>Feature sequence001 131 307 gene locus_tag LOCUS_00010 131 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 437 1336 gene locus_tag LOCUS_00020 437 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1470 2021 gene locus_tag LOCUS_00030 1470 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2046 2615 gene locus_tag LOCUS_00040 2046 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2560 2778 gene locus_tag LOCUS_00050 2560 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2782 3639 gene locus_tag LOCUS_00060 2782 3639 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_00060 3640 3864 gene locus_tag LOCUS_00070 3640 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3861 4202 gene locus_tag LOCUS_00080 3861 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4159 4638 gene locus_tag LOCUS_00090 gene nrdG 4159 4638 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_00090 6065 4875 gene locus_tag LOCUS_00100 6065 4875 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_00100 6334 6071 gene locus_tag LOCUS_00110 6334 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6957 6331 gene locus_tag LOCUS_00120 6957 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7183 6938 gene locus_tag LOCUS_00130 7183 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7637 7290 gene locus_tag LOCUS_00140 7637 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7769 7981 gene locus_tag LOCUS_00150 7769 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8021 8734 gene locus_tag LOCUS_00160 8021 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 8721 9074 gene locus_tag LOCUS_00170 8721 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 9333 9599 gene locus_tag LOCUS_00180 9333 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 9571 9798 gene locus_tag LOCUS_00190 9571 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 10044 10238 gene locus_tag LOCUS_00200 10044 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 10235 10390 gene locus_tag LOCUS_00210 10235 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 10440 10877 gene locus_tag LOCUS_00220 10440 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 10882 11154 gene locus_tag LOCUS_00230 10882 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 11167 11370 gene locus_tag LOCUS_00240 11167 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 11765 12448 gene locus_tag LOCUS_00250 11765 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 12655 13143 gene locus_tag LOCUS_00260 12655 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 13100 13321 gene locus_tag LOCUS_00270 13100 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 13336 14466 gene locus_tag LOCUS_00280 13336 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 14480 14731 gene locus_tag LOCUS_00290 14480 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 14724 14975 gene locus_tag LOCUS_00300 14724 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 15058 15444 gene locus_tag LOCUS_00310 15058 15444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 15586 16773 gene locus_tag LOCUS_00320 15586 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 16787 17173 gene locus_tag LOCUS_00330 16787 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 17184 17396 gene locus_tag LOCUS_00340 17184 17396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 17398 17700 gene locus_tag LOCUS_00350 17398 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 17710 18819 gene locus_tag LOCUS_00360 gene dnaN 17710 18819 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212886.1 protein_id gnl|my_center|LOCUS_00360 18816 19112 gene locus_tag LOCUS_00370 18816 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 19109 19555 gene locus_tag LOCUS_00380 19109 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 19908 20594 gene locus_tag LOCUS_00390 19908 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 >Feature sequence002 144 362 gene locus_tag LOCUS_00400 144 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 375 1844 gene locus_tag LOCUS_00410 375 1844 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964714.1 protein_id gnl|my_center|LOCUS_00410 5398 2201 gene locus_tag LOCUS_00420 5398 2201 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_00420 6601 5411 gene locus_tag LOCUS_00430 gene adeI 6601 5411 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AdeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 protein_id gnl|my_center|LOCUS_00430 6751 7578 gene locus_tag LOCUS_00440 6751 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 7589 8338 gene locus_tag LOCUS_00450 gene murQ 7589 8338 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477459.1 protein_id gnl|my_center|LOCUS_00450 8458 9504 gene locus_tag LOCUS_00460 8458 9504 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948951.1 protein_id gnl|my_center|LOCUS_00460 9596 10348 gene locus_tag LOCUS_00470 9596 10348 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_00470 10435 11193 gene locus_tag LOCUS_00480 10435 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 11258 11824 gene locus_tag LOCUS_00490 11258 11824 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 protein_id gnl|my_center|LOCUS_00490 11821 12444 gene locus_tag LOCUS_00500 gene thyX 11821 12444 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_00500 12515 12958 gene locus_tag LOCUS_00510 gene rpiB 12515 12958 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_00510 13044 13613 gene locus_tag LOCUS_00520 gene yfcE 13044 13613 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392436.1 protein_id gnl|my_center|LOCUS_00520 13626 14138 gene locus_tag LOCUS_00530 13626 14138 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 protein_id gnl|my_center|LOCUS_00530 >Feature sequence003 <1 501 gene locus_tag LOCUS_00540 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244546.1:2-keto-myo-inositol isomerase 526 1536 gene locus_tag LOCUS_00550 gene iolG 526 1536 CDS product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 protein_id gnl|my_center|LOCUS_00550 2378 1608 