>Feature sequence001 <1 1015 gene locus_tag LOCUS_00010 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005779363.1:L-fucose isomerase 1609 2166 gene locus_tag LOCUS_00020 gene frr 1609 2166 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_00020 2163 2378 gene locus_tag LOCUS_00030 2163 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2365 3150 gene locus_tag LOCUS_00040 2365 3150 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_00040 3147 4289 gene locus_tag LOCUS_00050 3147 4289 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_00050 4334 5437 gene locus_tag LOCUS_00060 gene rseP 4334 5437 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_00060 5468 6256 gene locus_tag LOCUS_00070 5468 6256 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_00070 6261 7304 gene locus_tag LOCUS_00080 gene ispG 6261 7304 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_00080 7314 11660 gene locus_tag LOCUS_00090 7314 11660 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_00090 11676 12944 gene locus_tag LOCUS_00100 11676 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13103 15007 gene locus_tag LOCUS_00110 13103 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15169 15390 gene locus_tag LOCUS_00120 15169 15390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16316 15489 gene locus_tag LOCUS_00130 16316 15489 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_00130 16502 17761 gene locus_tag LOCUS_00140 16502 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17898 17668 gene locus_tag LOCUS_00150 17898 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19803 18367 gene locus_tag LOCUS_00160 19803 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21246 19837 gene locus_tag LOCUS_00170 21246 19837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21399 22214 gene locus_tag LOCUS_00180 21399 22214 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_00180 22293 23006 gene locus_tag LOCUS_00190 22293 23006 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_00190 23017 23766 gene locus_tag LOCUS_00200 23017 23766 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063819.1 protein_id gnl|my_center|LOCUS_00200 24002 25015 gene locus_tag LOCUS_00210 gene rsgA 24002 25015 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_00210 25084 26049 gene locus_tag LOCUS_00220 25084 26049 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_00220 26642 27097 gene locus_tag LOCUS_00230 26642 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27287 27820 gene locus_tag LOCUS_00240 27287 27820 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_00240 27825 29129 gene locus_tag LOCUS_00250 27825 29129 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_00250 29126 29998 gene locus_tag LOCUS_00260 29126 29998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29999 30964 gene locus_tag LOCUS_00270 29999 30964 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722230.1 protein_id gnl|my_center|LOCUS_00270 31003 33027 gene locus_tag LOCUS_00280 31003 33027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33581 33078 gene locus_tag LOCUS_00290 gene nrdG 33581 33078 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_00290 35902 33575 gene locus_tag LOCUS_00300 35902 33575 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_00300 37218 36376 gene locus_tag LOCUS_00310 37218 36376 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_00310 37430 38740 gene locus_tag LOCUS_00320 37430 38740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38745 39488 gene locus_tag LOCUS_00330 38745 39488 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908409.1 protein_id gnl|my_center|LOCUS_00330 40676 39540 gene locus_tag LOCUS_00340 40676 39540 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_00340 41699 40770 gene locus_tag LOCUS_00350 41699 40770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42628 41741 gene locus_tag LOCUS_00360 42628 41741 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_00360 43494 42640 gene locus_tag LOCUS_00370 43494 42640 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_00370 45136 43571 gene locus_tag LOCUS_00380 45136 43571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 46843 45236 gene locus_tag LOCUS_00390 46843 45236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48688 46976 gene locus_tag LOCUS_00400 gene yesM 48688 46976 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_00400 50610 48910 gene locus_tag LOCUS_00410 50610 48910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51545 50691 gene locus_tag LOCUS_00420 51545 50691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51775 52467 gene locus_tag LOCUS_00430 51775 52467 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_00430 52436 53929 gene locus_tag LOCUS_00440 52436 53929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 53926 55470 gene locus_tag LOCUS_00450 53926 55470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 56990 55467 gene locus_tag LOCUS_00460 56990 55467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 57393 58274 gene locus_tag LOCUS_00470 gene dapA 57393 58274 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_00470 58287 59003 gene locus_tag LOCUS_00480 gene dapB 58287 59003 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_00480 59007 59699 gene locus_tag LOCUS_00490 gene dapD 59007 59699 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_00490 60571 59771 gene locus_tag LOCUS_00500 60571 59771 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462069.1 protein_id gnl|my_center|LOCUS_00500 60830 61876 gene locus_tag LOCUS_00510 60830 61876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61897 63063 gene locus_tag LOCUS_00520 61897 63063 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986990.1 protein_id gnl|my_center|LOCUS_00520 64561 63119 gene locus_tag LOCUS_00530 64561 63119 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_00530 64698 64949 gene locus_tag LOCUS_00540 64698 64949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 66333 65086 gene locus_tag LOCUS_00550 66333 65086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67307 66405 gene locus_tag LOCUS_00560 67307 66405 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_00560 68263 67307 gene locus_tag LOCUS_00570 68263 67307 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_00570 69913 68357 gene locus_tag LOCUS_00580 69913 68357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 70834 69965 gene locus_tag LOCUS_00590 70834 69965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 71103 72152 gene locus_tag LOCUS_00600 71103 72152 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_00600 72166 73173 gene locus_tag LOCUS_00610 72166 73173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 73202 74089 gene locus_tag LOCUS_00620 73202 74089 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096619.1 protein_id gnl|my_center|LOCUS_00620 75632 74415 gene locus_tag LOCUS_00630 75632 74415 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_00630 77296 75656 gene locus_tag LOCUS_00640 77296 75656 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_00640 78094 77315 gene locus_tag LOCUS_00650 78094 77315 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_00650 78698 78180 gene locus_tag LOCUS_00660 gene rimI 78698 78180 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_00660 79399 78695 gene locus_tag LOCUS_00670 gene tsaB 79399 78695 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865764.1 protein_id gnl|my_center|LOCUS_00670 79869 79396 gene locus_tag LOCUS_00680 gene tsaE 79869 79396 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_00680 81129 79891 gene locus_tag LOCUS_00690 gene galK 81129 79891 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_00690 81580 82254 gene locus_tag LOCUS_00700 81580 82254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 82352 83872 gene locus_tag LOCUS_00710 82352 83872 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016044.1 protein_id gnl|my_center|LOCUS_00710 85446 84610 gene locus_tag LOCUS_00720 85446 84610 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776771.1 protein_id gnl|my_center|LOCUS_00720 85949 85464 gene locus_tag LOCUS_00730 85949 85464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 87009 86017 gene locus_tag LOCUS_00740 87009 86017 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_00740 87523 87038 gene locus_tag LOCUS_00750 87523 87038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 91640 87630 gene locus_tag LOCUS_00760 91640 87630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 93018 91894 gene locus_tag LOCUS_00770 93018 91894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 94420 93041 gene locus_tag LOCUS_00780 94420 93041 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_00780 94719 95507 gene locus_tag LOCUS_00790 94719 95507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 95529 96461 gene locus_tag LOCUS_00800 gene metA 95529 96461 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_00800 96530 98332 gene locus_tag LOCUS_00810 96530 98332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 98910 98458 gene locus_tag LOCUS_00820 98910 98458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 99086 99274 gene locus_tag LOCUS_00830 99086 99274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 101278 99521 gene locus_tag LOCUS_00840 101278 99521 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_00840 101474 102742 gene locus_tag LOCUS_00850 101474 102742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 103765 104178 gene locus_tag LOCUS_00860 103765 104178 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329067.1 protein_id gnl|my_center|LOCUS_00860 104210 105217 gene locus_tag LOCUS_00870 104210 105217 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_00870 106371 105487 gene locus_tag LOCUS_00880 106371 105487 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_00880 107192 106368 gene locus_tag LOCUS_00890 107192 106368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 108828 107434 gene locus_tag LOCUS_00900 108828 107434 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_00900 110009 108825 gene locus_tag LOCUS_00910 110009 108825 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_00910 110806 110027 gene locus_tag LOCUS_00920 110806 110027 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_00920 111511 111095 gene locus_tag LOCUS_00930 111511 111095 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965941.1 protein_id gnl|my_center|LOCUS_00930 112425 111508 gene locus_tag LOCUS_00940 gene pyrB 112425 111508 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_00940 113065 112427 gene locus_tag LOCUS_00950 gene pyrE 113065 112427 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_00950 113793 113092 gene locus_tag LOCUS_00960 gene pyrF 113793 113092 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_00960 114704 113790 gene locus_tag LOCUS_00970 114704 113790 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_00970 115426 114695 gene locus_tag LOCUS_00980 115426 114695 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_00980 118613 115440 gene locus_tag LOCUS_00990 gene carB 118613 115440 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_00990 119891 118617 gene locus_tag LOCUS_01000 119891 118617 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_01000 121338 120223 gene locus_tag LOCUS_01010 121338 120223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 121577 123619 gene locus_tag LOCUS_01020 121577 123619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 123653 124423 gene locus_tag LOCUS_01030 123653 124423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 124531 125940 gene locus_tag LOCUS_01040 124531 125940 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_01040 125951 127171 gene locus_tag LOCUS_01050 125951 127171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 127183 128103 gene locus_tag LOCUS_01060 gene murB 127183 128103 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_01060 128122 129066 gene locus_tag LOCUS_01070 gene whiA 128122 129066 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_01070 129068 130723 gene locus_tag LOCUS_01080 129068 130723 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_01080 130757 131446 gene locus_tag LOCUS_01090 gene hitR 130757 131446 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878919.1 protein_id gnl|my_center|LOCUS_01090 131433 132803 gene locus_tag LOCUS_01100 131433 132803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 132800 133426 gene locus_tag LOCUS_01110 132800 133426 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_01110 135295 133442 gene locus_tag LOCUS_01120 135295 133442 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_01120 135522 135292 gene locus_tag LOCUS_01130 135522 135292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01130 135866 135519 gene locus_tag LOCUS_01140 135866 135519 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_01140 138873 136156 gene locus_tag LOCUS_01150 138873 136156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 140925 138985 gene locus_tag LOCUS_01160 140925 138985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 141407 141093 gene locus_tag LOCUS_01170 141407 141093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 141828 141409 gene locus_tag LOCUS_01180 141828 141409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 142553 141825 gene locus_tag LOCUS_01190 142553 141825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 142848 143612 gene locus_tag LOCUS_01200 142848 143612 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_01200 143619 144512 gene locus_tag LOCUS_01210 143619 144512 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_01210 144524 145171 gene locus_tag LOCUS_01220 144524 145171 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_01220 145236 145547 gene locus_tag LOCUS_01230 145236 145547 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_01230 145644 147824 gene locus_tag LOCUS_01240 145644 147824 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_01240 149229 148138 gene locus_tag LOCUS_01250 gene mnmA 149229 148138 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_01250 149411 149632 gene locus_tag LOCUS_01260 149411 149632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 149629 149814 gene locus_tag LOCUS_01270 149629 149814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 149900 151033 gene locus_tag LOCUS_01280 149900 151033 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_01280 151202 151459 gene locus_tag LOCUS_01290 151202 151459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 151461 151793 gene locus_tag LOCUS_01300 151461 151793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 152017 152178 gene locus_tag LOCUS_01310 gene rpmG 152017 152178 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_01310 152220 152471 gene locus_tag LOCUS_01320 152220 152471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 152489 153019 gene locus_tag LOCUS_01330 gene nusG 152489 153019 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_01330 153122 153547 gene locus_tag LOCUS_01340 gene rplK 153122 153547 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_01340 153624 154310 gene locus_tag LOCUS_01350 gene rplA 153624 154310 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_01350 154389 155747 gene locus_tag LOCUS_01360 154389 155747 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_01360 156778 156011 gene locus_tag LOCUS_01370 156778 156011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 156950 157930 gene locus_tag LOCUS_01380 156950 157930 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964544.1 protein_id gnl|my_center|LOCUS_01380 158917 158057 gene locus_tag LOCUS_01390 158917 158057 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_01390 159127 160041 gene locus_tag LOCUS_01400 159127 160041 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_01400 160913 160149 gene locus_tag LOCUS_01410 160913 160149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 161971 160913 gene locus_tag LOCUS_01420 161971 160913 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_01420 163110 161980 gene locus_tag LOCUS_01430 163110 161980 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454526.1 protein_id gnl|my_center|LOCUS_01430 164142 163129 gene locus_tag LOCUS_01440 164142 163129 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031094.1 protein_id gnl|my_center|LOCUS_01440 165119 164142 gene locus_tag LOCUS_01450 165119 164142 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797369.1 protein_id gnl|my_center|LOCUS_01450 166368 165220 gene locus_tag LOCUS_01460 166368 165220 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_01460 168767 166365 gene locus_tag LOCUS_01470 168767 166365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 169374 168784 gene locus_tag LOCUS_01480 169374 168784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 170041 169457 gene locus_tag LOCUS_01490 170041 169457 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 protein_id gnl|my_center|LOCUS_01490 170670 170086 gene locus_tag LOCUS_01500 170670 170086 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_01500 171300 170722 gene locus_tag LOCUS_01510 171300 170722 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146731.1 protein_id gnl|my_center|LOCUS_01510 173956 171356 gene locus_tag LOCUS_01520 173956 171356 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_01520 174399 175076 gene locus_tag LOCUS_01530 174399 175076 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_01530 175073 175402 gene locus_tag LOCUS_01540 gene azlD 175073 175402 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_01540 175430 177511 gene locus_tag LOCUS_01550 175430 177511 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438022.1 protein_id gnl|my_center|LOCUS_01550 177538 178644 gene locus_tag LOCUS_01560 177538 178644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_01560 178748 179881 gene locus_tag LOCUS_01570 178748 179881 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_01570 179968 180522 gene locus_tag LOCUS_01580 179968 180522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 180516 180776 gene locus_tag LOCUS_01590 180516 180776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 180899 182074 gene locus_tag LOCUS_01600 180899 182074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 182071 182268 gene locus_tag LOCUS_01610 182071 182268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 182528 183751 gene locus_tag LOCUS_01620 182528 183751 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence002 177 104 gene locus_tag LOCUS_t00010 177 104 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 898 284 gene locus_tag LOCUS_01630 gene sigH 898 284 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_01630 1882 950 gene locus_tag LOCUS_01640 gene rlmB 1882 950 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_01640 2287 1892 gene locus_tag LOCUS_01650 2287 1892 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966433.1 protein_id gnl|my_center|LOCUS_01650 3828 2293 gene locus_tag LOCUS_01660 3828 2293 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764990.1 protein_id gnl|my_center|LOCUS_01660 5729 4665 gene locus_tag LOCUS_01670 gene tsaD 5729 4665 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_01670 6366 5716 gene locus_tag LOCUS_01680 6366 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 7548 6451 gene locus_tag LOCUS_01690 gene prfB 7548 6451 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226186.1 protein_id gnl|my_center|LOCUS_01690 10288 7583 gene locus_tag LOCUS_01700 gene secA 10288 7583 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_01700 12745 10355 gene locus_tag LOCUS_01710 12745 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 13913 12738 gene locus_tag LOCUS_01720 13913 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 14874 13921 gene locus_tag LOCUS_01730 14874 13921 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_01730 15449 15081 gene locus_tag LOCUS_01740 15449 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 16033 15560 gene locus_tag LOCUS_01750 16033 15560 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_01750 16298 17128 gene locus_tag LOCUS_01760 16298 17128 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 protein_id gnl|my_center|LOCUS_01760 17474 17190 gene locus_tag LOCUS_01770 17474 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 17565 17490 gene locus_tag LOCUS_t00020 17565 17490 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18049 17660 gene locus_tag LOCUS_01780 18049 17660 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965490.1 protein_id gnl|my_center|LOCUS_01780 18288 18046 gene locus_tag LOCUS_01790 18288 18046 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_01790 20018 18285 gene locus_tag LOCUS_01800 20018 18285 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_01800 21520 20051 gene locus_tag LOCUS_01810 21520 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 22937 21531 gene locus_tag LOCUS_01820 22937 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 24440 22953 gene locus_tag LOCUS_01830 24440 22953 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_01830 25289 24615 gene locus_tag LOCUS_01840 25289 24615 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 protein_id gnl|my_center|LOCUS_01840 27443 25296 gene locus_tag LOCUS_01850 27443 25296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 27924 27436 gene locus_tag LOCUS_01860 27924 27436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 29753 27921 gene locus_tag LOCUS_01870 29753 27921 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_01870 30264 29899 gene locus_tag LOCUS_01880 gene spoVAE 30264 29899 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_01880 31279 30257 gene locus_tag LOCUS_01890 gene spoVAD 31279 30257 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_01890 31719 31270 gene locus_tag LOCUS_01900 gene spoVAC 31719 31270 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_01900 31864 31697 gene locus_tag LOCUS_01910 31864 31697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 32060 32569 gene locus_tag LOCUS_01920 gene purE 32060 32569 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_01920 32571 33284 gene locus_tag LOCUS_01930 32571 33284 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_01930 33284 34714 gene locus_tag LOCUS_01940 gene purF 33284 34714 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_01940 34711 35754 gene locus_tag LOCUS_01950 gene purM 34711 35754 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 protein_id gnl|my_center|LOCUS_01950 35751 36365 gene locus_tag LOCUS_01960 gene purN 35751 36365 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01960 36362 37072 gene locus_tag LOCUS_01970 36362 37072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 37094 38278 gene locus_tag LOCUS_01980 37094 38278 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_01980 38303 39571 gene locus_tag LOCUS_01990 gene purD 38303 39571 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_01990 39573 43259 gene locus_tag LOCUS_02000 39573 43259 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_02000 44770 43652 gene locus_tag LOCUS_02010 44770 43652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 44975 48016 gene locus_tag LOCUS_02020 44975 48016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 48144 49442 gene locus_tag LOCUS_02030 48144 49442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 49446 53285 gene locus_tag LOCUS_02040 49446 53285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 53426 55651 gene locus_tag LOCUS_02050 gene helD 53426 55651 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964344.1 protein_id gnl|my_center|LOCUS_02050 55723 56697 gene locus_tag LOCUS_02060 55723 56697 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890534.1 protein_id gnl|my_center|LOCUS_02060 58640 56772 gene locus_tag LOCUS_02070 gene htpG 58640 56772 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_02070 58975 60996 gene locus_tag LOCUS_02080 58975 60996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 61080 61346 gene locus_tag LOCUS_02090 61080 61346 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391580.1 protein_id gnl|my_center|LOCUS_02090 61726 61349 gene locus_tag LOCUS_02100 61726 61349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 61916 63673 gene locus_tag LOCUS_02110 61916 63673 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_02110 65132 64281 gene locus_tag LOCUS_02120 65132 64281 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_02120 65295 66254 gene locus_tag LOCUS_02130 65295 66254 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_02130 67867 66245 gene locus_tag LOCUS_02140 67867 66245 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 protein_id gnl|my_center|LOCUS_02140 68251 67973 gene locus_tag LOCUS_02150 68251 67973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 68468 68268 gene locus_tag LOCUS_02160 68468 68268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 69442 68546 gene locus_tag LOCUS_02170 69442 68546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 70168 69497 gene locus_tag LOCUS_02180 70168 69497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 71438 70161 gene locus_tag LOCUS_02190 71438 70161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 72091 71435 gene locus_tag LOCUS_02200 72091 71435 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_02200 72285 74714 gene locus_tag LOCUS_02210 72285 74714 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_02210 74725 75510 gene locus_tag LOCUS_02220 74725 75510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 76517 75564 gene locus_tag LOCUS_02230 76517 75564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 79004 76608 gene locus_tag LOCUS_02240 gene pheT 79004 76608 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_02240 80044 79019 gene locus_tag LOCUS_02250 gene pheS 80044 79019 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_02250 81132 80371 gene locus_tag LOCUS_02260 81132 80371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 81467 81198 gene locus_tag LOCUS_02270 81467 81198 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564007.1 protein_id gnl|my_center|LOCUS_02270 82772 81615 gene locus_tag LOCUS_02280 82772 81615 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_02280 82886 83434 gene locus_tag LOCUS_02290 82886 83434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 83457 84596 gene locus_tag LOCUS_02300 83457 84596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 85410 84670 gene locus_tag LOCUS_02310 85410 84670 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262966.1 protein_id gnl|my_center|LOCUS_02310 86286 85417 gene locus_tag LOCUS_02320 86286 85417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 87370 86300 gene locus_tag LOCUS_02330 87370 86300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 87530 88717 gene locus_tag LOCUS_02340 gene nagA 87530 88717 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_02340 88714 89619 gene locus_tag LOCUS_02350 88714 89619 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_02350 90450 89680 gene locus_tag LOCUS_02360 90450 89680 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_02360 91290 90568 gene locus_tag LOCUS_02370 91290 90568 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_02370 92740 91277 gene locus_tag LOCUS_02380 92740 91277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 94254 92839 gene locus_tag LOCUS_02390 94254 92839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 94703 94521 gene locus_tag LOCUS_02400 94703 94521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 97946 94866 gene locus_tag LOCUS_02410 97946 94866 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_02410 98173 98248 gene locus_tag LOCUS_t00030 98173 98248 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 1888 104 gene locus_tag LOCUS_02420 1888 104 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_02420 2583 1885 gene locus_tag LOCUS_02430 2583 1885 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_02430 2851 2769 gene locus_tag LOCUS_t00040 2851 2769 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3061 3516 gene locus_tag LOCUS_02440 3061 3516 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 protein_id gnl|my_center|LOCUS_02440 3518 4012 gene locus_tag LOCUS_02450 gene ruvC 3518 4012 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_02450 4022 4624 gene locus_tag LOCUS_02460 gene ruvA 4022 4624 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_02460 4626 5456 gene locus_tag LOCUS_02470 4626 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5747 5463 gene locus_tag LOCUS_02480 5747 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 6198 5791 gene locus_tag LOCUS_02490 6198 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6497 8371 gene locus_tag LOCUS_02500 6497 8371 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836902.1 protein_id gnl|my_center|LOCUS_02500 8520 9836 gene locus_tag LOCUS_02510 8520 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 9837 10982 gene locus_tag LOCUS_02520 9837 10982 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_02520 10994 13069 gene locus_tag LOCUS_02530 10994 13069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_02530 15113 13458 gene locus_tag LOCUS_02540 15113 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 16258 15131 gene locus_tag LOCUS_02550 16258 15131 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805158.1 protein_id gnl|my_center|LOCUS_02550 18034 16424 gene locus_tag LOCUS_02560 18034 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 19772 18105 gene locus_tag LOCUS_02570 gene abc-f 19772 18105 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070104985.1 protein_id gnl|my_center|LOCUS_02570 22673 20127 gene locus_tag LOCUS_02580 22673 20127 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_02580 23240 22713 gene locus_tag LOCUS_02590 23240 22713 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102490.1 protein_id gnl|my_center|LOCUS_02590 25259 23259 gene locus_tag LOCUS_02600 25259 23259 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_02600 25422 26825 gene locus_tag LOCUS_02610 25422 26825 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_02610 27980 26931 gene locus_tag LOCUS_02620 27980 26931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 29023 27977 gene locus_tag LOCUS_02630 29023 27977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 29289 29062 gene locus_tag LOCUS_02640 29289 29062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 29431 29279 gene locus_tag LOCUS_02650 29431 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 29803 29669 gene locus_tag LOCUS_02660 gene rpmH 29803 29669 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359452.1 protein_id gnl|my_center|LOCUS_02660 30323 31306 gene locus_tag LOCUS_02670 gene pta 30323 31306 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_02670 31325 32533 gene locus_tag LOCUS_02680 31325 32533 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_02680 32626 33132 gene locus_tag LOCUS_02690 32626 33132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 33135 33326 gene locus_tag LOCUS_02700 gene rpmF 33135 33326 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_02700 33536 34975 gene locus_tag LOCUS_02710 33536 34975 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_02710 34988 35374 gene locus_tag LOCUS_02720 34988 35374 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_02720 35391 36236 gene locus_tag LOCUS_02730 35391 36236 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_02730 36292 37776 gene locus_tag LOCUS_02740 36292 37776 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_02740 39264 38284 gene locus_tag LOCUS_02750 39264 38284 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989747.1 protein_id gnl|my_center|LOCUS_02750 39352 39564 gene locus_tag LOCUS_02760 39352 39564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 39885 40052 gene locus_tag LOCUS_02770 39885 40052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 40295 40429 gene locus_tag LOCUS_02780 40295 40429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 40494 41996 gene locus_tag LOCUS_02790 40494 41996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 42339 42010 gene locus_tag LOCUS_02800 42339 42010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 43401 42547 gene locus_tag LOCUS_02810 43401 42547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 44715 43528 gene locus_tag LOCUS_02820 44715 43528 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_02820 46574 44763 gene locus_tag LOCUS_02830 46574 44763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 46839 47474 gene locus_tag LOCUS_02840 46839 47474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 47509 52461 gene locus_tag LOCUS_02850 47509 52461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 52511 57781 gene locus_tag LOCUS_02860 52511 57781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 57978 58733 gene locus_tag LOCUS_02870 57978 58733 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_02870 58860 59519 gene locus_tag LOCUS_02880 58860 59519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 59512 60642 gene locus_tag LOCUS_02890 59512 60642 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_02890 60664 61233 gene locus_tag LOCUS_02900 60664 61233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 61234 62205 gene locus_tag LOCUS_02910 61234 62205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 62263 62898 gene locus_tag LOCUS_02920 62263 62898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 63041 64231 gene locus_tag LOCUS_02930 63041 64231 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_02930 64233 65366 gene locus_tag LOCUS_02940 gene glgD 64233 65366 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_02940 65388 67079 gene locus_tag LOCUS_02950 gene glgA 65388 67079 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_02950 67288 68109 gene locus_tag LOCUS_02960 67288 68109 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_02960 68335 70362 gene locus_tag LOCUS_02970 68335 70362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 71600 70746 gene locus_tag LOCUS_02980 71600 70746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 73780 71597 gene locus_tag LOCUS_02990 gene recQ 73780 71597 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 protein_id gnl|my_center|LOCUS_02990 75210 74035 gene locus_tag LOCUS_03000 75210 74035 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_03000 76280 75204 gene locus_tag LOCUS_03010 76280 75204 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356041.1 protein_id gnl|my_center|LOCUS_03010 76883 76284 gene locus_tag LOCUS_03020 76883 76284 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 protein_id gnl|my_center|LOCUS_03020 77605 76880 gene locus_tag LOCUS_03030 77605 76880 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082968.1 protein_id gnl|my_center|LOCUS_03030 78704 77898 gene locus_tag LOCUS_03040 78704 77898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 78969 79913 gene locus_tag LOCUS_03050 78969 79913 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_03050 79927 80883 gene locus_tag LOCUS_03060 79927 80883 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_03060 80990 82816 gene locus_tag LOCUS_03070 80990 82816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 84509 83601 gene locus_tag LOCUS_03080 84509 83601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_03080 85194 84496 gene locus_tag LOCUS_03090 85194 84496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_03090 86436 85231 gene locus_tag LOCUS_03100 86436 85231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 88029 86500 gene locus_tag LOCUS_03110 88029 86500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 89160 88048 gene locus_tag LOCUS_03120 89160 88048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 90265 89144 gene locus_tag LOCUS_03130 gene vexC 90265 89144 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069849.1 protein_id gnl|my_center|LOCUS_03130 91356 90262 gene locus_tag LOCUS_03140 91356 90262 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_03140 92223 91360 gene locus_tag LOCUS_03150 gene rsmI 92223 91360 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583798.