>Feature sequence001 >Feature sequence002 1269 658 gene locus_tag LOCUS_00010 1269 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1685 1347 gene locus_tag LOCUS_00020 1685 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3994 2888 gene locus_tag LOCUS_00030 3994 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5188 4049 gene locus_tag LOCUS_00040 5188 4049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_00040 6437 5238 gene locus_tag LOCUS_00050 6437 5238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_00050 7527 6538 gene locus_tag LOCUS_00060 7527 6538 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_00060 9078 7702 gene locus_tag LOCUS_00070 9078 7702 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_00070 >Feature sequence003 2863 1061 gene locus_tag LOCUS_00080 2863 1061 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_00080 6041 2943 gene locus_tag LOCUS_00090 6041 2943 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_00090 >Feature sequence004 551 4534 gene locus_tag LOCUS_00100 551 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5614 4874 gene locus_tag LOCUS_00110 5614 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6457 5996 gene locus_tag LOCUS_00120 gene ndk 6457 5996 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_00120 6938 6747 gene locus_tag LOCUS_00130 6938 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 8273 6975 gene locus_tag LOCUS_00140 gene xseA 8273 6975 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_00140 >Feature sequence005 1554 4256 gene locus_tag LOCUS_00150 1554 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 4266 7595 gene locus_tag LOCUS_00160 4266 7595 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_00160 >Feature sequence006 1680 5072 gene locus_tag LOCUS_00170 1680 5072 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_00170 5155 6879 gene locus_tag LOCUS_00180 5155 6879 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840505.1 protein_id gnl|my_center|LOCUS_00180 >Feature sequence007 66 2600 gene locus_tag LOCUS_00190 66 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 2871 6416 gene locus_tag LOCUS_00200 2871 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence008 97 1695 gene locus_tag LOCUS_00210 97 1695 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840505.1 protein_id gnl|my_center|LOCUS_00210 1908 3761 gene locus_tag LOCUS_00220 1908 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 3794 5440 gene locus_tag LOCUS_00230 3794 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 >Feature sequence009 2025 157 gene locus_tag LOCUS_00240 2025 157 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_00240 3199 2114 gene locus_tag LOCUS_00250 3199 2114 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_00250 3627 4814 gene locus_tag LOCUS_00260 3627 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 5091 6401 gene locus_tag LOCUS_00270 5091 6401 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_00270 6555 6908 gene locus_tag LOCUS_00280 6555 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 >Feature sequence010 2135 528 gene locus_tag LOCUS_00290 2135 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 5324 2151 gene locus_tag LOCUS_00300 5324 2151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_00300 >Feature sequence011 1389 922 gene locus_tag LOCUS_00310 gene rimP 1389 922 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_00310 3588 1624 gene locus_tag LOCUS_00320 3588 1624 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_00320 4427 3657 gene locus_tag LOCUS_00330 4427 3657 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789811.1 protein_id gnl|my_center|LOCUS_00330 5593 4652 gene locus_tag LOCUS_00340 gene rsgA 5593 4652 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_00340 6250 5690 gene locus_tag LOCUS_00350 gene frr 6250 5690 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_00350 6534 6304 gene locus_tag LOCUS_00360 6534 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 >Feature sequence012 237 1172 gene locus_tag LOCUS_00370 gene ribD 237 1172 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_00370 1452 2792 gene locus_tag LOCUS_00380 1452 2792 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108950.1 protein_id gnl|my_center|LOCUS_00380 2896 3537 gene locus_tag LOCUS_00390 2896 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 3551 4303 gene locus_tag LOCUS_00400 3551 4303 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence013 >Feature sequence014 1911 820 gene locus_tag LOCUS_00410 1911 820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_00410 3038 1992 gene locus_tag LOCUS_00420 3038 1992 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_00420 3588 3082 gene locus_tag LOCUS_00430 3588 3082 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_00430 >Feature sequence015 3389 2091 gene locus_tag LOCUS_00440 3389 2091 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_00440 4622 3477 gene locus_tag LOCUS_00450 gene dnaJ 4622 3477 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_00450 5215 4646 gene locus_tag LOCUS_00460 5215 4646 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_00460 <6149 5349 gene locus_tag LOCUS_00470 <6149 5349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788814.1:diaminopimelate decarboxylase >Feature sequence016 1039 3630 gene locus_tag LOCUS_00480 1039 3630 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_00480 3686 4549 gene locus_tag LOCUS_00490 3686 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 >Feature sequence017 2242 1325 gene locus_tag LOCUS_00500 2242 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 2876 2346 gene locus_tag LOCUS_00510 2876 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3860 2889 gene locus_tag LOCUS_00520 3860 2889 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765453.1 protein_id gnl|my_center|LOCUS_00520 5265 3907 gene locus_tag LOCUS_00530 gene argH 5265 3907 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_00530 5774 5301 gene locus_tag LOCUS_00540 5774 5301 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence018 251 2758 gene locus_tag LOCUS_00550 gene pheT 251 2758 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_00550 2958 3689 gene locus_tag LOCUS_00560 2958 3689 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_00560 3803 4060 gene locus_tag LOCUS_00570 3803 4060 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_00570 4086 4493 gene locus_tag LOCUS_00580 4086 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 <5936 4605 gene locus_tag LOCUS_00590 <5936 4605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202229.1:DUF4270 domain-containing protein >Feature sequence019 <1 691 gene locus_tag LOCUS_00600 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783919.1:transcription termination factor NusA 764 3805 gene locus_tag LOCUS_00610 gene infB 764 3805 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_00610 3932 4465 gene locus_tag LOCUS_00620 3932 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 4484 5923 gene locus_tag LOCUS_00630 gene sufB 4484 5923 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence020 3024 769 gene locus_tag LOCUS_00640 3024 769 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_00640 4243 3119 gene locus_tag LOCUS_00650 4243 3119 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_00650 >Feature sequence021 165 2177 gene locus_tag LOCUS_00660 165 2177 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761944.1 protein_id gnl|my_center|LOCUS_00660 2279 4993 gene locus_tag LOCUS_00670 2279 4993 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence022 2826 3875 gene locus_tag LOCUS_00680 gene lpxD 2826 3875 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_00680 4052 5431 gene locus_tag LOCUS_00690 4052 5431 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_00690 >Feature sequence023 1617 178 gene locus_tag LOCUS_00700 1617 178 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_00700 1853 1629 gene locus_tag LOCUS_00710 1853 1629 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_00710 2369 1890 gene locus_tag LOCUS_00720 2369 1890 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256136.1 protein_id gnl|my_center|LOCUS_00720 3317 2373 gene locus_tag LOCUS_00730 gene cysK 3317 2373 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_00730 3703 3314 gene locus_tag LOCUS_00740 3703 3314 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_00740 4532 3726 gene locus_tag LOCUS_00750 gene moeB 4532 3726 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_00750 4824 4612 gene locus_tag LOCUS_00760 gene thiS 4824 4612 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence024 665 937 gene locus_tag LOCUS_00770 665 937 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_00770 955 2328 gene locus_tag LOCUS_00780 955 2328 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_00780 3000 2332 gene locus_tag LOCUS_00790 3000 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4146 3004 gene locus_tag LOCUS_00800 4146 3004 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_00800 5202 4201 gene locus_tag LOCUS_00810 5202 4201 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_00810 >Feature sequence025 2575 4461 gene locus_tag LOCUS_00820 gene mnmG 2575 4461 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_00820 4533 5063 gene locus_tag LOCUS_00830 4533 5063 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence026 336 1769 gene locus_tag LOCUS_00840 336 1769 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865516.1 protein_id gnl|my_center|LOCUS_00840 1900 4038 gene locus_tag LOCUS_00850 1900 4038 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_00850 >Feature sequence027 4598 519 gene locus_tag LOCUS_00860 4598 519 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_00860 4825 5013 gene locus_tag LOCUS_00870 4825 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 >Feature sequence028 778 245 gene locus_tag LOCUS_00880 778 245 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_00880 1909 980 gene locus_tag LOCUS_00890 1909 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 2505 3575 gene locus_tag LOCUS_00900 2505 3575 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence029 3672 232 gene locus_tag LOCUS_00910 3672 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 >Feature sequence030 1581 157 gene locus_tag LOCUS_00920 gene gldK 1581 157 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_00920 2686 1733 gene locus_tag LOCUS_00930 2686 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence031 1145 90 gene locus_tag LOCUS_00940 1145 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 1602 1156 gene locus_tag LOCUS_00950 1602 1156 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_00950 2226 1606 gene locus_tag LOCUS_00960 2226 1606 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_00960 2965 2252 gene locus_tag LOCUS_00970 2965 2252 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_00970 3171 4058 gene locus_tag LOCUS_00980 3171 4058 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence032 1699 380 gene locus_tag LOCUS_00990 gene ftsZ 1699 380 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_00990 3382 1760 gene locus_tag LOCUS_01000 gene ftsA 3382 1760 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_01000 4245 3457 gene locus_tag LOCUS_01010 4245 3457 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence033 1460 606 gene locus_tag LOCUS_01020 1460 606 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_01020 2602 1583 gene locus_tag LOCUS_01030 2602 1583 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_01030 3210 2605 gene locus_tag LOCUS_01040 3210 2605 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_01040 3331 4707 gene locus_tag LOCUS_01050 gene pdxB 3331 4707 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence034 <1 1267 gene locus_tag LOCUS_01060 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795491.1:ferrous iron transport protein B 1396 1322 gene locus_tag LOCUS_t00010 1396 1322 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1824 2474 gene locus_tag LOCUS_01070 1824 2474 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_01070 2520 3854 gene locus_tag LOCUS_01080 gene ffh 2520 3854 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_01080 3882 4763 gene locus_tag LOCUS_01090 gene folD 3882 4763 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_01090 >Feature sequence035 223 918 gene locus_tag LOCUS_01100 223 918 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_01100 960 1484 gene locus_tag LOCUS_01110 960 1484 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_01110 4521 1927 gene locus_tag LOCUS_01120 4521 1927 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence036 <1 2140 gene locus_tag LOCUS_01130 <1 2140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203588.1:translocation/assembly module TamB domain-containing protein 2353 4734 gene locus_tag LOCUS_01140 2353 4734 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence037 958 659 gene locus_tag LOCUS_01150 958 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 1801 1031 gene locus_tag LOCUS_01160 1801 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109226.1 protein_id gnl|my_center|LOCUS_01160 2827 1847 gene locus_tag LOCUS_01170 gene mltG 2827 1847 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_01170 >Feature sequence038 1242 2021 gene locus_tag LOCUS_01180 1242 2021 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_01180 3345 2179 gene locus_tag LOCUS_01190 3345 2179 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_01190 3789 3361 gene locus_tag LOCUS_01200 3789 3361 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_01200 4782 3823 gene locus_tag LOCUS_01210 4782 3823 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence039 3356 303 gene locus_tag LOCUS_01220 3356 303 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764385.1 protein_id gnl|my_center|LOCUS_01220 <4772 3634 gene locus_tag LOCUS_01230 <4772 3634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202172.1:DUF6057 family protein >Feature sequence040 913 440 gene locus_tag LOCUS_01240 gene mreD 913 440 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_01240 1853 993 gene locus_tag LOCUS_01250 gene mreC 1853 993 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_01250 2880 1855 gene locus_tag LOCUS_01260 2880 1855 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_01260 3608 3018 gene locus_tag LOCUS_01270 3608 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence041 391 2070 gene locus_tag LOCUS_01280 391 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2143 2910 gene locus_tag LOCUS_01290 2143 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2955 3611 gene locus_tag LOCUS_01300 2955 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence042 1870 3237 gene locus_tag LOCUS_01310 1870 3237 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_01310 3390 4232 gene locus_tag LOCUS_01320 gene kduI 3390 4232 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence043 379 140 gene locus_tag LOCUS_01330 379 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 1644 523 gene locus_tag LOCUS_01340 1644 523 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109277.1 protein_id gnl|my_center|LOCUS_01340 2071 3159 gene locus_tag LOCUS_01350 2071 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence044 <1 3633 gene locus_tag LOCUS_01360 <1 3633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992104.1:glycoside hydrolase 43 family protein 3926 4372 gene locus_tag LOCUS_01370 3926 4372 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765741.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence045 156 1118 gene locus_tag LOCUS_01380 156 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 1311 2777 gene locus_tag LOCUS_01390 1311 2777 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence046 323 1783 gene locus_tag LOCUS_01400 323 1783 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_01400 >Feature sequence047 <1 880 gene locus_tag LOCUS_01410 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767049.1:beta-galactosidase 1258 2445 gene locus_tag LOCUS_01420 1258 2445 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_01420 2678 4525 gene locus_tag LOCUS_01430 gene glmS 2678 4525 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence048 1259 18 gene locus_tag LOCUS_01440 1259 18 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_01440 2574 1336 gene locus_tag LOCUS_01450 gene serB 2574 1336 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793930.1 protein_id gnl|my_center|LOCUS_01450 3674 2676 gene locus_tag LOCUS_01460 3674 2676 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_01460 4025 4342 gene locus_tag LOCUS_01470 4025 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence049 4087 989 gene locus_tag LOCUS_01480 4087 989 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence050 154 2601 gene locus_tag LOCUS_01490 154 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 2638 3756 gene locus_tag LOCUS_01500 2638 3756 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202735.