gene locus_tag LOCUS_00560 2378 1608 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067850802.1 protein_id gnl|my_center|LOCUS_00560 6728 2529 gene locus_tag LOCUS_00570 6728 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 7356 6748 gene locus_tag LOCUS_00580 7356 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 7970 7377 gene locus_tag LOCUS_00590 7970 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 8875 7967 gene locus_tag LOCUS_00600 8875 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 9076 10242 gene locus_tag LOCUS_00610 9076 10242 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_00610 10257 11375 gene locus_tag LOCUS_00620 10257 11375 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_00620 11376 12218 gene locus_tag LOCUS_00630 11376 12218 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131820.1 protein_id gnl|my_center|LOCUS_00630 12224 13282 gene locus_tag LOCUS_00640 12224 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence004 772 1785 gene locus_tag LOCUS_00650 772 1785 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 protein_id gnl|my_center|LOCUS_00650 3060 1822 gene locus_tag LOCUS_00660 3060 1822 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_00660 4605 3076 gene locus_tag LOCUS_00670 4605 3076 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972453.1 protein_id gnl|my_center|LOCUS_00670 7482 4723 gene locus_tag LOCUS_00680 7482 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence005 332 1072 gene locus_tag LOCUS_00690 gene rlmB 332 1072 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_00690 1065 1586 gene locus_tag LOCUS_00700 1065 1586 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966430.1 protein_id gnl|my_center|LOCUS_00700 1617 3155 gene locus_tag LOCUS_00710 1617 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 5050 3182 gene locus_tag LOCUS_00720 5050 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 5697 5014 gene locus_tag LOCUS_00730 5697 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 6172 5723 gene locus_tag LOCUS_00740 6172 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 7337 6177 gene locus_tag LOCUS_00750 7337 6177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_00750 7481 8149 gene locus_tag LOCUS_00760 7481 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9272 8163 gene locus_tag LOCUS_00770 9272 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10306 9269 gene locus_tag LOCUS_00780 10306 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12155 10311 gene locus_tag LOCUS_00790 12155 10311 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 protein_id gnl|my_center|LOCUS_00790 >Feature sequence006 <1 1357 gene locus_tag LOCUS_00800 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 1359 2603 gene locus_tag LOCUS_00810 gene rpoN 1359 2603 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_00810 4140 2629 gene locus_tag LOCUS_00820 4140 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 5128 4124 gene locus_tag LOCUS_00830 gene cydB 5128 4124 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393586.1 protein_id gnl|my_center|LOCUS_00830 5429 5157 gene locus_tag LOCUS_00840 5429 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 5768 5454 gene locus_tag LOCUS_00850 5768 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 7141 5774 gene locus_tag LOCUS_00860 7141 5774 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461542.1 protein_id gnl|my_center|LOCUS_00860 8240 7281 gene locus_tag LOCUS_00870 8240 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 11757 8218 gene locus_tag LOCUS_00880 11757 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 11871 12323 gene locus_tag LOCUS_00890 11871 12323 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263820.1 protein_id gnl|my_center|LOCUS_00890 >Feature sequence007 1050 118 gene locus_tag LOCUS_00900 1050 118 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_00900 1923 1066 gene locus_tag LOCUS_00910 1923 1066 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144136388.1 protein_id gnl|my_center|LOCUS_00910 2316 1966 gene locus_tag LOCUS_00920 2316 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 3031 2327 gene locus_tag LOCUS_00930 3031 2327 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393547.1 protein_id gnl|my_center|LOCUS_00930 3852 3109 gene locus_tag LOCUS_00940 3852 3109 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_00940 5158 3866 gene locus_tag LOCUS_00950 gene purB 5158 3866 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_00950 6307 5171 gene locus_tag LOCUS_00960 6307 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 7026 6373 gene locus_tag LOCUS_00970 7026 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 7139 7771 gene locus_tag LOCUS_00980 7139 7771 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_00980 8390 7833 gene locus_tag LOCUS_00990 8390 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 8881 8396 gene locus_tag LOCUS_01000 8881 8396 CDS product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047624.1 protein_id gnl|my_center|LOCUS_01000 10241 9114 gene locus_tag LOCUS_01010 10241 9114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_01010 10438 10638 gene locus_tag LOCUS_01020 10438 10638 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392301.1 protein_id gnl|my_center|LOCUS_01020 10657 11199 gene locus_tag LOCUS_01030 10657 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 11215 11637 gene locus_tag LOCUS_01040 11215 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 >Feature sequence008 7817 4407 gene locus_tag LOCUS_01050 7817 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 9220 7814 gene locus_tag LOCUS_01060 9220 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 9440 9910 gene locus_tag LOCUS_01070 9440 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 9929 10984 gene locus_tag LOCUS_01080 9929 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 >Feature sequence009 <1 845 gene locus_tag LOCUS_01090 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890565.1:carbon