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence004 2430 1156 gene locus_tag LOCUS_03160 2430 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2655 2449 gene locus_tag LOCUS_03170 2655 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3458 3171 gene locus_tag LOCUS_03180 3458 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4004 5341 gene locus_tag LOCUS_03190 4004 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 5463 5750 gene locus_tag LOCUS_03200 5463 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5890 6546 gene locus_tag LOCUS_03210 5890 6546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644830.1 protein_id gnl|my_center|LOCUS_03210 6539 7867 gene locus_tag LOCUS_03220 6539 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 7879 8781 gene locus_tag LOCUS_03230 7879 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10274 9438 gene locus_tag LOCUS_03240 10274 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 12402 11134 gene locus_tag LOCUS_03250 12402 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 12577 12422 gene locus_tag LOCUS_03260 12577 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 12816 12547 gene locus_tag LOCUS_03270 12816 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 13872 12895 gene locus_tag LOCUS_03280 13872 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 14885 14031 gene locus_tag LOCUS_03290 14885 14031 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_03290 16454 15141 gene locus_tag LOCUS_03300 16454 15141 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_03300 16977 16432 gene locus_tag LOCUS_03310 16977 16432 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257362.1 protein_id gnl|my_center|LOCUS_03310 18145 16970 gene locus_tag LOCUS_03320 18145 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 19373 18165 gene locus_tag LOCUS_03330 19373 18165 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_03330 19753 19373 gene locus_tag LOCUS_03340 19753 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 21781 20570 gene locus_tag LOCUS_03350 21781 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 22929 21802 gene locus_tag LOCUS_03360 22929 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 23974 22958 gene locus_tag LOCUS_03370 23974 22958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 25220 24030 gene locus_tag LOCUS_03380 25220 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 26302 25220 gene locus_tag LOCUS_03390 26302 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 26739 26503 gene locus_tag LOCUS_03400 26739 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 27173 27358 gene locus_tag LOCUS_03410 27173 27358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 27493 28479 gene locus_tag LOCUS_03420 27493 28479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 28548 29756 gene locus_tag LOCUS_03430 28548 29756 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_03430 29756 30649 gene locus_tag LOCUS_03440 29756 30649 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846481.1 protein_id gnl|my_center|LOCUS_03440 30646 31494 gene locus_tag LOCUS_03450 30646 31494 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259004.1 protein_id gnl|my_center|LOCUS_03450 31498 33303 gene locus_tag LOCUS_03460 31498 33303 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994174.1 protein_id gnl|my_center|LOCUS_03460 33308 34312 gene locus_tag LOCUS_03470 gene malR 33308 34312 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_03470 34966 34469 gene locus_tag LOCUS_03480 34966 34469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 35346 34972 gene locus_tag LOCUS_03490 35346 34972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 35943 36569 gene locus_tag LOCUS_03500 35943 36569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 36647 36874 gene locus_tag LOCUS_03510 36647 36874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 36879 37367 gene locus_tag LOCUS_03520 36879 37367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 37746 38333 gene locus_tag LOCUS_03530 37746 38333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 39002 38472 gene locus_tag LOCUS_03540 39002 38472 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_03540 39187 39113 gene locus_tag LOCUS_t00050 39187 39113 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39557 39306 gene locus_tag LOCUS_03550 39557 39306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 39785 41923 gene locus_tag LOCUS_03560 gene helD 39785 41923 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948433.1 protein_id gnl|my_center|LOCUS_03560 41925 43160 gene locus_tag LOCUS_03570 41925 43160 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_03570 43157 44746 gene locus_tag LOCUS_03580 43157 44746 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_03580 44752 45960 gene locus_tag LOCUS_03590 44752 45960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 46083 46156 gene locus_tag LOCUS_t00060 46083 46156 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46160 46232 gene locus_tag LOCUS_t00070 46160 46232 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 46437 47276 gene locus_tag LOCUS_03600 46437 47276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 47295 47537 gene locus_tag LOCUS_03610 47295 47537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 48806 47943 gene locus_tag LOCUS_03620 48806 47943 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_03620 50466 48961 gene locus_tag LOCUS_03630 50466 48961 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_03630 51458 50526 gene locus_tag LOCUS_03640 51458 50526 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_03640 52424 51477 gene locus_tag LOCUS_03650 52424 51477 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_03650 52585 54021 gene locus_tag LOCUS_03660 52585 54021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 54041 55513 gene locus_tag LOCUS_03670 54041 55513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 57363 55597 gene locus_tag LOCUS_03680 57363 55597 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_03680 58799 57789 gene locus_tag LOCUS_03690 58799 57789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 59840 58803 gene locus_tag LOCUS_03700 59840 58803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 59988 60506 gene locus_tag LOCUS_03710 59988 60506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 60654 61949 gene locus_tag LOCUS_03720 60654 61949 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680701.1 protein_id gnl|my_center|LOCUS_03720 63440 62007 gene locus_tag LOCUS_03730 63440 62007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 64481 63594 gene locus_tag LOCUS_03740 gene dapA 64481 63594 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_03740 64798 65721 gene locus_tag LOCUS_03750 gene argC 64798 65721 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_03750 65735 66949 gene locus_tag LOCUS_03760 gene argJ 65735 66949 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_03760 66962 67828 gene locus_tag LOCUS_03770 gene argB 66962 67828 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_03770 67825 68994 gene locus_tag LOCUS_03780 67825 68994 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_03780 68991 69896 gene locus_tag LOCUS_03790 gene argF 68991 69896 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_03790 69914 70972 gene locus_tag LOCUS_03800 gene carA 69914 70972 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_03800 70977 75014 gene locus_tag LOCUS_03810 gene carB 70977 75014 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862003.1 protein_id gnl|my_center|LOCUS_03810 75230 75442 gene locus_tag LOCUS_03820 75230 75442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 76916 75492 gene locus_tag LOCUS_03830 gene glnA 76916 75492 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_03830 77856 77020 gene locus_tag LOCUS_03840 77856 77020 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_03840 79049 77952 gene locus_tag LOCUS_03850 79049 77952 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_03850 80074 79190 gene locus_tag LOCUS_03860 gene miaA 80074 79190 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_03860 80263 81138 gene locus_tag LOCUS_03870 80263 81138 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_03870 81159 81995 gene locus_tag LOCUS_03880 81159 81995 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_03880 81992 83017 gene locus_tag LOCUS_03890 81992 83017 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840143.1 protein_id gnl|my_center|LOCUS_03890 83014 83490 gene locus_tag LOCUS_03900 gene rlmH 83014 83490 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_03900 83646 84932 gene locus_tag LOCUS_03910 83646 84932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 85005 85700 gene locus_tag LOCUS_03920 85005 85700 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_03920 86016 86282 gene locus_tag LOCUS_03930 86016 86282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 86263 86679 gene locus_tag LOCUS_03940 gene ytfJ 86263 86679 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_03940 87779 86727 gene locus_tag LOCUS_03950 87779 86727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 88035 87796 gene locus_tag LOCUS_03960 88035 87796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence005 1031 783 gene locus_tag LOCUS_03970 1031 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2894 1092 gene locus_tag LOCUS_03980 2894 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3151 3540 gene locus_tag LOCUS_03990 3151 3540 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_03990 4350 3637 gene locus_tag LOCUS_04000 4350 3637 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048397.1 protein_id gnl|my_center|LOCUS_04000 4790 6793 gene locus_tag LOCUS_04010 gene metG 4790 6793 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_04010 6869 8374 gene locus_tag LOCUS_04020 6869 8374 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_04020 9100 8453 gene locus_tag LOCUS_04030 9100 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10013 9138 gene locus_tag LOCUS_04040 10013 9138 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_04040 10640 10026 gene locus_tag LOCUS_04050 gene udk 10640 10026 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648617.1 protein_id gnl|my_center|LOCUS_04050 11550 10672 gene locus_tag LOCUS_04060 11550 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 12562 11684 gene locus_tag LOCUS_04070 12562 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 14329 12626 gene locus_tag LOCUS_04080 gene recN 14329 12626 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660689.1 protein_id gnl|my_center|LOCUS_04080 14833 14375 gene locus_tag LOCUS_04090 14833 14375 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_04090 15770 14964 gene locus_tag LOCUS_04100 15770 14964 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_04100 17619 15751 gene locus_tag LOCUS_04110 gene dxs 17619 15751 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_04110 18543 17638 gene locus_tag LOCUS_04120 18543 17638 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_04120 18764 18540 gene locus_tag LOCUS_04130 18764 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 19975 18761 gene locus_tag LOCUS_04140 gene xseA 19975 18761 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 protein_id gnl|my_center|LOCUS_04140 20822 19968 gene locus_tag LOCUS_04150 gene folD 20822 19968 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_04150 21766 20822 gene locus_tag LOCUS_04160 21766 20822 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_04160 22164 21766 gene locus_tag LOCUS_04170 gene nusB 22164 21766 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_04170 23180 22212 gene locus_tag LOCUS_04180 23180 22212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 23831 23184 gene locus_tag LOCUS_04190 23831 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 24442 23927 gene locus_tag LOCUS_04200 24442 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 24794 24426 gene locus_tag LOCUS_04210 24794 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 24967 24791 gene locus_tag LOCUS_04220 24967 24791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 26086 24974 gene locus_tag LOCUS_04230 26086 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 26466 26083 gene locus_tag LOCUS_04240 gene spoIIIAD 26466 26083 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_04240 26667 26470 gene locus_tag LOCUS_04250 26667 26470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 27195 26683 gene locus_tag LOCUS_04260 27195 26683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 28070 27186 gene locus_tag LOCUS_04270 gene spoIIIAA 28070 27186 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_04270 28721 28164 gene locus_tag LOCUS_04280 28721 28164 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832140.1 protein_id gnl|my_center|LOCUS_04280 29757 28711 gene locus_tag LOCUS_04290 gene mutY 29757 28711 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_04290 30269 29775 gene locus_tag LOCUS_04300 30269 29775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 32112 30325 gene locus_tag LOCUS_04310 32112 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 32438 34789 gene locus_tag LOCUS_04320 32438 34789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 35914 34889 gene locus_tag LOCUS_04330 35914 34889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 36171 36809 gene locus_tag LOCUS_04340 36171 36809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 36925 37623 gene locus_tag LOCUS_04350 36925 37623 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_04350 38325 37669 gene locus_tag LOCUS_04360 38325 37669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 39179 38322 gene locus_tag LOCUS_04370 39179 38322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 39830 39225 gene locus_tag LOCUS_04380 39830 39225 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_04380 40577 39999 gene locus_tag LOCUS_04390 40577 39999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 41392 40574 gene locus_tag LOCUS_04400 41392 40574 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_04400 41992 41408 gene locus_tag LOCUS_04410 gene rsxA 41992 41408 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_04410 42630 41995 gene locus_tag LOCUS_04420 42630 41995 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_04420 43559 42627 gene locus_tag LOCUS_04430 43559 42627 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_04430 44884 43556 gene locus_tag LOCUS_04440 gene rsxC 44884 43556 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_04440 45481 44885 gene locus_tag LOCUS_04450 45481 44885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 47238 45643 gene locus_tag LOCUS_04460 47238 45643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 47752 47228 gene locus_tag LOCUS_04470 gene rimM 47752 47228 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_04470 48522 47749 gene locus_tag LOCUS_04480 48522 47749 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_04480 49884 48532 gene locus_tag LOCUS_04490 49884 48532 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584098.1 protein_id gnl|my_center|LOCUS_04490 50673 49948 gene locus_tag LOCUS_04500 gene nagB 50673 49948 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_04500 51850 50966 gene locus_tag LOCUS_04510 51850 50966 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_04510 52572 51925 gene locus_tag LOCUS_04520 52572 51925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 53379 52597 gene locus_tag LOCUS_04530 53379 52597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 53723 54427 gene locus_tag LOCUS_04540 53723 54427 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616157.1 protein_id gnl|my_center|LOCUS_04540 55005 54433 gene locus_tag LOCUS_04550 55005 54433 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 protein_id gnl|my_center|LOCUS_04550 55241 55023 gene locus_tag LOCUS_04560 55241 55023 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_04560 55728 55252 gene locus_tag LOCUS_04570 55728 55252 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809105.1 protein_id gnl|my_center|LOCUS_04570 56254 55778 gene locus_tag LOCUS_04580 56254 55778 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 protein_id gnl|my_center|LOCUS_04580 56790 56266 gene locus_tag LOCUS_04590 56790 56266 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_04590 57408 57007 gene locus_tag LOCUS_04600 57408 57007 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_04600 59078 57591 gene locus_tag LOCUS_04610 gene glpK 59078 57591 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_04610 60002 59112 gene locus_tag LOCUS_04620 60002 59112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 61815 60148 gene locus_tag LOCUS_04630 61815 60148 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_04630 62717 61911 gene locus_tag LOCUS_04640 gene noc 62717 61911 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_04640 62926 63738 gene locus_tag LOCUS_04650 62926 63738 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476368.1 protein_id gnl|my_center|LOCUS_04650 63768 64934 gene locus_tag LOCUS_04660 gene ogl 63768 64934 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_04660 66370 65150 gene locus_tag LOCUS_04670 66370 65150 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964998.1 protein_id gnl|my_center|LOCUS_04670 66519 67667 gene locus_tag LOCUS_04680 gene mrfB 66519 67667 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_04680 67688 68437 gene locus_tag LOCUS_04690 67688 68437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 70552 68510 gene locus_tag LOCUS_04700 70552 68510 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_04700 71228 70662 gene locus_tag LOCUS_04710 71228 70662 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_04710 71800 71225 gene locus_tag LOCUS_04720 71800 71225 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence006 1719 148 gene locus_tag LOCUS_04730 1719 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2335 1721 gene locus_tag LOCUS_04740 2335 1721 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930501.1 protein_id gnl|my_center|LOCUS_04740 2835 2332 gene locus_tag LOCUS_04750 2835 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2993 4006 gene locus_tag LOCUS_04760 2993 4006 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_04760 4807 4037 gene locus_tag LOCUS_04770 4807 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389995.1 protein_id gnl|my_center|LOCUS_04770 6055 4919 gene locus_tag LOCUS_04780 6055 4919 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_04780 7563 6052 gene locus_tag LOCUS_04790 gene gltX 7563 6052 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_04790 8841 8020 gene locus_tag LOCUS_04800 8841 8020 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_04800 8994 10004 gene locus_tag LOCUS_04810 8994 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 10051 10425 gene locus_tag LOCUS_04820 10051 10425 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_04820 11058 10528 gene locus_tag LOCUS_04830 11058 10528 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829402.1 protein_id gnl|my_center|LOCUS_04830 11319 11098 gene locus_tag LOCUS_04840 11319 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 11233 11655 gene locus_tag LOCUS_04850 11233 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_04850 11684 11941 gene locus_tag LOCUS_04860 11684 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 12836 12192 gene locus_tag LOCUS_04870 gene hisIE 12836 12192 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_04870 13599 12823 gene locus_tag LOCUS_04880 gene hisF 13599 12823 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_04880 14324 13602 gene locus_tag LOCUS_04890 gene hisA 14324 13602 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_04890 14941 14321 gene locus_tag LOCUS_04900 gene hisH 14941 14321 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905832.1 protein_id gnl|my_center|LOCUS_04900 15528 14938 gene locus_tag LOCUS_04910 gene hisB 15528 14938 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 protein_id gnl|my_center|LOCUS_04910 16589 15525 gene locus_tag LOCUS_04920 gene hisC 16589 15525 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_04920 17863 16586 gene locus_tag LOCUS_04930 gene hisD 17863 16586 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_04930 18480 17860 gene locus_tag LOCUS_04940 gene hisG 18480 17860 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_04940 19544 18474 gene locus_tag LOCUS_04950 19544 18474 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949109.1 protein_id gnl|my_center|LOCUS_04950 20969 19944 gene locus_tag LOCUS_04960 20969 19944 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_04960 21988 21026 gene locus_tag LOCUS_04970 21988 21026 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083301.1 protein_id gnl|my_center|LOCUS_04970 23004 22012 gene locus_tag LOCUS_04980 23004 22012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 23173 23757 gene locus_tag LOCUS_04990 23173 23757 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_04990 25728 23851 gene locus_tag LOCUS_05000 25728 23851 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460094.1 protein_id gnl|my_center|LOCUS_05000 25963 25721 gene locus_tag LOCUS_05010 25963 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 26733 25978 gene locus_tag LOCUS_05020 gene fecE 26733 25978 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175457.1 protein_id gnl|my_center|LOCUS_05020 27725 26727 gene locus_tag LOCUS_05030 27725 26727 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204710.1 protein_id gnl|my_center|LOCUS_05030 28651 27722 gene locus_tag LOCUS_05040 28651 27722 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156774516.1 protein_id gnl|my_center|LOCUS_05040 28737 28961 gene locus_tag LOCUS_05050 28737 28961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 29119 30828 gene locus_tag LOCUS_05060 gene argS 29119 30828 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_05060 30864 31865 gene locus_tag LOCUS_05070 gene manA 30864 31865 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_05070 31890 33200 gene locus_tag LOCUS_05080 gene melA 31890 33200 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_05080 33501 33280 gene locus_tag LOCUS_05090 33501 33280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 33702 36533 gene locus_tag LOCUS_05100 33702 36533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 36605 37366 gene locus_tag LOCUS_05110 36605 37366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 37450 37995 gene locus_tag LOCUS_05120 37450 37995 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_05120 38015 39748 gene locus_tag LOCUS_05130 38015 39748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 39762 40799 gene locus_tag LOCUS_05140 39762 40799 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_05140 40799 41362 gene locus_tag LOCUS_05150 40799 41362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_05150 42589 41546 gene locus_tag LOCUS_05160 42589 41546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_05160 43403 42609 gene locus_tag LOCUS_05170 43403 42609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_05170 44215 43397 gene locus_tag LOCUS_05180 44215 43397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_05180 45314 44205 gene locus_tag LOCUS_05190 45314 44205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_05190 45875 45333 gene locus_tag LOCUS_05200 45875 45333 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_05200 46339 49182 gene locus_tag LOCUS_05210 46339 49182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 49306 50559 gene locus_tag LOCUS_05220 49306 50559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 50578 51147 gene locus_tag LOCUS_05230 50578 51147 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_05230 51301 51882 gene locus_tag LOCUS_05240 51301 51882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 54192 51988 gene locus_tag LOCUS_05250 54192 51988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 54469 55416 gene locus_tag LOCUS_05260 54469 55416 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_05260 55434 56324 gene locus_tag LOCUS_05270 55434 56324 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_05270 56370 57959 gene locus_tag LOCUS_05280 56370 57959 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 protein_id gnl|my_center|LOCUS_05280 58664 60859 gene locus_tag LOCUS_05290 58664 60859 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_05290 60856 61731 gene locus_tag LOCUS_05300 60856 61731 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 protein_id gnl|my_center|LOCUS_05300 62285 61860 gene locus_tag LOCUS_05310 62285 61860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 62794 62390 gene locus_tag LOCUS_05320 62794 62390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 63821 63123 gene locus_tag LOCUS_05330 63821 63123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 64752 63844 gene locus_tag LOCUS_05340 64752 63844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 65661 64780 gene locus_tag LOCUS_05350 65661 64780 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760477.1 protein_id gnl|my_center|LOCUS_05350 65912 66568 gene locus_tag LOCUS_05360 65912 66568 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_05360 66650 67195 gene locus_tag LOCUS_05370 66650 67195 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263641.1 protein_id gnl|my_center|LOCUS_05370 67880 67470 gene locus_tag LOCUS_05380 67880 67470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 68230 67904 gene locus_tag LOCUS_05390 68230 67904 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_05390 69550 68585 gene locus_tag LOCUS_05400 69550 68585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 70149 69547 gene locus_tag LOCUS_05410 70149 69547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 70462 70142 gene locus_tag LOCUS_05420 70462 70142 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_05420 70570 70746 gene locus_tag LOCUS_05430 70570 70746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 71127 71279 gene locus_tag LOCUS_05440 71127 71279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence007 788 1975 gene locus_tag LOCUS_05450 788 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2059 2859 gene locus_tag LOCUS_05460 2059 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2856 3602 gene locus_tag LOCUS_05470 2856 3602 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197405.1 protein_id gnl|my_center|LOCUS_05470 3606 4322 gene locus_tag LOCUS_05480 gene cps4B 3606 4322 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_05480 4499 5749 gene locus_tag LOCUS_05490 4499 5749 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_05490 5782 7431 gene locus_tag LOCUS_05500 5782 7431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_05500 8115 7534 gene locus_tag LOCUS_05510 8115 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8451 8131 gene locus_tag LOCUS_05520 8451 8131 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257803.1 protein_id gnl|my_center|LOCUS_05520 9604 8894 gene locus_tag LOCUS_05530 9604 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 10570 9842 gene locus_tag LOCUS_05540 10570 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10702 11739 gene locus_tag LOCUS_05550 10702 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 13483 11879 gene locus_tag LOCUS_05560 gene dnaX 13483 11879 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_05560 14475 13504 gene locus_tag LOCUS_05570 14475 13504 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195516.1 protein_id gnl|my_center|LOCUS_05570 14727 15803 gene locus_tag LOCUS_05580 14727 15803 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_05580 15863 17269 gene locus_tag LOCUS_05590 15863 17269 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_05590 17368 17508 gene locus_tag LOCUS_05600 gene scfA 17368 17508 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_05600 17580 18950 gene locus_tag LOCUS_05610 gene scfB 17580 18950 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_05610 18996 19664 gene locus_tag LOCUS_05620 18996 19664 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_05620 19768 20043 gene locus_tag LOCUS_05630 19768 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 20059 21021 gene locus_tag LOCUS_05640 20059 21021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_05640 21011 21772 gene locus_tag LOCUS_05650 21011 21772 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_05650 21774 22397 gene locus_tag LOCUS_05660 21774 22397 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_05660 22464 23846 gene locus_tag LOCUS_05670 22464 23846 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_05670 24534 23920 gene locus_tag LOCUS_05680 24534 23920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 26484 24535 gene locus_tag LOCUS_05690 26484 24535 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_05690 27006 26500 gene locus_tag LOCUS_05700 27006 26500 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_05700 28322 27054 gene locus_tag LOCUS_05710 28322 27054 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_05710 29384 28338 gene locus_tag LOCUS_05720 29384 28338 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578002.1 protein_id gnl|my_center|LOCUS_05720 30701 29475 gene locus_tag LOCUS_05730 30701 29475 CDS product YidE/YbjL duplication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280515.1 protein_id gnl|my_center|LOCUS_05730 32318 30723 gene locus_tag LOCUS_05740 32318 30723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 33007 32333 gene locus_tag LOCUS_05750 33007 32333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 33859 33026 gene locus_tag LOCUS_05760 33859 33026 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_05760 34880 33852 gene locus_tag LOCUS_05770 34880 33852 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_05770 35871 34873 gene locus_tag LOCUS_05780 35871 34873 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_05780 36293 35859 gene locus_tag LOCUS_05790 36293 35859 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_05790 38278 36284 gene locus_tag LOCUS_05800 38278 36284 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_05800 38680 38294 gene locus_tag LOCUS_05810 38680 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 39464 38673 gene locus_tag LOCUS_05820 39464 38673 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_05820 40443 39499 gene locus_tag LOCUS_05830 40443 39499 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949073.1 protein_id gnl|my_center|LOCUS_05830 41735 40836 gene locus_tag LOCUS_05840 gene murQ 41735 40836 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 protein_id gnl|my_center|LOCUS_05840 42705 41749 gene locus_tag LOCUS_05850 42705 41749 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_05850 42877 44046 gene locus_tag LOCUS_05860 42877 44046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 44841 44107 gene locus_tag LOCUS_05870 44841 44107 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_05870 45595 44855 gene locus_tag LOCUS_05880 45595 44855 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_05880 46556 45600 gene locus_tag LOCUS_05890 46556 45600 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439905.1 protein_id gnl|my_center|LOCUS_05890 47213 46671 gene locus_tag LOCUS_05900 47213 46671 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_05900 48246 47215 gene locus_tag LOCUS_05910 48246 47215 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_05910 48988 48260 gene locus_tag LOCUS_05920 48988 48260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 49970 48975 gene locus_tag LOCUS_05930 49970 48975 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110811.1 protein_id gnl|my_center|LOCUS_05930 50123 51274 gene locus_tag LOCUS_05940 50123 51274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 52856 51612 gene locus_tag LOCUS_05950 52856 51612 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_05950 54318 52873 gene locus_tag LOCUS_05960 54318 52873 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_05960 55679 54321 gene locus_tag LOCUS_05970 gene glmL 55679 54321 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_05970 56110 55676 gene locus_tag LOCUS_05980 gene glmS 56110 55676 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_05980 56727 56164 gene locus_tag LOCUS_05990 56727 56164 