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence051 2365 596 gene locus_tag LOCUS_01510 2365 596 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_01510 3877 2411 gene locus_tag LOCUS_01520 gene xylE 3877 2411 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_01520 <4463 3886 gene locus_tag LOCUS_01530 <4463 3886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108866.1:galactose mutarotase >Feature sequence052 1070 4348 gene locus_tag LOCUS_01540 1070 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 >Feature sequence053 3222 2536 gene locus_tag LOCUS_01550 3222 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence054 4147 2363 gene locus_tag LOCUS_01560 4147 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence055 <1 1274 gene locus_tag LOCUS_01570 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987091.1:NAD-dependent dihydropyrimidine dehydrogenase subunit PreA 1555 2091 gene locus_tag LOCUS_01580 1555 2091 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796886.1 protein_id gnl|my_center|LOCUS_01580 2179 3120 gene locus_tag LOCUS_01590 2179 3120 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence056 421 1584 gene locus_tag LOCUS_01600 gene cobT 421 1584 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067582.1 protein_id gnl|my_center|LOCUS_01600 1720 2532 gene locus_tag LOCUS_01610 1720 2532 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292396.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence057 >Feature sequence058 773 81 gene locus_tag LOCUS_01620 773 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 <4367 915 gene locus_tag LOCUS_01630 <4367 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767789.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence059 2964 514 gene locus_tag LOCUS_01640 2964 514 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762569.1 protein_id gnl|my_center|LOCUS_01640 3631 3170 gene locus_tag LOCUS_01650 3631 3170 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_01650 3976 3770 gene locus_tag LOCUS_01660 3976 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence060 2146 116 gene locus_tag LOCUS_01670 gene uvrB 2146 116 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_01670 2340 3146 gene locus_tag LOCUS_01680 gene bamD 2340 3146 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_01680 3183 3518 gene locus_tag LOCUS_01690 3183 3518 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_01690 3524 4039 gene locus_tag LOCUS_01700 3524 4039 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_01700 4191 4264 gene locus_tag LOCUS_t00020 4191 4264 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 1489 491 gene locus_tag LOCUS_01710 1489 491 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_01710 1703 2539 gene locus_tag LOCUS_01720 1703 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2721 4085 gene locus_tag LOCUS_01730 gene rlmD 2721 4085 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence062 2349 25 gene locus_tag LOCUS_01740 2349 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 2796 4157 gene locus_tag LOCUS_01750 2796 4157 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence063 <1 972 gene locus_tag LOCUS_01760 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583217.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1189 1902 gene locus_tag LOCUS_01770 1189 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2093 3094 gene locus_tag LOCUS_01780 2093 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 >Feature sequence064 1157 909 gene locus_tag LOCUS_01790 1157 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1593 4076 gene locus_tag LOCUS_01800 1593 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence065 180 2429 gene locus_tag LOCUS_01810 180 2429 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786012.1 protein_id gnl|my_center|LOCUS_01810 <4273 2587 gene locus_tag LOCUS_01820 <4273 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626185.1:AMP-binding protein >Feature sequence066 1349 372 gene locus_tag LOCUS_01830 1349 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 1889 1395 gene locus_tag LOCUS_01840 1889 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2080 2886 gene locus_tag LOCUS_01850 2080 2886 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_01850 2938 3567 gene locus_tag LOCUS_01860 gene rsmG 2938 3567 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817853.1 protein_id gnl|my_center|LOCUS_01860 3571 4227 gene locus_tag LOCUS_01870 3571 4227 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence067 1012 266 gene locus_tag LOCUS_01880 1012 266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_01880 1182 2033 gene locus_tag LOCUS_01890 gene lptB 1182 2033 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_01890 2111 4114 gene locus_tag LOCUS_01900 2111 4114 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence068 2724 1486 gene locus_tag LOCUS_01910 2724 1486 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_01910 3022 3636 gene locus_tag LOCUS_01920 gene udk 3022 3636 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_01920 3849 4061 gene locus_tag LOCUS_01930 3849 4061 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence069 <1 1823 gene locus_tag LOCUS_01940 <1 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766196.1:xanthan lyase 1890 2189 gene locus_tag LOCUS_01950 1890 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_01950 2217 4094 gene locus_tag LOCUS_01960 2217 4094 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence070 653 288 gene locus_tag LOCUS_01970 653 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1105 650 gene locus_tag LOCUS_01980 1105 650 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_01980 1330 3258 gene locus_tag LOCUS_01990 gene yidC 1330 3258 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence071 913 2157 gene locus_tag LOCUS_02000 913 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2368 4089 gene locus_tag LOCUS_02010 2368 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence072 161 1633 gene locus_tag LOCUS_02020 161 1633 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767799.1 protein_id gnl|my_center|LOCUS_02020 2045 2485 gene locus_tag LOCUS_02030 2045 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2897 2625 gene locus_tag LOCUS_02040 2897 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence073 66 335 gene locus_tag LOCUS_02050 gene rpsS 66 335 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_02050 390 773 gene locus_tag LOCUS_02060 gene rplV 390 773 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_02060 776 1510 gene locus_tag LOCUS_02070 gene rpsC 776 1510 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_02070 1525 1959 gene locus_tag LOCUS_02080 gene rplP 1525 1959 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_02080 1962 2156 gene locus_tag LOCUS_02090 gene rpmC 1962 2156 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_02090 2159 2425 gene locus_tag LOCUS_02100 gene rpsQ 2159 2425 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_02100 2429 2794 gene locus_tag LOCUS_02110 gene rplN 2429 2794 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_02110 2818 3135 gene locus_tag LOCUS_02120 gene rplX 2818 3135 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_02120 3135 3689 gene locus_tag LOCUS_02130 gene rplE 3135 3689 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_02130 3700 3999 gene locus_tag LOCUS_02140 gene rpsN 3700 3999 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762042.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence074 >Feature sequence075 104 1450 gene locus_tag LOCUS_02150 104 1450 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788965.1 protein_id gnl|my_center|LOCUS_02150 1463 2350 gene locus_tag LOCUS_02160 1463 2350 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766201.1 protein_id gnl|my_center|LOCUS_02160 2559 3746 gene locus_tag LOCUS_02170 2559 3746 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766203.1 protein_id gnl|my_center|LOCUS_02170 >Feature sequence076 2 1615 gene locus_tag LOCUS_02180 2 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 1964 3163 gene locus_tag LOCUS_02190 1964 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence077 1571 999 gene locus_tag LOCUS_02200 1571 999 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_02200 2217 1648 gene locus_tag LOCUS_02210 2217 1648 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_02210 <4022 2222 gene locus_tag LOCUS_02220 <4022 2222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814911.1:phosphoribosylformylglycinamidine synthase >Feature sequence078 435 2648 gene locus_tag LOCUS_02230 435 2648 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107937.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence079 1147 1857 gene locus_tag LOCUS_02240 1147 1857 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762407.1 protein_id gnl|my_center|LOCUS_02240 1841 2842 gene locus_tag LOCUS_02250 gene murB 1841 2842 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_02250 2995 3780 gene locus_tag LOCUS_02260 2995 3780 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence080 3978 196 gene locus_tag LOCUS_02270 3978 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 >Feature sequence081 1709 972 gene locus_tag LOCUS_02280 1709 972 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_02280 1985 3775 gene locus_tag LOCUS_02290 gene rpsA 1985 3775 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence082 >Feature sequence083 <1 527 gene locus_tag LOCUS_02300 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765688.1:DEAD/DEAH box helicase 496 1212 gene locus_tag LOCUS_02310 496 1212 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_02310 1282 2616 gene locus_tag LOCUS_02320 1282 2616 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_02320 2710 3321 gene locus_tag LOCUS_02330 gene lptC 2710 3321 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence084 >Feature sequence085 2891 1368 gene locus_tag LOCUS_02340 2891 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 <3926 2894 gene locus_tag LOCUS_02350 <3926 2894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203753.1:leucine--tRNA ligase >Feature sequence086 453 1514 gene locus_tag LOCUS_02360 453 1514 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_02360 1580 2146 gene locus_tag LOCUS_02370 1580 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2250 2176 gene locus_tag LOCUS_t00030 2250 2176 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3093 2398 gene locus_tag LOCUS_02380 gene trmD 3093 2398 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence087 951 88 gene locus_tag LOCUS_02390 951 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1354 1034 gene locus_tag LOCUS_02400 1354 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1852 1379 gene locus_tag LOCUS_02410 gene rnpA 1852 1379 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_02410 2629 1874 gene locus_tag LOCUS_02420 2629 1874 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence088 2381 243 gene locus_tag LOCUS_02430 2381 243 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767003.1 protein_id gnl|my_center|LOCUS_02430 <3918 2608 gene locus_tag LOCUS_02440 <3918 2608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767002.1:glycoside hydrolase family 13 protein >Feature sequence089 <1 969 gene locus_tag LOCUS_02450 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043943600.1:ABC transporter ATP-binding protein 2491 980 gene locus_tag LOCUS_02460 2491 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3552 2773 gene locus_tag LOCUS_02470 3552 2773 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence090 394 3186 gene locus_tag LOCUS_02480 394 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence091 1898 2962 gene locus_tag LOCUS_02490 1898 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 >Feature sequence092 378 1076 gene locus_tag LOCUS_02500 378 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1435 1752 gene locus_tag LOCUS_02510 gene rplU 1435 1752 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_02510 1779 2042 gene locus_tag LOCUS_02520 gene rpmA 1779 2042 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_02520 2162 2422 gene locus_tag LOCUS_02530 gene rpmB 2162 2422 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_02530 2449 2637 gene locus_tag LOCUS_02540 gene rpmG 2449 2637 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_02540 2650 2805 gene locus_tag LOCUS_02550 2650 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence093 1119 2660 gene locus_tag LOCUS_02560 1119 2660 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107987.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence094 1726 2604 gene locus_tag LOCUS_02570 1726 2604 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence095 1729 209 gene locus_tag LOCUS_02580 1729 209 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence096 3758 729 gene locus_tag LOCUS_02590 3758 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence097 1011 64 gene locus_tag LOCUS_02600 gene xerD 1011 64 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_02600 1303 1743 gene locus_tag LOCUS_02610 gene aroQ 1303 1743 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_02610 1757 2476 gene locus_tag LOCUS_02620 1757 2476 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_02620 2574 2909 gene locus_tag LOCUS_02630 gene rbfA 2574 2909 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence098 <1 1010 gene locus_tag LOCUS_02640 <1 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763207.1:tetratricopeptide repeat protein 1117 1992 gene locus_tag LOCUS_02650 1117 1992 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence099 <1 869 gene locus_tag LOCUS_02660 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109157.1:right-handed parallel beta-helix repeat-containing protein 2304 1006 gene locus_tag LOCUS_02670 2304 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3169 2549 gene locus_tag LOCUS_02680 gene pnuC 3169 2549 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_02680 <3808 3279 gene locus_tag LOCUS_02690 <3808 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108276.1:TonB-dependent receptor >Feature sequence100 271 2799 gene locus_tag LOCUS_02700 271 2799 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_02700 3302 2796 gene locus_tag LOCUS_02710 3302 2796 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence101 2835 373 gene locus_tag LOCUS_02720 2835 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3715 2840 gene locus_tag LOCUS_02730 3715 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence102 197 2788 gene locus_tag LOCUS_02740 197 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence103 223 456 gene locus_tag LOCUS_02750 223 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1183 413 gene locus_tag LOCUS_02760 1183 413 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_02760 1469 3676 gene locus_tag LOCUS_02770 1469 3676 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence104 <1 1439 gene locus_tag LOCUS_02780 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767782.1:DUF4980 domain-containing protein 1495 3162 gene locus_tag LOCUS_02790 1495 3162 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence105 1057 128 gene locus_tag LOCUS_02800 1057 128 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_02800 2339 1194 gene locus_tag LOCUS_02810 2339 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3581 2685 gene locus_tag LOCUS_02820 3581 2685 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789684.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence106 >Feature sequence107 243 169 gene locus_tag LOCUS_t00040 243 169 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 975 337 gene locus_tag LOCUS_02830 975 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2247 1465 gene locus_tag LOCUS_02840 2247 1465 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence108 <1 951 gene locus_tag LOCUS_02850 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103036562.1:TonB-dependent receptor 995 2539 gene locus_tag LOCUS_02860 995 2539 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659443.