starvation CstA family protein 2545 962 gene locus_tag LOCUS_01100 gene pnbA 2545 962 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_01100 2980 2906 gene locus_tag LOCUS_t00010 2980 2906 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4232 2991 gene locus_tag LOCUS_01110 gene maeB 4232 2991 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_01110 5993 4815 gene locus_tag LOCUS_01120 5993 4815 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_01120 7990 6089 gene locus_tag LOCUS_01130 7990 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 10037 8205 gene locus_tag LOCUS_01140 10037 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 10197 10595 gene locus_tag LOCUS_01150 10197 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 <11639 10671 gene locus_tag LOCUS_01160 <11639 10671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460177.1:putative heme d1 biosynthesis radical SAM protein NirJ2 >Feature sequence010 355 1179 gene locus_tag LOCUS_01170 355 1179 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_01170 1311 1236 gene locus_tag LOCUS_t00020 1311 1236 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1592 1362 gene locus_tag LOCUS_01180 gene rpsR 1592 1362 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_01180 2087 1605 gene locus_tag LOCUS_01190 2087 1605 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_01190 2382 2080 gene locus_tag LOCUS_01200 gene rpsF 2382 2080 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_01200 3157 2555 gene locus_tag LOCUS_01210 3157 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3581 3240 gene locus_tag LOCUS_01220 3581 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 3920 3591 gene locus_tag LOCUS_01230 3920 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4026 5204 gene locus_tag LOCUS_01240 4026 5204 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_01240 5217 6557 gene locus_tag LOCUS_01250 5217 6557 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01250 6576 6953 gene locus_tag LOCUS_01260 6576 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01260 7447 6950 gene locus_tag LOCUS_01270 7447 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 7612 8571 gene locus_tag LOCUS_01280 7612 8571 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_01280 9831 8791 gene locus_tag LOCUS_01290 gene rseP 9831 8791 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_01290 10985 9828 gene locus_tag LOCUS_01300 gene dxr 10985 9828 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986796.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence011 98 1528 gene locus_tag LOCUS_01310 98 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 1879 2262 gene locus_tag LOCUS_01320 1879 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 2315 2764 gene locus_tag LOCUS_01330 gene fliW 2315 2764 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_01330 2769 2996 gene locus_tag LOCUS_01340 gene csrA 2769 2996 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460793.1 protein_id gnl|my_center|LOCUS_01340 3083 3499 gene locus_tag LOCUS_01350 3083 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 3529 5730 gene locus_tag LOCUS_01360 3529 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 5769 6173 gene locus_tag LOCUS_01370 gene fliS 5769 6173 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_01370 6166 6516 gene locus_tag LOCUS_01380 6166 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 7632 6754 gene locus_tag LOCUS_01390 gene cysE 7632 6754 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_01390 8367 7897 gene locus_tag LOCUS_01400 gene ispF 8367 7897 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_01400 8986 8378 gene locus_tag LOCUS_01410 8986 8378 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 protein_id gnl|my_center|LOCUS_01410 9665 8970 gene locus_tag LOCUS_01420 gene ispD 9665 8970 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288292.1 protein_id gnl|my_center|LOCUS_01420 10469 9666 gene locus_tag LOCUS_01430 10469 9666 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence012 2062 380 gene locus_tag LOCUS_01440 gene argS 2062 380 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_01440 5627 2199 gene locus_tag LOCUS_01450 5627 2199 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_01450 6568 5717 gene locus_tag LOCUS_01460 6568 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 6990 6565 gene locus_tag LOCUS_01470 6990 6565 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_01470 7445 7005 gene locus_tag LOCUS_01480 7445 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8750 7449 gene locus_tag LOCUS_01490 8750 7449 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_01490 9937 9359 gene locus_tag LOCUS_01500 9937 9359 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence013 1103 138 gene locus_tag LOCUS_01510 gene rfaD 1103 138 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_01510 1300 1151 gene locus_tag LOCUS_01520 1300 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 2732 1335 gene locus_tag LOCUS_01530 2732 1335 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948950.1 protein_id gnl|my_center|LOCUS_01530 3152 2733 gene locus_tag LOCUS_01540 3152 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3326 3156 gene locus_tag LOCUS_01550 3326 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4255 3323 gene locus_tag LOCUS_01560 4255 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 7007 4335 gene locus_tag LOCUS_01570 7007 4335 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_01570 8075 7092 gene locus_tag LOCUS_01580 8075 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 8999 8079 gene locus_tag LOCUS_01590 8999 8079 CDS product 5'-methylthioadenosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819438.1 protein_id gnl|my_center|LOCUS_01590 9601 8999 gene locus_tag LOCUS_01600 9601 8999 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence014 237 716 gene locus_tag LOCUS_01610 237 716 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940969.1 protein_id