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_05990 57589 56744 gene locus_tag LOCUS_06000 57589 56744 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_06000 58452 57586 gene locus_tag LOCUS_06010 gene citG 58452 57586 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103241.1 protein_id gnl|my_center|LOCUS_06010 58586 59332 gene locus_tag LOCUS_06020 58586 59332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 60584 59709 gene locus_tag LOCUS_06030 60584 59709 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975186.1 protein_id gnl|my_center|LOCUS_06030 61733 60618 gene locus_tag LOCUS_06040 61733 60618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 63197 61794 gene locus_tag LOCUS_06050 gene uxaC 63197 61794 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 protein_id gnl|my_center|LOCUS_06050 63355 64011 gene locus_tag LOCUS_06060 63355 64011 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_06060 64818 64510 gene locus_tag LOCUS_06070 gene trxA 64818 64510 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_06070 65908 64967 gene locus_tag LOCUS_06080 65908 64967 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_06080 66397 67692 gene locus_tag LOCUS_06090 66397 67692 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_06090 67945 68646 gene locus_tag LOCUS_06100 67945 68646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 68959 68870 gene locus_tag LOCUS_t00080 68959 68870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 69055 68970 gene locus_tag LOCUS_t00090 69055 68970 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 69210 70136 gene locus_tag LOCUS_06110 gene trxB 69210 70136 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence008 3585 4520 gene locus_tag LOCUS_06120 3585 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4554 11420 gene locus_tag LOCUS_06130 4554 11420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 11642 12724 gene locus_tag LOCUS_06140 11642 12724 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_06140 12724 13026 gene locus_tag LOCUS_06150 12724 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 13050 13916 gene locus_tag LOCUS_06160 13050 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 13955 15355 gene locus_tag LOCUS_06170 13955 15355 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_06170 15375 16127 gene locus_tag LOCUS_06180 15375 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 16500 16715 gene locus_tag LOCUS_06190 16500 16715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06190 16974 18557 gene locus_tag LOCUS_06200 gene malQ 16974 18557 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747291.1 protein_id gnl|my_center|LOCUS_06200 18942 20702 gene locus_tag LOCUS_06210 18942 20702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 21663 20686 gene locus_tag LOCUS_06220 21663 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 21847 22812 gene locus_tag LOCUS_06230 21847 22812 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_06230 22802 23707 gene locus_tag LOCUS_06240 22802 23707 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_06240 23767 24090 gene locus_tag LOCUS_06250 23767 24090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 24087 25391 gene locus_tag LOCUS_06260 24087 25391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 26720 25488 gene locus_tag LOCUS_06270 26720 25488 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_06270 27473 26736 gene locus_tag LOCUS_06280 27473 26736 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_06280 28429 27470 gene locus_tag LOCUS_06290 28429 27470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 29392 28499 gene locus_tag LOCUS_06300 29392 28499 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816555.1 protein_id gnl|my_center|LOCUS_06300 30141 29389 gene locus_tag LOCUS_06310 30141 29389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 31461 30199 gene locus_tag LOCUS_06320 gene rodA 31461 30199 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_06320 32234 31446 gene locus_tag LOCUS_06330 gene minD 32234 31446 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583751.1 protein_id gnl|my_center|LOCUS_06330 34758 32251 gene locus_tag LOCUS_06340 34758 32251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 35291 34788 gene locus_tag LOCUS_06350 35291 34788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 36413 35322 gene locus_tag LOCUS_06360 36413 35322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 37472 36435 gene locus_tag LOCUS_06370 37472 36435 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_06370 38067 37492 gene locus_tag LOCUS_06380 38067 37492 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_06380 38356 38664 gene locus_tag LOCUS_06390 gene rplU 38356 38664 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_06390 38670 39011 gene locus_tag LOCUS_06400 38670 39011 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_06400 39017 39313 gene locus_tag LOCUS_06410 gene rpmA 39017 39313 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_06410 39386 40183 gene locus_tag LOCUS_06420 39386 40183 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_06420 40188 40892 gene locus_tag LOCUS_06430 40188 40892 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_06430 40899 42173 gene locus_tag LOCUS_06440 40899 42173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 42170 43120 gene locus_tag LOCUS_06450 gene queG 42170 43120 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 protein_id gnl|my_center|LOCUS_06450 43127 43951 gene locus_tag LOCUS_06460 43127 43951 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285996.1 protein_id gnl|my_center|LOCUS_06460 43972 44490 gene locus_tag LOCUS_06470 43972 44490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 44487 45458 gene locus_tag LOCUS_06480 44487 45458 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_06480 45469 46224 gene locus_tag LOCUS_06490 45469 46224 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_06490 46237 47844 gene locus_tag LOCUS_06500 46237 47844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 47896 48426 gene locus_tag LOCUS_06510 47896 48426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 50590 48860 gene locus_tag LOCUS_06520 50590 48860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 50973 50587 gene locus_tag LOCUS_06530 50973 50587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 51602 50973 gene locus_tag LOCUS_06540 51602 50973 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_06540 51975 53705 gene locus_tag LOCUS_06550 51975 53705 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081418.1 protein_id gnl|my_center|LOCUS_06550 54832 53768 gene locus_tag LOCUS_06560 54832 53768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 55793 54849 gene locus_tag LOCUS_06570 55793 54849 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_06570 56614 55871 gene locus_tag LOCUS_06580 56614 55871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 57149 56703 gene locus_tag LOCUS_06590 57149 56703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 57352 58710 gene locus_tag LOCUS_06600 57352 58710 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_06600 59358 58750 gene locus_tag LOCUS_06610 59358 58750 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005646.1 protein_id gnl|my_center|LOCUS_06610 60232 59387 gene locus_tag LOCUS_06620 60232 59387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 60570 60929 gene locus_tag LOCUS_06630 60570 60929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 61306 61061 gene locus_tag LOCUS_06640 61306 61061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 61907 61835 gene locus_tag LOCUS_t00100 61907 61835 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 63079 62246 gene locus_tag LOCUS_06650 gene kduI 63079 62246 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 protein_id gnl|my_center|LOCUS_06650 64146 63115 gene locus_tag LOCUS_06660 64146 63115 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_06660 64292 65392 gene locus_tag LOCUS_06670 64292 65392 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_06670 65510 68116 gene locus_tag LOCUS_06680 gene clpB 65510 68116 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence009 <1 991 gene locus_tag LOCUS_06690 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816476.1:molecular chaperone DnaK 1111 2241 gene locus_tag LOCUS_06700 gene dnaJ 1111 2241 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_06700 2264 3208 gene locus_tag LOCUS_06710 gene prmA 2264 3208 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_06710 3212 3943 gene locus_tag LOCUS_06720 3212 3943 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_06720 3947 5242 gene locus_tag LOCUS_06730 gene mtaB 3947 5242 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_06730 5245 5586 gene locus_tag LOCUS_06740 5245 5586 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_06740 5744 5917 gene locus_tag LOCUS_06750 5744 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6023 7024 gene locus_tag LOCUS_06760 6023 7024 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742064.1 protein_id gnl|my_center|LOCUS_06760 7093 9285 gene locus_tag LOCUS_06770 7093 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9451 9648 gene locus_tag LOCUS_06780 gene rpmE 9451 9648 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_06780 9774 10814 gene locus_tag LOCUS_06790 9774 10814 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_06790 10814 11653 gene locus_tag LOCUS_06800 gene prmC 10814 11653 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462247.1 protein_id gnl|my_center|LOCUS_06800 11650 12756 gene locus_tag LOCUS_06810 gene prfA 11650 12756 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583170.1 protein_id gnl|my_center|LOCUS_06810 12753 13790 gene locus_tag LOCUS_06820 12753 13790 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_06820 13791 14228 gene locus_tag LOCUS_06830 13791 14228 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583173.1 protein_id gnl|my_center|LOCUS_06830 14225 14857 gene locus_tag LOCUS_06840 14225 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 14872 16533 gene locus_tag LOCUS_06850 gene araB 14872 16533 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_06850 16639 18072 gene locus_tag LOCUS_06860 16639 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 20439 18112 gene locus_tag LOCUS_06870 20439 18112 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966263.1 protein_id gnl|my_center|LOCUS_06870 21870 20506 gene locus_tag LOCUS_06880 gene hslU 21870 20506 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_06880 22409 21873 gene locus_tag LOCUS_06890 gene hslV 22409 21873 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288419.1 protein_id gnl|my_center|LOCUS_06890 23725 22421 gene locus_tag LOCUS_06900 gene trmFO 23725 22421 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_06900 25820 23718 gene locus_tag LOCUS_06910 gene topA 25820 23718 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_06910 26933 25845 gene locus_tag LOCUS_06920 gene dprA 26933 25845 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_06920 28474 26945 gene locus_tag LOCUS_06930 28474 26945 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06930 32457 28498 gene locus_tag LOCUS_06940 32457 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 32908 32552 gene locus_tag LOCUS_06950 32908 32552 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_06950 33543 32905 gene locus_tag LOCUS_06960 gene rnhB 33543 32905 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06960 34398 33544 gene locus_tag LOCUS_06970 gene ylqF 34398 33544 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_06970 34814 34473 gene locus_tag LOCUS_06980 gene rplS 34814 34473 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_06980 35752 34943 gene locus_tag LOCUS_06990 gene cdsA 35752 34943 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_06990 35910 36734 gene locus_tag LOCUS_07000 35910 36734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 37828 36806 gene locus_tag LOCUS_07010 37828 36806 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_07010 39418 37952 gene locus_tag LOCUS_07020 39418 37952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 39598 40173 gene locus_tag LOCUS_07030 39598 40173 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948106.1 protein_id gnl|my_center|LOCUS_07030 40185 40967 gene locus_tag LOCUS_07040 40185 40967 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_07040 41071 42309 gene locus_tag LOCUS_07050 41071 42309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 42437 43525 gene locus_tag LOCUS_07060 42437 43525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_07060 43659 45221 gene locus_tag LOCUS_07070 43659 45221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 45426 46922 gene locus_tag LOCUS_07080 45426 46922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 46962 48281 gene locus_tag LOCUS_07090 46962 48281 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_07090 48327 49655 gene locus_tag LOCUS_07100 gene der 48327 49655 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_07100 49656 50315 gene locus_tag LOCUS_07110 gene plsY 49656 50315 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_07110 50312 51835 gene locus_tag LOCUS_07120 gene xylB 50312 51835 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_07120 51992 52696 gene locus_tag LOCUS_07130 51992 52696 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_07130 52702 54495 gene locus_tag LOCUS_07140 gene resE 52702 54495 CDS product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964667.1 protein_id gnl|my_center|LOCUS_07140 55704 54505 gene locus_tag LOCUS_07150 55704 54505 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390571.1 protein_id gnl|my_center|LOCUS_07150 55853 55769 gene locus_tag LOCUS_t00110 55853 55769 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55969 56547 gene locus_tag LOCUS_07160 55969 56547 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_07160 56572 57975 gene locus_tag LOCUS_07170 56572 57975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 57972 58679 gene locus_tag LOCUS_07180 57972 58679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 59259 58756 gene locus_tag LOCUS_07190 59259 58756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 59435 59755 gene locus_tag LOCUS_07200 59435 59755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 59843 60694 gene locus_tag LOCUS_07210 gene ispE 59843 60694 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_07210 60773 61276 gene locus_tag LOCUS_07220 60773 61276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 61294 61971 gene locus_tag LOCUS_07230 gene sleB 61294 61971 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_07230 61986 63275 gene locus_tag LOCUS_07240 gene ypeB 61986 63275 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_07240 63281 63709 gene locus_tag LOCUS_07250 63281 63709 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_07250 63865 64554 gene locus_tag LOCUS_07260 63865 64554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence010 1918 92 gene locus_tag LOCUS_07270 1918 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3638 2217 gene locus_tag LOCUS_07280 3638 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3798 4790 gene locus_tag LOCUS_07290 3798 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4888 5577 gene locus_tag LOCUS_07300 4888 5577 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_07300 5597 5989 gene locus_tag LOCUS_07310 5597 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 6009 6851 gene locus_tag LOCUS_07320 6009 6851 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_07320 8236 7121 gene locus_tag LOCUS_07330 8236 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 9308 8286 gene locus_tag LOCUS_07340 9308 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 10729 9305 gene locus_tag LOCUS_07350 10729 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 11922 10744 gene locus_tag LOCUS_07360 11922 10744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_07360 12620 11919 gene locus_tag LOCUS_07370 12620 11919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903135.1 protein_id gnl|my_center|LOCUS_07370 13627 12617 gene locus_tag LOCUS_07380 13627 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13818 15800 gene locus_tag LOCUS_07390 13818 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 15940 19206 gene locus_tag LOCUS_07400 15940 19206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 19261 19950 gene locus_tag LOCUS_07410 19261 19950 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_07410 20029 20691 gene locus_tag LOCUS_07420 20029 20691 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_07420 22006 20774 gene locus_tag LOCUS_07430 22006 20774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 23070 22087 gene locus_tag LOCUS_07440 23070 22087 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_07440 23926 23105 gene locus_tag LOCUS_07450 23926 23105 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_07450 24127 26061 gene locus_tag LOCUS_07460 gene gyrB 24127 26061 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_07460 26104 28686 gene locus_tag LOCUS_07470 gene gyrA 26104 28686 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_07470 28933 29799 gene locus_tag LOCUS_07480 28933 29799 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_07480 29800 31044 gene locus_tag LOCUS_07490 29800 31044 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_07490 31730 31146 gene locus_tag LOCUS_07500 31730 31146 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986310.1 protein_id gnl|my_center|LOCUS_07500 32896 31727 gene locus_tag LOCUS_07510 32896 31727 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_07510 33193 32963 gene locus_tag LOCUS_07520 33193 32963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 33436 34371 gene locus_tag LOCUS_07530 33436 34371 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_07530 34393 35274 gene locus_tag LOCUS_07540 34393 35274 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_07540 35317 36636 gene locus_tag LOCUS_07550 35317 36636 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_07550 36653 38197 gene locus_tag LOCUS_07560 36653 38197 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_07560 38194 39270 gene locus_tag LOCUS_07570 38194 39270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 40035 39379 gene locus_tag LOCUS_07580 40035 39379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 41070 40111 gene locus_tag LOCUS_07590 41070 40111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 41861 41172 gene locus_tag LOCUS_07600 gene tsaA 41861 41172 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_07600 42092 43303 gene locus_tag LOCUS_07610 42092 43303 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_07610 45228 43699 gene locus_tag LOCUS_07620 45228 43699 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_07620 46212 45289 gene locus_tag LOCUS_07630 46212 45289 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_07630 47160 46228 gene locus_tag LOCUS_07640 47160 46228 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_07640 48255 47350 gene locus_tag LOCUS_07650 48255 47350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 48815 48279 gene locus_tag LOCUS_07660 48815 48279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 50425 48803 gene locus_tag LOCUS_07670 50425 48803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 50797 50438 gene locus_tag LOCUS_07680 50797 50438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 51090 50854 gene locus_tag LOCUS_07690 51090 50854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 52399 51107 gene locus_tag LOCUS_07700 52399 51107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 53166 52417 gene locus_tag LOCUS_07710 53166 52417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 53394 54800 gene locus_tag LOCUS_07720 53394 54800 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446180.1 protein_id gnl|my_center|LOCUS_07720 54797 55447 gene locus_tag LOCUS_07730 54797 55447 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965264.1 protein_id gnl|my_center|LOCUS_07730 56917 55925 gene locus_tag LOCUS_07740 56917 55925 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970599.1 protein_id gnl|my_center|LOCUS_07740 57849 56938 gene locus_tag LOCUS_07750 57849 56938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 59882 57930 gene locus_tag LOCUS_07760 59882 57930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 60322 59939 gene locus_tag LOCUS_07770 60322 59939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 60573 60322 gene locus_tag LOCUS_07780 60573 60322 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_07780 61576 60695 gene locus_tag LOCUS_07790 61576 60695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 61743 62828 gene locus_tag LOCUS_07800 61743 62828 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence011 1584 265 gene locus_tag LOCUS_07810 1584 265 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_07810 3561 1981 gene locus_tag LOCUS_07820 3561 1981 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_07820 4587 3637 gene locus_tag LOCUS_07830 4587 3637 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_07830 5559 4603 gene locus_tag LOCUS_07840 5559 4603 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_07840 7186 5609 gene locus_tag LOCUS_07850 7186 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7576 9189 gene locus_tag LOCUS_07860 7576 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9987 9283 gene locus_tag LOCUS_07870 gene rsmG 9987 9283 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_07870 11867 9984 gene locus_tag LOCUS_07880 gene mnmG 11867 9984 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_07880 13628 11889 gene locus_tag LOCUS_07890 13628 11889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_07890 15357 13621 gene locus_tag LOCUS_07900 15357 13621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_07900 16388 15378 gene locus_tag LOCUS_07910 gene ansA 16388 15378 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_07910 16596 18458 gene locus_tag LOCUS_07920 16596 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 18558 19754 gene locus_tag LOCUS_07930 18558 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 19765 20727 gene locus_tag LOCUS_07940 19765 20727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 20809 22029 gene locus_tag LOCUS_07950 20809 22029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 22026 23243 gene locus_tag LOCUS_07960 22026 23243 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_07960 28674 23329 gene locus_tag LOCUS_07970 28674 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 30092 29520 gene locus_tag LOCUS_07980 30092 29520 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_07980 31825 30089 gene locus_tag LOCUS_07990 gene iorA 31825 30089 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_07990 33572 31938 gene locus_tag LOCUS_08000 33572 31938 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_08000 34790 33603 gene locus_tag LOCUS_08010 34790 33603 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_08010 35202 35023 gene locus_tag LOCUS_08020 35202 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 35941 35228 gene locus_tag LOCUS_08030 35941 35228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 36857 36048 gene locus_tag LOCUS_08040 36857 36048 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295567.1 protein_id gnl|my_center|LOCUS_08040 37653 36859 gene locus_tag LOCUS_08050 37653 36859 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295567.1 protein_id gnl|my_center|LOCUS_08050 39042 37669 gene locus_tag LOCUS_08060 39042 37669 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_08060 40036 39023 gene locus_tag LOCUS_08070 40036 39023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 41505 40141 gene locus_tag LOCUS_08080 41505 40141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 42945 41572 gene locus_tag LOCUS_08090 42945 41572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 44407 42965 gene locus_tag LOCUS_08100 44407 42965 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_08100 44592 46109 gene locus_tag LOCUS_08110 44592 46109 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906091.1 protein_id gnl|my_center|LOCUS_08110 46287 47495 gene locus_tag LOCUS_08120 46287 47495 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_08120 47579 49054 gene locus_tag LOCUS_08130 47579 49054 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_08130 49054 49989 gene locus_tag LOCUS_08140 49054 49989 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_08140 50005 51132 gene locus_tag LOCUS_08150 gene ugpC 50005 51132 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_08150 52021 51416 gene locus_tag LOCUS_08160 gene pcp 52021 51416 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_08160 52207 52117 gene locus_tag LOCUS_t00120 52207 52117 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 52674 54032 gene locus_tag LOCUS_08170 52674 54032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 54230 55201 gene locus_tag LOCUS_08180 54230 55201 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287294.1 protein_id gnl|my_center|LOCUS_08180 55198 58116 gene locus_tag LOCUS_08190 55198 58116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 59296 58922 gene locus_tag LOCUS_08200 59296 58922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 60533 59409 gene locus_tag LOCUS_08210 gene tgt 60533 59409 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_08210 61083 60607 gene locus_tag LOCUS_08220 61083 60607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 <62233 61265 gene locus_tag LOCUS_08230 <62233 61265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203202.1:alpha-L-fucosidase >Feature sequence012 748 176 gene locus_tag LOCUS_08240 748 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2215 773 gene locus_tag LOCUS_08250 2215 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2475 4931 gene locus_tag LOCUS_08260 2475 4931 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_08260 4954 5394 gene locus_tag LOCUS_08270 4954 5394 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575438.1 protein_id gnl|my_center|LOCUS_08270 5446 6408 gene locus_tag LOCUS_08280 5446 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6731 7864 gene locus_tag LOCUS_08290 6731 7864 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_08290 8915 7914 gene locus_tag LOCUS_08300 8915 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9903 8944 gene locus_tag LOCUS_08310 9903 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 12099 10372 gene locus_tag LOCUS_08320 12099 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 13111 12176 gene locus_tag LOCUS_08330 13111 12176 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_08330 14060 13125 gene locus_tag LOCUS_08340 14060 13125 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_08340 14297 15091 gene locus_tag LOCUS_08350 14297 15091 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809818.1 protein_id gnl|my_center|LOCUS_08350 15137 16153 gene locus_tag LOCUS_08360 15137 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16159 16911 gene locus_tag LOCUS_08370 gene fabG 16159 16911 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_08370 16911 17888 gene locus_tag LOCUS_08380 16911 17888 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923246.1 protein_id gnl|my_center|LOCUS_08380 17892 18821 gene locus_tag LOCUS_08390 17892 18821 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704182.1 protein_id gnl|my_center|LOCUS_08390 19984 19202 gene locus_tag LOCUS_08400 19984 19202 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_08400 20743 20027 gene locus_tag LOCUS_08410 20743 20027 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_08410 20869 22425 gene locus_tag LOCUS_08420 20869 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 22429 23100 gene locus_tag LOCUS_08430 22429 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 23267 24775 gene locus_tag LOCUS_08440 23267 24775 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989833.1 protein_id gnl|my_center|LOCUS_08440 24798 26780 gene locus_tag LOCUS_08450 gene tkt 24798 26780 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_08450 26859 28097 gene locus_tag LOCUS_08460 26859 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 29033 28149 gene locus_tag LOCUS_08470 29033 28149 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837152.1 protein_id gnl|my_center|LOCUS_08470 29863 29141 gene locus_tag LOCUS_08480 29863 29141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 30728 29967 gene locus_tag LOCUS_08490 30728 29967 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_08490 33971 30744 gene locus_tag LOCUS_08500 33971 30744 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_08500 34134 34532 gene locus_tag LOCUS_08510 34134 34532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 35386 34592 gene locus_tag LOCUS_08520 35386 34592 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_08520 35861 38137 gene locus_tag LOCUS_08530 35861 38137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 40371 38227 gene locus_tag LOCUS_08540 40371 38227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 41984 40449 gene locus_tag LOCUS_08550 41984 40449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_08550 42938 42039 gene locus_tag LOCUS_08560 42938 42039 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_08560 43874 42951 gene locus_tag LOCUS_08570 43874 42951 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_08570 44149 45162 gene locus_tag LOCUS_08580 44149 45162 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_08580 45848 48166 gene locus_tag LOCUS_08590 45848 48166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 48406 48218 gene locus_tag LOCUS_08600 48406 48218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 48577 49974 gene locus_tag LOCUS_08610 48577 49974 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_08610 49971 52484 gene locus_tag LOCUS_08620 49971 52484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 52538 53602 gene locus_tag LOCUS_08630 52538 53602 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_08630 53602 54270 gene locus_tag LOCUS_08640 53602 54270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_08640 54289 54495 gene locus_tag LOCUS_08650 54289 54495 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_08650 54508 55575 gene locus_tag LOCUS_08660 54508 55575 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_08660 55576 56328 gene locus_tag LOCUS_08670 55576 56328 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_08670 56325 56858 gene locus_tag LOCUS_08680 56325 56858 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_08680 57011 58060 gene locus_tag LOCUS_08690 57011 58060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 58116 59228 gene locus_tag LOCUS_08700 58116 59228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence013 695 1186 gene locus_tag LOCUS_08710 695 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1075 2445 gene locus_tag LOCUS_08720 1075 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2554 3312 gene locus_tag LOCUS_08730 2554 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3305 4834 gene locus_tag LOCUS_08740 3305 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 6898 5120 gene locus_tag LOCUS_08750 6898 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 7456 7989 gene locus_tag LOCUS_08760 7456 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9261 8083 gene locus_tag LOCUS_08770 9261 8083 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085419.1 protein_id gnl|my_center|LOCUS_08770 10739 9285 gene locus_tag LOCUS_08780 10739 9285 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_08780 11389 11631 gene locus_tag LOCUS_08790 11389 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 11632 11796 gene locus_tag LOCUS_08800 11632 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 11953 13287 gene locus_tag LOCUS_08810 11953 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 13451 15163 gene locus_tag LOCUS_08820 13451 15163 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_08820 15334 17553 gene locus_tag LOCUS_08830 15334 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 19666 17663 gene locus_tag LOCUS_08840 19666 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19824 20252 gene locus_tag LOCUS_08850 19824 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 protein_id gnl|my_center|LOCUS_08850 20318 20599 gene locus_tag LOCUS_08860 20318 20599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 20603 20971 gene locus_tag LOCUS_08870 20603 20971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 21032 21328 gene locus_tag LOCUS_08880 21032 21328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 22034 21402 gene locus_tag LOCUS_08890 22034 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 23071 22208 gene locus_tag LOCUS_08900 23071 22208 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455196.1 protein_id gnl|my_center|LOCUS_08900 24474 23098 gene locus_tag LOCUS_08910 24474 23098 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_08910 25489 24479 gene locus_tag LOCUS_08920 25489 24479 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_08920 26445 25591 gene locus_tag LOCUS_08930 26445 25591 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_08930 27140 26436 gene locus_tag LOCUS_08940 27140 26436 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_08940 28153 27137 gene locus_tag LOCUS_08950 28153 27137 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_08950 28421 28086 gene locus_tag LOCUS_08960 28421 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 30124 28559 gene locus_tag LOCUS_08970 30124 28559 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_08970 30286 33756 gene locus_tag LOCUS_08980 30286 33756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 33864 35060 gene locus_tag LOCUS_08990 33864 35060 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_08990 35083 36264 gene locus_tag LOCUS_09000 35083 36264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 36287 37069 gene locus_tag LOCUS_09010 36287 37069 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_09010 37164 38579 gene locus_tag LOCUS_09020 gene pyk 37164 38579 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_09020 