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence109 642 1142 gene locus_tag LOCUS_02870 642 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1132 1347 gene locus_tag LOCUS_02880 1132 1347 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_02880 1505 2122 gene locus_tag LOCUS_02890 1505 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2318 3205 gene locus_tag LOCUS_02900 2318 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence110 <1 1956 gene locus_tag LOCUS_02910 <1 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016266957.1:TonB-dependent receptor >Feature sequence111 2563 1493 gene locus_tag LOCUS_02920 2563 1493 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767048.1 protein_id gnl|my_center|LOCUS_02920 3459 3031 gene locus_tag LOCUS_02930 3459 3031 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence112 404 1117 gene locus_tag LOCUS_02940 404 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 <3670 1274 gene locus_tag LOCUS_02950 <3670 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017598384.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence113 918 61 gene locus_tag LOCUS_02960 918 61 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_02960 1372 2028 gene locus_tag LOCUS_02970 1372 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence114 83 577 gene locus_tag LOCUS_02980 83 577 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_02980 1062 604 gene locus_tag LOCUS_02990 1062 604 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759987.1 protein_id gnl|my_center|LOCUS_02990 1819 1112 gene locus_tag LOCUS_03000 1819 1112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_03000 2654 1869 gene locus_tag LOCUS_03010 2654 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03010 3383 2664 gene locus_tag LOCUS_03020 3383 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03020 >Feature sequence115 >Feature sequence116 <1 3153 gene locus_tag LOCUS_03030 <1 3153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766732.1:alginate lyase family protein 3367 3206 gene locus_tag LOCUS_03040 3367 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 >Feature sequence117 2517 484 gene locus_tag LOCUS_03050 2517 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 <3636 2527 gene locus_tag LOCUS_03060 <3636 2527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764385.1:TonB-dependent receptor >Feature sequence118 363 3371 gene locus_tag LOCUS_03070 363 3371 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence119 2359 305 gene locus_tag LOCUS_03080 2359 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 <3611 2410 gene locus_tag LOCUS_03090 <3611 2410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840505.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence120 627 31 gene locus_tag LOCUS_03100 gene ruvC 627 31 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062938.1 protein_id gnl|my_center|LOCUS_03100 1081 776 gene locus_tag LOCUS_03110 1081 776 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203211.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence121 642 127 gene locus_tag LOCUS_03120 642 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1144 755 gene locus_tag LOCUS_03130 1144 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109213.1 protein_id gnl|my_center|LOCUS_03130 1763 1272 gene locus_tag LOCUS_03140 1763 1272 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_03140 2187 1927 gene locus_tag LOCUS_03150 2187 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3370 2456 gene locus_tag LOCUS_03160 3370 2456 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence122 833 36 gene locus_tag LOCUS_03170 833 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1076 2200 gene locus_tag LOCUS_03180 1076 2200 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_03180 3309 2221 gene locus_tag LOCUS_03190 3309 2221 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_03190 3594 3475 gene locus_tag LOCUS_03200 3594 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence123 >Feature sequence124 2164 3345 gene locus_tag LOCUS_03210 2164 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence125 189 1097 gene locus_tag LOCUS_03220 189 1097 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence126 394 1095 gene locus_tag LOCUS_03230 394 1095 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_03230 3406 1139 gene locus_tag LOCUS_03240 3406 1139 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence127 72 1832 gene locus_tag LOCUS_03250 72 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 <3568 2190 gene locus_tag LOCUS_03260 <3568 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203451.1:patatin-like phospholipase family protein >Feature sequence128 2965 764 gene locus_tag LOCUS_03270 2965 764 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence129 >Feature sequence130 <1 890 gene locus_tag LOCUS_03280 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870178.1:glycyl radical protein 877 1752 gene locus_tag LOCUS_03290 877 1752 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_03290 1942 2223 gene locus_tag LOCUS_03300 1942 2223 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871355.1 protein_id gnl|my_center|LOCUS_03300 2220 2561 gene locus_tag LOCUS_03310 2220 2561 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_03310 2558 2953 gene locus_tag LOCUS_03320 2558 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2969 3493 gene locus_tag LOCUS_03330 2969 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence131 <3547 294 gene locus_tag LOCUS_03340 <3547 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126140198.1:pectinesterase family protein >Feature sequence132 914 1750 gene locus_tag LOCUS_03350 914 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 1909 1837 gene locus_tag LOCUS_t00050 1909 1837 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3362 2169 gene locus_tag LOCUS_03360 3362 2169 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence133 402 1004 gene locus_tag LOCUS_03370 gene rsxA 402 1004 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_03370 2065 1301 gene locus_tag LOCUS_03380 2065 1301 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_03380 <3533 2223 gene locus_tag LOCUS_03390 <3533 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107905.1:RNase adapter RapZ >Feature sequence134 641 342 gene locus_tag LOCUS_03400 641 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1042 3471 gene locus_tag LOCUS_03410 1042 3471 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence135 189 2501 gene locus_tag LOCUS_03420 189 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 2753 3094 gene locus_tag LOCUS_03430 2753 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence136 2049 874 gene locus_tag LOCUS_03440 2049 874 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence137 1518 649 gene locus_tag LOCUS_03450 1518 649 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_03450 3152 1602 gene locus_tag LOCUS_03460 gene atpA 3152 1602 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence138 <1 967 gene locus_tag LOCUS_03470 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765321.1:TonB-dependent receptor 1182 2474 gene locus_tag LOCUS_03480 gene purD 1182 2474 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_03480 2576 3439 gene locus_tag LOCUS_03490 2576 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence139 <1 2428 gene locus_tag LOCUS_03500 <1 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:TonB-dependent receptor >Feature sequence140 >Feature sequence141 1798 1379 gene locus_tag LOCUS_03510 1798 1379 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence142 424 1377 gene locus_tag LOCUS_03520 424 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 1539 2219 gene locus_tag LOCUS_03530 1539 2219 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783846.1 protein_id gnl|my_center|LOCUS_03530 2216 3088 gene locus_tag LOCUS_03540 2216 3088 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence143 >Feature sequence144 <1 990 gene locus_tag LOCUS_03550 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792061.1:rod shape-determining protein RodA 2379 1003 gene locus_tag LOCUS_03560 2379 1003 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_03560 <3390 2419 gene locus_tag LOCUS_03570 <3390 2419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762587.1:sodium-dependent transporter >Feature sequence145 725 117 gene locus_tag LOCUS_03580 725 117 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766210.1 protein_id gnl|my_center|LOCUS_03580 1029 1104 gene locus_tag LOCUS_t00060 1029 1104 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1234 1539 gene locus_tag LOCUS_03590 1234 1539 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_03590 1604 2038 gene locus_tag LOCUS_03600 1604 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence146 434 1210 gene locus_tag LOCUS_03610 434 1210 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_03610 1293 2612 gene locus_tag LOCUS_03620 1293 2612 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence147 <1 1596 gene locus_tag LOCUS_03630 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791792.1:OmpA family protein 2211 1717 gene locus_tag LOCUS_03640 2211 1717 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_03640 2782 2375 gene locus_tag LOCUS_03650 2782 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 3283 2891 gene locus_tag LOCUS_03660 3283 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence148 227 544 gene locus_tag LOCUS_03670 gene rhaM 227 544 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_03670 812 3181 gene locus_tag LOCUS_03680 gene pnp 812 3181 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765197.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence149 <1 1307 gene locus_tag LOCUS_03690 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107599.1:UvrD-helicase domain-containing protein 1393 2943 gene locus_tag LOCUS_03700 1393 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence150 546 1808 gene locus_tag LOCUS_03710 546 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 <3372 1850 gene locus_tag LOCUS_03720 <3372 1850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783855.1:ABC transporter ATP-binding protein >Feature sequence151 982 83 gene locus_tag LOCUS_03730 982 83 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_03730 <3366 1318 gene locus_tag LOCUS_03740 <3366 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765303.1:protein translocase subunit SecDF >Feature sequence152 <1 623 gene locus_tag LOCUS_03750 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762875.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 723 1259 gene locus_tag LOCUS_03760 723 1259 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_03760 1393 3210 gene locus_tag LOCUS_03770 gene uvrC 1393 3210 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence153 >Feature sequence154 592 1113 gene locus_tag LOCUS_03780 592 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1129 2022 gene locus_tag LOCUS_03790 1129 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 <3347 2050 gene locus_tag LOCUS_03800 <3347 2050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791792.1:OmpA family protein >Feature sequence155 3295 3047 gene locus_tag LOCUS_03810 3295 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence156 1260 22 gene locus_tag LOCUS_03820 1260 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2036 1281 gene locus_tag LOCUS_03830 2036 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence157 2747 1092 gene locus_tag LOCUS_03840 2747 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 <3319 2762 gene locus_tag LOCUS_03850 <3319 2762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962444.1:two-component regulator propeller domain-containing protein >Feature sequence158 3 145 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcttcggcaaaaccgaagc 204 1757 gene locus_tag LOCUS_03860 204 1757 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_03860 1818 2249 gene locus_tag LOCUS_03870 gene tsaE 1818 2249 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence159 403 1779 gene locus_tag LOCUS_03880 403 1779 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_03880 <3307 1886 gene locus_tag LOCUS_03890 <3307 1886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813223.1:PD40 domain-containing protein >Feature sequence160 1473 226 gene locus_tag LOCUS_03900 1473 226 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_03900 1644 3116 gene locus_tag LOCUS_03910 1644 3116 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence161 2556 1504 gene locus_tag LOCUS_03920 2556 1504 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762064.1 protein_id gnl|my_center|LOCUS_03920 <3293 2628 gene locus_tag LOCUS_03930 <3293 2628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762063.1:TolC family protein >Feature sequence162 487 3093 gene locus_tag LOCUS_03940 487 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence163 1032 319 gene locus_tag LOCUS_03950 1032 319 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_03950 2465 1227 gene locus_tag LOCUS_03960 2465 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence164 788 2233 gene locus_tag LOCUS_03970 788 2233 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence165 1406 123 gene locus_tag LOCUS_03980 1406 123 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_03980 1669 1596 gene locus_tag LOCUS_t00070 1669 1596 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2299 1826 gene locus_tag LOCUS_03990 gene nrdG 2299 1826 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_03990 3266 2367 gene locus_tag LOCUS_04000 3266 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence166 752 222 gene locus_tag LOCUS_04010 752 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108812.1 protein_id gnl|my_center|LOCUS_04010 1345 851 gene locus_tag LOCUS_04020 1345 851 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_04020 2747 1488 gene locus_tag LOCUS_04030 2747 1488 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence167 1 495 gene locus_tag LOCUS_04040 1 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 756 1028 gene locus_tag LOCUS_04050 756 1028 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_04050 1057 2682 gene locus_tag LOCUS_04060 gene groL 1057 2682 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_04060 2819 3244 gene locus_tag LOCUS_04070 2819 3244 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence168 1760 1422 gene locus_tag LOCUS_04080 1760 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784743.1 protein_id gnl|my_center|LOCUS_04080 2176 1868 gene locus_tag LOCUS_04090 gene trxA 2176 1868 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence169 2345 1017 gene locus_tag LOCUS_04100 gene sufD 2345 1017 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201910.1 protein_id gnl|my_center|LOCUS_04100 3094 2342 gene locus_tag LOCUS_04110 gene sufC 3094 2342 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence170 <1 793 gene locus_tag LOCUS_04120 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761942.1:RagB/SusD family nutrient uptake outer membrane protein 825 2342 gene locus_tag LOCUS_04130 825 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence171 760 59 gene locus_tag LOCUS_04140 760 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1634 912 gene locus_tag LOCUS_04150 1634 912 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_04150 <3246 1823 gene locus_tag LOCUS_04160 <3246 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107427.1:DUF5113 domain-containing protein >Feature sequence172 <1 587 gene locus_tag LOCUS_04170 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788686.1:YggS family pyridoxal phosphate-dependent enzyme 624 1199 gene locus_tag LOCUS_04180 624 1199 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_04180 1330 2847 gene locus_tag LOCUS_04190 1330 2847 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203395.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence173 425 2572 gene locus_tag LOCUS_04200 425 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence174 >Feature sequence175 568 1047 gene locus_tag LOCUS_04210 568 1047 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_04210 1053 1613 gene locus_tag LOCUS_04220 gene folE 1053 1613 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence176 110 868 gene locus_tag LOCUS_04230 110 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 948 1133 gene locus_tag LOCUS_04240 948 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1492 2352 gene locus_tag LOCUS_04250 1492 2352 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_04250 2458 2652 gene locus_tag LOCUS_04260 2458 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence177 <1 1500 gene locus_tag LOCUS_04270 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203587.1:BamA/TamA family outer membrane protein 3079 1511 gene locus_tag LOCUS_04280 3079 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence178 >Feature sequence179 >Feature sequence180 <1 609 gene locus_tag LOCUS_04290 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788239.