gnl|my_center|LOCUS_01610 744 1358 gene locus_tag LOCUS_01620 744 1358 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774235.1 protein_id gnl|my_center|LOCUS_01620 1361 1846 gene locus_tag LOCUS_01630 1361 1846 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_01630 1919 2305 gene locus_tag LOCUS_01640 1919 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2398 3150 gene locus_tag LOCUS_01650 gene whiG 2398 3150 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_01650 3249 4910 gene locus_tag LOCUS_01660 3249 4910 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667114.1 protein_id gnl|my_center|LOCUS_01660 4970 5296 gene locus_tag LOCUS_01670 4970 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 5293 6480 gene locus_tag LOCUS_01680 5293 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6534 7538 gene locus_tag LOCUS_01690 6534 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 7545 8543 gene locus_tag LOCUS_01700 7545 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence015 2938 2354 gene locus_tag LOCUS_01710 2938 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4097 2949 gene locus_tag LOCUS_01720 4097 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7620 4411 gene locus_tag LOCUS_01730 7620 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8141 7782 gene locus_tag LOCUS_01740 8141 7782 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_01740 9000 8407 gene locus_tag LOCUS_01750 9000 8407 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence016 1490 1110 gene locus_tag LOCUS_01760 1490 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1937 1662 gene locus_tag LOCUS_01770 1937 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2276 2058 gene locus_tag LOCUS_01780 2276 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3292 2327 gene locus_tag LOCUS_01790 3292 2327 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_01790 4376 3282 gene locus_tag LOCUS_01800 4376 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 5184 4378 gene locus_tag LOCUS_01810 5184 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 6516 5197 gene locus_tag LOCUS_01820 6516 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 7674 6625 gene locus_tag LOCUS_01830 7674 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 8151 7693 gene locus_tag LOCUS_01840 8151 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 8390 8474 gene locus_tag LOCUS_t00030 8390 8474 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence017 980 111 gene locus_tag LOCUS_01850 980 111 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940939.1 protein_id gnl|my_center|LOCUS_01850 1382 2098 gene locus_tag LOCUS_01860 1382 2098 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_01860 2334 3107 gene locus_tag LOCUS_01870 gene motA 2334 3107 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458996.1 protein_id gnl|my_center|LOCUS_01870 3120 3914 gene locus_tag LOCUS_01880 3120 3914 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809827.1 protein_id gnl|my_center|LOCUS_01880 3911 4285 gene locus_tag LOCUS_01890 gene acpS 3911 4285 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 protein_id gnl|my_center|LOCUS_01890 4578 7970 gene locus_tag LOCUS_01900 4578 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 8705 8034 gene locus_tag LOCUS_01910 gene rpe 8705 8034 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence018 34 3450 gene locus_tag LOCUS_01920 34 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 6735 3544 gene locus_tag LOCUS_01930 gene addB 6735 3544 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058551.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence019 <1 951 gene locus_tag LOCUS_01940 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258367.1:methylmalonyl-CoA mutase 1602 1270 gene locus_tag LOCUS_01950 1602 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 2106 1609 gene locus_tag LOCUS_01960 2106 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4033 2843 gene locus_tag LOCUS_01970 4033 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 4130 5236 gene locus_tag LOCUS_01980 4130 5236 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202735.1 protein_id gnl|my_center|LOCUS_01980 6560 5295 gene locus_tag LOCUS_01990 6560 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 7062 6562 gene locus_tag LOCUS_02000 gene ilvN 7062 6562 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_02000 7217 8089 gene locus_tag LOCUS_02010 7217 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 <8762 8142 gene locus_tag LOCUS_02020 <8762 8142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000426887.1:FkbM family methyltransferase >Feature sequence020 1473 253 gene locus_tag LOCUS_02030 1473 253 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_02030 2650 1466 gene locus_tag LOCUS_02040 2650 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3628 2744 gene locus_tag LOCUS_02050 3628 2744 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144136388.1 protein_id gnl|my_center|LOCUS_02050 4934 3699 gene locus_tag LOCUS_02060 4934 3699 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_02060 5391 5080 gene locus_tag LOCUS_02070 5391 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5863 5483 gene locus_tag LOCUS_02080 5863 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7584 5899 gene locus_tag LOCUS_02090 7584 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 <8637 7595 gene locus_tag LOCUS_02100 <8637 7595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_075901854.1:glycosyltransferase family 4 protein >Feature sequence021 204 938 gene locus_tag LOCUS_02110 204 938 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_02110 1175 1717 gene locus_tag LOCUS_02120 1175 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 1719 2861 gene locus_tag LOCUS_02130 1719 2861 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_02130 3186 4094 gene locus_tag LOCUS_02140 gene ftsY 3186 4094 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_02140 4745 4170 gene locus_tag LOCUS_02150 4745 