40263 38719 gene locus_tag LOCUS_09030 gene rny 40263 38719 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_09030 41699 40533 gene locus_tag LOCUS_09040 41699 40533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 43209 41776 gene locus_tag LOCUS_09050 gene purB 43209 41776 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_09050 43535 43993 gene locus_tag LOCUS_09060 43535 43993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 44028 44402 gene locus_tag LOCUS_09070 44028 44402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 44496 45536 gene locus_tag LOCUS_09080 44496 45536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 45564 46157 gene locus_tag LOCUS_09090 45564 46157 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047960.1 protein_id gnl|my_center|LOCUS_09090 46216 46584 gene locus_tag LOCUS_09100 46216 46584 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_09100 46950 48089 gene locus_tag LOCUS_09110 46950 48089 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_09110 48325 49914 gene locus_tag LOCUS_09120 48325 49914 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_09120 49911 52157 gene locus_tag LOCUS_09130 49911 52157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 52150 53469 gene locus_tag LOCUS_09140 52150 53469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627593.1 protein_id gnl|my_center|LOCUS_09140 53763 55115 gene locus_tag LOCUS_09150 53763 55115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 55473 56765 gene locus_tag LOCUS_09160 gene guaA 55473 56765 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence014 1052 2155 gene locus_tag LOCUS_09170 1052 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2127 2939 gene locus_tag LOCUS_09180 2127 2939 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016616.1 protein_id gnl|my_center|LOCUS_09180 3052 4095 gene locus_tag LOCUS_09190 3052 4095 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_09190 4174 4677 gene locus_tag LOCUS_09200 4174 4677 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458839.1 protein_id gnl|my_center|LOCUS_09200 4674 5882 gene locus_tag LOCUS_09210 4674 5882 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_09210 5879 7051 gene locus_tag LOCUS_09220 5879 7051 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_09220 7048 8427 gene locus_tag LOCUS_09230 7048 8427 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_09230 9694 8531 gene locus_tag LOCUS_09240 9694 8531 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836498.1 protein_id gnl|my_center|LOCUS_09240 11683 9713 gene locus_tag LOCUS_09250 11683 9713 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_09250 12525 11680 gene locus_tag LOCUS_09260 12525 11680 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203682.1 protein_id gnl|my_center|LOCUS_09260 13892 12606 gene locus_tag LOCUS_09270 13892 12606 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_09270 14871 14089 gene locus_tag LOCUS_09280 gene proC 14871 14089 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363628.1 protein_id gnl|my_center|LOCUS_09280 16010 14910 gene locus_tag LOCUS_09290 16010 14910 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_09290 17268 16012 gene locus_tag LOCUS_09300 17268 16012 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715835.1 protein_id gnl|my_center|LOCUS_09300 17949 17275 gene locus_tag LOCUS_09310 17949 17275 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_09310 18091 18999 gene locus_tag LOCUS_09320 18091 18999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 19617 19147 gene locus_tag LOCUS_09330 19617 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 19755 22355 gene locus_tag LOCUS_09340 gene polA 19755 22355 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_09340 22339 22974 gene locus_tag LOCUS_09350 gene coaE 22339 22974 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_09350 22971 23537 gene locus_tag LOCUS_09360 22971 23537 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_09360 23509 25062 gene locus_tag LOCUS_09370 23509 25062 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_09370 25487 25999 gene locus_tag LOCUS_09380 25487 25999 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_09380 26123 27172 gene locus_tag LOCUS_09390 26123 27172 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705962.1 protein_id gnl|my_center|LOCUS_09390 27169 27375 gene locus_tag LOCUS_09400 27169 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 27606 29831 gene locus_tag LOCUS_09410 27606 29831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 32104 30263 gene locus_tag LOCUS_09420 32104 30263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_09420 33973 32120 gene locus_tag LOCUS_09430 33973 32120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_09430 34301 35968 gene locus_tag LOCUS_09440 34301 35968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 36842 35937 gene locus_tag LOCUS_09450 36842 35937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 37123 37527 gene locus_tag LOCUS_09460 37123 37527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_09460 37534 38376 gene locus_tag LOCUS_09470 37534 38376 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_09470 38373 39074 gene locus_tag LOCUS_09480 38373 39074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 39990 39016 gene locus_tag LOCUS_09490 39990 39016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 40160 41338 gene locus_tag LOCUS_09500 40160 41338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 41348 42031 gene locus_tag LOCUS_09510 41348 42031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 42082 42678 gene locus_tag LOCUS_09520 42082 42678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 42689 42970 gene locus_tag LOCUS_09530 42689 42970 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_09530 43086 43613 gene locus_tag LOCUS_09540 43086 43613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 43738 44016 gene locus_tag LOCUS_09550 43738 44016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 43991 44476 gene locus_tag LOCUS_09560 gene lspA 43991 44476 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775073.1 protein_id gnl|my_center|LOCUS_09560 44479 45384 gene locus_tag LOCUS_09570 44479 45384 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130995.1 protein_id gnl|my_center|LOCUS_09570 45484 46080 gene locus_tag LOCUS_09580 45484 46080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 46150 47178 gene locus_tag LOCUS_09590 46150 47178 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440854.1 protein_id gnl|my_center|LOCUS_09590 47289 47363 gene locus_tag LOCUS_t00130 47289 47363 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 47918 47454 gene locus_tag LOCUS_09600 47918 47454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 50076 47911 gene locus_tag LOCUS_09610 50076 47911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 50249 50524 gene locus_tag LOCUS_09620 50249 50524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 50527 51240 gene locus_tag LOCUS_09630 50527 51240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 51237 51956 gene locus_tag LOCUS_09640 51237 51956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence015 450 1370 gene locus_tag LOCUS_09650 450 1370 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552588.1 protein_id gnl|my_center|LOCUS_09650 1367 2506 gene locus_tag LOCUS_09660 gene alr 1367 2506 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09660 3906 2581 gene locus_tag LOCUS_09670 3906 2581 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_09670 5285 4101 gene locus_tag LOCUS_09680 5285 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_09680 5660 5352 gene locus_tag LOCUS_09690 gene trxA 5660 5352 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479673.1 protein_id gnl|my_center|LOCUS_09690 6077 5673 gene locus_tag LOCUS_09700 6077 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 6727 6074 gene locus_tag LOCUS_09710 6727 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8820 6724 gene locus_tag LOCUS_09720 8820 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9798 8842 gene locus_tag LOCUS_09730 9798 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 10072 11610 gene locus_tag LOCUS_09740 10072 11610 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_09740 11642 12751 gene locus_tag LOCUS_09750 11642 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 13651 12944 gene locus_tag LOCUS_09760 13651 12944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_09760 14502 13654 gene locus_tag LOCUS_09770 14502 13654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_09770 15575 14499 gene locus_tag LOCUS_09780 15575 14499 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_09780 16494 15586 gene locus_tag LOCUS_09790 16494 15586 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_09790 17776 16643 gene locus_tag LOCUS_09800 17776 16643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_09800 18782 18516 gene locus_tag LOCUS_09810 18782 18516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 19864 18860 gene locus_tag LOCUS_09820 19864 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 21027 19900 gene locus_tag LOCUS_09830 21027 19900 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_09830 22333 21167 gene locus_tag LOCUS_09840 22333 21167 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_09840 22415 23290 gene locus_tag LOCUS_09850 22415 23290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 24386 23304 gene locus_tag LOCUS_09860 24386 23304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 25023 24403 gene locus_tag LOCUS_09870 25023 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 25201 25374 gene locus_tag LOCUS_09880 25201 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 25722 25513 gene locus_tag LOCUS_09890 25722 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 26494 25979 gene locus_tag LOCUS_09900 26494 25979 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_09900 27182 26499 gene locus_tag LOCUS_09910 27182 26499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 27917 27183 gene locus_tag LOCUS_09920 27917 27183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 29377 27914 gene locus_tag LOCUS_09930 29377 27914 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_09930 29997 29374 gene locus_tag LOCUS_09940 29997 29374 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_09940 30448 29999 gene locus_tag LOCUS_09950 gene dtd 30448 29999 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_09950 32668 30467 gene locus_tag LOCUS_09960 32668 30467 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_09960 35033 32661 gene locus_tag LOCUS_09970 35033 32661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 37790 35151 gene locus_tag LOCUS_09980 37790 35151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 38018 39142 gene locus_tag LOCUS_09990 38018 39142 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986590.1 protein_id gnl|my_center|LOCUS_09990 39288 39115 gene locus_tag LOCUS_10000 39288 39115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 40774 39539 gene locus_tag LOCUS_10010 40774 39539 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_10010 42024 40855 gene locus_tag LOCUS_10020 42024 40855 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922202.1 protein_id gnl|my_center|LOCUS_10020 43102 42026 gene locus_tag LOCUS_10030 gene serC 43102 42026 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_10030 43918 43253 gene locus_tag LOCUS_10040 gene trmB 43918 43253 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_10040 44709 43936 gene locus_tag LOCUS_10050 44709 43936 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130766.1 protein_id gnl|my_center|LOCUS_10050 46743 44722 gene locus_tag LOCUS_10060 46743 44722 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_10060 47481 46768 gene locus_tag LOCUS_10070 47481 46768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 48044 47478 gene locus_tag LOCUS_10080 gene scpB 48044 47478 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_10080 48176 49096 gene locus_tag LOCUS_10090 48176 49096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 49114 49248 gene locus_tag LOCUS_10100 49114 49248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 49318 50421 gene locus_tag LOCUS_10110 49318 50421 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_10110 50418 51605 gene locus_tag LOCUS_10120 50418 51605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 51629 53272 gene locus_tag LOCUS_10130 51629 53272 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence016 1742 468 gene locus_tag LOCUS_10140 1742 468 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 protein_id gnl|my_center|LOCUS_10140 1981 2946 gene locus_tag LOCUS_10150 1981 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3563 5713 gene locus_tag LOCUS_10160 gene rnr 3563 5713 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_10160 6413 5757 gene locus_tag LOCUS_10170 gene yihA 6413 5757 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_10170 8783 6417 gene locus_tag LOCUS_10180 gene lon 8783 6417 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_10180 9455 8967 gene locus_tag LOCUS_10190 9455 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 10590 9544 gene locus_tag LOCUS_10200 10590 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12957 10597 gene locus_tag LOCUS_10210 12957 10597 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229052.1 protein_id gnl|my_center|LOCUS_10210 13603 12893 gene locus_tag LOCUS_10220 13603 12893 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229453.1 protein_id gnl|my_center|LOCUS_10220 15198 13681 gene locus_tag LOCUS_10230 15198 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 15392 16495 gene locus_tag LOCUS_10240 15392 16495 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_10240 17988 16588 gene locus_tag LOCUS_10250 17988 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 18197 19234 gene locus_tag LOCUS_10260 18197 19234 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_10260 19430 20032 gene locus_tag LOCUS_10270 19430 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 20683 20096 gene locus_tag LOCUS_10280 20683 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 22897 21215 gene locus_tag LOCUS_10290 22897 21215 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_10290 23907 22954 gene locus_tag LOCUS_10300 23907 22954 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_10300 24871 23921 gene locus_tag LOCUS_10310 24871 23921 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_10310 25169 25489 gene locus_tag LOCUS_10320 25169 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 25486 26919 gene locus_tag LOCUS_10330 25486 26919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 26969 28285 gene locus_tag LOCUS_10340 26969 28285 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_10340 30523 28364 gene locus_tag LOCUS_10350 30523 28364 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_10350 31935 30553 gene locus_tag LOCUS_10360 31935 30553 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_10360 32635 31928 gene locus_tag LOCUS_10370 32635 31928 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_10370 32777 33814 gene locus_tag LOCUS_10380 32777 33814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 33811 35121 gene locus_tag LOCUS_10390 33811 35121 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943178.1 protein_id gnl|my_center|LOCUS_10390 35363 36907 gene locus_tag LOCUS_10400 35363 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 37107 36973 gene locus_tag LOCUS_10410 37107 36973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 37822 37223 gene locus_tag LOCUS_10420 37822 37223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 38027 38947 gene locus_tag LOCUS_10430 38027 38947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 39946 39185 gene locus_tag LOCUS_10440 39946 39185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 40115 40315 gene locus_tag LOCUS_10450 40115 40315 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_10450 41438 40455 gene locus_tag LOCUS_10460 41438 40455 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_10460 43122 41635 gene locus_tag LOCUS_10470 43122 41635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 43293 44480 gene locus_tag LOCUS_10480 43293 44480 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358751.1 protein_id gnl|my_center|LOCUS_10480 44492 45070 gene locus_tag LOCUS_10490 44492 45070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 45258 46634 gene locus_tag LOCUS_10500 45258 46634 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_10500 46638 47300 gene locus_tag LOCUS_10510 46638 47300 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_10510 47303 49234 gene locus_tag LOCUS_10520 47303 49234 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_10520 49234 50394 gene locus_tag LOCUS_10530 49234 50394 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_10530 50652 51302 gene locus_tag LOCUS_10540 50652 51302 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_10540 51272 52084 gene locus_tag LOCUS_10550 51272 52084 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_10550 52081 52752 gene locus_tag LOCUS_10560 52081 52752 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964798.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence017 <1 726 gene locus_tag LOCUS_10570 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259287.1:ABC transporter ATP-binding protein 938 2011 gene locus_tag LOCUS_10580 938 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2046 3287 gene locus_tag LOCUS_10590 2046 3287 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 protein_id gnl|my_center|LOCUS_10590 4470 3328 gene locus_tag LOCUS_10600 4470 3328 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_10600 4561 4839 gene locus_tag LOCUS_10610 4561 4839 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434250.1 protein_id gnl|my_center|LOCUS_10610 4930 5556 gene locus_tag LOCUS_10620 gene nth 4930 5556 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_10620 5578 6843 gene locus_tag LOCUS_10630 gene obgE 5578 6843 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_10630 6868 7164 gene locus_tag LOCUS_10640 gene yhbY 6868 7164 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_10640 7943 7161 gene locus_tag LOCUS_10650 7943 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8058 8630 gene locus_tag LOCUS_10660 gene yqeK 8058 8630 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_10660 8627 8986 gene locus_tag LOCUS_10670 8627 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8993 9790 gene locus_tag LOCUS_10680 8993 9790 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_10680 9815 10696 gene locus_tag LOCUS_10690 9815 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 10699 11391 gene locus_tag LOCUS_10700 10699 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 12788 11460 gene locus_tag LOCUS_10710 12788 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 13297 12785 gene locus_tag LOCUS_10720 13297 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 14609 13284 gene locus_tag LOCUS_10730 14609 13284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 15530 14622 gene locus_tag LOCUS_10740 gene cdaA 15530 14622 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_10740 16178 15633 gene locus_tag LOCUS_10750 16178 15633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 16877 16257 gene locus_tag LOCUS_10760 16877 16257 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_10760 17245 16874 gene locus_tag LOCUS_10770 17245 16874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 18728 17229 gene locus_tag LOCUS_10780 18728 17229 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_10780 19520 18744 gene locus_tag LOCUS_10790 19520 18744 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_10790 19662 19743 gene locus_tag LOCUS_t00140 19662 19743 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20760 20128 gene locus_tag LOCUS_10800 20760 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 20884 21633 gene locus_tag LOCUS_10810 20884 21633 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_10810 21706 22467 gene locus_tag LOCUS_10820 gene murI 21706 22467 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966524.1 protein_id gnl|my_center|LOCUS_10820 22603 24684 gene locus_tag LOCUS_10830 gene fusA 22603 24684 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_10830 24804 25259 gene locus_tag LOCUS_10840 24804 25259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 25322 26680 gene locus_tag LOCUS_10850 25322 26680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 26992 28686 gene locus_tag LOCUS_10860 gene dnaG 26992 28686 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_10860 28719 29807 gene locus_tag LOCUS_10870 gene rpoD 28719 29807 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_10870 29876 30538 gene locus_tag LOCUS_10880 29876 30538 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006551.1 protein_id gnl|my_center|LOCUS_10880 30535 31308 gene locus_tag LOCUS_10890 30535 31308 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_10890 31305 32012 gene locus_tag LOCUS_10900 31305 32012 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_10900 33217 32564 gene locus_tag LOCUS_10910 33217 32564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 34627 33233 gene locus_tag LOCUS_10920 gene murC 34627 33233 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_10920 34843 35670 gene locus_tag LOCUS_10930 gene purR 34843 35670 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425934.1 protein_id gnl|my_center|LOCUS_10930 36519 35716 gene locus_tag LOCUS_10940 36519 35716 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_10940 36683 37561 gene locus_tag LOCUS_10950 36683 37561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 37762 38325 gene locus_tag LOCUS_10960 gene pth 37762 38325 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_10960 38351 42055 gene locus_tag LOCUS_10970 gene mfd 38351 42055 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_10970 42061 42519 gene locus_tag LOCUS_10980 42061 42519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10980 42544 44025 gene locus_tag LOCUS_10990 42544 44025 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10990 43997 45469 gene locus_tag LOCUS_11000 43997 45469 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949051.1 protein_id gnl|my_center|LOCUS_11000 45580 46341 gene locus_tag LOCUS_11010 45580 46341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 46397 47143 gene locus_tag LOCUS_11020 46397 47143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 48006 47140 gene locus_tag LOCUS_11030 48006 47140 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_11030 49180 48083 gene locus_tag LOCUS_11040 49180 48083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 50311 49190 gene locus_tag LOCUS_11050 50311 49190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 51813 50308 gene locus_tag LOCUS_11060 51813 50308 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence018 1382 687 gene locus_tag LOCUS_11070 1382 687 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_11070 1986 1408 gene locus_tag LOCUS_11080 gene yfbR 1986 1408 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_11080 2662 2087 gene locus_tag LOCUS_11090 gene thiT 2662 2087 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_11090 2955 3587 gene locus_tag LOCUS_11100 2955 3587 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_11100 3928 4596 gene locus_tag LOCUS_11110 3928 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 5272 4571 gene locus_tag LOCUS_11120 5272 4571 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965748.1 protein_id gnl|my_center|LOCUS_11120 6515 5265 gene locus_tag LOCUS_11130 6515 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 6715 6512 gene locus_tag LOCUS_11140 6715 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6645 7358 gene locus_tag LOCUS_11150 gene deoD 6645 7358 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_11150 8545 7355 gene locus_tag LOCUS_11160 8545 7355 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625279.1 protein_id gnl|my_center|LOCUS_11160 8691 9995 gene locus_tag LOCUS_11170 8691 9995 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_11170 10011 10781 gene locus_tag LOCUS_11180 10011 10781 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_11180 10781 12643 gene locus_tag LOCUS_11190 10781 12643 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_11190 12659 13573 gene locus_tag LOCUS_11200 12659 13573 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_11200 13591 14880 gene locus_tag LOCUS_11210 13591 14880 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_11210 15221 14940 gene locus_tag LOCUS_11220 15221 14940 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_11220 16288 15524 gene locus_tag LOCUS_11230 16288 15524 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_11230 18483 16285 gene locus_tag LOCUS_11240 18483 16285 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_11240 19267 18470 gene locus_tag LOCUS_11250 19267 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 19605 19264 gene locus_tag LOCUS_11260 19605 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 19790 20095 gene locus_tag LOCUS_11270 19790 20095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 20239 21969 gene locus_tag LOCUS_11280 20239 21969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_11280 21969 24068 gene locus_tag LOCUS_11290 21969 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 24910 24158 gene locus_tag LOCUS_11300 24910 24158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 32385 24943 gene locus_tag LOCUS_11310 32385 24943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 33366 32503 gene locus_tag LOCUS_11320 33366 32503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 33858 33370 gene locus_tag LOCUS_11330 gene coaD 33858 33370 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140849.1 protein_id gnl|my_center|LOCUS_11330 34421 33855 gene locus_tag LOCUS_11340 gene rsmD 34421 33855 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_11340 35257 34490 gene locus_tag LOCUS_11350 35257 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 36381 35275 gene locus_tag LOCUS_11360 gene alr 36381 35275 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181633.1 protein_id gnl|my_center|LOCUS_11360 36812 36378 gene locus_tag LOCUS_11370 36812 36378 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_11370 38154 36826 gene locus_tag LOCUS_11380 38154 36826 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_11380 38254 38970 gene locus_tag LOCUS_11390 38254 38970 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_11390 38972 39355 gene locus_tag LOCUS_11400 38972 39355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 39411 39653 gene locus_tag LOCUS_11410 39411 39653 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252982.1 protein_id gnl|my_center|LOCUS_11410 39655 41619 gene locus_tag LOCUS_11420 gene feoB 39655 41619 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_11420 42850 41609 gene locus_tag LOCUS_11430 gene eno 42850 41609 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_11430 42967 44115 gene locus_tag LOCUS_11440 42967 44115 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071679105.1 protein_id gnl|my_center|LOCUS_11440 44130 45623 gene locus_tag LOCUS_11450 gene abfB 44130 45623 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_11450 45662 45934 gene locus_tag LOCUS_11460 45662 45934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 45918 47327 gene locus_tag LOCUS_11470 45918 47327 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_11470 47346 48614 gene locus_tag LOCUS_11480 47346 48614 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963553.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence019 2940 574 gene locus_tag LOCUS_11490 2940 574 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989326.1 protein_id gnl|my_center|LOCUS_11490 3979 3134 gene locus_tag LOCUS_11500 3979 3134 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813608.1 protein_id gnl|my_center|LOCUS_11500 5061 4036 gene locus_tag LOCUS_11510 5061 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6127 5051 gene locus_tag LOCUS_11520 6127 5051 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 protein_id gnl|my_center|LOCUS_11520 6479 7642 gene locus_tag LOCUS_11530 6479 7642 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_11530 7819 8877 gene locus_tag LOCUS_11540 7819 8877 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_11540 8892 10343 gene locus_tag LOCUS_11550 gene gnd 8892 10343 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_11550 10362 11636 gene locus_tag LOCUS_11560 10362 11636 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_11560 11990 13681 gene locus_tag LOCUS_11570 11990 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 13757 15274 gene locus_tag LOCUS_11580 13757 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 15271 16206 gene locus_tag LOCUS_11590 15271 16206 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_11590 16218 17123 gene locus_tag LOCUS_11600 16218 17123 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_11600 17161 18930 gene locus_tag LOCUS_11610 17161 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 20636 18990 gene locus_tag LOCUS_11620 20636 18990 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_11620 21512 20766 gene locus_tag LOCUS_11630 21512 20766 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582876.1 protein_id gnl|my_center|LOCUS_11630 22718 21531 gene locus_tag LOCUS_11640 22718 21531 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_11640 25296 22804 gene locus_tag LOCUS_11650 25296 22804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 27829 25364 gene locus_tag LOCUS_11660 27829 25364 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_11660 28557 28204 gene locus_tag LOCUS_11670 gene rplT 28557 28204 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_11670 28770 28573 gene locus_tag LOCUS_11680 gene rpmI 28770 28573 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_11680 29316 28795 gene locus_tag LOCUS_11690 gene infC 29316 28795 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_11690 29593 31386 gene locus_tag LOCUS_11700 gene pepF 29593 31386 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_11700 31429 32187 gene locus_tag LOCUS_11710 31429 32187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 32206 33711 gene locus_tag LOCUS_11720 32206 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 33791 34966 gene locus_tag LOCUS_11730 33791 34966 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_11730 36020 35190 gene locus_tag LOCUS_11740 36020 35190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 36363 37346 gene locus_tag LOCUS_11750 36363 37346 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907125.1 protein_id gnl|my_center|LOCUS_11750 37348 38349 gene locus_tag LOCUS_11760 37348 38349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 38358 39272 gene locus_tag LOCUS_11770 38358 39272 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_11770 39286 40203 gene locus_tag LOCUS_11780 39286 40203 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_11780 40261 41862 gene locus_tag LOCUS_11790 40261 41862 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_11790 41961 42944 gene locus_tag LOCUS_11800 41961 42944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 42944 43978 gene locus_tag LOCUS_11810 42944 43978 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_11810 44362 44287 gene locus_tag LOCUS_t00150 44362 44287 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45317 44496 gene locus_tag LOCUS_11820 gene dppA 45317 44496 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_11820 45542 45375 gene locus_tag LOCUS_11830 45542 45375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 45681 45547 gene locus_tag LOCUS_11840 45681 45547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 47278 45833 gene locus_tag LOCUS_11850 47278 45833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 48518 48078 gene locus_tag LOCUS_11860 48518 48078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 49551 48709 gene locus_tag LOCUS_11870 49551 48709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_11870 49925 49551 gene locus_tag LOCUS_11880 49925 49551 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence020 <1 583 gene locus_tag LOCUS_11890 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048370.1:glycine--tRNA ligase 608 1843 gene locus_tag LOCUS_11900 608 1843 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_11900 2674 1931 gene locus_tag LOCUS_11910 gene nadE 2674 1931 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_11910 4143 2674 gene locus_tag LOCUS_11920 4143 2674 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072073.1 protein_id gnl|my_center|LOCUS_11920 4954 4157 gene locus_tag LOCUS_11930 4954 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5488 4958 gene locus_tag LOCUS_11940 5488 4958 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_11940 6264 5491 gene locus_tag LOCUS_11950 6264 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 8434 6272 gene locus_tag LOCUS_11960 8434 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 9295 8570 gene locus_tag LOCUS_11970 9295 8570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812189.1 protein_id gnl|my_center|LOCUS_11970 10014 9292 gene locus_tag LOCUS_11980 10014 9292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_11980 11222 10011 gene locus_tag LOCUS_11990 11222 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 11431 11868 gene locus_tag LOCUS_12000 11431 11868 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_12000 11865 13025 gene locus_tag LOCUS_12010 gene nifS 11865 13025 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_12010 13072 13452 gene locus_tag LOCUS_12020 gene nifU 13072 13452 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_12020 13455 13976 gene locus_tag LOCUS_12030 13455 13976 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255233.1 protein_id gnl|my_center|LOCUS_12030 13987 14913 gene locus_tag LOCUS_12040 13987 14913 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_12040 15227 16684 gene locus_tag LOCUS_12050 15227 16684 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_12050 