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit 725 2353 gene locus_tag LOCUS_04300 gene asnB 725 2353 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence181 <1 1272 gene locus_tag LOCUS_04310 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303124.1:glycoside hydrolase family 31 protein 1486 2469 gene locus_tag LOCUS_04320 1486 2469 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence182 1875 2324 gene locus_tag LOCUS_04330 1875 2324 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_04330 2464 3120 gene locus_tag LOCUS_04340 2464 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence183 457 1668 gene locus_tag LOCUS_04350 gene nspC 457 1668 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_04350 2247 1774 gene locus_tag LOCUS_04360 2247 1774 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766080.1 protein_id gnl|my_center|LOCUS_04360 2457 2702 gene locus_tag LOCUS_04370 2457 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2717 3091 gene locus_tag LOCUS_04380 2717 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence184 <3166 479 gene locus_tag LOCUS_04390 <3166 479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108938.1:TonB-dependent receptor >Feature sequence185 1875 1081 gene locus_tag LOCUS_04400 1875 1081 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_04400 2600 1926 gene locus_tag LOCUS_04410 gene ilvN 2600 1926 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790699.1 protein_id gnl|my_center|LOCUS_04410 <3155 2625 gene locus_tag LOCUS_04420 <3155 2625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761034.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence186 1713 190 gene locus_tag LOCUS_04430 1713 190 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_04430 <3153 1886 gene locus_tag LOCUS_04440 <3153 1886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202547.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence187 310 1440 gene locus_tag LOCUS_04450 310 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 <3145 1928 gene locus_tag LOCUS_04460 <3145 1928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582688.1:glycosyl hydrolase >Feature sequence188 718 2355 gene locus_tag LOCUS_04470 718 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2726 2813 gene locus_tag LOCUS_t00080 2726 2813 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence189 1673 54 gene locus_tag LOCUS_04480 1673 54 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_04480 1815 2504 gene locus_tag LOCUS_04490 1815 2504 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence190 288 2156 gene locus_tag LOCUS_04500 288 2156 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_04500 2153 2902 gene locus_tag LOCUS_04510 2153 2902 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence191 1315 2637 gene locus_tag LOCUS_04520 gene miaB 1315 2637 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence192 1601 888 gene locus_tag LOCUS_04530 1601 888 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765262.1 protein_id gnl|my_center|LOCUS_04530 2506 1598 gene locus_tag LOCUS_04540 2506 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 <3099 2574 gene locus_tag LOCUS_04550 <3099 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762936.1:carbohydrate-binding family 9-like protein >Feature sequence193 <1 1346 gene locus_tag LOCUS_04560 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791939.1:tetratricopeptide repeat protein 1596 2522 gene locus_tag LOCUS_04570 1596 2522 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765298.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence194 1109 162 gene locus_tag LOCUS_04580 1109 162 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_04580 2079 1222 gene locus_tag LOCUS_04590 2079 1222 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_04590 <3096 2275 gene locus_tag LOCUS_04600 <3096 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796251.1:TonB-dependent receptor >Feature sequence195 1975 695 gene locus_tag LOCUS_04610 1975 695 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_04610 <3095 2025 gene locus_tag LOCUS_04620 <3095 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108473.1:sigma-70 family RNA polymerase sigma factor >Feature sequence196 1182 172 gene locus_tag LOCUS_04630 1182 172 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence197 <1 876 gene locus_tag LOCUS_04640 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016266957.1:TonB-dependent receptor 889 2616 gene locus_tag LOCUS_04650 889 2616 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence198 1833 841 gene locus_tag LOCUS_04660 1833 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence199 1491 892 gene locus_tag LOCUS_04670 1491 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2891 1608 gene locus_tag LOCUS_04680 2891 1608 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence200 <1 1534 gene locus_tag LOCUS_04690 <1 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203062.1:GldM family protein 1670 2878 gene locus_tag LOCUS_04700 1670 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence201 2188 266 gene locus_tag LOCUS_04710 2188 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence202 >Feature sequence203 1164 541 gene locus_tag LOCUS_04720 1164 541 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_04720 2099 1161 gene locus_tag LOCUS_04730 2099 1161 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_04730 <3033 2336 gene locus_tag LOCUS_04740 <3033 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107360.1:electron transport complex subunit RsxC >Feature sequence204 2327 42 gene locus_tag LOCUS_04750 2327 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence205 <1 1725 gene locus_tag LOCUS_04760 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764412.1:M56 family metallopeptidase 2931 1837 gene locus_tag LOCUS_04770 2931 1837 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence206 227 463 gene locus_tag LOCUS_04780 227 463 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_04780 537 1379 gene locus_tag LOCUS_04790 537 1379 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_04790 1416 2276 gene locus_tag LOCUS_04800 gene truB 1416 2276 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence207 <1 881 gene locus_tag LOCUS_04810 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764385.1:TonB-dependent receptor >Feature sequence208 1812 220 gene locus_tag LOCUS_04820 1812 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence209 1338 451 gene locus_tag LOCUS_04830 gene deoC 1338 451 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_04830 1766 1395 gene locus_tag LOCUS_04840 gene dtd 1766 1395 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_04840 <3007 1937 gene locus_tag LOCUS_04850 <3007 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108727.1:excinuclease ABC subunit UvrC >Feature sequence210 2019 55 gene locus_tag LOCUS_04860 2019 55 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_04860 <3003 2319 gene locus_tag LOCUS_04870 <3003 2319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107340.1:DUF3078 domain-containing protein >Feature sequence211 >Feature sequence212 184 1488 gene locus_tag LOCUS_04880 gene thrC 184 1488 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence213 >Feature sequence214 1341 619 gene locus_tag LOCUS_04890 1341 619 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_04890 2526 1360 gene locus_tag LOCUS_04900 2526 1360 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_04900 2964 2602 gene locus_tag LOCUS_04910 2964 2602 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence215 2621 108 gene locus_tag LOCUS_04920 2621 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence216 <1 2569 gene locus_tag LOCUS_04930 <1 2569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence217 1828 539 gene locus_tag LOCUS_04940 1828 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence218 2713 1796 gene locus_tag LOCUS_04950 2713 1796 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence219 1078 632 gene locus_tag LOCUS_04960 1078 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 <2982 1297 gene locus_tag LOCUS_04970 <2982 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082568.1:endo-1,4-beta-xylanase >Feature sequence220 <1 942 gene locus_tag LOCUS_04980 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202492.1:efflux RND transporter periplasmic adaptor subunit 978 1658 gene locus_tag LOCUS_04990 978 1658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence221 1716 208 gene locus_tag LOCUS_05000 1716 208 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence222 1379 528 gene locus_tag LOCUS_05010 gene metA 1379 528 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_05010 <2974 1654 gene locus_tag LOCUS_05020 <2974 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814533.1:M13 family metallopeptidase >Feature sequence223 <2969 281 gene locus_tag LOCUS_05030 <2969 281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107458.1:isoleucine--tRNA ligase >Feature sequence224 83 535 gene locus_tag LOCUS_05040 83 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 561 1304 gene locus_tag LOCUS_05050 561 1304 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_05050 1393 2298 gene locus_tag LOCUS_05060 1393 2298 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202197.1 protein_id gnl|my_center|LOCUS_05060 2369 2950 gene locus_tag LOCUS_05070 2369 2950 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence225 <1 516 gene locus_tag LOCUS_05080 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108949.1:POTRA domain-containing protein 684 1184 gene locus_tag LOCUS_05090 684 1184 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_05090 1402 1899 gene locus_tag LOCUS_05100 1402 1899 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784365.1 protein_id gnl|my_center|LOCUS_05100 <2949 1976 gene locus_tag LOCUS_05110 <2949 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108151.1:metallophosphoesterase family protein >Feature sequence226 1214 753 gene locus_tag LOCUS_05120 1214 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 1710 1234 gene locus_tag LOCUS_05130 1710 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 <2948 1716 gene locus_tag LOCUS_05140 <2948 1716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797416.1:arginine--tRNA ligase >Feature sequence227 <2935 2279 gene locus_tag LOCUS_05150 <2935 2279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107138.1:glycoside hydrolase family 88 protein >Feature sequence228 1 672 gene locus_tag LOCUS_05160 1 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 787 2604 gene locus_tag LOCUS_05170 gene susD 787 2604 CDS product starch-binding outer membrane lipoprotein SusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767005.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence229 1364 1113 gene locus_tag LOCUS_05180 1364 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 1909 1361 gene locus_tag LOCUS_05190 1909 1361 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_05190 2883 1906 gene locus_tag LOCUS_05200 gene lgt 2883 1906 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108644.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence230 1832 684 gene locus_tag LOCUS_05210 1832 684 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence231 471 1502 gene locus_tag LOCUS_05220 gene recA 471 1502 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_229032746.1 protein_id gnl|my_center|LOCUS_05220 1588 2199 gene locus_tag LOCUS_05230 1588 2199 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence232 >Feature sequence233 362 2377 gene locus_tag LOCUS_05240 gene ligA 362 2377 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence234 2055 1894 gene locus_tag LOCUS_05250 2055 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2490 2122 gene locus_tag LOCUS_05260 2490 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence235 2400 1003 gene locus_tag LOCUS_05270 2400 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 >Feature sequence236 2054 1053 gene locus_tag LOCUS_05280 2054 1053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107327.1 protein_id gnl|my_center|LOCUS_05280 2798 2193 gene locus_tag LOCUS_05290 2798 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence237 16 2217 gene locus_tag LOCUS_05300 16 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence238 563 928 gene locus_tag LOCUS_05310 gene rplS 563 928 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_05310 1214 1681 gene locus_tag LOCUS_05320 1214 1681 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence239 >Feature sequence240 885 58 gene locus_tag LOCUS_05330 885 58 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_05330 2399 1074 gene locus_tag LOCUS_05340 2399 1074 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775327.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence241 1413 817 gene locus_tag LOCUS_05350 gene recO 1413 817 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783992.1 protein_id gnl|my_center|LOCUS_05350 1766 1840 gene locus_tag LOCUS_t00090 1766 1840 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1935 2186 gene locus_tag LOCUS_05360 gene rpsT 1935 2186 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence242 <1 715 gene locus_tag LOCUS_05370 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012311219.1:glycosyl hydrolase 53 family protein note possible pseudo, internal stop codon 722 1594 gene locus_tag LOCUS_05380 722 1594 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_05380 <2857 1675 gene locus_tag LOCUS_05390 <2857 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108288.1:U32 family peptidase >Feature sequence243 >Feature sequence244 852 418 gene locus_tag LOCUS_05400 852 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1415 849 gene locus_tag LOCUS_05410 1415 849 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_05410 2665 1412 gene locus_tag LOCUS_05420 2665 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence245 3 386 gene locus_tag LOCUS_05430 3 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 389 679 gene locus_tag LOCUS_05440 389 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1292 789 gene locus_tag LOCUS_05450 1292 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 <2834 1400 gene locus_tag LOCUS_05460 <2834 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201873.1:S46 family peptidase >Feature sequence246 47 121 gene locus_tag LOCUS_t00100 47 121 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 570 1136 gene locus_tag LOCUS_05470 570 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 <2827 1736 gene locus_tag LOCUS_05480 <2827 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107211.1:glycoside hydrolase family 127 protein >Feature sequence247 420 347 gene locus_tag LOCUS_t00110 420 347 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1223 519 gene locus_tag LOCUS_05490 1223 519 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109206.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence248 2817 2686 gene locus_tag LOCUS_05500 2817 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence249 <2818 968 gene locus_tag LOCUS_05510 <2818 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763745.1:LptF/LptG family permease >Feature sequence250 1659 481 gene locus_tag LOCUS_05520 gene mraY 1659 481 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_05520 <2814 1868 gene locus_tag LOCUS_05530 <2814 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201929.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence251 3 1712 gene locus_tag LOCUS_05540 3 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 <2813 2061 gene locus_tag LOCUS_05550 <2813 2061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764329.1:MFS transporter >Feature sequence252 >Feature sequence253 1405 527 gene locus_tag LOCUS_05560 1405 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_05560 2591 1437 gene locus_tag LOCUS_05570 2591 1437 CDS product fragipain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788546.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence254 79 1134 gene locus_tag LOCUS_05580 79 1134 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_05580 1375 2106 gene locus_tag LOCUS_05590 1375 2106 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_05590 2131 2694 gene locus_tag LOCUS_05600 2131 2694 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence255 1360 203 gene locus_tag LOCUS_05610 gene glf 1360 203 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_05610 1628 2464 gene locus_tag LOCUS_05620 1628 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2789 2481 gene locus_tag LOCUS_05630 2789 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence256 1731 1468 gene locus_tag LOCUS_05640 1731 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2480 1839 gene locus_tag LOCUS_05650 2480 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence257 2500 338 gene locus_tag LOCUS_05660 2500 338 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence258 >Feature sequence259 <1 1018 gene locus_tag LOCUS_05670 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108542.1:efflux RND transporter permease subunit 1320 2729 gene locus_tag LOCUS_05680 1320 2729 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303116.