCUS_24450 <1356 307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976379.1:arabinan endo-1,5-alpha-L-arabinosidase >Feature sequence791 588 220 gene locus_tag LOCUS_24460 588 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 710 1321 gene locus_tag LOCUS_24470 710 1321 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence792 614 126 gene locus_tag LOCUS_24480 614 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 <1341 601 gene locus_tag LOCUS_24490 <1341 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775926.1:DUF58 domain-containing protein >Feature sequence793 393 28 gene locus_tag LOCUS_24500 393 28 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_24500 461 907 gene locus_tag LOCUS_24510 461 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence794 185 1099 gene locus_tag LOCUS_24520 185 1099 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068009.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence795 >Feature sequence796 234 1241 gene locus_tag LOCUS_24530 234 1241 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225188.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence797 >Feature sequence798 <1 1034 gene locus_tag LOCUS_24540 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976982.1:ABC-F family ATP-binding cassette domain-containing protein 1321 1007 gene locus_tag LOCUS_24550 1321 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24550 >Feature sequence799 41 1255 gene locus_tag LOCUS_24560 41 1255 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929871.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence800 <1 532 gene locus_tag LOCUS_24570 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029524.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 1244 561 gene locus_tag LOCUS_24580 1244 561 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence801 >Feature sequence802 292 217 gene locus_tag LOCUS_t00430 292 217 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 364 987 gene locus_tag LOCUS_24590 364 987 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence803 >Feature sequence804 >Feature sequence805 437 108 gene locus_tag LOCUS_24600 437 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 625 434 gene locus_tag LOCUS_24610 625 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 645 664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence806 >Feature sequence807 >Feature sequence808 <1 991 gene locus_tag LOCUS_24620 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776931.1:family 78 glycoside hydrolase catalytic domain >Feature sequence809 38 1066 gene locus_tag LOCUS_24630 38 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence810 >Feature sequence811 <1 552 gene locus_tag LOCUS_24640 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027561.1:ROK family protein <1284 742 gene locus_tag LOCUS_24650 <1284 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974078.1:sigma-70 family RNA polymerase sigma factor >Feature sequence812 1174 386 gene locus_tag LOCUS_24660 1174 386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence813 329 967 gene locus_tag LOCUS_24670 329 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence814 >Feature sequence815 >Feature sequence816 <1260 32 gene locus_tag LOCUS_24680 <1260 32 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226662.1:zinc ribbon domain-containing protein >Feature sequence817 62 1081 gene locus_tag LOCUS_24690 62 1081 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence818 >Feature sequence819 >Feature sequence820 1166 21 gene locus_tag LOCUS_24700 1166 21 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence821 <1 661 gene locus_tag LOCUS_24710 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027462.1:glycoside hydrolase family 38 C-terminal domain-containing protein >Feature sequence822 >Feature sequence823 161 1030 gene locus_tag LOCUS_24720 gene modA 161 1030 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence824 988 56 gene locus_tag LOCUS_24730 988 56 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence825 1 408 gene locus_tag LOCUS_24740 1 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 415 765 gene locus_tag LOCUS_24750 415 765 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence826 >Feature sequence827 912 280 gene locus_tag LOCUS_24760 912 280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 protein_id gnl|my_center|LOCUS_24760 1232 1077 gene locus_tag LOCUS_24770 1232 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence828 >Feature sequence829 >Feature sequence830 702 346 gene locus_tag LOCUS_24780 702 346 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921246.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence831 >Feature sequence832 313 1008 gene locus_tag LOCUS_24790 313 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence833 >Feature sequence834 566 865 gene locus_tag LOCUS_24800 566 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence835 474 238 gene locus_tag LOCUS_24810 474 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24810 <1206 481 gene locus_tag LOCUS_24820 <1206 481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016326663.1:alpha-ketoacid dehydrogenase subunit beta note possible pseudo, internal stop codon >Feature sequence836 >Feature sequence837 <1 853 gene locus_tag LOCUS_24830 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010147544.1:tRNA dihydrouridine synthase DusB >Feature sequence838 668 138 gene locus_tag LOCUS_24840 668 138 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533080.