17035 19119 gene locus_tag LOCUS_12060 17035 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 19053 20468 gene locus_tag LOCUS_12070 19053 20468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 20720 21796 gene locus_tag LOCUS_12080 gene rmgQ 20720 21796 CDS product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 protein_id gnl|my_center|LOCUS_12080 21813 22568 gene locus_tag LOCUS_12090 gene surE 21813 22568 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_12090 23362 22565 gene locus_tag LOCUS_12100 23362 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 23484 24269 gene locus_tag LOCUS_12110 23484 24269 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_12110 24269 24736 gene locus_tag LOCUS_12120 gene tadA 24269 24736 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 protein_id gnl|my_center|LOCUS_12120 25152 26855 gene locus_tag LOCUS_12130 25152 26855 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_12130 26904 27257 gene locus_tag LOCUS_12140 26904 27257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 27272 28549 gene locus_tag LOCUS_12150 gene mltG 27272 28549 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_12150 28693 29397 gene locus_tag LOCUS_12160 gene sigK 28693 29397 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_12160 29458 30552 gene locus_tag LOCUS_12170 29458 30552 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_12170 30585 31160 gene locus_tag LOCUS_12180 30585 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 31356 32600 gene locus_tag LOCUS_12190 gene htrB 31356 32600 CDS product serine protease Do-like protein HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228534.1 protein_id gnl|my_center|LOCUS_12190 34612 33086 gene locus_tag LOCUS_12200 34612 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 35036 34626 gene locus_tag LOCUS_12210 35036 34626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 35535 35792 gene locus_tag LOCUS_12220 35535 35792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 35768 36727 gene locus_tag LOCUS_12230 gene cbiB 35768 36727 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_12230 37314 38237 gene locus_tag LOCUS_12240 37314 38237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 38551 39540 gene locus_tag LOCUS_12250 38551 39540 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 protein_id gnl|my_center|LOCUS_12250 39537 40310 gene locus_tag LOCUS_12260 39537 40310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_12260 40498 41607 gene locus_tag LOCUS_12270 40498 41607 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_12270 41767 42726 gene locus_tag LOCUS_12280 41767 42726 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110811.1 protein_id gnl|my_center|LOCUS_12280 43102 43623 gene locus_tag LOCUS_12290 43102 43623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 44356 43688 gene locus_tag LOCUS_12300 44356 43688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 46012 45155 gene locus_tag LOCUS_12310 46012 45155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 46349 46182 gene locus_tag LOCUS_12320 46349 46182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 46610 46455 gene locus_tag LOCUS_12330 46610 46455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 47157 46729 gene locus_tag LOCUS_12340 47157 46729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 47451 47263 gene locus_tag LOCUS_12350 47451 47263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence021 1181 108 gene locus_tag LOCUS_12360 1181 108 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_12360 1909 1184 gene locus_tag LOCUS_12370 1909 1184 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_12370 3084 1906 gene locus_tag LOCUS_12380 3084 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4241 3081 gene locus_tag LOCUS_12390 4241 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5160 4228 gene locus_tag LOCUS_12400 5160 4228 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902065.1 protein_id gnl|my_center|LOCUS_12400 6059 5157 gene locus_tag LOCUS_12410 6059 5157 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375711.1 protein_id gnl|my_center|LOCUS_12410 6643 6056 gene locus_tag LOCUS_12420 6643 6056 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_12420 6963 9413 gene locus_tag LOCUS_12430 6963 9413 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_12430 9410 11170 gene locus_tag LOCUS_12440 9410 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12106 11405 gene locus_tag LOCUS_12450 12106 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 13114 12122 gene locus_tag LOCUS_12460 13114 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14281 13133 gene locus_tag LOCUS_12470 14281 13133 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_12470 15251 14391 gene locus_tag LOCUS_12480 15251 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 16031 15267 gene locus_tag LOCUS_12490 16031 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 16208 17077 gene locus_tag LOCUS_12500 16208 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 18182 17130 gene locus_tag LOCUS_12510 18182 17130 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_12510 18734 19204 gene locus_tag LOCUS_12520 18734 19204 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_12520 19210 19581 gene locus_tag LOCUS_12530 19210 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 19587 20189 gene locus_tag LOCUS_12540 19587 20189 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 protein_id gnl|my_center|LOCUS_12540 20186 20743 gene locus_tag LOCUS_12550 20186 20743 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_12550 21957 20833 gene locus_tag LOCUS_12560 21957 20833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 22037 22192 gene locus_tag LOCUS_12570 22037 22192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 22137 22910 gene locus_tag LOCUS_12580 22137 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 22901 23878 gene locus_tag LOCUS_12590 22901 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_12590 23871 24857 gene locus_tag LOCUS_12600 23871 24857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 24983 25537 gene locus_tag LOCUS_12610 24983 25537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12610 25549 25845 gene locus_tag LOCUS_12620 25549 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 26418 25915 gene locus_tag LOCUS_12630 26418 25915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 26533 27645 gene locus_tag LOCUS_12640 26533 27645 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_12640 27769 28239 gene locus_tag LOCUS_12650 27769 28239 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_12650 28236 28718 gene locus_tag LOCUS_12660 28236 28718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 28715 29926 gene locus_tag LOCUS_12670 28715 29926 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_12670 29923 30726 gene locus_tag LOCUS_12680 29923 30726 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_12680 30941 31162 gene locus_tag LOCUS_12690 30941 31162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 31272 33188 gene locus_tag LOCUS_12700 31272 33188 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_12700 33208 34947 gene locus_tag LOCUS_12710 33208 34947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 35128 35469 gene locus_tag LOCUS_12720 35128 35469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 35466 36179 gene locus_tag LOCUS_12730 35466 36179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 37601 36207 gene locus_tag LOCUS_12740 37601 36207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 38179 37736 gene locus_tag LOCUS_12750 gene aroQ 38179 37736 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860435.1 protein_id gnl|my_center|LOCUS_12750 39404 38160 gene locus_tag LOCUS_12760 39404 38160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 40548 39409 gene locus_tag LOCUS_12770 gene pheA 40548 39409 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_12770 41632 40550 gene locus_tag LOCUS_12780 gene aroC 41632 40550 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_12780 42875 41622 gene locus_tag LOCUS_12790 gene aroA 42875 41622 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_12790 43944 42877 gene locus_tag LOCUS_12800 gene aroB 43944 42877 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920829.1 protein_id gnl|my_center|LOCUS_12800 44782 43946 gene locus_tag LOCUS_12810 44782 43946 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_12810 45804 44788 gene locus_tag LOCUS_12820 gene aroF 45804 44788 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence022 1303 194 gene locus_tag LOCUS_12830 1303 194 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_12830 2059 1337 gene locus_tag LOCUS_12840 2059 1337 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530499.1 protein_id gnl|my_center|LOCUS_12840 2191 2856 gene locus_tag LOCUS_12850 2191 2856 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_12850 2962 4206 gene locus_tag LOCUS_12860 2962 4206 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_12860 4207 4680 gene locus_tag LOCUS_12870 4207 4680 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335817.1 protein_id gnl|my_center|LOCUS_12870 4664 4966 gene locus_tag LOCUS_12880 4664 4966 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146638.1 protein_id gnl|my_center|LOCUS_12880 4959 5282 gene locus_tag LOCUS_12890 4959 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5270 5530 gene locus_tag LOCUS_12900 5270 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 5514 6440 gene locus_tag LOCUS_12910 5514 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6444 6818 gene locus_tag LOCUS_12920 6444 6818 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_12920 6819 8312 gene locus_tag LOCUS_12930 6819 8312 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_12930 8341 9807 gene locus_tag LOCUS_12940 8341 9807 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_12940 9825 11270 gene locus_tag LOCUS_12950 9825 11270 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545971.1 protein_id gnl|my_center|LOCUS_12950 11284 13365 gene locus_tag LOCUS_12960 11284 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 13404 14453 gene locus_tag LOCUS_12970 13404 14453 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 protein_id gnl|my_center|LOCUS_12970 14726 16342 gene locus_tag LOCUS_12980 14726 16342 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_12980 16373 18202 gene locus_tag LOCUS_12990 gene typA 16373 18202 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_12990 18223 19323 gene locus_tag LOCUS_13000 gene recF 18223 19323 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_13000 19330 19860 gene locus_tag LOCUS_13010 19330 19860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 20035 21501 gene locus_tag LOCUS_13020 20035 21501 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903185.1 protein_id gnl|my_center|LOCUS_13020 23546 21612 gene locus_tag LOCUS_13030 gene thrS 23546 21612 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_13030 24614 23883 gene locus_tag LOCUS_13040 24614 23883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 26381 24627 gene locus_tag LOCUS_13050 26381 24627 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196523.1 protein_id gnl|my_center|LOCUS_13050 26585 27655 gene locus_tag LOCUS_13060 26585 27655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 27674 29095 gene locus_tag LOCUS_13070 27674 29095 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_13070 29289 29603 gene locus_tag LOCUS_13080 29289 29603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 29938 29621 gene locus_tag LOCUS_13090 29938 29621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 30627 29935 gene locus_tag LOCUS_13100 30627 29935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 30832 32001 gene locus_tag LOCUS_13110 30832 32001 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860656.1 protein_id gnl|my_center|LOCUS_13110 32250 32011 gene locus_tag LOCUS_13120 32250 32011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 32434 32925 gene locus_tag LOCUS_13130 32434 32925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 34268 33003 gene locus_tag LOCUS_13140 34268 33003 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_13140 34387 35901 gene locus_tag LOCUS_13150 34387 35901 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_13150 36026 36802 gene locus_tag LOCUS_13160 gene proB 36026 36802 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_13160 36804 38054 gene locus_tag LOCUS_13170 36804 38054 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836905.1 protein_id gnl|my_center|LOCUS_13170 38268 40235 gene locus_tag LOCUS_13180 gene gyrB 38268 40235 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_13180 40239 42680 gene locus_tag LOCUS_13190 gene gyrA 40239 42680 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_13190 42696 43421 gene locus_tag LOCUS_13200 42696 43421 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_13200 44532 43822 gene locus_tag LOCUS_13210 44532 43822 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_13210 44724 45116 gene locus_tag LOCUS_13220 44724 45116 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_13220 45143 45682 gene locus_tag LOCUS_13230 45143 45682 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence023 439 1062 gene locus_tag LOCUS_13240 439 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1064 1189 gene locus_tag LOCUS_13250 1064 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2910 1354 gene locus_tag LOCUS_13260 2910 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3223 3675 gene locus_tag LOCUS_13270 3223 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5133 3862 gene locus_tag LOCUS_13280 gene serS 5133 3862 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963346.1 protein_id gnl|my_center|LOCUS_13280 6100 5426 gene locus_tag LOCUS_13290 6100 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 6964 6185 gene locus_tag LOCUS_13300 6964 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7245 8777 gene locus_tag LOCUS_13310 gene murJ 7245 8777 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966328.1 protein_id gnl|my_center|LOCUS_13310 8793 9833 gene locus_tag LOCUS_13320 gene ruvB 8793 9833 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_13320 9852 10874 gene locus_tag LOCUS_13330 gene queA 9852 10874 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723535.1 protein_id gnl|my_center|LOCUS_13330 10906 12051 gene locus_tag LOCUS_13340 10906 12051 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_13340 12105 14132 gene locus_tag LOCUS_13350 12105 14132 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_13350 14870 14133 gene locus_tag LOCUS_13360 14870 14133 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_13360 16554 14872 gene locus_tag LOCUS_13370 16554 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 17123 16953 gene locus_tag LOCUS_13380 17123 16953 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_13380 17250 17747 gene locus_tag LOCUS_13390 17250 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 20719 17744 gene locus_tag LOCUS_13400 20719 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 21262 20801 gene locus_tag LOCUS_13410 21262 20801 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358480.1 protein_id gnl|my_center|LOCUS_13410 23388 21331 gene locus_tag LOCUS_13420 23388 21331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 23891 24736 gene locus_tag LOCUS_13430 23891 24736 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375198.1 protein_id gnl|my_center|LOCUS_13430 25214 26485 gene locus_tag LOCUS_13440 25214 26485 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_13440 26502 27152 gene locus_tag LOCUS_13450 26502 27152 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_13450 28766 27156 gene locus_tag LOCUS_13460 28766 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 28940 29893 gene locus_tag LOCUS_13470 28940 29893 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972410.1 protein_id gnl|my_center|LOCUS_13470 29981 31462 gene locus_tag LOCUS_13480 gene rbsA 29981 31462 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 protein_id gnl|my_center|LOCUS_13480 31489 33468 gene locus_tag LOCUS_13490 31489 33468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 33504 34547 gene locus_tag LOCUS_13500 33504 34547 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_13500 35664 34864 gene locus_tag LOCUS_13510 35664 34864 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_13510 35750 37099 gene locus_tag LOCUS_13520 35750 37099 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_13520 38008 37082 gene locus_tag LOCUS_13530 38008 37082 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_13530 38037 38798 gene locus_tag LOCUS_13540 38037 38798 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_13540 39146 38799 gene locus_tag LOCUS_13550 39146 38799 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_13550 39559 39146 gene locus_tag LOCUS_13560 39559 39146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 39739 40377 gene locus_tag LOCUS_13570 39739 40377 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_13570 40374 41138 gene locus_tag LOCUS_13580 40374 41138 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_13580 42884 41748 gene locus_tag LOCUS_13590 42884 41748 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_13590 43861 43145 gene locus_tag LOCUS_13600 gene sigE 43861 43145 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_13600 44652 43882 gene locus_tag LOCUS_13610 44652 43882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 44890 45081 gene locus_tag LOCUS_13620 44890 45081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 45099 45602 gene locus_tag LOCUS_13630 45099 45602 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence024 933 589 gene locus_tag LOCUS_13640 933 589 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_13640 2189 930 gene locus_tag LOCUS_13650 2189 930 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_13650 2997 2179 gene locus_tag LOCUS_13660 2997 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13660 3627 3016 gene locus_tag LOCUS_13670 3627 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13670 4360 3770 gene locus_tag LOCUS_13680 4360 3770 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116197.1 protein_id gnl|my_center|LOCUS_13680 5169 4390 gene locus_tag LOCUS_13690 5169 4390 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_13690 5201 5362 gene locus_tag LOCUS_13700 5201 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 5337 6290 gene locus_tag LOCUS_13710 5337 6290 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_13710 6304 7380 gene locus_tag LOCUS_13720 6304 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7398 9281 gene locus_tag LOCUS_13730 7398 9281 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_13730 9283 10182 gene locus_tag LOCUS_13740 9283 10182 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_13740 10196 11314 gene locus_tag LOCUS_13750 10196 11314 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_13750 11491 13053 gene locus_tag LOCUS_13760 11491 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 13455 13616 gene locus_tag LOCUS_13770 13455 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13940 13859 gene locus_tag LOCUS_t00160 13940 13859 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14824 13976 gene locus_tag LOCUS_13780 14824 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 15171 15944 gene locus_tag LOCUS_13790 gene sigG 15171 15944 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_13790 15985 16239 gene locus_tag LOCUS_13800 15985 16239 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181832.1 protein_id gnl|my_center|LOCUS_13800 16452 16895 gene locus_tag LOCUS_13810 gene nrdR 16452 16895 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_13810 16930 17634 gene locus_tag LOCUS_13820 16930 17634 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_13820 17631 19412 gene locus_tag LOCUS_13830 17631 19412 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965008.1 protein_id gnl|my_center|LOCUS_13830 19413 20546 gene locus_tag LOCUS_13840 19413 20546 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_13840 21828 20686 gene locus_tag LOCUS_13850 21828 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 22949 21840 gene locus_tag LOCUS_13860 22949 21840 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_13860 23279 24382 gene locus_tag LOCUS_13870 23279 24382 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_13870 24551 26113 gene locus_tag LOCUS_13880 24551 26113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_13880 26126 27313 gene locus_tag LOCUS_13890 26126 27313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_13890 27316 28245 gene locus_tag LOCUS_13900 27316 28245 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_13900 28380 28802 gene locus_tag LOCUS_13910 gene mscL 28380 28802 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_13910 28923 30020 gene locus_tag LOCUS_13920 28923 30020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 30017 30469 gene locus_tag LOCUS_13930 gene rplI 30017 30469 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_13930 30506 31873 gene locus_tag LOCUS_13940 30506 31873 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_13940 32291 33481 gene locus_tag LOCUS_13950 32291 33481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 33528 34520 gene locus_tag LOCUS_13960 33528 34520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_13960 34524 35519 gene locus_tag LOCUS_13970 34524 35519 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_13970 35621 37489 gene locus_tag LOCUS_13980 35621 37489 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_13980 37575 38351 gene locus_tag LOCUS_13990 37575 38351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 38365 39828 gene locus_tag LOCUS_14000 38365 39828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 39844 40827 gene locus_tag LOCUS_14010 39844 40827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_14010 40841 42004 gene locus_tag LOCUS_14020 40841 42004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080422.1 protein_id gnl|my_center|LOCUS_14020 42017 44047 gene locus_tag LOCUS_14030 42017 44047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 44071 44445 gene locus_tag LOCUS_14040 44071 44445 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582807.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence025 46 444 gene locus_tag LOCUS_14050 gene rpsH 46 444 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_14050 464 1009 gene locus_tag LOCUS_14060 gene rplF 464 1009 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357306.1 protein_id gnl|my_center|LOCUS_14060 1028 1396 gene locus_tag LOCUS_14070 gene rplR 1028 1396 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_14070 1413 1910 gene locus_tag LOCUS_14080 gene rpsE 1413 1910 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_14080 1925 2107 gene locus_tag LOCUS_14090 gene rpmD 1925 2107 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213339.1 protein_id gnl|my_center|LOCUS_14090 2119 2559 gene locus_tag LOCUS_14100 gene rplO 2119 2559 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_14100 2561 3826 gene locus_tag LOCUS_14110 gene secY 2561 3826 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_14110 3847 4470 gene locus_tag LOCUS_14120 3847 4470 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_14120 4473 5246 gene locus_tag LOCUS_14130 gene map 4473 5246 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_14130 5243 5515 gene locus_tag LOCUS_14140 5243 5515 CDS product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895197.1 protein_id gnl|my_center|LOCUS_14140 5520 5741 gene locus_tag LOCUS_14150 gene infA 5520 5741 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_14150 6240 6010 gene locus_tag LOCUS_14160 6240 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 6816 6421 gene locus_tag LOCUS_14170 6816 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 7758 6832 gene locus_tag LOCUS_14180 7758 6832 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582840.1 protein_id gnl|my_center|LOCUS_14180 7954 9906 gene locus_tag LOCUS_14190 7954 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9967 10101 gene locus_tag LOCUS_14200 9967 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 10161 10469 gene locus_tag LOCUS_14210 10161 10469 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_14210 10462 12729 gene locus_tag LOCUS_14220 gene pcrA 10462 12729 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_14220 12742 14718 gene locus_tag LOCUS_14230 gene ligA 12742 14718 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_14230 14811 15683 gene locus_tag LOCUS_14240 14811 15683 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_14240 15712 15921 gene locus_tag LOCUS_14250 gene rpoZ 15712 15921 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_14250 16014 17216 gene locus_tag LOCUS_14260 gene coaBC 16014 17216 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_14260 17198 19426 gene locus_tag LOCUS_14270 gene priA 17198 19426 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_14270 19454 19918 gene locus_tag LOCUS_14280 gene def 19454 19918 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_14280 19922 20863 gene locus_tag LOCUS_14290 gene fmt 19922 20863 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_14290 20860 22548 gene locus_tag LOCUS_14300 gene rsmB 20860 22548 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 protein_id gnl|my_center|LOCUS_14300 22545 23597 gene locus_tag LOCUS_14310 gene rlmN 22545 23597 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_14310 23610 24335 gene locus_tag LOCUS_14320 23610 24335 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_14320 24328 26154 gene locus_tag LOCUS_14330 gene pknB 24328 26154 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_14330 26169 27053 gene locus_tag LOCUS_14340 gene rsgA 26169 27053 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_14340 27046 27708 gene locus_tag LOCUS_14350 gene rpe 27046 27708 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_14350 27767 27946 gene locus_tag LOCUS_14360 27767 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 29268 27994 gene locus_tag LOCUS_14370 29268 27994 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14370 29618 30916 gene locus_tag LOCUS_14380 29618 30916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 30913 31641 gene locus_tag LOCUS_14390 30913 31641 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_14390 31897 31706 gene locus_tag LOCUS_14400 gene rpmB 31897 31706 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_14400 32076 32357 gene locus_tag LOCUS_14410 32076 32357 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644126.1 protein_id gnl|my_center|LOCUS_14410 32370 33722 gene locus_tag LOCUS_14420 32370 33722 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_14420 33948 34298 gene locus_tag LOCUS_14430 33948 34298 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_14430 34374 36023 gene locus_tag LOCUS_14440 34374 36023 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_14440 36128 38128 gene locus_tag LOCUS_14450 gene recG 36128 38128 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_14450 38204 38398 gene locus_tag LOCUS_14460 38204 38398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 38441 38647 gene locus_tag LOCUS_14470 38441 38647 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048070.1 protein_id gnl|my_center|LOCUS_14470 39010 40050 gene locus_tag LOCUS_14480 gene tdh 39010 40050 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194543.1 protein_id gnl|my_center|LOCUS_14480 40064 41251 gene locus_tag LOCUS_14490 40064 41251 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_14490 41843 43021 gene locus_tag LOCUS_14500 41843 43021 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_14500 <43935 43117 gene locus_tag LOCUS_14510 <43935 43117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003726503.1:chaperonin GroEL >Feature sequence026 355 807 gene locus_tag LOCUS_14520 gene spoIIAB 355 807 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_14520 804 1523 gene locus_tag LOCUS_14530 gene sigF 804 1523 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393005.1 protein_id gnl|my_center|LOCUS_14530 2771 1494 gene locus_tag LOCUS_14540 2771 1494 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905867.1 protein_id gnl|my_center|LOCUS_14540 2944 4788 gene locus_tag LOCUS_14550 2944 4788 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_14550 4785 5450 gene locus_tag LOCUS_14560 4785 5450 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_14560 5453 6895 gene locus_tag LOCUS_14570 5453 6895 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_14570 6898 8289 gene locus_tag LOCUS_14580 gene miaB 6898 8289 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_14580 8299 8703 gene locus_tag LOCUS_14590 8299 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8728 11313 gene locus_tag LOCUS_14600 gene mutS 8728 11313 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_14600 11314 13281 gene locus_tag LOCUS_14610 gene mutL 11314 13281 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_14610 13287 14228 gene locus_tag LOCUS_14620 gene miaA 13287 14228 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_14620 14225 15439 gene locus_tag LOCUS_14630 14225 15439 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_14630 16140 15544 gene locus_tag LOCUS_14640 gene lexA 16140 15544 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_14640 16894 16253 gene locus_tag LOCUS_14650 16894 16253 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812049.1 protein_id gnl|my_center|LOCUS_14650 17951 16932 gene locus_tag LOCUS_14660 17951 16932 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081951.1 protein_id gnl|my_center|LOCUS_14660 18202 18456 gene locus_tag LOCUS_14670 18202 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 18453 18719 gene locus_tag LOCUS_14680 18453 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 19331 19259 gene locus_tag LOCUS_t00170 19331 19259 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20139 19396 gene locus_tag LOCUS_14690 20139 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 20525 20453 gene locus_tag LOCUS_t00180 20525 20453 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20698 21621 gene locus_tag LOCUS_14700 20698 21621 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_14700 21680 22453 gene locus_tag LOCUS_14710 21680 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 22497 23486 gene locus_tag LOCUS_14720 22497 23486 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913975.1 protein_id gnl|my_center|LOCUS_14720 23498 23938 gene locus_tag LOCUS_14730 gene rnhA 23498 23938 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_14730 25053 23977 gene locus_tag LOCUS_14740 25053 23977 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_14740 26543 26355 gene locus_tag LOCUS_14750 26543 26355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 26822 26625 gene locus_tag LOCUS_14760 26822 26625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 27353 26916 gene locus_tag LOCUS_14770 27353 26916 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_14770 27474 29447 gene locus_tag LOCUS_14780 27474 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 30487 29516 gene locus_tag LOCUS_14790 30487 29516 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_14790 31305 30508 gene locus_tag LOCUS_14800 31305 30508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_14800 32257 31298 gene locus_tag LOCUS_14810 32257 31298 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_14810 33298 32342 gene locus_tag LOCUS_14820 33298 32342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_14820 33536 33393 gene locus_tag LOCUS_14830 33536 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 34236 33703 gene locus_tag LOCUS_14840 34236 33703 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358603.1 protein_id gnl|my_center|LOCUS_14840 34576 34223 gene locus_tag LOCUS_14850 34576 34223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 35849 34545 gene locus_tag LOCUS_14860 35849 34545 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358606.1 protein_id gnl|my_center|LOCUS_14860 37130 35868 gene locus_tag LOCUS_14870 37130 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 38121 37123 gene locus_tag LOCUS_14880 38121 37123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 38346 38263 gene locus_tag LOCUS_t00190 38346 38263 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 39626 38409 gene locus_tag LOCUS_14890 39626 38409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476412.1 protein_id gnl|my_center|LOCUS_14890 40747 39644 gene locus_tag LOCUS_14900 40747 39644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 41563 41478 gene locus_tag LOCUS_t00200 41563 41478 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41676 41592 gene locus_tag LOCUS_t00210 41676 41592 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 41771 41700 gene locus_tag LOCUS_t00220 41771 41700 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 386 1027 gene locus_tag LOCUS_14910 386 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1029 1748 gene locus_tag LOCUS_14920 1029 1748 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890721.1 protein_id gnl|my_center|LOCUS_14920 1820 2854 gene locus_tag LOCUS_14930 1820 2854 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_14930 3823 3014 gene locus_tag LOCUS_14940 3823 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5061 3835 gene locus_tag LOCUS_14950 5061 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7246 5042 gene locus_tag LOCUS_14960 7246 5042 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_14960 7388 8029 gene locus_tag LOCUS_14970 7388 8029 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_14970 8054 8950 gene locus_tag LOCUS_14980 8054 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 9000 11159 gene locus_tag LOCUS_14990 9000 11159 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_14990 12077 11214 gene locus_tag LOCUS_15000 gene rsmA 12077 11214 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475602.1 protein_id gnl|my_center|LOCUS_15000 14900 12171 gene locus_tag LOCUS_15010 14900 12171 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_15010 