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence260 <1 597 gene locus_tag LOCUS_05690 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109125.1:pyridoxal phosphate-dependent aminotransferase 713 2191 gene locus_tag LOCUS_05700 713 2191 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence261 238 2637 gene locus_tag LOCUS_05710 238 2637 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence262 >Feature sequence263 <1 818 gene locus_tag LOCUS_05720 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109145.1:beta-galactosidase >Feature sequence264 533 1558 gene locus_tag LOCUS_05730 533 1558 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_05730 2017 1652 gene locus_tag LOCUS_05740 2017 1652 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence265 <1 2100 gene locus_tag LOCUS_05750 <1 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109366.1:beta-galactosidase GalB >Feature sequence266 1172 2536 gene locus_tag LOCUS_05760 1172 2536 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence267 747 2714 gene locus_tag LOCUS_05770 747 2714 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence268 176 826 gene locus_tag LOCUS_05780 176 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 823 1809 gene locus_tag LOCUS_05790 823 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence269 140 580 gene locus_tag LOCUS_05800 140 580 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133916.1 protein_id gnl|my_center|LOCUS_05800 1830 799 gene locus_tag LOCUS_05810 1830 799 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence270 92 1501 gene locus_tag LOCUS_05820 gene uxaC 92 1501 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_05820 1843 2388 gene locus_tag LOCUS_05830 1843 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence271 >Feature sequence272 1009 455 gene locus_tag LOCUS_05840 gene rplI 1009 455 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769978.1 protein_id gnl|my_center|LOCUS_05840 1303 1028 gene locus_tag LOCUS_05850 gene rpsR 1303 1028 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_05850 1641 1306 gene locus_tag LOCUS_05860 gene rpsF 1641 1306 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_05860 1939 2127 gene locus_tag LOCUS_05870 1939 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence273 <1 596 gene locus_tag LOCUS_05880 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788190.1:excinuclease ABC subunit UvrA 1431 667 gene locus_tag LOCUS_05890 1431 667 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_05890 <2715 1502 gene locus_tag LOCUS_05900 <2715 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788903.1:diphosphate--fructose-6-phosphate 1-phosphotransferase >Feature sequence274 3 197 gene locus_tag LOCUS_05910 3 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence275 2 460 gene locus_tag LOCUS_05920 2 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 557 1111 gene locus_tag LOCUS_05930 557 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764414.1 protein_id gnl|my_center|LOCUS_05930 1161 2075 gene locus_tag LOCUS_05940 gene miaA 1161 2075 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence276 1157 111 gene locus_tag LOCUS_05950 1157 111 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_05950 <2702 1613 gene locus_tag LOCUS_05960 <2702 1613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202133.1:alpha-2-macroglobulin family protein >Feature sequence277 <2695 1131 gene locus_tag LOCUS_05970 <2695 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764325.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence278 <1 649 gene locus_tag LOCUS_05980 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791913.1:FKBP-type peptidyl-prolyl cis-trans isomerase 806 1297 gene locus_tag LOCUS_05990 806 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1421 2473 gene locus_tag LOCUS_06000 1421 2473 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence279 452 1327 gene locus_tag LOCUS_06010 452 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1835 2062 gene locus_tag LOCUS_06020 1835 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2059 2532 gene locus_tag LOCUS_06030 2059 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence280 <1 556 gene locus_tag LOCUS_06040 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962345.1:leucine-rich repeat domain-containing protein 802 2550 gene locus_tag LOCUS_06050 802 2550 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence281 454 690 gene locus_tag LOCUS_06060 454 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 697 1110 gene locus_tag LOCUS_06070 697 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 <2684 1268 gene locus_tag LOCUS_06080 <2684 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533398.1:S9 family peptidase >Feature sequence282 430 747 gene locus_tag LOCUS_06090 430 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2675 780 gene locus_tag LOCUS_06100 gene rnr 2675 780 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence283 1376 2203 gene locus_tag LOCUS_06110 1376 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence284 430 780 gene locus_tag LOCUS_06120 430 780 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_06120 1833 886 gene locus_tag LOCUS_06130 1833 886 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_06130 2595 1849 gene locus_tag LOCUS_06140 gene kdsA 2595 1849 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence285 228 593 gene locus_tag LOCUS_06150 228 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1137 1757 gene locus_tag LOCUS_06160 1137 1757 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence286 476 75 gene locus_tag LOCUS_06170 476 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2131 620 gene locus_tag LOCUS_06180 2131 620 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence287 1500 307 gene locus_tag LOCUS_06190 1500 307 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225147.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06190 >Feature sequence288 87 887 gene locus_tag LOCUS_06200 87 887 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107473.1 protein_id gnl|my_center|LOCUS_06200 1577 921 gene locus_tag LOCUS_06210 1577 921 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762117.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence289 1598 1005 gene locus_tag LOCUS_06220 1598 1005 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_06220 <2649 1762 gene locus_tag LOCUS_06230 <2649 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008770001.1:methionyl-tRNA formyltransferase >Feature sequence290 1111 137 gene locus_tag LOCUS_06240 1111 137 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_06240 1900 1352 gene locus_tag LOCUS_06250 1900 1352 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence291 >Feature sequence292 <1 855 gene locus_tag LOCUS_06260 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760004.1:class I SAM-dependent rRNA methyltransferase 1622 987 gene locus_tag LOCUS_06270 1622 987 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_06270 1861 1652 gene locus_tag LOCUS_06280 1861 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789240.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence293 1123 1677 gene locus_tag LOCUS_06290 1123 1677 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence294 >Feature sequence295 109 591 gene locus_tag LOCUS_06300 109 591 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784379.1 protein_id gnl|my_center|LOCUS_06300 688 1707 gene locus_tag LOCUS_06310 gene dusB 688 1707 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_06310 1842 2450 gene locus_tag LOCUS_06320 1842 2450 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence296 2624 1671 gene locus_tag LOCUS_06330 2624 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence297 >Feature sequence298 110 2578 gene locus_tag LOCUS_06340 110 2578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence299 >Feature sequence300 178 825 gene locus_tag LOCUS_06350 178 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790373.1 protein_id gnl|my_center|LOCUS_06350 999 1307 gene locus_tag LOCUS_06360 999 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_06360 1337 1642 gene locus_tag LOCUS_06370 1337 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence301 2610 1219 gene locus_tag LOCUS_06380 2610 1219 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203639.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence302 1447 587 gene locus_tag LOCUS_06390 1447 587 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_06390 2269 1499 gene locus_tag LOCUS_06400 2269 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence303 >Feature sequence304 >Feature sequence305 880 2541 gene locus_tag LOCUS_06410 880 2541 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence306 296 430 gene locus_tag LOCUS_06420 296 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 <2589 492 gene locus_tag LOCUS_06430 <2589 492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107134.1:two-component regulator propeller domain-containing protein >Feature sequence307 <2579 1618 gene locus_tag LOCUS_06440 <2579 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108918.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence308 >Feature sequence309 821 135 gene locus_tag LOCUS_06450 821 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1747 914 gene locus_tag LOCUS_06460 1747 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_06460 2510 1779 gene locus_tag LOCUS_06470 gene rsmI 2510 1779 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence310 >Feature sequence311 180 2444 gene locus_tag LOCUS_06480 180 2444 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109148.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence312 >Feature sequence313 799 266 gene locus_tag LOCUS_06490 gene hpt 799 266 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence314 2550 1723 gene locus_tag LOCUS_06500 2550 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence315 >Feature sequence316 <1 637 gene locus_tag LOCUS_06510 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202228.1:glycogen debranching enzyme N-terminal domain-containing protein 669 1925 gene locus_tag LOCUS_06520 669 1925 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence317 <2543 1532 gene locus_tag LOCUS_06530 <2543 1532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802118.1:DNA primase >Feature sequence318 578 1702 gene locus_tag LOCUS_06540 578 1702 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798126.1 protein_id gnl|my_center|LOCUS_06540 1788 2456 gene locus_tag LOCUS_06550 1788 2456 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798129.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence319 2475 988 gene locus_tag LOCUS_06560 2475 988 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence320 1294 491 gene locus_tag LOCUS_06570 gene hisG 1294 491 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_06570 2534 1824 gene locus_tag LOCUS_06580 2534 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence321 894 640 gene locus_tag LOCUS_06590 894 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2180 972 gene locus_tag LOCUS_06600 2180 972 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence322 >Feature sequence323 539 1885 gene locus_tag LOCUS_06610 539 1885 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence324 >Feature sequence325 216 2045 gene locus_tag LOCUS_06620 216 2045 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence326 >Feature sequence327 <2513 1163 gene locus_tag LOCUS_06630 <2513 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767005.1:starch-binding outer membrane lipoprotein SusD >Feature sequence328 <1 714 gene locus_tag LOCUS_06640 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291723.1:peptidoglycan editing factor PgeF 1555 773 gene locus_tag LOCUS_06650 1555 773 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_06650 2223 1570 gene locus_tag LOCUS_06660 2223 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence329 1159 164 gene locus_tag LOCUS_06670 1159 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 1948 1391 gene locus_tag LOCUS_06680 gene efp 1948 1391 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766998.1 protein_id gnl|my_center|LOCUS_06680 2258 2413 gene locus_tag LOCUS_06690 gene rpmH 2258 2413 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence330 222 821 gene locus_tag LOCUS_06700 gene hisH 222 821 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_06700 941 1666 gene locus_tag LOCUS_06710 gene hisA 941 1666 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_06710 1660 2415 gene locus_tag LOCUS_06720 gene hisF 1660 2415 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence331 <1 997 gene locus_tag LOCUS_06730 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107600.1:PD-(D/E)XK nuclease family protein 1338 2264 gene locus_tag LOCUS_06740 1338 2264 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763680.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence332 >Feature sequence333 <1 1467 gene locus_tag LOCUS_06750 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:TonB-dependent receptor 1633 2436 gene locus_tag LOCUS_06760 1633 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence334 1743 913 gene locus_tag LOCUS_06770 gene pyrF 1743 913 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_06770 <2499 1771 gene locus_tag LOCUS_06780 <2499 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759884.1:peptide chain release factor 1 >Feature sequence335 935 123 gene locus_tag LOCUS_06790 935 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1793 1107 gene locus_tag LOCUS_06800 1793 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence336 >Feature sequence337 >Feature sequence338 >Feature sequence339 <1 547 gene locus_tag LOCUS_06810 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783637.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 639 1103 gene locus_tag LOCUS_06820 gene folK 639 1103 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_06820 1654 1034 gene locus_tag LOCUS_06830 1654 1034 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_06830 1776 2414 gene locus_tag LOCUS_06840 1776 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence340 <1 855 gene locus_tag LOCUS_06850 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202171.1:cellobiose 2-epimerase 915 2372 gene locus_tag LOCUS_06860 915 2372 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence341 236 1411 gene locus_tag LOCUS_06870 236 1411 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence342 1822 1688 gene locus_tag LOCUS_06880 1822 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2132 1785 gene locus_tag LOCUS_06890 2132 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence343 1659 178 gene locus_tag LOCUS_06900 1659 178 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_06900 <2460 1874 gene locus_tag LOCUS_06910 <2460 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108031.1:glycoside hydrolase family 43 protein >Feature sequence344 1107 40 gene locus_tag LOCUS_06920 1107 40 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202472.1 protein_id gnl|my_center|LOCUS_06920 1123 1260 gene locus_tag LOCUS_06930 1123 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence345 108 542 gene locus_tag LOCUS_06940 108 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1331 879 gene locus_tag LOCUS_06950 1331 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1690 1343 gene locus_tag LOCUS_06960 1690 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2180 1680 gene locus_tag LOCUS_06970 2180 1680 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence346 70 1380 gene locus_tag LOCUS_06980 70 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1495 1932 gene locus_tag LOCUS_06990 1495 1932 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence347 <1 640 gene locus_tag LOCUS_07000 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786936.1:DUF5686 and carboxypeptidase-like regulatory domain-containing protein >Feature sequence348 >Feature sequence349 >Feature sequence350 1265 2128 gene locus_tag LOCUS_07010 1265 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence351 >Feature sequence352 163 1305 gene locus_tag LOCUS_07020 gene fucP 163 1305 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence353 <1 714 gene locus_tag LOCUS_07030 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759581.1:GTPase HflX >Feature sequence354 <1 2365 gene locus_tag LOCUS_07040 <1 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776921.1:glycoside hydrolase family 27 protein >Feature sequence355 566 1936 gene locus_tag LOCUS_07050 566 1936 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence356 1414 74 gene locus_tag LOCUS_07060 1414 