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5034 7229 gene locus_tag LOCUS_02160 gene ptsG 5034 7229 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473200.1 protein_id gnl|my_center|LOCUS_02160 7503 7865 gene locus_tag LOCUS_02170 7503 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence022 1943 1530 gene locus_tag LOCUS_02180 gene mce 1943 1530 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_02180 2641 2039 gene locus_tag LOCUS_02190 2641 2039 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966586.1 protein_id gnl|my_center|LOCUS_02190 2963 2679 gene locus_tag LOCUS_02200 2963 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4511 3006 gene locus_tag LOCUS_02210 4511 3006 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_02210 4723 5460 gene locus_tag LOCUS_02220 gene rph 4723 5460 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_02220 5528 6109 gene locus_tag LOCUS_02230 5528 6109 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_02230 6106 6594 gene locus_tag LOCUS_02240 6106 6594 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_02240 6781 7938 gene locus_tag LOCUS_02250 6781 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 >Feature sequence023 532 182 gene locus_tag LOCUS_02260 gene rplS 532 182 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_02260 1849 1400 gene locus_tag LOCUS_02270 1849 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1942 2328 gene locus_tag LOCUS_02280 1942 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2554 2895 gene locus_tag LOCUS_02290 2554 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2900 3685 gene locus_tag LOCUS_02300 2900 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3844 4386 gene locus_tag LOCUS_02310 gene rnmV 3844 4386 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_02310 4392 4655 gene locus_tag LOCUS_02320 4392 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4675 5487 gene locus_tag LOCUS_02330 gene rsmA 4675 5487 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_02330 5758 6036 gene locus_tag LOCUS_02340 5758 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 6050 8425 gene locus_tag LOCUS_02350 6050 8425 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence024 453 1553 gene locus_tag LOCUS_02360 453 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_02360 1541 3166 gene locus_tag LOCUS_02370 1541 3166 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_02370 3180 3887 gene locus_tag LOCUS_02380 3180 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3975 4541 gene locus_tag LOCUS_02390 3975 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02390 4615 5463 gene locus_tag LOCUS_02400 4615 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02400 6287 5469 gene locus_tag LOCUS_02410 6287 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6477 7715 gene locus_tag LOCUS_02420 gene larC 6477 7715 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_02420 8180 7719 gene locus_tag LOCUS_02430 gene ybeY 8180 7719 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_02430 8440 8177 gene locus_tag LOCUS_02440 8440 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 >Feature sequence025 2150 414 gene locus_tag LOCUS_02450 gene ade 2150 414 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476052.1 protein_id gnl|my_center|LOCUS_02450 3789 2428 gene locus_tag LOCUS_02460 3789 2428 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_02460 4237 3848 gene locus_tag LOCUS_02470 4237 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5083 4277 gene locus_tag LOCUS_02480 5083 4277 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_02480 6228 5452 gene locus_tag LOCUS_02490 6228 5452 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986889.1 protein_id gnl|my_center|LOCUS_02490 6926 6225 gene locus_tag LOCUS_02500 gene rpe 6926 6225 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_02500 7072 8211 gene locus_tag LOCUS_02510 7072 8211 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861810.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence026 1540 806 gene locus_tag LOCUS_02520 1540 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1809 1654 gene locus_tag LOCUS_02530 1809 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3851 1824 gene locus_tag LOCUS_02540 3851 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 4142 3897 gene locus_tag LOCUS_02550 4142 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 4674 4156 gene locus_tag LOCUS_02560 4674 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 4961 4677 gene locus_tag LOCUS_02570 4961 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 5169 4951 gene locus_tag LOCUS_02580 5169 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 7593 5257 gene locus_tag LOCUS_02590 7593 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence027 372 836 gene locus_tag LOCUS_02600 372 836 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_02600 896 3283 gene locus_tag LOCUS_02610 896 3283 CDS product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214035.1 protein_id gnl|my_center|LOCUS_02610 3299 3430 gene locus_tag LOCUS_02620 3299 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 3438 4547 gene locus_tag LOCUS_02630 3438 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4559 5821 gene locus_tag LOCUS_02640 4559 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 7233 5797 gene locus_tag LOCUS_02650 7233 5797 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence028 192 1052 gene locus_tag LOCUS_02660 192 1052 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272738.1 protein_id gnl|my_center|LOCUS_02660 1103 1504 gene locus_tag LOCUS_02670 1103 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 1437 1634 gene locus_tag LOCUS_02680 1437 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 1640 2089 gene locus_tag LOCUS_02690 1640 2089 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461906.1 protein_id gnl|my_center|LOCUS_02690 2086 2811 gene locus_tag LOCUS_02700 2086 2811 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310179.1 