15128 14919 gene locus_tag LOCUS_15020 15128 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 16000 15413 gene locus_tag LOCUS_15030 gene pgsA 16000 15413 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_15030 16411 16121 gene locus_tag LOCUS_15040 16411 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 17080 16451 gene locus_tag LOCUS_15050 17080 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 17242 18330 gene locus_tag LOCUS_15060 17242 18330 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_15060 18320 19723 gene locus_tag LOCUS_15070 18320 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 21335 20151 gene locus_tag LOCUS_15080 21335 20151 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062220.1 protein_id gnl|my_center|LOCUS_15080 21826 21332 gene locus_tag LOCUS_15090 21826 21332 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_15090 23222 21819 gene locus_tag LOCUS_15100 23222 21819 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_15100 23405 24313 gene locus_tag LOCUS_15110 23405 24313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 24338 25141 gene locus_tag LOCUS_15120 24338 25141 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_15120 25516 25905 gene locus_tag LOCUS_15130 25516 25905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 25937 26440 gene locus_tag LOCUS_15140 25937 26440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 26664 27068 gene locus_tag LOCUS_15150 26664 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 27062 27904 gene locus_tag LOCUS_15160 27062 27904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 27924 29672 gene locus_tag LOCUS_15170 27924 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 29925 30638 gene locus_tag LOCUS_15180 29925 30638 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262663.1 protein_id gnl|my_center|LOCUS_15180 30659 31702 gene locus_tag LOCUS_15190 30659 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 32585 31881 gene locus_tag LOCUS_15200 gene pyrH 32585 31881 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_15200 32848 34080 gene locus_tag LOCUS_15210 32848 34080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 35890 34169 gene locus_tag LOCUS_15220 35890 34169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 37347 35911 gene locus_tag LOCUS_15230 37347 35911 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_15230 37837 37337 gene locus_tag LOCUS_15240 37837 37337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 38013 39362 gene locus_tag LOCUS_15250 gene gdhA 38013 39362 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_15250 39534 40037 gene locus_tag LOCUS_15260 39534 40037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence028 58 130 gene locus_tag LOCUS_t00230 58 130 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 853 620 gene locus_tag LOCUS_15270 853 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2678 1776 gene locus_tag LOCUS_15280 2678 1776 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892281.1 protein_id gnl|my_center|LOCUS_15280 3128 4429 gene locus_tag LOCUS_15290 3128 4429 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_15290 4446 4880 gene locus_tag LOCUS_15300 4446 4880 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_15300 6402 4975 gene locus_tag LOCUS_15310 6402 4975 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_15310 7875 6664 gene locus_tag LOCUS_15320 7875 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 9107 7893 gene locus_tag LOCUS_15330 9107 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 10647 9274 gene locus_tag LOCUS_15340 10647 9274 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_15340 10905 10687 gene locus_tag LOCUS_15350 10905 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 11882 10953 gene locus_tag LOCUS_15360 11882 10953 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_15360 12837 11899 gene locus_tag LOCUS_15370 12837 11899 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_15370 13295 15367 gene locus_tag LOCUS_15380 13295 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 15370 16419 gene locus_tag LOCUS_15390 15370 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 18197 16737 gene locus_tag LOCUS_15400 18197 16737 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_15400 18501 19142 gene locus_tag LOCUS_15410 18501 19142 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_15410 19139 19507 gene locus_tag LOCUS_15420 19139 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15420 19510 20223 gene locus_tag LOCUS_15430 19510 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15430 22893 20335 gene locus_tag LOCUS_15440 22893 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 25275 22984 gene locus_tag LOCUS_15450 25275 22984 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_15450 25457 25726 gene locus_tag LOCUS_15460 25457 25726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 26099 25680 gene locus_tag LOCUS_15470 26099 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 26933 26178 gene locus_tag LOCUS_15480 26933 26178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 27120 27980 gene locus_tag LOCUS_15490 27120 27980 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_15490 29027 28092 gene locus_tag LOCUS_15500 gene rbsK 29027 28092 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119387.1 protein_id gnl|my_center|LOCUS_15500 30343 29078 gene locus_tag LOCUS_15510 30343 29078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 31290 30349 gene locus_tag LOCUS_15520 31290 30349 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454848.1 protein_id gnl|my_center|LOCUS_15520 32221 31652 gene locus_tag LOCUS_15530 32221 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 32535 32218 gene locus_tag LOCUS_15540 32535 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 32704 33288 gene locus_tag LOCUS_15550 32704 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 33315 34097 gene locus_tag LOCUS_15560 33315 34097 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_15560 35362 34469 gene locus_tag LOCUS_15570 35362 34469 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_15570 35655 36416 gene locus_tag LOCUS_15580 35655 36416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 36440 37543 gene locus_tag LOCUS_15590 36440 37543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_15590 37545 38492 gene locus_tag LOCUS_15600 37545 38492 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355143.1 protein_id gnl|my_center|LOCUS_15600 38506 39396 gene locus_tag LOCUS_15610 38506 39396 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence029 141 66 gene locus_tag LOCUS_t00240 141 66 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 722 258 gene locus_tag LOCUS_15620 722 258 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941889.1 protein_id gnl|my_center|LOCUS_15620 2047 719 gene locus_tag LOCUS_15630 gene rph 2047 719 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435607.1 protein_id gnl|my_center|LOCUS_15630 3132 2068 gene locus_tag LOCUS_15640 gene gerM 3132 2068 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126760.1 protein_id gnl|my_center|LOCUS_15640 3293 5002 gene locus_tag LOCUS_15650 3293 5002 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_15650 5431 5060 gene locus_tag LOCUS_15660 5431 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 6115 5450 gene locus_tag LOCUS_15670 6115 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 9112 6197 gene locus_tag LOCUS_15680 9112 6197 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080411.1 protein_id gnl|my_center|LOCUS_15680 9518 9222 gene locus_tag LOCUS_15690 9518 9222 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_15690 10894 9710 gene locus_tag LOCUS_15700 10894 9710 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_15700 11863 10895 gene locus_tag LOCUS_15710 gene holB 11863 10895 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_15710 12192 11863 gene locus_tag LOCUS_15720 12192 11863 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963622.1 protein_id gnl|my_center|LOCUS_15720 13747 12395 gene locus_tag LOCUS_15730 gene ftsZ 13747 12395 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_15730 14988 13783 gene locus_tag LOCUS_15740 gene ftsA 14988 13783 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047886.1 protein_id gnl|my_center|LOCUS_15740 16059 15136 gene locus_tag LOCUS_15750 16059 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 17281 16118 gene locus_tag LOCUS_15760 gene spoVE 17281 16118 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_15760 18645 17278 gene locus_tag LOCUS_15770 gene murD 18645 17278 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_15770 19661 18663 gene locus_tag LOCUS_15780 gene mraY 19661 18663 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_15780 21136 19679 gene locus_tag LOCUS_15790 21136 19679 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_15790 23308 21179 gene locus_tag LOCUS_15800 23308 21179 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_15800 23811 23341 gene locus_tag LOCUS_15810 23811 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 24316 23831 gene locus_tag LOCUS_15820 gene mraZ 24316 23831 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_15820 25226 24531 gene locus_tag LOCUS_15830 25226 24531 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_15830 25612 25229 gene locus_tag LOCUS_15840 25612 25229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 25749 26228 gene locus_tag LOCUS_15850 25749 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 27304 26309 gene locus_tag LOCUS_15860 27304 26309 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583905.1 protein_id gnl|my_center|LOCUS_15860 27866 27297 gene locus_tag LOCUS_15870 27866 27297 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963542.1 protein_id gnl|my_center|LOCUS_15870 28425 27847 gene locus_tag LOCUS_15880 28425 27847 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966279.1 protein_id gnl|my_center|LOCUS_15880 28657 28439 gene locus_tag LOCUS_15890 28657 28439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 29233 28715 gene locus_tag LOCUS_15900 gene trmL 29233 28715 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_15900 30057 29230 gene locus_tag LOCUS_15910 30057 29230 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_15910 30881 30054 gene locus_tag LOCUS_15920 30881 30054 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_15920 31351 30878 gene locus_tag LOCUS_15930 31351 30878 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762311.1 protein_id gnl|my_center|LOCUS_15930 32211 31339 gene locus_tag LOCUS_15940 32211 31339 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919846.1 protein_id gnl|my_center|LOCUS_15940 32938 32297 gene locus_tag LOCUS_15950 32938 32297 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_15950 34181 32943 gene locus_tag LOCUS_15960 gene tyrS 34181 32943 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_15960 35387 34200 gene locus_tag LOCUS_15970 35387 34200 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_15970 36571 36038 gene locus_tag LOCUS_15980 36571 36038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 37485 36565 gene locus_tag LOCUS_15990 37485 36565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15990 38918 37680 gene locus_tag LOCUS_16000 38918 37680 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence030 1012 218 gene locus_tag LOCUS_16010 1012 218 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967090.1 protein_id gnl|my_center|LOCUS_16010 1277 3031 gene locus_tag LOCUS_16020 1277 3031 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_16020 4136 2916 gene locus_tag LOCUS_16030 4136 2916 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_16030 4335 5591 gene locus_tag LOCUS_16040 4335 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5654 5866 gene locus_tag LOCUS_16050 5654 5866 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562948.1 protein_id gnl|my_center|LOCUS_16050 5847 6377 gene locus_tag LOCUS_16060 gene lepB 5847 6377 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_16060 6419 7297 gene locus_tag LOCUS_16070 gene lepB 6419 7297 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246166.1 protein_id gnl|my_center|LOCUS_16070 7312 7452 gene locus_tag LOCUS_16080 7312 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 7512 8918 gene locus_tag LOCUS_16090 7512 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 8935 9726 gene locus_tag LOCUS_16100 8935 9726 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_16100 9726 10490 gene locus_tag LOCUS_16110 9726 10490 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547977.1 protein_id gnl|my_center|LOCUS_16110 10855 12225 gene locus_tag LOCUS_16120 10855 12225 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_16120 13652 12330 gene locus_tag LOCUS_16130 13652 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 14592 13678 gene locus_tag LOCUS_16140 14592 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 14771 16846 gene locus_tag LOCUS_16150 14771 16846 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_16150 16875 18149 gene locus_tag LOCUS_16160 16875 18149 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_16160 18149 18592 gene locus_tag LOCUS_16170 18149 18592 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_16170 18891 19181 gene locus_tag LOCUS_16180 18891 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 19387 20181 gene locus_tag LOCUS_16190 19387 20181 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124419.1 protein_id gnl|my_center|LOCUS_16190 21263 20178 gene locus_tag LOCUS_16200 21263 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 22436 21570 gene locus_tag LOCUS_16210 22436 21570 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_16210 25535 22467 gene locus_tag LOCUS_16220 gene lacZ 25535 22467 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_16220 26664 25621 gene locus_tag LOCUS_16230 26664 25621 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_16230 26956 26657 gene locus_tag LOCUS_16240 26956 26657 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_16240 27545 27120 gene locus_tag LOCUS_16250 27545 27120 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_16250 29888 27591 gene locus_tag LOCUS_16260 29888 27591 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_16260 31159 30257 gene locus_tag LOCUS_16270 31159 30257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 33474 31246 gene locus_tag LOCUS_16280 33474 31246 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_16280 33712 33560 gene locus_tag LOCUS_16290 33712 33560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 34626 33892 gene locus_tag LOCUS_16300 34626 33892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 35764 34637 gene locus_tag LOCUS_16310 gene galK 35764 34637 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_16310 <37591 35995 gene locus_tag LOCUS_16320 <37591 35995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860391.1:leucine-rich repeat protein >Feature sequence031 226 384 gene locus_tag LOCUS_16330 226 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2432 1164 gene locus_tag LOCUS_16340 2432 1164 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_16340 3396 2473 gene locus_tag LOCUS_16350 3396 2473 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_16350 3529 4548 gene locus_tag LOCUS_16360 gene citC 3529 4548 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870396.1 protein_id gnl|my_center|LOCUS_16360 4538 4807 gene locus_tag LOCUS_16370 gene citD 4538 4807 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905811.1 protein_id gnl|my_center|LOCUS_16370 4810 5685 gene locus_tag LOCUS_16380 gene citE 4810 5685 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547014.1 protein_id gnl|my_center|LOCUS_16380 5682 7085 gene locus_tag LOCUS_16390 gene citF 5682 7085 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_16390 7100 7597 gene locus_tag LOCUS_16400 7100 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7599 8153 gene locus_tag LOCUS_16410 gene yfcE 7599 8153 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_16410 8394 9698 gene locus_tag LOCUS_16420 8394 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 9695 10444 gene locus_tag LOCUS_16430 9695 10444 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_16430 10461 11360 gene locus_tag LOCUS_16440 gene hslO 10461 11360 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_16440 11393 13090 gene locus_tag LOCUS_16450 11393 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 13116 13946 gene locus_tag LOCUS_16460 13116 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 13983 15383 gene locus_tag LOCUS_16470 13983 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 15596 16777 gene locus_tag LOCUS_16480 15596 16777 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_16480 16904 18184 gene locus_tag LOCUS_16490 16904 18184 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115768.1 protein_id gnl|my_center|LOCUS_16490 20205 18640 gene locus_tag LOCUS_16500 20205 18640 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039046.1 protein_id gnl|my_center|LOCUS_16500 20404 23322 gene locus_tag LOCUS_16510 20404 23322 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_16510 23346 24284 gene locus_tag LOCUS_16520 23346 24284 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_16520 24287 25561 gene locus_tag LOCUS_16530 24287 25561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 25605 27113 gene locus_tag LOCUS_16540 25605 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16540 27088 27756 gene locus_tag LOCUS_16550 27088 27756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16550 27771 30359 gene locus_tag LOCUS_16560 27771 30359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 30359 31510 gene locus_tag LOCUS_16570 30359 31510 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_16570 31500 32507 gene locus_tag LOCUS_16580 31500 32507 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence032 27 392 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcccaccccgcatggggtgggtggattgaaat 582 3197 gene locus_tag LOCUS_16590 582 3197 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_16590 3424 4953 gene locus_tag LOCUS_16600 3424 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5058 5819 gene locus_tag LOCUS_16610 5058 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5816 6310 gene locus_tag LOCUS_16620 5816 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9050 6771 gene locus_tag LOCUS_16630 gene feoB 9050 6771 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_16630 9999 9409 gene locus_tag LOCUS_16640 9999 9409 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_16640 10530 11147 gene locus_tag LOCUS_16650 10530 11147 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_16650 11295 12074 gene locus_tag LOCUS_16660 11295 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 12187 12462 gene locus_tag LOCUS_16670 12187 12462 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430198.1 protein_id gnl|my_center|LOCUS_16670 12476 13009 gene locus_tag LOCUS_16680 12476 13009 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990647.1 protein_id gnl|my_center|LOCUS_16680 13010 13471 gene locus_tag LOCUS_16690 13010 13471 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_16690 13776 14420 gene locus_tag LOCUS_16700 13776 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 14476 14865 gene locus_tag LOCUS_16710 14476 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 15959 14937 gene locus_tag LOCUS_16720 15959 14937 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081714208.1 protein_id gnl|my_center|LOCUS_16720 16849 16007 gene locus_tag LOCUS_16730 16849 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 17298 18713 gene locus_tag LOCUS_16740 17298 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 18814 21681 gene locus_tag LOCUS_16750 18814 21681 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_16750 21699 22631 gene locus_tag LOCUS_16760 21699 22631 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_16760 22632 23585 gene locus_tag LOCUS_16770 22632 23585 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_16770 23598 25052 gene locus_tag LOCUS_16780 23598 25052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 25049 25714 gene locus_tag LOCUS_16790 25049 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 25744 28227 gene locus_tag LOCUS_16800 25744 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 28224 29156 gene locus_tag LOCUS_16810 28224 29156 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_16810 29149 30144 gene locus_tag LOCUS_16820 29149 30144 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_16820 30485 31273 gene locus_tag LOCUS_16830 30485 31273 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_16830 31280 31840 gene locus_tag LOCUS_16840 31280 31840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence033 679 1527 gene locus_tag LOCUS_16850 679 1527 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_16850 1503 2348 gene locus_tag LOCUS_16860 1503 2348 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_16860 2356 3165 gene locus_tag LOCUS_16870 2356 3165 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_16870 3176 3943 gene locus_tag LOCUS_16880 gene truA 3176 3943 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_16880 3940 4413 gene locus_tag LOCUS_16890 gene ybaK 3940 4413 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_16890 4506 5066 gene locus_tag LOCUS_16900 4506 5066 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_16900 6384 5383 gene locus_tag LOCUS_16910 6384 5383 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338207.1 protein_id gnl|my_center|LOCUS_16910 6524 7306 gene locus_tag LOCUS_16920 6524 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 7961 7284 gene locus_tag LOCUS_16930 7961 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809375.1 protein_id gnl|my_center|LOCUS_16930 8654 7977 gene locus_tag LOCUS_16940 8654 7977 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244307.1 protein_id gnl|my_center|LOCUS_16940 8803 8878 gene locus_tag LOCUS_t00250 8803 8878 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9423 9647 gene locus_tag LOCUS_16950 9423 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 9586 10782 gene locus_tag LOCUS_16960 9586 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 10829 13201 gene locus_tag LOCUS_16970 10829 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 13232 14554 gene locus_tag LOCUS_16980 13232 14554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 14592 16154 gene locus_tag LOCUS_16990 14592 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 16355 16465 gene locus_tag LOCUS_r00010 16355 16465 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 16575 17450 gene locus_tag LOCUS_17000 16575 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 18527 17517 gene locus_tag LOCUS_17010 gene purR 18527 17517 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190982.1 protein_id gnl|my_center|LOCUS_17010 18783 19643 gene locus_tag LOCUS_17020 18783 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 19804 19876 gene locus_tag LOCUS_t00260 19804 19876 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19884 19955 gene locus_tag LOCUS_t00270 19884 19955 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19960 20032 gene locus_tag LOCUS_t00280 19960 20032 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20038 20111 gene locus_tag LOCUS_t00290 20038 20111 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20559 21659 gene locus_tag LOCUS_17030 20559 21659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 21683 22225 gene locus_tag LOCUS_17040 21683 22225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 22254 27038 gene locus_tag LOCUS_17050 gene essC 22254 27038 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837665.1 protein_id gnl|my_center|LOCUS_17050 27031 27807 gene locus_tag LOCUS_17060 27031 27807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 27804 28310 gene locus_tag LOCUS_17070 27804 28310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 28314 28565 gene locus_tag LOCUS_17080 28314 28565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 28879 29172 gene locus_tag LOCUS_17090 28879 29172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 29227 29559 gene locus_tag LOCUS_17100 29227 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 29588 29866 gene locus_tag LOCUS_17110 29588 29866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 29879 30343 gene locus_tag LOCUS_17120 29879 30343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 30391 30678 gene locus_tag LOCUS_17130 30391 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 30678 30917 gene locus_tag LOCUS_17140 30678 30917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence034 1591 557 gene locus_tag LOCUS_17150 1591 557 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429564.1 protein_id gnl|my_center|LOCUS_17150 3382 1694 gene locus_tag LOCUS_17160 3382 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3540 4247 gene locus_tag LOCUS_17170 3540 4247 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_17170 4317 5840 gene locus_tag LOCUS_17180 gene xylB 4317 5840 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_17180 5855 6091 gene locus_tag LOCUS_17190 5855 6091 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371287.1 protein_id gnl|my_center|LOCUS_17190 7058 6390 gene locus_tag LOCUS_17200 7058 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 7834 7055 gene locus_tag LOCUS_17210 7834 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 8301 8089 gene locus_tag LOCUS_17220 8301 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 8868 9287 gene locus_tag LOCUS_17230 8868 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 9299 10720 gene locus_tag LOCUS_17240 9299 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 10894 11877 gene locus_tag LOCUS_17250 10894 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 11914 12558 gene locus_tag LOCUS_17260 gene eda 11914 12558 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_17260 14773 13289 gene locus_tag LOCUS_17270 14773 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 15664 14816 gene locus_tag LOCUS_17280 15664 14816 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 protein_id gnl|my_center|LOCUS_17280 16549 15737 gene locus_tag LOCUS_17290 16549 15737 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_17290 17374 16586 gene locus_tag LOCUS_17300 gene yfaU 17374 16586 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992992.1 protein_id gnl|my_center|LOCUS_17300 18393 17371 gene locus_tag LOCUS_17310 18393 17371 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_17310 20025 18496 gene locus_tag LOCUS_17320 gene abfB 20025 18496 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_17320 20652 20056 gene locus_tag LOCUS_17330 20652 20056 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_17330 22454 20811 gene locus_tag LOCUS_17340 22454 20811 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_17340 23503 22595 gene locus_tag LOCUS_17350 23503 22595 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_17350 24448 23513 gene locus_tag LOCUS_17360 24448 23513 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_17360 24718 27000 gene locus_tag LOCUS_17370 24718 27000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 27257 28783 gene locus_tag LOCUS_17380 27257 28783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 29679 29607 gene locus_tag LOCUS_t00300 29679 29607 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 1109 282 gene locus_tag LOCUS_17390 1109 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3269 1227 gene locus_tag LOCUS_17400 3269 1227 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_17400 4785 3298 gene locus_tag LOCUS_17410 4785 3298 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_17410 5450 6916 gene locus_tag LOCUS_17420 gene malQ 5450 6916 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028588.1 protein_id gnl|my_center|LOCUS_17420 6913 9240 gene locus_tag LOCUS_17430 6913 9240 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_17430 9262 11016 gene locus_tag LOCUS_17440 gene hflX 9262 11016 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048095.1 protein_id gnl|my_center|LOCUS_17440 11512 11189 gene locus_tag LOCUS_17450 11512 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 12856 11528 gene locus_tag LOCUS_17460 12856 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 13625 12879 gene locus_tag LOCUS_17470 gene aacC 13625 12879 CDS product BA2930 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879231.1 protein_id gnl|my_center|LOCUS_17470 13848 15971 gene locus_tag LOCUS_17480 13848 15971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 16188 16018 gene locus_tag LOCUS_17490 16188 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 16328 18073 gene locus_tag LOCUS_17500 16328 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 20917 18323 gene locus_tag LOCUS_17510 20917 18323 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989583.1 protein_id gnl|my_center|LOCUS_17510 21101 20943 gene locus_tag LOCUS_17520 21101 20943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 21134 23164 gene locus_tag LOCUS_17530 21134 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 23950 23240 gene locus_tag LOCUS_17540 23950 23240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 24139 25380 gene locus_tag LOCUS_17550 24139 25380 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_17550 28307 25677 gene locus_tag LOCUS_17560 28307 25677 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence036 243 1454 gene locus_tag LOCUS_17570 243 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1561 2490 gene locus_tag LOCUS_17580 1561 2490 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_17580 3306 2578 gene locus_tag LOCUS_17590 3306 2578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900606.1 protein_id gnl|my_center|LOCUS_17590 4025 3303 gene locus_tag LOCUS_17600 4025 3303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_17600 4597 4022 gene locus_tag LOCUS_17610 4597 4022 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047752.1 protein_id gnl|my_center|LOCUS_17610 6874 5087 gene locus_tag LOCUS_17620 6874 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 7643 6945 gene locus_tag LOCUS_17630 7643 6945 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_17630 8695 7661 gene locus_tag LOCUS_17640 8695 7661 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_17640 8781 9449 gene locus_tag LOCUS_17650 8781 9449 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_17650 11644 9485 gene locus_tag LOCUS_17660 11644 9485 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966127.1 protein_id gnl|my_center|LOCUS_17660 11962 13131 gene locus_tag LOCUS_17670 11962 13131 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_17670 15671 13341 gene locus_tag LOCUS_17680 15671 13341 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_17680 16837 15668 gene locus_tag LOCUS_17690 16837 15668 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_17690 19911 16879 gene locus_tag LOCUS_17700 gene lacZ 19911 16879 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177875.1 protein_id gnl|my_center|LOCUS_17700 20266 22815 gene locus_tag LOCUS_17710 20266 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 22945 23772 gene locus_tag LOCUS_17720 22945 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584075.1 protein_id gnl|my_center|LOCUS_17720 25366 24209 gene locus_tag LOCUS_17730 25366 24209 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_17730 25538 26434 gene locus_tag LOCUS_17740 25538 26434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_17740 26431 27648 gene locus_tag LOCUS_17750 26431 27648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_17750 28154 27993 gene locus_tag LOCUS_17760 28154 27993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence037 212 1273 gene locus_tag LOCUS_17770 212 1273 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_17770 2089 1355 gene locus_tag LOCUS_17780 2089 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2813 2058 gene locus_tag LOCUS_17790 gene rluF 2813 2058 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222169.1 protein_id gnl|my_center|LOCUS_17790 2958 3845 gene locus_tag LOCUS_17800 2958 3845 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_17800 3876 4454 gene locus_tag LOCUS_17810 3876 4454 CDS product UBA/TS-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986773.1 protein_id gnl|my_center|LOCUS_17810 5162 4545 gene locus_tag LOCUS_17820 5162 4545 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_17820 8008 5171 gene locus_tag LOCUS_17830 8008 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 8124 9800 gene locus_tag LOCUS_17840 8124 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 10585 9902 gene locus_tag LOCUS_17850 10585 9902 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_17850 11433 10648 gene locus_tag LOCUS_17860 11433 10648 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_17860 12310 11435 gene locus_tag LOCUS_17870 12310 11435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_17870 13406 12297 gene locus_tag LOCUS_17880 13406 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 13675 13403 gene locus_tag LOCUS_17890 13675 13403 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_17890 14315 13872 gene locus_tag LOCUS_17900 14315 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 15595 14393 gene locus_tag LOCUS_17910 15595 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 17751 15592 gene locus_tag LOCUS_17920 17751 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 19371 17755 gene locus_tag LOCUS_17930 19371 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 20356 19373 gene locus_tag LOCUS_17940 gene opp1B 20356 19373 CDS product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 protein_id gnl|my_center|LOCUS_17940 23235 20770 gene locus_tag LOCUS_17950 23235 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 24541 23531 gene locus_tag LOCUS_17960 gene galE 24541 23531 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_17960 25608 24538 gene locus_tag LOCUS_17970 25608 24538 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_17970 26543 25614 gene locus_tag LOCUS_17980 26543 25614 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_17980 26701 27804 gene locus_tag LOCUS_17990 26701 27804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence038 1235 315 gene locus_tag LOCUS_18000 1235 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1463 1810 gene locus_tag LOCUS_18010 1463 1810 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_18010 1832 2428 gene locus_tag LOCUS_18020 gene recR 1832 2428 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_18020 3601 2474 gene locus_tag LOCUS_18030 3601 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5167 3671 gene locus_tag LOCUS_18040 5167 3671 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_18040 6122 5190 gene locus_tag LOCUS_18050 6122 5190 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_18050 7107 6136 gene locus_tag LOCUS_18060 7107 6136 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_18060 8558 7293 gene locus_tag LOCUS_18070 8558 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 8703 8876 gene locus_tag LOCUS_18080 8703 8876 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_18080 8895 10493 gene locus_tag LOCUS_18090 8895 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 11980 11195 gene locus_tag LOCUS_18100 11980 11195 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_18100 13358 12039 gene locus_tag LOCUS_18110 gene rlmD 13358 12039 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_18110 14407 13355 gene locus_tag LOCUS_18120 gene pfkA 14407 13355 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963839.1 protein_id gnl|my_center|LOCUS_18120 14537 15142 gene locus_tag LOCUS_18130 gene vanX 14537 15142 CDS product D-Ala-D-Ala dipeptidase VanX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230017.1 protein_id gnl|my_center|LOCUS_18130 15157 15921 gene locus_tag LOCUS_18140 15157 15921 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_18140 17146 16184 gene locus_tag LOCUS_18150 17146 16184 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_18150 17721 17149 gene locus_tag LOCUS_18160 17721 17149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 18081 17734 gene locus_tag LOCUS_18170 18081 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 18845 18078 gene locus_tag LOCUS_18180 gene cobS 18845 18078 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_18180 19366 18842 gene locus_tag LOCUS_18190 gene cobU 19366 18842 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706019.1 protein_id gnl|my_center|LOCUS_18190 20418 19363 gene locus_tag LOCUS_18200 gene cobT 20418 19363 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_18200 20592 21611 gene locus_tag LOCUS_18210 20592 21611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 21743 22879 gene locus_tag LOCUS_18220 21743 22879 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_18220 22866 25493 gene locus_tag LOCUS_18230 22866 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 25570 25719 gene locus_tag LOCUS_18240 25570 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 26330 25836 gene locus_tag LOCUS_18250 26330 25836 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_18250 26705 26340 gene locus_tag LOCUS_18260 26705 26340 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723121.1 protein_id gnl|my_center|LOCUS_18260 <28131 26978 gene locus_tag LOCUS_18270 <28131 26978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966478.