74 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_07060 <2420 1432 gene locus_tag LOCUS_07070 <2420 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303169.1:family 43 glycosylhydrolase >Feature sequence357 307 1554 gene locus_tag LOCUS_07080 307 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence358 <2415 840 gene locus_tag LOCUS_07090 <2415 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789610.1:family 10 glycosylhydrolase >Feature sequence359 >Feature sequence360 196 1083 gene locus_tag LOCUS_07100 196 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2062 1091 gene locus_tag LOCUS_07110 2062 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence361 1531 833 gene locus_tag LOCUS_07120 gene cmk 1531 833 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_07120 <2407 1573 gene locus_tag LOCUS_07130 <2407 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764528.1:preprotein translocase subunit SecA >Feature sequence362 >Feature sequence363 >Feature sequence364 1061 180 gene locus_tag LOCUS_07140 1061 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 <2397 1123 gene locus_tag LOCUS_07150 <2397 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:RecQ family ATP-dependent DNA helicase >Feature sequence365 <1 764 gene locus_tag LOCUS_07160 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108331.1:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase 845 2341 gene locus_tag LOCUS_07170 gene cysS 845 2341 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence366 940 2334 gene locus_tag LOCUS_07180 940 2334 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence367 1 1608 gene locus_tag LOCUS_07190 1 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2114 1881 gene locus_tag LOCUS_07200 2114 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence368 365 1990 gene locus_tag LOCUS_07210 365 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2045 2350 gene locus_tag LOCUS_07220 2045 2350 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence369 1070 252 gene locus_tag LOCUS_07230 1070 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1632 1060 gene locus_tag LOCUS_07240 1632 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 1934 2113 gene locus_tag LOCUS_07250 1934 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence370 1096 359 gene locus_tag LOCUS_07260 1096 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1867 1475 gene locus_tag LOCUS_07270 1867 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence371 >Feature sequence372 <1 917 gene locus_tag LOCUS_07280 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786127.1:Na+/H+ antiporter NhaC family protein 961 2343 gene locus_tag LOCUS_07290 961 2343 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence373 1249 92 gene locus_tag LOCUS_07300 1249 92 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_07300 <2359 1440 gene locus_tag LOCUS_07310 <2359 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203455.1:putative LPS assembly protein LptD >Feature sequence374 <2359 113 gene locus_tag LOCUS_07320 <2359 113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202070.1:TonB-dependent receptor >Feature sequence375 193 1845 gene locus_tag LOCUS_07330 193 1845 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788170.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence376 <1 1981 gene locus_tag LOCUS_07340 <1 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108497.1:tetratricopeptide repeat protein >Feature sequence377 1249 35 gene locus_tag LOCUS_07350 1249 35 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_07350 1949 1251 gene locus_tag LOCUS_07360 1949 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2351 2049 gene locus_tag LOCUS_07370 2351 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence378 >Feature sequence379 256 1209 gene locus_tag LOCUS_07380 256 1209 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_07380 1273 1713 gene locus_tag LOCUS_07390 1273 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence380 388 1281 gene locus_tag LOCUS_07400 388 1281 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence381 1982 255 gene locus_tag LOCUS_07410 1982 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence382 >Feature sequence383 702 73 gene locus_tag LOCUS_07420 702 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1911 886 gene locus_tag LOCUS_07430 1911 886 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456217.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence384 <2331 1047 gene locus_tag LOCUS_07440 <2331 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761420.1:pitrilysin family protein >Feature sequence385 888 37 gene locus_tag LOCUS_07450 888 37 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_07450 1925 888 gene locus_tag LOCUS_07460 1925 888 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence386 1244 654 gene locus_tag LOCUS_07470 1244 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence387 775 1986 gene locus_tag LOCUS_07480 775 1986 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence388 2020 1178 gene locus_tag LOCUS_07490 2020 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence389 393 2198 gene locus_tag LOCUS_07500 393 2198 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence390 <2310 1063 gene locus_tag LOCUS_07510 <2310 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202810.1:BamA/TamA family outer membrane protein >Feature sequence391 >Feature sequence392 >Feature sequence393 >Feature sequence394 192 1199 gene locus_tag LOCUS_07520 192 1199 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_07520 1257 2246 gene locus_tag LOCUS_07530 1257 2246 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence395 419 2068 gene locus_tag LOCUS_07540 419 2068 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence396 902 2233 gene locus_tag LOCUS_07550 gene rmuC 902 2233 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560136.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence397 <1 939 gene locus_tag LOCUS_07560 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791376.1:TlpA disulfide reductase family protein 2128 1040 gene locus_tag LOCUS_07570 2128 1040 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence398 1 1131 gene locus_tag LOCUS_07580 1 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1151 2263 gene locus_tag LOCUS_07590 gene lpxK 1151 2263 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence399 1464 286 gene locus_tag LOCUS_07600 1464 286 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_07600 <2277 1639 gene locus_tag LOCUS_07610 <2277 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766920.1:methylenetetrahydrofolate reductase [NAD(P)H] >Feature sequence400 1424 144 gene locus_tag LOCUS_07620 1424 144 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_07620 <2276 1510 gene locus_tag LOCUS_07630 <2276 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107958.1:excinuclease ABC subunit UvrA >Feature sequence401 >Feature sequence402 414 923 gene locus_tag LOCUS_07640 414 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence403 359 1657 gene locus_tag LOCUS_07650 gene rimO 359 1657 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_07650 1668 1943 gene locus_tag LOCUS_07660 1668 1943 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence404 >Feature sequence405 1798 680 gene locus_tag LOCUS_07670 1798 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence406 214 1233 gene locus_tag LOCUS_07680 214 1233 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_07680 1404 2066 gene locus_tag LOCUS_07690 1404 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence407 1562 1113 gene locus_tag LOCUS_07700 1562 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 <2265 1688 gene locus_tag LOCUS_07710 <2265 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768748.1:ribose-phosphate pyrophosphokinase >Feature sequence408 477 1481 gene locus_tag LOCUS_07720 477 1481 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786940.1 protein_id gnl|my_center|LOCUS_07720 1572 2084 gene locus_tag LOCUS_07730 1572 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence409 463 654 gene locus_tag LOCUS_07740 gene rpsU 463 654 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_07740 883 1782 gene locus_tag LOCUS_07750 gene xerC 883 1782 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_07750 1795 2085 gene locus_tag LOCUS_07760 gene raiA 1795 2085 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_07760 2187 2261 gene locus_tag LOCUS_t00120 2187 2261 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence410 586 314 gene locus_tag LOCUS_07770 gene rpsR 586 314 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_07770 924 589 gene locus_tag LOCUS_07780 gene rpsF 924 589 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_07780 1231 1410 gene locus_tag LOCUS_07790 1231 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 <2261 1529 gene locus_tag LOCUS_07800 <2261 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790952.1:response regulator transcription factor >Feature sequence411 1344 490 gene locus_tag LOCUS_07810 1344 490 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence412 679 1416 gene locus_tag LOCUS_07820 679 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence413 207 716 gene locus_tag LOCUS_07830 207 716 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_07830 721 1188 gene locus_tag LOCUS_07840 gene smpB 721 1188 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760495.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence414 3 608 gene locus_tag LOCUS_07850 3 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1071 1155 gene locus_tag LOCUS_t00130 1071 1155 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1987 1382 gene locus_tag LOCUS_07860 1987 1382 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence415 <1 1085 gene locus_tag LOCUS_07870 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073033580.1:leucine-rich repeat protein >Feature sequence416 691 1455 gene locus_tag LOCUS_07880 691 1455 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_07880 1534 2202 gene locus_tag LOCUS_07890 1534 2202 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761373.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence417 >Feature sequence418 1032 1364 gene locus_tag LOCUS_07900 1032 1364 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 protein_id gnl|my_center|LOCUS_07900 1433 2026 gene locus_tag LOCUS_07910 1433 2026 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence419 >Feature sequence420 454 311 gene locus_tag LOCUS_07920 454 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1666 707 gene locus_tag LOCUS_07930 1666 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence421 <2227 437 gene locus_tag LOCUS_07940 <2227 437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048693189.1:cytochrome c biogenesis protein CcdA >Feature sequence422 92 952 gene locus_tag LOCUS_07950 92 952 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_07950 1299 1460 gene locus_tag LOCUS_07960 1299 1460 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence423 1256 405 gene locus_tag LOCUS_07970 1256 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 2017 1253 gene locus_tag LOCUS_07980 2017 1253 CDS product sugar nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901997.1 protein_id gnl|my_center|LOCUS_07980 2144 2007 gene locus_tag LOCUS_07990 2144 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence424 856 1257 gene locus_tag LOCUS_08000 856 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1565 1978 gene locus_tag LOCUS_08010 gene mce 1565 1978 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence425 >Feature sequence426 939 448 gene locus_tag LOCUS_08020 939 448 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence427 <1 500 gene locus_tag LOCUS_08030 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767780.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence428 381 2105 gene locus_tag LOCUS_08040 381 2105 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229316.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence429 >Feature sequence430 557 372 gene locus_tag LOCUS_08050 557 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2190 637 gene locus_tag LOCUS_08060 2190 637 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence431 <2190 1003 gene locus_tag LOCUS_08070 <2190 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109240.1:DUF5107 domain-containing protein >Feature sequence432 1291 1139 gene locus_tag LOCUS_08080 1291 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 <2188 1366 gene locus_tag LOCUS_08090 <2188 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764459.1:glutamine-hydrolyzing GMP synthase >Feature sequence433 <1 1899 gene locus_tag LOCUS_08100 <1 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303123.1:insulinase family protein 1992 2144 gene locus_tag LOCUS_08110 1992 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence434 <1 1272 gene locus_tag LOCUS_08120 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783669.1:DUF2723 domain-containing protein 1279 1917 gene locus_tag LOCUS_08130 1279 1917 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767469.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence435 <2182 662 gene locus_tag LOCUS_08140 <2182 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783448.1:TonB-dependent receptor >Feature sequence436 >Feature sequence437 683 3 gene locus_tag LOCUS_08150 683 3 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence438 2004 685 gene locus_tag LOCUS_08160 2004 685 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence439 166 579 gene locus_tag LOCUS_08170 166 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 804 2021 gene locus_tag LOCUS_08180 804 2021 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787540.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence440 1357 1055 gene locus_tag LOCUS_08190 1357 1055 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence441 301 927 gene locus_tag LOCUS_08200 301 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1001 2071 gene locus_tag LOCUS_08210 1001 2071 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence442 431 12 gene locus_tag LOCUS_08220 431 12 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence443 258 1652 gene locus_tag LOCUS_08230 258 1652 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence444 <2154 100 gene locus_tag LOCUS_08240 <2154 100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766293.1:NADP-dependent malic enzyme >Feature sequence445 >Feature sequence446 156 1535 gene locus_tag LOCUS_08250 156 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence447 963 1427 gene locus_tag LOCUS_08260 gene greA 963 1427 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_08260 1473 1871 gene locus_tag LOCUS_08270 1473 1871 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence448 >Feature sequence449 471 1742 gene locus_tag LOCUS_08280 471 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767426.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence450 2086 1493 gene locus_tag LOCUS_08290 gene leuD 2086 1493 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence451 <2137 53 gene locus_tag LOCUS_08300 <2137 53 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962206.1:transglycosylase domain-containing protein >Feature sequence452 1616 1170 gene locus_tag LOCUS_08310 1616 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence453 >Feature sequence454 >Feature sequence455 202 723 gene locus_tag LOCUS_08320 202 723 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_08320 1004 1483 gene locus_tag LOCUS_08330 1004 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence456 59 223 gene locus_tag LOCUS_08340 59 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence457 128 769 gene locus_tag LOCUS_08350 128 769 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_08350 797 2104 gene locus_tag LOCUS_08360 gene murA 797 2104 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence458 566 1861 gene locus_tag LOCUS_08370 gene tyrS 566 1861 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence459 <1 1402 gene locus_tag LOCUS_08380 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108923.1:triple tyrosine motif-containing protein <2125 1415 gene locus_tag LOCUS_08390 <2125 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760889.1:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence460 1992 652 gene locus_tag LOCUS_08400 1992 652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence461 589 1704 gene locus_tag LOCUS_08410 589 1704 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence462 428 973 gene locus_tag LOCUS_08420 428 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2024 1032 gene locus_tag LOCUS_08430 gene tsf 2024 1032 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence463 910 320 gene locus_tag LOCUS_08440 910 320 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_08440 1042 1755 gene locus_tag LOCUS_08450 1042 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence464 >Feature sequence465 1305 154 gene locus_tag LOCUS_08460 1305 154 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence466 >Feature sequence467 >Feature sequence468 1455 1874 gene locus_tag LOCUS_08470 1455 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence469 190 1989 gene locus_tag LOCUS_08480 190 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence470 <1 1245 gene locus_tag LOCUS_08490 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813223.1:PD40 domain-containing protein 1331 1930 gene locus_tag LOCUS_08500 1331 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence471 >Feature sequence472 <1 2021 gene locus_tag LOCUS_08510 <1 2021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797103.1:helix-hairpin-helix domain-containing protein >Feature sequence473 201 1811 gene locus_tag LOCUS_08520 201 1811 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence474 <1 693 gene locus_tag LOCUS_08530 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767043.1:glycoside hydrolase family 97 protein >Feature sequence475 1337 198 gene locus_tag LOCUS_08540 1337 198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence476 156 1079 gene locus_tag LOCUS_08550 156 1079 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767133.