protein_id gnl|my_center|LOCUS_02700 2822 3811 gene locus_tag LOCUS_02710 2822 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3948 4151 gene locus_tag LOCUS_02720 3948 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4302 4078 gene locus_tag LOCUS_02730 4302 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4423 5655 gene locus_tag LOCUS_02740 4423 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5657 5851 gene locus_tag LOCUS_02750 5657 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5908 6177 gene locus_tag LOCUS_02760 5908 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 6181 6564 gene locus_tag LOCUS_02770 6181 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6557 7243 gene locus_tag LOCUS_02780 6557 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 7252 7458 gene locus_tag LOCUS_02790 7252 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 7458 7838 gene locus_tag LOCUS_02800 7458 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 >Feature sequence029 2516 1626 gene locus_tag LOCUS_02810 gene era 2516 1626 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 protein_id gnl|my_center|LOCUS_02810 2398 2619 gene locus_tag LOCUS_02820 2398 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 6271 2612 gene locus_tag LOCUS_02830 6271 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6439 7647 gene locus_tag LOCUS_02840 6439 7647 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_02840 7655 7816 gene locus_tag LOCUS_02850 7655 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 >Feature sequence030 461 288 gene locus_tag LOCUS_02860 461 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 620 1453 gene locus_tag LOCUS_02870 620 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1446 2348 gene locus_tag LOCUS_02880 gene argB 1446 2348 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_02880 2341 3210 gene locus_tag LOCUS_02890 2341 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 3260 3598 gene locus_tag LOCUS_02900 3260 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02900 3615 4514 gene locus_tag LOCUS_02910 3615 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4520 5716 gene locus_tag LOCUS_02920 4520 5716 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_02920 5720 6946 gene locus_tag LOCUS_02930 5720 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6951 7880 gene locus_tag LOCUS_02940 gene argF 6951 7880 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence031 1137 430 gene locus_tag LOCUS_02950 gene pyrH 1137 430 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_02950 1330 2196 gene locus_tag LOCUS_02960 1330 2196 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_02960 2215 2652 gene locus_tag LOCUS_02970 gene mscL 2215 2652 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_02970 3549 2791 gene locus_tag LOCUS_02980 gene codY 3549 2791 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774472.1 protein_id gnl|my_center|LOCUS_02980 4647 3730 gene locus_tag LOCUS_02990 4647 3730 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_02990 4702 4926 gene locus_tag LOCUS_03000 4702 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5247 5918 gene locus_tag LOCUS_03010 5247 5918 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_03010 5915 6325 gene locus_tag LOCUS_03020 5915 6325 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755082.1 protein_id gnl|my_center|LOCUS_03020 6322 7041 gene locus_tag LOCUS_03030 6322 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence032 95 1225 gene locus_tag LOCUS_03040 95 1225 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_03040 1230 2234 gene locus_tag LOCUS_03050 1230 2234 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202790.1 protein_id gnl|my_center|LOCUS_03050 2296 2655 gene locus_tag LOCUS_03060 2296 2655 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_03060 2771 4027 gene locus_tag LOCUS_03070 2771 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5191 4196 gene locus_tag LOCUS_03080 5191 4196 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_03080 5299 5952 gene locus_tag LOCUS_03090 5299 5952 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917062.1 protein_id gnl|my_center|LOCUS_03090 7769 6171 gene locus_tag LOCUS_03100 gene recN 7769 6171 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence033 1608 544 gene locus_tag LOCUS_03110 gene pepQ 1608 544 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_03110 2081 1605 gene locus_tag LOCUS_03120 gene aroQ 2081 1605 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_03120 2412 2065 gene locus_tag LOCUS_03130 2412 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3692 2484 gene locus_tag LOCUS_03140 3692 2484 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_03140 5134 3956 gene locus_tag LOCUS_03150 5134 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5451 5131 gene locus_tag LOCUS_03160 5451 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5873 5451 gene locus_tag LOCUS_03170 gene ruvX 5873 5451 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_03170 6151 5870 gene locus_tag LOCUS_03180 6151 5870 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719797.1 protein_id gnl|my_center|LOCUS_03180 6293 6688 gene locus_tag LOCUS_03190 6293 6688 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_03190 6654 7181 gene locus_tag LOCUS_03200 gene rimM 6654 7181 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_03200 7200 7880 gene locus_tag LOCUS_03210 gene trmD 7200 7880 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence034 2533 1049 gene locus_tag LOCUS_03220 2533 1049 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_03220 2661 4433 gene locus_tag LOCUS_03230 2661 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4485 5471 gene locus_tag LOCUS_03240 4485 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 6817 5786 gene locus_tag LOCUS_03250 gene lpxD 6817 5786 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_03250 7135 6830 gene locus_tag LOCUS_03260 7135 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 