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence039 2734 374 gene locus_tag LOCUS_18280 gene galB 2734 374 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_18280 3482 2757 gene locus_tag LOCUS_18290 3482 2757 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_18290 4862 3504 gene locus_tag LOCUS_18300 gene mgtE 4862 3504 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_18300 5375 6400 gene locus_tag LOCUS_18310 5375 6400 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_18310 6496 8664 gene locus_tag LOCUS_18320 gene gnpA 6496 8664 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068765.1 protein_id gnl|my_center|LOCUS_18320 8680 9246 gene locus_tag LOCUS_18330 8680 9246 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_18330 9348 9614 gene locus_tag LOCUS_18340 9348 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 9770 10267 gene locus_tag LOCUS_18350 9770 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 12122 10761 gene locus_tag LOCUS_18360 12122 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 12343 12900 gene locus_tag LOCUS_18370 12343 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 12995 14140 gene locus_tag LOCUS_18380 12995 14140 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_18380 14148 15296 gene locus_tag LOCUS_18390 gene thiI 14148 15296 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_18390 15303 17576 gene locus_tag LOCUS_18400 gene mrfA 15303 17576 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_18400 19223 18360 gene locus_tag LOCUS_18410 19223 18360 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_18410 21097 19319 gene locus_tag LOCUS_18420 gene aspS 21097 19319 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_18420 22368 21100 gene locus_tag LOCUS_18430 gene hisS 22368 21100 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_18430 23121 22699 gene locus_tag LOCUS_18440 23121 22699 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948529.1 protein_id gnl|my_center|LOCUS_18440 23354 24568 gene locus_tag LOCUS_18450 23354 24568 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_18450 24635 26149 gene locus_tag LOCUS_18460 24635 26149 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_18460 26164 26844 gene locus_tag LOCUS_18470 26164 26844 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence040 1302 415 gene locus_tag LOCUS_18480 gene thrB 1302 415 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_18480 2762 1290 gene locus_tag LOCUS_18490 gene thrC 2762 1290 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_18490 2881 4011 gene locus_tag LOCUS_18500 2881 4011 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_18500 4025 5032 gene locus_tag LOCUS_18510 4025 5032 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_18510 5289 5002 gene locus_tag LOCUS_18520 5289 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 5562 6629 gene locus_tag LOCUS_18530 5562 6629 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_18530 6698 7471 gene locus_tag LOCUS_18540 6698 7471 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948565.1 protein_id gnl|my_center|LOCUS_18540 7472 7927 gene locus_tag LOCUS_18550 7472 7927 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_18550 9813 7921 gene locus_tag LOCUS_18560 9813 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 10621 9818 gene locus_tag LOCUS_18570 10621 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 11542 10634 gene locus_tag LOCUS_18580 11542 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 11677 13155 gene locus_tag LOCUS_18590 gene spoIVA 11677 13155 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_18590 13308 14336 gene locus_tag LOCUS_18600 13308 14336 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_18600 14548 15345 gene locus_tag LOCUS_18610 14548 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 15360 16424 gene locus_tag LOCUS_18620 15360 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 16438 17811 gene locus_tag LOCUS_18630 16438 17811 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_18630 17818 18831 gene locus_tag LOCUS_18640 17818 18831 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_18640 18844 19701 gene locus_tag LOCUS_18650 gene rhaR 18844 19701 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230731.1 protein_id gnl|my_center|LOCUS_18650 19727 20827 gene locus_tag LOCUS_18660 19727 20827 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_18660 20830 22227 gene locus_tag LOCUS_18670 20830 22227 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_18670 22229 23452 gene locus_tag LOCUS_18680 22229 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 23517 24401 gene locus_tag LOCUS_18690 23517 24401 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416903.1 protein_id gnl|my_center|LOCUS_18690 24398 25255 gene locus_tag LOCUS_18700 24398 25255 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027191.1 protein_id gnl|my_center|LOCUS_18700 25272 26141 gene locus_tag LOCUS_18710 25272 26141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 26274 26347 gene locus_tag LOCUS_t00310 26274 26347 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26351 26426 gene locus_tag LOCUS_t00320 26351 26426 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 26431 26504 gene locus_tag LOCUS_t00330 26431 26504 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 7267 314 gene locus_tag LOCUS_18720 7267 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 9281 7542 gene locus_tag LOCUS_18730 9281 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 13445 9363 gene locus_tag LOCUS_18740 13445 9363 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272590.1 protein_id gnl|my_center|LOCUS_18740 13577 14956 gene locus_tag LOCUS_18750 gene uxaE 13577 14956 CDS product D-tagaturonate epimerase UxaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_18750 15187 16599 gene locus_tag LOCUS_18760 15187 16599 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_18760 16666 20970 gene locus_tag LOCUS_18770 16666 20970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 21937 21059 gene locus_tag LOCUS_18780 21937 21059 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_18780 23500 21956 gene locus_tag LOCUS_18790 23500 21956 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303098.1 protein_id gnl|my_center|LOCUS_18790 24992 23709 gene locus_tag LOCUS_18800 24992 23709 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_18800 26173 25019 gene locus_tag LOCUS_18810 26173 25019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence042 1 465 gene locus_tag LOCUS_18820 1 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 520 1533 gene locus_tag LOCUS_18830 520 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1622 2251 gene locus_tag LOCUS_18840 gene upp 1622 2251 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_18840 3596 2466 gene locus_tag LOCUS_18850 3596 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4453 3593 gene locus_tag LOCUS_18860 gene sdaAA 4453 3593 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_18860 5141 4482 gene locus_tag LOCUS_18870 gene sdaAB 5141 4482 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_18870 5796 5203 gene locus_tag LOCUS_18880 5796 5203 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_18880 6040 7044 gene locus_tag LOCUS_18890 6040 7044 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_18890 8220 7123 gene locus_tag LOCUS_18900 8220 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 9364 8225 gene locus_tag LOCUS_18910 9364 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 9945 9673 gene locus_tag LOCUS_18920 9945 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 10477 9851 gene locus_tag LOCUS_18930 10477 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 10718 12271 gene locus_tag LOCUS_18940 10718 12271 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048283.1 protein_id gnl|my_center|LOCUS_18940 13084 12320 gene locus_tag LOCUS_18950 13084 12320 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_18950 13204 13881 gene locus_tag LOCUS_18960 13204 13881 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_18960 13878 15215 gene locus_tag LOCUS_18970 13878 15215 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_18970 15308 16120 gene locus_tag LOCUS_18980 15308 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 16536 17276 gene locus_tag LOCUS_18990 16536 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 17273 18292 gene locus_tag LOCUS_19000 17273 18292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 18389 18661 gene locus_tag LOCUS_19010 18389 18661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 20939 18780 gene locus_tag LOCUS_19020 20939 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 23670 21394 gene locus_tag LOCUS_19030 23670 21394 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_19030 23798 24631 gene locus_tag LOCUS_19040 23798 24631 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133938067.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence043 256 181 gene locus_tag LOCUS_t00340 256 181 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 628 2064 gene locus_tag LOCUS_19050 628 2064 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_19050 2119 4431 gene locus_tag LOCUS_19060 gene yicI 2119 4431 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083036.1 protein_id gnl|my_center|LOCUS_19060 4499 4825 gene locus_tag LOCUS_19070 4499 4825 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_19070 5816 4848 gene locus_tag LOCUS_19080 5816 4848 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_19080 6039 7526 gene locus_tag LOCUS_19090 6039 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 7608 8837 gene locus_tag LOCUS_19100 7608 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 8945 11287 gene locus_tag LOCUS_19110 8945 11287 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965638.1 protein_id gnl|my_center|LOCUS_19110 11301 13649 gene locus_tag LOCUS_19120 11301 13649 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_19120 13672 14772 gene locus_tag LOCUS_19130 13672 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 14780 15235 gene locus_tag LOCUS_19140 14780 15235 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941534.1 protein_id gnl|my_center|LOCUS_19140 15310 15804 gene locus_tag LOCUS_19150 15310 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 15856 16878 gene locus_tag LOCUS_19160 gene floA 15856 16878 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_19160 16913 17275 gene locus_tag LOCUS_19170 16913 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 17379 18128 gene locus_tag LOCUS_19180 17379 18128 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460401.1 protein_id gnl|my_center|LOCUS_19180 18149 19534 gene locus_tag LOCUS_19190 18149 19534 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_19190 19535 20881 gene locus_tag LOCUS_19200 19535 20881 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_19200 21040 21798 gene locus_tag LOCUS_19210 gene spo0A 21040 21798 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_19210 21906 22886 gene locus_tag LOCUS_19220 21906 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 23570 22938 gene locus_tag LOCUS_19230 23570 22938 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_19230 <24548 23567 gene locus_tag LOCUS_19240 <24548 23567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398654.1:alpha-L-arabinofuranosidase AbfB >Feature sequence044 76 1632 gene locus_tag LOCUS_19250 gene gpmI 76 1632 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_19250 1879 2325 gene locus_tag LOCUS_19260 1879 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2510 4039 gene locus_tag LOCUS_19270 2510 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 4052 5386 gene locus_tag LOCUS_19280 4052 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 5405 5941 gene locus_tag LOCUS_19290 5405 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 5959 6933 gene locus_tag LOCUS_19300 gene dusB 5959 6933 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_19300 6920 8272 gene locus_tag LOCUS_19310 6920 8272 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584098.1 protein_id gnl|my_center|LOCUS_19310 8275 8616 gene locus_tag LOCUS_19320 8275 8616 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_19320 9822 8689 gene locus_tag LOCUS_19330 9822 8689 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_19330 9931 10347 gene locus_tag LOCUS_19340 9931 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 11372 10851 gene locus_tag LOCUS_19350 11372 10851 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_19350 12076 11369 gene locus_tag LOCUS_19360 12076 11369 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_19360 12250 14334 gene locus_tag LOCUS_19370 12250 14334 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_19370 14334 15182 gene locus_tag LOCUS_19380 14334 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 15214 16515 gene locus_tag LOCUS_19390 15214 16515 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_19390 16743 17174 gene locus_tag LOCUS_19400 16743 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 17178 17918 gene locus_tag LOCUS_19410 gene atpB 17178 17918 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_19410 17954 18232 gene locus_tag LOCUS_19420 gene atpE 17954 18232 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_19420 18268 18777 gene locus_tag LOCUS_19430 gene atpF 18268 18777 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892033.1 protein_id gnl|my_center|LOCUS_19430 18774 19310 gene locus_tag LOCUS_19440 18774 19310 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966152.1 protein_id gnl|my_center|LOCUS_19440 19331 20848 gene locus_tag LOCUS_19450 gene atpA 19331 20848 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_19450 20861 21706 gene locus_tag LOCUS_19460 gene atpG 20861 21706 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_19460 21722 23110 gene locus_tag LOCUS_19470 gene atpD 21722 23110 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_19470 23114 23515 gene locus_tag LOCUS_19480 23114 23515 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence045 2135 225 gene locus_tag LOCUS_19490 2135 225 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_19490 2899 2306 gene locus_tag LOCUS_19500 2899 2306 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_19500 3585 2896 gene locus_tag LOCUS_19510 gene cmk 3585 2896 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110867.1 protein_id gnl|my_center|LOCUS_19510 4993 3578 gene locus_tag LOCUS_19520 gene pepV 4993 3578 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274265.1 protein_id gnl|my_center|LOCUS_19520 6942 5062 gene locus_tag LOCUS_19530 gene uvrC 6942 5062 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_19530 8330 6939 gene locus_tag LOCUS_19540 8330 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 9418 8327 gene locus_tag LOCUS_19550 9418 8327 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_19550 10380 9415 gene locus_tag LOCUS_19560 10380 9415 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_19560 11826 10411 gene locus_tag LOCUS_19570 11826 10411 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_19570 13136 11823 gene locus_tag LOCUS_19580 13136 11823 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357478.1 protein_id gnl|my_center|LOCUS_19580 13686 13123 gene locus_tag LOCUS_19590 13686 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 13921 15606 gene locus_tag LOCUS_19600 13921 15606 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_19600 16518 18395 gene locus_tag LOCUS_19610 16518 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 18405 20372 gene locus_tag LOCUS_19620 18405 20372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 20671 20390 gene locus_tag LOCUS_19630 20671 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 21199 23613 gene locus_tag LOCUS_19640 gene leuS 21199 23613 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence046 <1 713 gene locus_tag LOCUS_19650 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256630.1:DUF4838 domain-containing protein 917 2179 gene locus_tag LOCUS_19660 917 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4001 2292 gene locus_tag LOCUS_19670 4001 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5170 4001 gene locus_tag LOCUS_19680 5170 4001 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_19680 6827 5289 gene locus_tag LOCUS_19690 6827 5289 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_19690 10104 7102 gene locus_tag LOCUS_19700 10104 7102 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_19700 10508 10182 gene locus_tag LOCUS_19710 10508 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 11758 10598 gene locus_tag LOCUS_19720 gene metK 11758 10598 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_19720 12092 13498 gene locus_tag LOCUS_19730 12092 13498 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010818874.1 protein_id gnl|my_center|LOCUS_19730 13726 14193 gene locus_tag LOCUS_19740 gene smpB 13726 14193 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_19740 14210 14557 gene locus_tag LOCUS_tm00010 14210 14557 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14662 15138 gene locus_tag LOCUS_19750 14662 15138 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922703.1 protein_id gnl|my_center|LOCUS_19750 15209 16342 gene locus_tag LOCUS_19760 15209 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 16557 18008 gene locus_tag LOCUS_19770 16557 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 18158 18727 gene locus_tag LOCUS_19780 18158 18727 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 protein_id gnl|my_center|LOCUS_19780 18842 20317 gene locus_tag LOCUS_19790 18842 20317 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_19790 20330 20689 gene locus_tag LOCUS_19800 20330 20689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 20713 21105 gene locus_tag LOCUS_19810 20713 21105 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_19810 21147 22571 gene locus_tag LOCUS_19820 21147 22571 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence047 <1 715 gene locus_tag LOCUS_19830 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109323.1:site-specific integrase 834 761 gene locus_tag LOCUS_t00350 834 761 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1140 2051 gene locus_tag LOCUS_19840 1140 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2077 3081 gene locus_tag LOCUS_19850 2077 3081 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_19850 3123 4421 gene locus_tag LOCUS_19860 3123 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4448 5884 gene locus_tag LOCUS_19870 4448 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 5901 7016 gene locus_tag LOCUS_19880 5901 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 7125 8462 gene locus_tag LOCUS_19890 7125 8462 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722393.1 protein_id gnl|my_center|LOCUS_19890 10378 8864 gene locus_tag LOCUS_19900 10378 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 11375 10476 gene locus_tag LOCUS_19910 11375 10476 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_19910 11547 12467 gene locus_tag LOCUS_19920 11547 12467 CDS product auxin efflux carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582699.1 protein_id gnl|my_center|LOCUS_19920 12487 14226 gene locus_tag LOCUS_19930 12487 14226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_19930 14248 15471 gene locus_tag LOCUS_19940 14248 15471 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_19940 15542 16600 gene locus_tag LOCUS_19950 15542 16600 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_19950 17124 16672 gene locus_tag LOCUS_19960 17124 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 17831 17217 gene locus_tag LOCUS_19970 17831 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 18074 19243 gene locus_tag LOCUS_19980 18074 19243 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_19980 19240 21183 gene locus_tag LOCUS_19990 19240 21183 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_19990 21209 22174 gene locus_tag LOCUS_20000 21209 22174 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573446.1 protein_id gnl|my_center|LOCUS_20000 22374 22450 gene locus_tag LOCUS_t00360 22374 22450 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22460 22533 gene locus_tag LOCUS_t00370 22460 22533 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 1522 146 gene locus_tag LOCUS_20010 1522 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1831 4164 gene locus_tag LOCUS_20020 1831 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 6702 4270 gene locus_tag LOCUS_20030 gene clpC 6702 4270 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_20030 7754 6723 gene locus_tag LOCUS_20040 7754 6723 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_20040 8292 7747 gene locus_tag LOCUS_20050 8292 7747 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_20050 8764 8297 gene locus_tag LOCUS_20060 8764 8297 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701965.1 protein_id gnl|my_center|LOCUS_20060 9599 8910 gene locus_tag LOCUS_20070 9599 8910 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_20070 10068 9604 gene locus_tag LOCUS_20080 10068 9604 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_20080 11249 10065 gene locus_tag LOCUS_20090 gene ispD 11249 10065 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_20090 11527 11246 gene locus_tag LOCUS_20100 11527 11246 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048379.1 protein_id gnl|my_center|LOCUS_20100 11830 11558 gene locus_tag LOCUS_20110 11830 11558 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359333.1 protein_id gnl|my_center|LOCUS_20110 13096 11846 gene locus_tag LOCUS_20120 gene mazG 13096 11846 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966488.1 protein_id gnl|my_center|LOCUS_20120 13720 13166 gene locus_tag LOCUS_20130 gene spoVT 13720 13166 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_20130 14709 13861 gene locus_tag LOCUS_20140 14709 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 18014 14709 gene locus_tag LOCUS_20150 18014 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 18631 18305 gene locus_tag LOCUS_20160 18631 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 20633 18816 gene locus_tag LOCUS_20170 gene opp2A 20633 18816 CDS product oligopeptide ABC transporter substrate-binding protein Opp2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378964.1 protein_id gnl|my_center|LOCUS_20170 <22005 20734 gene locus_tag LOCUS_20180 <22005 20734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140422.1:SdrD B-like domain-containing protein >Feature sequence049 1302 274 gene locus_tag LOCUS_20190 1302 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1453 2898 gene locus_tag LOCUS_20200 1453 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2895 3881 gene locus_tag LOCUS_20210 2895 3881 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_20210 3878 4375 gene locus_tag LOCUS_20220 3878 4375 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_20220 4392 4979 gene locus_tag LOCUS_20230 4392 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5104 6471 gene locus_tag LOCUS_20240 gene trkA 5104 6471 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_20240 6473 7915 gene locus_tag LOCUS_20250 6473 7915 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_20250 8918 8217 gene locus_tag LOCUS_20260 8918 8217 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_20260 10197 8962 gene locus_tag LOCUS_20270 10197 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 10373 13384 gene locus_tag LOCUS_20280 10373 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 13408 14724 gene locus_tag LOCUS_20290 gene rimO 13408 14724 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_20290 14721 15281 gene locus_tag LOCUS_20300 gene pgsA 14721 15281 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_20300 15297 16535 gene locus_tag LOCUS_20310 15297 16535 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_20310 16532 18478 gene locus_tag LOCUS_20320 gene tet 16532 18478 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_20320 18544 19293 gene locus_tag LOCUS_20330 18544 19293 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_20330 19425 20330 gene locus_tag LOCUS_20340 19425 20330 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_20340 21006 20428 gene locus_tag LOCUS_20350 21006 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence050 <1 1479 gene locus_tag LOCUS_20360 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679355.1:alanine--tRNA ligase 1622 1885 gene locus_tag LOCUS_20370 1622 1885 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_20370 1882 4440 gene locus_tag LOCUS_20380 1882 4440 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_20380 5034 4555 gene locus_tag LOCUS_20390 5034 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 5159 5335 gene locus_tag LOCUS_20400 5159 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 6455 5307 gene locus_tag LOCUS_20410 gene fucO 6455 5307 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_20410 7664 6486 gene locus_tag LOCUS_20420 7664 6486 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_20420 8467 7661 gene locus_tag LOCUS_20430 8467 7661 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_20430 9180 8482 gene locus_tag LOCUS_20440 9180 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 9934 9539 gene locus_tag LOCUS_20450 9934 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 10093 10434 gene locus_tag LOCUS_20460 10093 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 11617 10499 gene locus_tag LOCUS_20470 11617 10499 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_20470 13099 11891 gene locus_tag LOCUS_20480 gene pepT 13099 11891 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437954.1 protein_id gnl|my_center|LOCUS_20480 14202 13096 gene locus_tag LOCUS_20490 14202 13096 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_20490 14916 14530 gene locus_tag LOCUS_20500 14916 14530 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_20500 16171 14903 gene locus_tag LOCUS_20510 16171 14903 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_20510 18454 16283 gene locus_tag LOCUS_20520 gene pnp 18454 16283 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_20520 18984 18724 gene locus_tag LOCUS_20530 gene rpsO 18984 18724 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_20530 19468 20850 gene locus_tag LOCUS_20540 19468 20850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence051 750 1694 gene locus_tag LOCUS_20550 750 1694 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015782.1 protein_id gnl|my_center|LOCUS_20550 2286 3737 gene locus_tag LOCUS_20560 2286 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 4063 3743 gene locus_tag LOCUS_20570 4063 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 4179 4442 gene locus_tag LOCUS_20580 4179 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 5310 4534 gene locus_tag LOCUS_20590 gene spo0A 5310 4534 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_20590 5767 5546 gene locus_tag LOCUS_20600 5767 5546 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_20600 6847 5909 gene locus_tag LOCUS_20610 6847 5909 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_20610 8247 6844 gene locus_tag LOCUS_20620 8247 6844 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_20620 8392 9306 gene locus_tag LOCUS_20630 gene gpr 8392 9306 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_20630 9417 13055 gene locus_tag LOCUS_20640 9417 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 13080 13283 gene locus_tag LOCUS_20650 13080 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 13280 13831 gene locus_tag LOCUS_20660 13280 13831 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316661.1 protein_id gnl|my_center|LOCUS_20660 14083 15804 gene locus_tag LOCUS_20670 14083 15804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence052 3 560 gene locus_tag LOCUS_20680 3 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 776 2734 gene locus_tag LOCUS_20690 776 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2736 3815 gene locus_tag LOCUS_20700 2736 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 5333 4002 gene locus_tag LOCUS_20710 5333 4002 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_20710 5461 6825 gene locus_tag LOCUS_20720 5461 6825 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_20720 6916 8016 gene locus_tag LOCUS_20730 6916 8016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_20730 8032 8925 gene locus_tag LOCUS_20740 8032 8925 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_20740 8936 9811 gene locus_tag LOCUS_20750 8936 9811 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_20750 9808 11394 gene locus_tag LOCUS_20760 9808 11394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_20760 11469 12206 gene locus_tag LOCUS_20770 11469 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 13161 12565 gene locus_tag LOCUS_20780 13161 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 13481 13215 gene locus_tag LOCUS_20790 13481 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 13818 13564 gene locus_tag LOCUS_20800 13818 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 14346 14173 gene locus_tag LOCUS_20810 14346 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 15292 14909 gene locus_tag LOCUS_20820 15292 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 <15866 15349 gene locus_tag LOCUS_20830 <15866 15349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460692.1:HipA domain-containing protein >Feature sequence053 58 585 gene locus_tag LOCUS_20840 58 585 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964685.1 protein_id gnl|my_center|LOCUS_20840 746 3076 gene locus_tag LOCUS_20850 746 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3078 4016 gene locus_tag LOCUS_20860 3078 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4178 4957 gene locus_tag LOCUS_20870 4178 4957 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_20870 4954 6000 gene locus_tag LOCUS_20880 4954 6000 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529336.1 protein_id gnl|my_center|LOCUS_20880 6028 6906 gene locus_tag LOCUS_20890 gene srlD 6028 6906 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_20890 6921 8093 gene locus_tag LOCUS_20900 6921 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 8095 9363 gene locus_tag LOCUS_20910 8095 9363 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853188.1 protein_id gnl|my_center|LOCUS_20910 9365 10630 gene locus_tag LOCUS_20920 9365 10630 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263119.1 protein_id gnl|my_center|LOCUS_20920 10652 12019 gene locus_tag LOCUS_20930 gene lpdA 10652 12019 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_20930 12053 14527 gene locus_tag LOCUS_20940 12053 14527 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence054 517 2091 gene locus_tag LOCUS_20950 517 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202254.1 protein_id gnl|my_center|LOCUS_20950 2161 3099 gene locus_tag LOCUS_20960 2161 3099 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_20960 