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence477 1214 2050 gene locus_tag LOCUS_08560 1214 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence478 >Feature sequence479 2010 658 gene locus_tag LOCUS_08570 gene hisS 2010 658 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence480 <1 1515 gene locus_tag LOCUS_08580 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108723.1:DNA polymerase I >Feature sequence481 <1 720 gene locus_tag LOCUS_08590 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802379.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase >Feature sequence482 1 1740 gene locus_tag LOCUS_08600 1 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence483 213 1355 gene locus_tag LOCUS_08610 213 1355 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence484 24 599 gene locus_tag LOCUS_08620 24 599 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202309.1 protein_id gnl|my_center|LOCUS_08620 752 1702 gene locus_tag LOCUS_08630 752 1702 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence485 61 1524 gene locus_tag LOCUS_08640 gene leuC 61 1524 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence486 393 317 gene locus_tag LOCUS_t00140 393 317 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence487 >Feature sequence488 >Feature sequence489 1937 870 gene locus_tag LOCUS_08650 gene mnmA 1937 870 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202407.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence490 <1 1262 gene locus_tag LOCUS_08660 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108132.1:methylmalonyl-CoA mutase small subunit >Feature sequence491 2036 1482 gene locus_tag LOCUS_08670 2036 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence492 >Feature sequence493 1054 92 gene locus_tag LOCUS_08680 1054 92 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_08680 <2030 1051 gene locus_tag LOCUS_08690 <2030 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798122.1:L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha >Feature sequence494 143 1102 gene locus_tag LOCUS_08700 143 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1619 1188 gene locus_tag LOCUS_08710 1619 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence495 <2027 830 gene locus_tag LOCUS_08720 <2027 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766199.1:transcription-repair coupling factor >Feature sequence496 1063 1917 gene locus_tag LOCUS_08730 1063 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence497 >Feature sequence498 >Feature sequence499 1086 112 gene locus_tag LOCUS_08740 1086 112 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence500 1543 41 gene locus_tag LOCUS_08750 1543 41 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence501 1 171 gene locus_tag LOCUS_08760 1 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 310 1548 gene locus_tag LOCUS_08770 310 1548 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760358.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence502 3 653 gene locus_tag LOCUS_08780 3 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 944 1924 gene locus_tag LOCUS_08790 944 1924 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence503 <1 547 gene locus_tag LOCUS_08800 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107930.1:ATP-binding cassette domain-containing protein 560 1975 gene locus_tag LOCUS_08810 560 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence504 206 1705 gene locus_tag LOCUS_08820 206 1705 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence505 >Feature sequence506 803 1861 gene locus_tag LOCUS_08830 803 1861 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797794.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence507 <1 1942 gene locus_tag LOCUS_08840 <1 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108600.1:outer membrane beta-barrel family protein >Feature sequence508 <1977 72 gene locus_tag LOCUS_08850 <1977 72 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208292391.1:glycoside hydrolase family 95 protein >Feature sequence509 <1977 363 gene locus_tag LOCUS_08860 <1977 363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203181.1:methionine synthase >Feature sequence510 1783 650 gene locus_tag LOCUS_08870 1783 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence511 704 30 gene locus_tag LOCUS_08880 gene clpP 704 30 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_08880 <1970 990 gene locus_tag LOCUS_08890 <1970 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791866.1:trigger factor >Feature sequence512 >Feature sequence513 <1 674 gene locus_tag LOCUS_08900 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783729.1:DNA alkylation repair protein 706 1638 gene locus_tag LOCUS_08910 706 1638 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115569.1 protein_id gnl|my_center|LOCUS_08910 1799 1691 gene locus_tag LOCUS_r00010 1799 1691 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence514 461 63 gene locus_tag LOCUS_08920 461 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1087 1860 gene locus_tag LOCUS_08930 1087 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence515 952 1326 gene locus_tag LOCUS_08940 952 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence516 1227 628 gene locus_tag LOCUS_08950 1227 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence517 1496 591 gene locus_tag LOCUS_08960 1496 591 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence518 >Feature sequence519 446 1513 gene locus_tag LOCUS_08970 446 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence520 <1 1089 gene locus_tag LOCUS_08980 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695721.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence521 187 1071 gene locus_tag LOCUS_08990 gene era 187 1071 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence522 1545 1276 gene locus_tag LOCUS_09000 1545 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence523 160 1395 gene locus_tag LOCUS_09010 160 1395 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence524 516 85 gene locus_tag LOCUS_09020 gene ybeY 516 85 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_09020 <1936 554 gene locus_tag LOCUS_09030 <1936 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797168.1:S41 family peptidase >Feature sequence525 867 214 gene locus_tag LOCUS_09040 867 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence526 >Feature sequence527 <1934 114 gene locus_tag LOCUS_09050 <1934 114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109056.1:GH92 family glycosyl hydrolase >Feature sequence528 <1 1047 gene locus_tag LOCUS_09060 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783573.1:L-aspartate oxidase >Feature sequence529 >Feature sequence530 >Feature sequence531 342 695 gene locus_tag LOCUS_09070 342 695 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_09070 833 1282 gene locus_tag LOCUS_09080 833 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence532 >Feature sequence533 233 1357 gene locus_tag LOCUS_09090 233 1357 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence534 >Feature sequence535 <1 1748 gene locus_tag LOCUS_09100 <1 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203461.1:4-alpha-glucanotransferase >Feature sequence536 172 573 gene locus_tag LOCUS_09110 172 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 682 1662 gene locus_tag LOCUS_09120 gene pfkA 682 1662 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence537 <1 500 gene locus_tag LOCUS_09130 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788747.1:3'-5' exonuclease 620 1861 gene locus_tag LOCUS_09140 gene coaBC 620 1861 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence538 >Feature sequence539 212 1255 gene locus_tag LOCUS_09150 212 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1342 1641 gene locus_tag LOCUS_09160 1342 1641 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020811.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence540 947 249 gene locus_tag LOCUS_09170 947 249 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_09170 1489 953 gene locus_tag LOCUS_09180 1489 953 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109201.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence541 <1 966 gene locus_tag LOCUS_09190 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766742.1:mannonate dehydratase >Feature sequence542 >Feature sequence543 >Feature sequence544 <1 917 gene locus_tag LOCUS_09200 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203582.1:regulatory iron-sulfur-containing complex subunit RicT 995 1609 gene locus_tag LOCUS_09210 995 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1735 1808 gene locus_tag LOCUS_t00150 1735 1808 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence545 1708 800 gene locus_tag LOCUS_09220 1708 800 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence546 538 41 gene locus_tag LOCUS_09230 538 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09230 1092 493 gene locus_tag LOCUS_09240 1092 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 <1897 1150 gene locus_tag LOCUS_09250 <1897 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840521.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence547 <1895 1158 gene locus_tag LOCUS_09260 <1895 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107519.1:translocation/assembly module TamB domain-containing protein >Feature sequence548 <1 1648 gene locus_tag LOCUS_09270 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760990.1:glycoside hydrolase family 88 protein >Feature sequence549 <1892 397 gene locus_tag LOCUS_09280 <1892 397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840507.1:rhamnogalacturonan acetylesterase >Feature sequence550 >Feature sequence551 >Feature sequence552 >Feature sequence553 >Feature sequence554 >Feature sequence555 1871 57 gene locus_tag LOCUS_09290 1871 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence556 <1872 260 gene locus_tag LOCUS_09300 <1872 260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764381.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence557 <1871 1319 gene locus_tag LOCUS_09310 <1871 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760700.1:peptide deformylase >Feature sequence558 >Feature sequence559 >Feature sequence560 >Feature sequence561 <1 1210 gene locus_tag LOCUS_09320 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108762.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence562 140 66 gene locus_tag LOCUS_t00160 140 66 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 273 200 gene locus_tag LOCUS_t00170 273 200 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 586 1215 gene locus_tag LOCUS_09330 586 1215 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence563 1 222 gene locus_tag LOCUS_09340 1 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 213 611 gene locus_tag LOCUS_09350 213 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 788 1795 gene locus_tag LOCUS_09360 gene atpB 788 1795 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence564 <1 1733 gene locus_tag LOCUS_09370 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658876.1:SurA N-terminal domain-containing protein >Feature sequence565 <1 672 gene locus_tag LOCUS_09380 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000685095.1:nucleotide sugar dehydrogenase 786 1685 gene locus_tag LOCUS_09390 gene rfbA 786 1685 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence566 487 873 gene locus_tag LOCUS_09400 gene folB 487 873 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence567 <1 1389 gene locus_tag LOCUS_09410 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206474.1:family 2A encapsulin nanocompartment cargo protein cysteine desulfurase >Feature sequence568 >Feature sequence569 >Feature sequence570 1845 949 gene locus_tag LOCUS_09420 1845 949 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence571 112 1635 gene locus_tag LOCUS_09430 112 1635 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence572 231 977 gene locus_tag LOCUS_09440 gene fabG 231 977 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_09440 1078 1776 gene locus_tag LOCUS_09450 1078 1776 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence573 1802 702 gene locus_tag LOCUS_09460 gene obgE 1802 702 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence574 <1 890 gene locus_tag LOCUS_09470 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962352.1:leucine-rich repeat domain-containing protein 1470 1186 gene locus_tag LOCUS_09480 1470 1186 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence575 >Feature sequence576 985 125 gene locus_tag LOCUS_09490 985 125 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_09490 <1832 1124 gene locus_tag LOCUS_09500 <1832 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765714.1:Nif3-like dinuclear metal center hexameric protein >Feature sequence577 <1 540 gene locus_tag LOCUS_09510 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785156.1:PhoH family protein 620 1573 gene locus_tag LOCUS_09520 620 1573 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence578 <1823 261 gene locus_tag LOCUS_09530 <1823 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793972.1:phosphatase PAP2 family protein >Feature sequence579 >Feature sequence580 451 47 gene locus_tag LOCUS_09540 451 47 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence581 >Feature sequence582 154 1473 gene locus_tag LOCUS_09550 154 1473 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence583 1804 713 gene locus_tag LOCUS_09560 1804 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence584 >Feature sequence585 217 1173 gene locus_tag LOCUS_09570 217 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence586 >Feature sequence587 >Feature sequence588 677 1075 gene locus_tag LOCUS_09580 677 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence589 >Feature sequence590 2 274 gene locus_tag LOCUS_09590 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence591 >Feature sequence592 >Feature sequence593 311 1216 gene locus_tag LOCUS_09600 311 1216 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence594 1289 549 gene locus_tag LOCUS_09610 1289 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence595 1659 82 gene locus_tag LOCUS_09620 1659 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence596 264 1484 gene locus_tag LOCUS_09630 264 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence597 <1 971 gene locus_tag LOCUS_09640 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226244.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein 1775 1305 gene locus_tag LOCUS_09650 1775 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence598 >Feature sequence599 1773 196 gene locus_tag LOCUS_09660 gene speA 1773 196 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence600 >Feature sequence601 >Feature sequence602 <1 757 gene locus_tag LOCUS_09670 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767849.1:DUF2520 domain-containing protein 776 1294 gene locus_tag LOCUS_09680 776 1294 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence603 <1 1077 gene locus_tag LOCUS_09690 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010538526.1:V-type ATP synthase subunit A >Feature sequence604 1111 17 gene locus_tag LOCUS_09700 1111 17 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence605 488 1084 gene locus_tag LOCUS_09710 488 1084 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence606 <1 821 gene locus_tag LOCUS_09720 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004295279.1:6-phosphofructokinase >Feature sequence607 170 1672 gene locus_tag LOCUS_09730 gene rhaB 170 1672 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence608 1646 579 gene locus_tag LOCUS_09740 1646 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence609 1203 70 gene locus_tag LOCUS_09750 1203 70 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence610 >Feature sequence611 <1752 192 gene locus_tag LOCUS_09760 <1752 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765057.1:glutamine synthetase III >Feature sequence612 395 1714 gene locus_tag LOCUS_09770 395 1714 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694823.