7211 7906 gene locus_tag LOCUS_03270 7211 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence035 768 1355 gene locus_tag LOCUS_03280 768 1355 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_03280 1352 1978 gene locus_tag LOCUS_03290 1352 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2052 2687 gene locus_tag LOCUS_03300 2052 2687 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198215.1 protein_id gnl|my_center|LOCUS_03300 2701 2919 gene locus_tag LOCUS_03310 2701 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2916 5654 gene locus_tag LOCUS_03320 2916 5654 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence036 801 2216 gene locus_tag LOCUS_03330 801 2216 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110951902.1 protein_id gnl|my_center|LOCUS_03330 3211 2291 gene locus_tag LOCUS_03340 3211 2291 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 protein_id gnl|my_center|LOCUS_03340 3374 4276 gene locus_tag LOCUS_03350 3374 4276 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_03350 5411 4263 gene locus_tag LOCUS_03360 gene nifS 5411 4263 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_03360 5568 5386 gene locus_tag LOCUS_03370 5568 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7032 5593 gene locus_tag LOCUS_03380 7032 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence037 1424 408 gene locus_tag LOCUS_03390 gene iolG 1424 408 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_03390 2734 1589 gene locus_tag LOCUS_03400 2734 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4389 2872 gene locus_tag LOCUS_03410 4389 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5364 4420 gene locus_tag LOCUS_03420 gene rbsB 5364 4420 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242760.1 protein_id gnl|my_center|LOCUS_03420 6992 5361 gene locus_tag LOCUS_03430 gene yesM 6992 5361 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_03430 <7847 7314 gene locus_tag LOCUS_03440 <7847 7314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001040419.1:polysaccharide deacetylase >Feature sequence038 501 773 gene locus_tag LOCUS_03450 501 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 770 2473 gene locus_tag LOCUS_03460 770 2473 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225156.1 protein_id gnl|my_center|LOCUS_03460 2620 3417 gene locus_tag LOCUS_03470 2620 3417 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850703.1 protein_id gnl|my_center|LOCUS_03470 3486 4370 gene locus_tag LOCUS_03480 3486 4370 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040419.1 protein_id gnl|my_center|LOCUS_03480 4392 4739 gene locus_tag LOCUS_03490 4392 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337920.1 protein_id gnl|my_center|LOCUS_03490 4732 5736 gene locus_tag LOCUS_03500 4732 5736 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268747.1 protein_id gnl|my_center|LOCUS_03500 7048 5804 gene locus_tag LOCUS_03510 gene rpoN 7048 5804 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421965.1 protein_id gnl|my_center|LOCUS_03510 <7704 7050 gene locus_tag LOCUS_03520 <7704 7050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence039 <1 881 gene locus_tag LOCUS_03530 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379222.1:aldehyde dehydrogenase family protein 868 1593 gene locus_tag LOCUS_03540 868 1593 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_03540 1590 2684 gene locus_tag LOCUS_03550 1590 2684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_03550 4745 2727 gene locus_tag LOCUS_03560 4745 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5235 4729 gene locus_tag LOCUS_03570 5235 4729 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_03570 5382 5756 gene locus_tag LOCUS_03580 5382 5756 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256827.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence040 336 1022 gene locus_tag LOCUS_03590 336 1022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459873.1 protein_id gnl|my_center|LOCUS_03590 1121 2197 gene locus_tag LOCUS_03600 1121 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 3280 2282 gene locus_tag LOCUS_03610 3280 2282 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_03610 3863 3285 gene locus_tag LOCUS_03620 3863 3285 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146731.1 protein_id gnl|my_center|LOCUS_03620 4217 4044 gene locus_tag LOCUS_03630 4217 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5172 4324 gene locus_tag LOCUS_03640 5172 4324 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_03640 5451 5912 gene locus_tag LOCUS_03650 5451 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5909 6871 gene locus_tag LOCUS_03660 5909 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence041 <1 891 gene locus_tag LOCUS_03670 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006315826.1:TIM barrel protein 904 2061 gene locus_tag LOCUS_03680 904 2061 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764418.1 protein_id gnl|my_center|LOCUS_03680 2135 3145 gene locus_tag LOCUS_03690 2135 3145 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536378.1 protein_id gnl|my_center|LOCUS_03690 3179 4576 gene locus_tag LOCUS_03700 3179 4576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_03700 4634 5230 gene locus_tag LOCUS_03710 4634 5230 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_03710 5244 6269 gene locus_tag LOCUS_03720 gene iolG 5244 6269 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence042 <1 652 gene locus_tag LOCUS_03730 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393903.1:tRNA pseudouridine(38-40) synthase TruA 751 1920 gene locus_tag LOCUS_03740 751 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2047 3258 gene locus_tag LOCUS_03750 2047 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4178 3432 gene locus_tag LOCUS_03760 4178 3432 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_03760 5350 4175 gene locus_tag LOCUS_03770 gene nirJ1 5350 4175 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_03770 6943 5363 gene locus_tag