3358 4200 gene locus_tag LOCUS_20970 3358 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4292 4894 gene locus_tag LOCUS_20980 4292 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5699 5025 gene locus_tag LOCUS_20990 5699 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6868 5786 gene locus_tag LOCUS_21000 6868 5786 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_21000 8020 6899 gene locus_tag LOCUS_21010 8020 6899 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_21010 8717 8214 gene locus_tag LOCUS_21020 8717 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 8971 8825 gene locus_tag LOCUS_21030 8971 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 9859 8990 gene locus_tag LOCUS_21040 9859 8990 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_21040 10773 9853 gene locus_tag LOCUS_21050 gene rmgP 10773 9853 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_21050 11905 10952 gene locus_tag LOCUS_21060 11905 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 12565 11909 gene locus_tag LOCUS_21070 12565 11909 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093405.1 protein_id gnl|my_center|LOCUS_21070 13338 12562 gene locus_tag LOCUS_21080 13338 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 13614 14816 gene locus_tag LOCUS_21090 gene dpaL 13614 14816 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence055 1903 737 gene locus_tag LOCUS_21100 1903 737 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_21100 2018 2575 gene locus_tag LOCUS_21110 2018 2575 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862458.1 protein_id gnl|my_center|LOCUS_21110 2611 3639 gene locus_tag LOCUS_21120 2611 3639 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_21120 3658 4761 gene locus_tag LOCUS_21130 3658 4761 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_21130 4855 5619 gene locus_tag LOCUS_21140 4855 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 5784 6197 gene locus_tag LOCUS_21150 5784 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 7877 6258 gene locus_tag LOCUS_21160 7877 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 8192 8040 gene locus_tag LOCUS_21170 8192 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 10525 8198 gene locus_tag LOCUS_21180 gene feoB 10525 8198 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_21180 10810 10589 gene locus_tag LOCUS_21190 10810 10589 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_21190 11044 10832 gene locus_tag LOCUS_21200 11044 10832 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_21200 11432 11935 gene locus_tag LOCUS_21210 gene rplJ 11432 11935 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_21210 11997 12368 gene locus_tag LOCUS_21220 gene rplL 11997 12368 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 protein_id gnl|my_center|LOCUS_21220 12570 12689 gene locus_tag LOCUS_21230 12570 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 12680 12802 gene locus_tag LOCUS_21240 12680 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 13151 13921 gene locus_tag LOCUS_21250 13151 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence056 1624 1019 gene locus_tag LOCUS_21260 gene grpE 1624 1019 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021933.1 protein_id gnl|my_center|LOCUS_21260 2650 1628 gene locus_tag LOCUS_21270 gene hrcA 2650 1628 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_21270 3994 2873 gene locus_tag LOCUS_21280 gene hemW 3994 2873 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_21280 5804 3996 gene locus_tag LOCUS_21290 gene lepA 5804 3996 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964590.1 protein_id gnl|my_center|LOCUS_21290 6765 5878 gene locus_tag LOCUS_21300 6765 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 6997 8004 gene locus_tag LOCUS_21310 6997 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 8026 9120 gene locus_tag LOCUS_21320 8026 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 9730 9179 gene locus_tag LOCUS_21330 9730 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 9899 11074 gene locus_tag LOCUS_21340 9899 11074 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_21340 11550 11272 gene locus_tag LOCUS_21350 11550 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 13119 11716 gene locus_tag LOCUS_21360 13119 11716 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_21360 13927 13112 gene locus_tag LOCUS_21370 13927 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence057 721 542 gene locus_tag LOCUS_21380 721 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1446 778 gene locus_tag LOCUS_21390 1446 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1793 1377 gene locus_tag LOCUS_21400 1793 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1810 1968 gene locus_tag LOCUS_21410 1810 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2939 2004 gene locus_tag LOCUS_21420 2939 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3097 4203 gene locus_tag LOCUS_21430 3097 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 5600 4260 gene locus_tag LOCUS_21440 5600 4260 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_21440 7631 5889 gene locus_tag LOCUS_21450 7631 5889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_21450 7999 7625 gene locus_tag LOCUS_21460 7999 7625 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816909.1 protein_id gnl|my_center|LOCUS_21460 8216 9217 gene locus_tag LOCUS_21470 gene mnmA 8216 9217 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_21470 10456 9434 gene locus_tag LOCUS_21480 10456 9434 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_21480 10823 11200 gene locus_tag LOCUS_21490 gene rpsM 10823 11200 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_21490 11236 11634 gene locus_tag LOCUS_21500 gene rpsK 11236 11634 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_21500 11650 12276 gene locus_tag LOCUS_21510 gene rpsD 11650 12276 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_21510 12402 13373 gene locus_tag LOCUS_21520 12402 13373 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence058 124 1206 gene locus_tag LOCUS_21530 124 1206 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_21530 1280 1747 gene locus_tag LOCUS_21540 1280 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 3110 2091 gene locus_tag LOCUS_21550 3110 2091 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_21550 5380 3113 gene locus_tag LOCUS_21560 5380 3113 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_21560 5511 7187 gene locus_tag LOCUS_21570 5511 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 7976 7230 gene locus_tag LOCUS_21580 7976 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 8556 8008 gene locus_tag LOCUS_21590 8556 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 9189 8632 gene locus_tag LOCUS_21600 gene efp 9189 8632 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_21600 9519 10148 gene locus_tag LOCUS_21610 9519 10148 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_21610 10211 11080 gene locus_tag LOCUS_21620 10211 11080 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence059 809 1309 gene locus_tag LOCUS_21630 809 1309 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_21630 1331 2464 gene locus_tag LOCUS_21640 gene nusA 1331 2464 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_21640 2457 2759 gene locus_tag LOCUS_21650 2457 2759 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_21650 2752 3054 gene locus_tag LOCUS_21660 2752 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3086 6106 gene locus_tag LOCUS_21670 gene infB 3086 6106 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460393.1 protein_id gnl|my_center|LOCUS_21670 6177 6545 gene locus_tag LOCUS_21680 gene rbfA 6177 6545 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965109.1 protein_id gnl|my_center|LOCUS_21680 6542 7516 gene locus_tag LOCUS_21690 6542 7516 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082036.1 protein_id gnl|my_center|LOCUS_21690 7516 8403 gene locus_tag LOCUS_21700 gene truB 7516 8403 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_21700 8424 11705 gene locus_tag LOCUS_21710 gene addB 8424 11705 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence060 2036 591 gene locus_tag LOCUS_21720 2036 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2971 2036 gene locus_tag LOCUS_21730 2971 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4920 3067 gene locus_tag LOCUS_21740 4920 3067 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748873.1 protein_id gnl|my_center|LOCUS_21740 5213 5563 gene locus_tag LOCUS_21750 5213 5563 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_21750 5569 6024 gene locus_tag LOCUS_21760 5569 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6024 7343 gene locus_tag LOCUS_21770 6024 7343 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_21770 7378 7719 gene locus_tag LOCUS_21780 7378 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_21780 7785 8432 gene locus_tag LOCUS_21790 7785 8432 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_21790 8444 9403 gene locus_tag LOCUS_21800 8444 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 9500 11221 gene locus_tag LOCUS_21810 9500 11221 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_21810 11715 11521 gene locus_tag LOCUS_21820 11715 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence061 1654 479 gene locus_tag LOCUS_21830 1654 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2124 1651 gene locus_tag LOCUS_21840 2124 1651 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_21840 2364 2128 gene locus_tag LOCUS_21850 2364 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2460 2996 gene locus_tag LOCUS_21860 2460 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2993 3607 gene locus_tag LOCUS_21870 2993 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3583 3975 gene locus_tag LOCUS_21880 3583 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21880 4491 5735 gene locus_tag LOCUS_21890 4491 5735 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_21890 5860 6804 gene locus_tag LOCUS_21900 5860 6804 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_21900 6822 7688 gene locus_tag LOCUS_21910 6822 7688 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_21910 8191 7823 gene locus_tag LOCUS_21920 8191 7823 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982339.1 protein_id gnl|my_center|LOCUS_21920 8357 9508 gene locus_tag LOCUS_21930 gene nagA 8357 9508 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861065.1 protein_id gnl|my_center|LOCUS_21930 9540 10913 gene locus_tag LOCUS_21940 9540 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence062 1617 241 gene locus_tag LOCUS_21950 1617 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2643 1771 gene locus_tag LOCUS_21960 2643 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3020 3511 gene locus_tag LOCUS_21970 3020 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 3537 3890 gene locus_tag LOCUS_21980 3537 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4314 3934 gene locus_tag LOCUS_21990 4314 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 5635 4424 gene locus_tag LOCUS_22000 5635 4424 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_22000 5882 6445 gene locus_tag LOCUS_22010 5882 6445 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_22010 7630 6611 gene locus_tag LOCUS_22020 7630 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 7882 9168 gene locus_tag LOCUS_22030 gene tilS 7882 9168 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_22030 9165 9707 gene locus_tag LOCUS_22040 gene hpt 9165 9707 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence063 <1 629 gene locus_tag LOCUS_22050 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393219.1:NADH-dependent [FeFe] hydrogenase, group A6 1215 1048 gene locus_tag LOCUS_22060 1215 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1936 1379 gene locus_tag LOCUS_22070 1936 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2005 2778 gene locus_tag LOCUS_22080 2005 2778 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_22080 2784 3767 gene locus_tag LOCUS_22090 2784 3767 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_22090 4482 3832 gene locus_tag LOCUS_22100 4482 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 4966 4520 gene locus_tag LOCUS_22110 gene rpiB 4966 4520 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_22110 5424 9212 gene locus_tag LOCUS_22120 gene rpoB 5424 9212 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence064 900 175 gene locus_tag LOCUS_22130 900 175 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287788.1 protein_id gnl|my_center|LOCUS_22130 1183 2616 gene locus_tag LOCUS_22140 1183 2616 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_22140 2804 4087 gene locus_tag LOCUS_22150 2804 4087 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_22150 4217 4810 gene locus_tag LOCUS_22160 4217 4810 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_22160 4828 5301 gene locus_tag LOCUS_22170 4828 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5298 6014 gene locus_tag LOCUS_22180 5298 6014 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_22180 7292 6018 gene locus_tag LOCUS_22190 7292 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 7447 8415 gene locus_tag LOCUS_22200 gene pfkB 7447 8415 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_22200 8412 9146 gene locus_tag LOCUS_22210 8412 9146 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_22210 9208 9852 gene locus_tag LOCUS_22220 9208 9852 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence065 454 119 gene locus_tag LOCUS_22230 454 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 604 482 gene locus_tag LOCUS_22240 604 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1001 925 gene locus_tag LOCUS_t00380 1001 925 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1081 1005 gene locus_tag LOCUS_t00390 1081 1005 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1278 2060 gene locus_tag LOCUS_22250 1278 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2660 2064 gene locus_tag LOCUS_22260 2660 2064 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704735.1 protein_id gnl|my_center|LOCUS_22260 2815 4005 gene locus_tag LOCUS_22270 2815 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4034 4744 gene locus_tag LOCUS_22280 4034 4744 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_22280 4785 5705 gene locus_tag LOCUS_22290 4785 5705 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287342.1 protein_id gnl|my_center|LOCUS_22290 5969 6667 gene locus_tag LOCUS_22300 5969 6667 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 protein_id gnl|my_center|LOCUS_22300 6655 7518 gene locus_tag LOCUS_22310 6655 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 7533 8009 gene locus_tag LOCUS_22320 7533 8009 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_22320 9215 8073 gene locus_tag LOCUS_22330 9215 8073 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence066 3 140 gene locus_tag LOCUS_22340 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 933 2426 gene locus_tag LOCUS_22350 gene gguA 933 2426 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_22350 2448 4241 gene locus_tag LOCUS_22360 2448 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4313 5365 gene locus_tag LOCUS_22370 4313 5365 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_22370 5825 6133 gene locus_tag LOCUS_22380 gene rpsJ 5825 6133 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357250.1 protein_id gnl|my_center|LOCUS_22380 6145 6786 gene locus_tag LOCUS_22390 gene rplC 6145 6786 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_22390 6813 7463 gene locus_tag LOCUS_22400 gene rplD 6813 7463 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_22400 7463 7759 gene locus_tag LOCUS_22410 gene rplW 7463 7759 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357444.1 protein_id gnl|my_center|LOCUS_22410 7775 8608 gene locus_tag LOCUS_22420 gene rplB 7775 8608 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357299.1 protein_id gnl|my_center|LOCUS_22420 8642 8920 gene locus_tag LOCUS_22430 gene rpsS 8642 8920 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357326.1 protein_id gnl|my_center|LOCUS_22430 8943 9329 gene locus_tag LOCUS_22440 gene rplV 8943 9329 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829734.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence067 313 1446 gene locus_tag LOCUS_22450 313 1446 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088289.1 protein_id gnl|my_center|LOCUS_22450 1451 2935 gene locus_tag LOCUS_22460 1451 2935 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_22460 2993 4837 gene locus_tag LOCUS_22470 2993 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5793 4966 gene locus_tag LOCUS_22480 5793 4966 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_22480 6115 6603 gene locus_tag LOCUS_22490 gene greA 6115 6603 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_22490 6701 8191 gene locus_tag LOCUS_22500 gene lysS 6701 8191 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_22500 8586 9068 gene locus_tag LOCUS_22510 8586 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence068 3 140 gene locus_tag LOCUS_22520 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 302 1681 gene locus_tag LOCUS_22530 302 1681 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_22530 3213 1828 gene locus_tag LOCUS_22540 gene argH 3213 1828 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_22540 4454 3228 gene locus_tag LOCUS_22550 4454 3228 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_22550 6666 4582 gene locus_tag LOCUS_22560 6666 4582 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_22560 <7287 6739 gene locus_tag LOCUS_22570 <7287 6739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680889.1:prolipoprotein diacylglyceryl transferase >Feature sequence069 1104 241 gene locus_tag LOCUS_22580 1104 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1229 2371 gene locus_tag LOCUS_22590 1229 2371 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_22590 2688 2612 gene locus_tag LOCUS_t00400 2688 2612 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3342 2803 gene locus_tag LOCUS_22600 3342 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3713 3555 gene locus_tag LOCUS_22610 3713 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 3843 4433 gene locus_tag LOCUS_22620 3843 4433 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_22620 5353 4394 gene locus_tag LOCUS_22630 5353 4394 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391635.1 protein_id gnl|my_center|LOCUS_22630 6805 5414 gene locus_tag LOCUS_22640 gene radA 6805 5414 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence070 34 1713 gene locus_tag LOCUS_22650 34 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1730 2710 gene locus_tag LOCUS_22660 1730 2710 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_22660 4233 3223 gene locus_tag LOCUS_22670 4233 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4401 4249 gene locus_tag LOCUS_22680 4401 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 6150 5320 gene locus_tag LOCUS_22690 6150 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence071 20 130 gene locus_tag LOCUS_r00020 20 130 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 237 1481 gene locus_tag LOCUS_22700 237 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3091 1571 gene locus_tag LOCUS_22710 3091 1571 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905274.1 protein_id gnl|my_center|LOCUS_22710 3243 5429 gene locus_tag LOCUS_22720 3243 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108901.1 protein_id gnl|my_center|LOCUS_22720 5692 6123 gene locus_tag LOCUS_22730 gene rplM 5692 6123 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 protein_id gnl|my_center|LOCUS_22730 6143 6535 gene locus_tag LOCUS_22740 gene rpsI 6143 6535 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence072 1770 175 gene locus_tag LOCUS_22750 1770 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2746 1832 gene locus_tag LOCUS_22760 2746 1832 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_22760 3679 2759 gene locus_tag LOCUS_22770 3679 2759 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_22770 3806 3579 gene locus_tag LOCUS_22780 3806 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 4529 5557 gene locus_tag LOCUS_22790 4529 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence073 347 1648 gene locus_tag LOCUS_22800 347 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1788 5012 gene locus_tag LOCUS_22810 1788 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 5049 5759 gene locus_tag LOCUS_22820 5049 5759 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence074 3 2765 gene locus_tag LOCUS_22830 gene ileS 3 2765 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_22830 2762 3220 gene locus_tag LOCUS_22840 2762 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3207 4130 gene locus_tag LOCUS_22850 3207 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5521 4727 gene locus_tag LOCUS_22860 5521 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence075 242 1456 gene locus_tag LOCUS_22870 242 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3015 1615 gene locus_tag LOCUS_22880 3015 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 4935 3226 gene locus_tag LOCUS_22890 4935 3226 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_22890 <5681 4960 gene locus_tag LOCUS_22900 <5681 4960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000761737.1:exo-alpha-sialidase >Feature sequence076 44 805 gene locus_tag LOCUS_22910 44 805 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721616.1 protein_id gnl|my_center|LOCUS_22910 959 1049 gene locus_tag LOCUS_t00410 959 1049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1175 1747 gene locus_tag LOCUS_22920 1175 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1774 2166 gene locus_tag LOCUS_22930 1774 2166 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_22930 2173 2652 gene locus_tag LOCUS_22940 2173 2652 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_22940 4855 2804 gene locus_tag LOCUS_22950 4855 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 5420 4998 gene locus_tag LOCUS_22960 5420 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence077 385 894 gene locus_tag LOCUS_22970 gene rplQ 385 894 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_22970 973 2010 gene locus_tag LOCUS_22980 973 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2091 2669 gene locus_tag LOCUS_22990 2091 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2804 3277 gene locus_tag LOCUS_23000 2804 3277 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393221.1 protein_id gnl|my_center|LOCUS_23000 3277 3828 gene locus_tag LOCUS_23010 3277 3828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_23010 3857 4222 gene locus_tag LOCUS_23020 3857 4222 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence078 3025 776 gene locus_tag LOCUS_23030 gene yicI 3025 776 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_23030 3267 4331 gene locus_tag LOCUS_23040 3267 4331 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_23040 4364 4576 gene locus_tag LOCUS_23050 4364 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5160 4753 gene locus_tag LOCUS_23060 5160 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence079 1426 758 gene locus_tag LOCUS_23070 1426 758 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948733.1 protein_id gnl|my_center|LOCUS_23070 1667 2965 gene locus_tag LOCUS_23080 gene eno 1667 2965 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_23080 3127 3741 gene locus_tag LOCUS_23090 3127 3741 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930501.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence080 212 21 gene locus_tag LOCUS_23100 212 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 127 801 gene locus_tag LOCUS_23110 gene deoC 127 801 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458726.1 protein_id gnl|my_center|LOCUS_23110 2729 948 gene locus_tag LOCUS_23120 2729 948 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783169.1 protein_id gnl|my_center|LOCUS_23120 3170 3475 gene locus_tag LOCUS_23130 3170 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3587 4447 gene locus_tag LOCUS_23140 3587 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence081 762 1715 gene locus_tag LOCUS_23150 762 1715 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_23150 1730 2638 gene locus_tag LOCUS_23160 1730 2638 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_23160 2844 4319 gene locus_tag LOCUS_23170 2844 4319 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_23170 4485 4616 gene locus_tag LOCUS_23180 4485 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence082 1554 388 gene locus_tag LOCUS_23190 1554 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3679 1571 gene locus_tag LOCUS_23200 3679 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence083 305 724 gene locus_tag LOCUS_23210 305 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23210 4178 786 gene locus_tag LOCUS_23220 4178 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence084 449 2008 gene locus_tag LOCUS_23230 449 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3094 2363 gene locus_tag LOCUS_23240 3094 2363 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 protein_id gnl|my_center|LOCUS_23240 3389 4090 gene locus_tag LOCUS_23250 3389 4090 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence085 149 1786 gene locus_tag LOCUS_23260 149 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1823 2794 gene locus_tag LOCUS_23270 1823 2794 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_23270 2861 4351 gene locus_tag LOCUS_23280 2861 4351 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence086 1761 592 gene locus_tag LOCUS_23290 1761 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2814 1831 gene locus_tag LOCUS_23300 2814 1831 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_23300 3657 2842 gene locus_tag LOCUS_23310 3657 2842 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_23310 <4368 3742 gene locus_tag LOCUS_23320 <4368 3742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028504.1:ABC transporter ATP-binding protein >Feature sequence087 <1 819 gene locus_tag LOCUS_23330 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860945.1:extracellular solute-binding protein 835 2145 gene locus_tag LOCUS_23340 835 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2162 3466 gene locus_tag LOCUS_23350 2162 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3626 4186 gene locus_tag LOCUS_23360 3626 4186 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016900.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence088 212 634 gene locus_tag LOCUS_23370 212 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 648 1055 gene locus_tag LOCUS_23380 648 1055 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203320.1 protein_id gnl|my_center|LOCUS_23380 1077 3014 gene locus_tag LOCUS_23390 1077 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3031 3204 gene locus_tag LOCUS_23400 3031 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3219 4007 gene locus_tag LOCUS_23410 3219 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence089 38 259 gene locus_tag LOCUS_23420 38 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2170 545 gene locus_tag LOCUS_23430 gene groL 2170 545 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_23430 2473 2189 gene locus_tag LOCUS_23440 gene groES 2473 2189 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_23440 2679 3137 gene locus_tag LOCUS_23450 2679 3137 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_23450 3216 3851 gene locus_tag LOCUS_23460 3216 3851 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence090 512 300 gene locus_tag LOCUS_23470 512 300 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_23470 903 1820 gene locus_tag LOCUS_23480 903 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2150 2074 gene locus_tag LOCUS_t00420 2150 2074 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2308 3657 gene locus_tag LOCUS_23490 2308 3657 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence091 1398 3644 gene locus_tag LOCUS_23500 1398 3644 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence092 389 910 gene locus_tag LOCUS_23510 389 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 914 2611 gene locus_tag LOCUS_23520 914 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence093 <1 896 gene locus_tag LOCUS_23530 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861937.1:ribosome small subunit-dependent GTPase A 1013 2632 gene locus_tag LOCUS_23540 1013 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence094 1155 403 gene locus_tag LOCUS_23550 gene spo0A 1155 403 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_23550 2703 1351 gene locus_tag LOCUS_23560 2703 1351 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_23560 <3220 2704 gene locus_tag LOCUS_23570 <3220 2704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891177.1:TldD/PmbA family protein >Feature sequence095 969 127 gene locus_tag LOCUS_23580 969 127 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_23580 1359 976 gene locus_tag LOCUS_23590 1359 976 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 protein_id gnl|my_center|LOCUS_23590 2867 1500 gene locus_tag LOCUS_23600 2867 1500 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966858.1 protein_id gnl|my_center|LOCUS_23600 2908 3027 gene locus_tag LOCUS_23610 2908 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence096 >Feature sequence097 <1 857 gene locus_tag LOCUS_23620 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388811.1:NAD(P)H-quinone oxidoreductase 2887 920 gene locus_tag LOCUS_23630 2887 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence098 609 1097 gene locus_tag LOCUS_23640 609 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23640 >Feature sequence099 838 257 gene locus_tag LOCUS_23650 838 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1644 853 gene locus_tag LOCUS_23660 1644 853 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243756.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence100 <1 1830 gene locus_tag LOCUS_23670 <1 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291304.1:ATP-binding cassette domain-containing protein >Feature sequence101 632 940 gene locus_tag LOCUS_23680 632 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 941 2044 gene locus_tag LOCUS_23690 941 2044 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793744.1 protein_id gnl|my_center|LOCUS_23690 <2792 2146 gene locus_tag LOCUS_23700 <2792 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966534.1:asparagine--tRNA ligase >Feature sequence102 811 317 gene locus_tag LOCUS_23710 811 317 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_23710 2486 1005 gene locus_tag LOCUS_23720 2486 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence103 1271 1044 gene locus_tag LOCUS_23730 gene yidD 1271 1044 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_23730 1637 1272 gene locus_tag LOCUS_23740 gene rnpA 1637 1272 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_23740 1921 1649 gene locus_tag LOCUS_23750 1921 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence104 1039 1602 gene locus_tag LOCUS_23760 1039 1602 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence105 891 34 gene locus_tag LOCUS_23770 891 34 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_23770 2108 906 gene locus_tag LOCUS_23780 2108 906 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence106 431 1438 gene locus_tag LOCUS_23790 431 1438 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203127.1 protein_id gnl|my_center|LOCUS_23790 <2519 1541 gene locus_tag LOCUS_23800 <2519 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680887.1:ABC transporter ATP-binding protein >Feature sequence107 943 2178 gene locus_tag LOCUS_23810 943 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence108 <2222 412 gene locus_tag LOCUS_23820 <2222 412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870178.1:glycyl radical protein >Feature sequence109 320 12 gene locus_tag LOCUS_23830 320 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 954 397 gene locus_tag LOCUS_23840 954 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1339 1085 gene locus_tag LOCUS_23850 1339 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 <2219 1481 gene locus_tag LOCUS_23860 <2219 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393767.1:argininosuccinate lyase >Feature sequence110 712 1614 gene locus_tag LOCUS_23870 712 1614 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence111 359 1708 gene locus_tag LOCUS_23880 359 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence112 <1 1313 gene locus_tag LOCUS_23890 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888725.1:4Fe-4S dicluster domain-containing protein >Feature sequence113 728 928 gene locus_tag LOCUS_23900 728 928 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_23900 994 1845 gene locus_tag LOCUS_23910 994 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence114 >Feature sequence115 >Feature sequence116 489 193 gene locus_tag LOCUS_23920 489 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 <1699 486 gene locus_tag LOCUS_23930 <1699 486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398654.1:alpha-L-arabinofuranosidase AbfB >Feature sequence117 <1654 917 gene locus_tag LOCUS_23940 <1654 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948973.1:M14 family metallopeptidase >Feature sequence118 498 1052 gene locus_tag LOCUS_23950 gene spoVT 498 1052 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence119 756 1037 gene locus_tag LOCUS_23960 756 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 <1612 1087 gene locus_tag LOCUS_23970 <1612 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788600.1:serine-type multi-promoter DNA invertase Mpi >Feature sequence120 <1 804 gene locus_tag LOCUS_23980 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027778.1:phosphodiester glycosidase family protein <1611 858 gene locus_tag LOCUS_23990 <1611 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012896469.1:glycerol kinase GlpK >Feature sequence121 169 1572 gene locus_tag LOCUS_24000 gene uxaC 169 1572 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence122 >Feature sequence123