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence613 <1750 534 gene locus_tag LOCUS_09780 <1750 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764381.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence614 <1 519 gene locus_tag LOCUS_09790 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108779.1:Ig-like domain-containing protein 665 1519 gene locus_tag LOCUS_09800 665 1519 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence615 1342 47 gene locus_tag LOCUS_09810 1342 47 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence616 >Feature sequence617 1246 599 gene locus_tag LOCUS_09820 1246 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence618 >Feature sequence619 1152 424 gene locus_tag LOCUS_09830 1152 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09830 <1730 1146 gene locus_tag LOCUS_09840 <1730 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790953.1:HAMP domain-containing sensor histidine kinase note possible pseudo, frameshifted >Feature sequence620 1546 635 gene locus_tag LOCUS_09850 1546 635 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587069.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence621 <1 520 gene locus_tag LOCUS_09860 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403685.1:CNNM domain-containing protein >Feature sequence622 193 996 gene locus_tag LOCUS_09870 gene nudC 193 996 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107851.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence623 480 4 gene locus_tag LOCUS_09880 480 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1145 534 gene locus_tag LOCUS_09890 1145 534 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence624 >Feature sequence625 <1 1085 gene locus_tag LOCUS_09900 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108511.1:glycoside hydrolase 43 family protein >Feature sequence626 298 750 gene locus_tag LOCUS_09910 298 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence627 >Feature sequence628 >Feature sequence629 99 941 gene locus_tag LOCUS_09920 99 941 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence630 979 86 gene locus_tag LOCUS_09930 gene dapA 979 86 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_09930 1275 1550 gene locus_tag LOCUS_09940 1275 1550 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence631 >Feature sequence632 907 332 gene locus_tag LOCUS_09950 907 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1021 1698 gene locus_tag LOCUS_09960 1021 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence633 1197 34 gene locus_tag LOCUS_09970 1197 34 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence634 1174 365 gene locus_tag LOCUS_09980 1174 365 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_09980 1688 1176 gene locus_tag LOCUS_09990 1688 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence635 >Feature sequence636 >Feature sequence637 <1682 83 gene locus_tag LOCUS_10000 <1682 83 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:insulinase family protein >Feature sequence638 1130 243 gene locus_tag LOCUS_10010 gene prmC 1130 243 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_10010 <1682 1127 gene locus_tag LOCUS_10020 <1682 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761715.1:phosphatase PAP2 family protein >Feature sequence639 1008 271 gene locus_tag LOCUS_10030 1008 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence640 <1681 27 gene locus_tag LOCUS_10040 <1681 27 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792058.1:penicillin-binding protein 2 >Feature sequence641 >Feature sequence642 1226 159 gene locus_tag LOCUS_10050 1226 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence643 >Feature sequence644 119 1645 gene locus_tag LOCUS_10060 119 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence645 9 680 gene locus_tag LOCUS_10070 9 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence646 672 238 gene locus_tag LOCUS_10080 672 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence647 <1665 882 gene locus_tag LOCUS_10090 <1665 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801566.1:metallophosphatase >Feature sequence648 >Feature sequence649 1105 92 gene locus_tag LOCUS_10100 1105 92 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764542.1 protein_id gnl|my_center|LOCUS_10100 1657 1238 gene locus_tag LOCUS_10110 1657 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence650 <1 1511 gene locus_tag LOCUS_10120 <1 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107262.1:threonine--tRNA ligase >Feature sequence651 >Feature sequence652 >Feature sequence653 382 1050 gene locus_tag LOCUS_10130 382 1050 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657631.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence654 >Feature sequence655 333 515 gene locus_tag LOCUS_10140 333 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 <1654 703 gene locus_tag LOCUS_10150 <1654 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:TlpA disulfide reductase family protein >Feature sequence656 <1 852 gene locus_tag LOCUS_10160 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763249.1:Acyl-CoA dehydrogenase C-terminal domain-containing protein >Feature sequence657 648 16 gene locus_tag LOCUS_10170 648 16 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203459.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence658 >Feature sequence659 1617 244 gene locus_tag LOCUS_10180 1617 244 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence660 >Feature sequence661 165 1031 gene locus_tag LOCUS_10190 165 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence662 1214 690 gene locus_tag LOCUS_10200 1214 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence663 882 136 gene locus_tag LOCUS_10210 882 136 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_10210 1187 1038 gene locus_tag LOCUS_10220 1187 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence664 <1 977 gene locus_tag LOCUS_10230 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence665 >Feature sequence666 1077 172 gene locus_tag LOCUS_10240 1077 172 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence667 1403 1278 gene locus_tag LOCUS_10250 1403 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence668 >Feature sequence669 223 1479 gene locus_tag LOCUS_10260 223 1479 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839972.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence670 721 131 gene locus_tag LOCUS_10270 721 131 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_10270 <1633 949 gene locus_tag LOCUS_10280 <1633 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764082.1:DNA repair protein RadA >Feature sequence671 218 1081 gene locus_tag LOCUS_10290 218 1081 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence672 <1 1102 gene locus_tag LOCUS_10300 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202217.1:M3 family metallopeptidase 1183 1608 gene locus_tag LOCUS_10310 1183 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence673 <1 1080 gene locus_tag LOCUS_10320 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005834079.1:ATP-binding protein 1243 1626 gene locus_tag LOCUS_10330 1243 1626 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence674 335 1495 gene locus_tag LOCUS_10340 335 1495 CDS product leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962344.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence675 3 1160 gene locus_tag LOCUS_10350 3 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence676 110 442 gene locus_tag LOCUS_10360 gene yajC 110 442 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_10360 452 1426 gene locus_tag LOCUS_10370 452 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence677 >Feature sequence678 923 72 gene locus_tag LOCUS_10380 923 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence679 >Feature sequence680 1282 218 gene locus_tag LOCUS_10390 gene thiL 1282 218 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence681 1266 106 gene locus_tag LOCUS_10400 gene cydB 1266 106 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence682 >Feature sequence683 <1611 911 gene locus_tag LOCUS_10410 <1611 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203410.1:RIP metalloprotease RseP >Feature sequence684 459 917 gene locus_tag LOCUS_10420 459 917 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_10420 1438 914 gene locus_tag LOCUS_10430 gene phoE 1438 914 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence685 >Feature sequence686 >Feature sequence687 484 278 gene locus_tag LOCUS_10440 484 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <1605 524 gene locus_tag LOCUS_10450 <1605 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765038.1:phosphoribosylaminoimidazolecarboxamide formyltransferase >Feature sequence688 <1602 1097 gene locus_tag LOCUS_10460 <1602 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203378.1:NADP-specific glutamate dehydrogenase >Feature sequence689 <1 844 gene locus_tag LOCUS_10470 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109117.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence690 1175 258 gene locus_tag LOCUS_10480 1175 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence691 >Feature sequence692 56 394 gene locus_tag LOCUS_10490 56 394 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_10490 413 889 gene locus_tag LOCUS_10500 413 889 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_10500 1044 1568 gene locus_tag LOCUS_10510 1044 1568 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence693 108 620 gene locus_tag LOCUS_10520 108 620 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_10520 677 1258 gene locus_tag LOCUS_10530 677 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence694 359 829 gene locus_tag LOCUS_10540 359 829 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_10540 865 1527 gene locus_tag LOCUS_10550 865 1527 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence695 36 647 gene locus_tag LOCUS_10560 36 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 628 1218 gene locus_tag LOCUS_10570 628 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1211 1579 gene locus_tag LOCUS_10580 1211 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence696 170 982 gene locus_tag LOCUS_10590 170 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence697 <1596 1029 gene locus_tag LOCUS_10600 <1596 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249477.1:alpha/beta hydrolase-fold protein >Feature sequence698 515 976 gene locus_tag LOCUS_10610 515 976 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence699 >Feature sequence700 >Feature sequence701 1167 58 gene locus_tag LOCUS_10620 1167 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence702 205 1089 gene locus_tag LOCUS_10630 gene queG 205 1089 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence703 <1590 472 gene locus_tag LOCUS_10640 <1590 472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203255.1:efflux RND transporter permease subunit >Feature sequence704 496 1563 gene locus_tag LOCUS_10650 496 1563 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203256.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence705 766 1098 gene locus_tag LOCUS_10660 766 1098 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785761.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence706 >Feature sequence707 >Feature sequence708 <1583 1002 gene locus_tag LOCUS_10670 <1583 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203214.1:phosphoglycerate kinase >Feature sequence709 >Feature sequence710 <1580 734 gene locus_tag LOCUS_10680 <1580 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107699.1:ABC transporter ATP-binding protein >Feature sequence711 >Feature sequence712 1504 20 gene locus_tag LOCUS_10690 1504 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence713 <1576 654 gene locus_tag LOCUS_10700 <1576 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260488.1:prenyltransferase/squalene oxidase repeat-containing protein >Feature sequence714 >Feature sequence715 >Feature sequence716 <1570 452 gene locus_tag LOCUS_10710 <1570 452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763287.1:DUF4960 domain-containing protein >Feature sequence717 <1568 255 gene locus_tag LOCUS_10720 <1568 255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107882.1:tRNA lysidine(34) synthetase TilS >Feature sequence718 >Feature sequence719 >Feature sequence720 >Feature sequence721 <1561 84 gene locus_tag LOCUS_10730 <1561 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434938.1:dipeptidase >Feature sequence722 >Feature sequence723 85 1143 gene locus_tag LOCUS_10740 85 1143 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760937.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence724 >Feature sequence725 <1552 454 gene locus_tag LOCUS_10750 <1552 454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763714.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence726 >Feature sequence727 <1 667 gene locus_tag LOCUS_10760 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793275.1:glycogen/starch synthase 831 1226 gene locus_tag LOCUS_10770 831 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10770 1236 1478 gene locus_tag LOCUS_10780 1236 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10780 >Feature sequence728 300 1502 gene locus_tag LOCUS_10790 300 1502 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445164.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence729 >Feature sequence730 <1 546 gene locus_tag LOCUS_10800 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765048.1:indole-3-glycerol phosphate synthase TrpC 543 1178 gene locus_tag LOCUS_10810 543 1178 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence731 <1 1135 gene locus_tag LOCUS_10820 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000946228.1:TolC family protein >Feature sequence732 <1530 518 gene locus_tag LOCUS_10830 <1530 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109116.1:glycoside hydrolase family 28 protein >Feature sequence733 997 404 gene locus_tag LOCUS_10840 997 404 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence734 >Feature sequence735 <1 660 gene locus_tag LOCUS_10850 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767782.1:DUF4980 domain-containing protein >Feature sequence736 >Feature sequence737 >Feature sequence738 1367 168 gene locus_tag LOCUS_10860 1367 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence739 <1 1417 gene locus_tag LOCUS_10870 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890803.1:RICIN domain-containing protein >Feature sequence740 1253 684 gene locus_tag LOCUS_10880 1253 684 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence741 345 1283 gene locus_tag LOCUS_10890 345 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence742 <1 1020 gene locus_tag LOCUS_10900 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785160.1:flotillin family protein >Feature sequence743 <1 1293 gene locus_tag LOCUS_10910 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109162.1:S9 family peptidase >Feature sequence744 >Feature sequence745 1432 734 gene locus_tag LOCUS_10920 1432 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence746 >Feature sequence747 >Feature sequence748 564 172 gene locus_tag LOCUS_10930 564 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence749 <1 1249 gene locus_tag LOCUS_10940 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203750.1:DNA mismatch repair protein MutS >Feature sequence750 <1 636 gene locus_tag LOCUS_10950 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201961.1:M20 family metallo-hydrolase >Feature sequence751 >Feature sequence752 590 1498 gene locus_tag LOCUS_10960 590 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence753 <1504 243 gene locus_tag LOCUS_10970 <1504 243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444593.1:AmmeMemoRadiSam system protein B >Feature sequence754 <1503 163 gene locus_tag LOCUS_10980 <1503 163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761694.1:DUF6377 domain-containing protein >Feature sequence755 <1 939 gene locus_tag LOCUS_10990 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767220.1:methionine--tRNA ligase