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence839 618 226 gene locus_tag LOCUS_24850 gene gcvH 618 226 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223709.1 protein_id gnl|my_center|LOCUS_24850 1061 669 gene locus_tag LOCUS_24860 1061 669 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence840 >Feature sequence841 >Feature sequence842 >Feature sequence843 379 909 gene locus_tag LOCUS_24870 379 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24870 >Feature sequence844 <1184 544 gene locus_tag LOCUS_24880 <1184 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028262.1:C4-type zinc ribbon domain-containing protein >Feature sequence845 48 845 gene locus_tag LOCUS_24890 48 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence846 230 1054 gene locus_tag LOCUS_24900 gene parJ 230 1054 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24900 >Feature sequence847 <1 1046 gene locus_tag LOCUS_24910 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893816.1:aspartate aminotransferase family protein >Feature sequence848 2 619 gene locus_tag LOCUS_24920 2 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence849 >Feature sequence850 <1 724 gene locus_tag LOCUS_24930 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029177.1:ABC transporter permease >Feature sequence851 <1 929 gene locus_tag LOCUS_24940 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027873.1:RNA methyltransferase >Feature sequence852 <1168 171 gene locus_tag LOCUS_24950 <1168 171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244361.1:type II CAAX endopeptidase family protein >Feature sequence853 >Feature sequence854 <1 978 gene locus_tag LOCUS_24960 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004113720.1:choice-of-anchor M domain-containing protein >Feature sequence855 <1 1075 gene locus_tag LOCUS_24970 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776179.1:acetylornithine transaminase >Feature sequence856 <1 675 gene locus_tag LOCUS_24980 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086436.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence857 184 459 gene locus_tag LOCUS_24990 184 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence858 <1155 18 gene locus_tag LOCUS_25000 <1155 18 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776145.1:M20 family metallopeptidase >Feature sequence859 >Feature sequence860 >Feature sequence861 >Feature sequence862 300 1115 gene locus_tag LOCUS_25010 300 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence863 <1139 307 gene locus_tag LOCUS_25020 <1139 307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776710.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence864 >Feature sequence865 <1 1080 gene locus_tag LOCUS_25030 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804291.1:BCCT family transporter >Feature sequence866 1005 187 gene locus_tag LOCUS_25040 gene ftsE 1005 187 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence867 887 201 gene locus_tag LOCUS_25050 gene sigR 887 201 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence868 >Feature sequence869 >Feature sequence870 <1107 359 gene locus_tag LOCUS_25060 <1107 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005094336.1:glycosyltransferase family 2 protein >Feature sequence871 <1 521 gene locus_tag LOCUS_25070 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804959.1:Ppx/GppA phosphatase family protein 632 958 gene locus_tag LOCUS_25080 632 958 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223697.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence872 >Feature sequence873 >Feature sequence874 >Feature sequence875 >Feature sequence876 >Feature sequence877 >Feature sequence878 >Feature sequence879 491 979 gene locus_tag LOCUS_25090 491 979 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730654.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence880 702 253 gene locus_tag LOCUS_25100 702 253 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_25100 995 1069 gene locus_tag LOCUS_t00440 995 1069 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence881 >Feature sequence882 >Feature sequence883 <1054 277 gene locus_tag LOCUS_25110 <1054 277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228036.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence884 >Feature sequence885 >Feature sequence886 >Feature sequence887 <1048 37 gene locus_tag LOCUS_25120 <1048 37 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224706.1:AarF/UbiB family protein >Feature sequence888 <1046 176 gene locus_tag LOCUS_25130 <1046 176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804290.1:phosphoglycerate dehydrogenase >Feature sequence889 1 852 gene locus_tag LOCUS_25140 1 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence890 <1042 67 gene locus_tag LOCUS_25150 <1042 67 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_191306837.1:peptidoglycan-binding protein >Feature sequence891 252 872 gene locus_tag LOCUS_25160 252 872 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence892 >Feature sequence893 1040 504 gene locus_tag LOCUS_25170 1040 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence894 <1 732 gene locus_tag LOCUS_25180 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729326.1:D-aminoacylase >Feature sequence895 965 276 gene locus_tag LOCUS_25190 gene prcA 965 276 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence896 >Feature sequence897 >Feature sequence898 <1028 128 gene locus_tag LOCUS_25200 <1028 128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384277.1:ABC transporter permease >Feature sequence899 <1021 379 gene locus_tag LOCUS_25210 <1021 379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897233.1:family 1 encapsulin nanocompartment shell protein >Feature sequence900 >Feature sequence901 670 915 gene locus_tag LOCUS_25220 670 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25220 >Feature sequence902 413 165 gene locus_tag LOCUS_25230 413 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 <1005 485 gene locus_tag LOCUS_25240 <1005 485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776056.1:type II secretion system F family protein >Feature sequence903 <1005 7 gene locus_tag LOCUS_25250 <1005 7 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390206.1:ExeM/NucH family extracellular endonuclease >Feature sequence904 >Feature sequence905