LOCUS_03780 gene serA 6943 5363 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_03780 7222 6950 gene locus_tag LOCUS_03790 7222 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03790 >Feature sequence043 1370 1047 gene locus_tag LOCUS_03800 1370 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2027 1383 gene locus_tag LOCUS_03810 2027 1383 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392611.1 protein_id gnl|my_center|LOCUS_03810 2666 2103 gene locus_tag LOCUS_03820 2666 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4873 3194 gene locus_tag LOCUS_03830 4873 3194 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963214.1 protein_id gnl|my_center|LOCUS_03830 6599 4878 gene locus_tag LOCUS_03840 6599 4878 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361500.1 protein_id gnl|my_center|LOCUS_03840 7490 6612 gene locus_tag LOCUS_03850 7490 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence044 740 75 gene locus_tag LOCUS_03860 740 75 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 protein_id gnl|my_center|LOCUS_03860 3618 730 gene locus_tag LOCUS_03870 3618 730 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_03870 5414 3615 gene locus_tag LOCUS_03880 5414 3615 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_03880 6043 5411 gene locus_tag LOCUS_03890 6043 5411 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_03890 7316 6048 gene locus_tag LOCUS_03900 7316 6048 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence045 285 419 gene locus_tag LOCUS_03910 285 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 422 1006 gene locus_tag LOCUS_03920 422 1006 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091831579.1 protein_id gnl|my_center|LOCUS_03920 1275 1448 gene locus_tag LOCUS_03930 1275 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1445 1753 gene locus_tag LOCUS_03940 1445 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2067 3407 gene locus_tag LOCUS_03950 gene dnaB 2067 3407 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_03950 3400 3690 gene locus_tag LOCUS_03960 3400 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3687 3875 gene locus_tag LOCUS_03970 3687 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3862 4227 gene locus_tag LOCUS_03980 3862 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4221 5033 gene locus_tag LOCUS_03990 4221 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 5045 5221 gene locus_tag LOCUS_04000 5045 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5199 5483 gene locus_tag LOCUS_04010 5199 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 5489 5752 gene locus_tag LOCUS_04020 5489 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 5749 6024 gene locus_tag LOCUS_04030 5749 6024 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_04030 6021 6227 gene locus_tag LOCUS_04040 6021 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 6331 6609 gene locus_tag LOCUS_04050 6331 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 6627 7046 gene locus_tag LOCUS_04060 6627 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence046 2018 1626 gene locus_tag LOCUS_04070 2018 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3345 2119 gene locus_tag LOCUS_04080 3345 2119 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_04080 3526 4503 gene locus_tag LOCUS_04090 3526 4503 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192045.1 protein_id gnl|my_center|LOCUS_04090 4747 6072 gene locus_tag LOCUS_04100 4747 6072 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_04100 6460 6323 gene locus_tag LOCUS_04110 6460 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 <7355 6572 gene locus_tag LOCUS_04120 <7355 6572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461447.1:putative manganese-dependent inorganic diphosphatase >Feature sequence047 <1 1559 gene locus_tag LOCUS_04130 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231947.1:flagellar biosynthesis protein FlhA 1969 1715 gene locus_tag LOCUS_04140 1969 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2365 1985 gene locus_tag LOCUS_04150 2365 1985 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_04150 2845 2369 gene locus_tag LOCUS_04160 2845 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3693 3169 gene locus_tag LOCUS_04170 3693 3169 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 protein_id gnl|my_center|LOCUS_04170 4703 3873 gene locus_tag LOCUS_04180 4703 3873 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101364.1 protein_id gnl|my_center|LOCUS_04180 5717 4704 gene locus_tag LOCUS_04190 5717 4704 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949061.1 protein_id gnl|my_center|LOCUS_04190 6595 5720 gene locus_tag LOCUS_04200 6595 5720 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101367.1 protein_id gnl|my_center|LOCUS_04200 6779 7141 gene locus_tag LOCUS_04210 6779 7141 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214419.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence048 875 1219 gene locus_tag LOCUS_04220 875 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 3376 1304 gene locus_tag LOCUS_04230 3376 1304 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_04230 4333 3377 gene locus_tag LOCUS_04240 4333 3377 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869405.1 protein_id gnl|my_center|LOCUS_04240 4470 5576 gene locus_tag LOCUS_04250 4470 5576 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_04250 5622 7133 gene locus_tag LOCUS_04260 5622 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence049 254 2575 gene locus_tag LOCUS_04270 254 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2831 2646 gene locus_tag LOCUS_04280 2831 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3117 2806 gene locus_tag LOCUS_04290 3117 2806 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_04290 6341 3114 gene locus_tag LOCUS_04300 gene carB 6341 3114 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_04300 <7269 6357 gene locus_tag LOCUS_04310 <7269 6357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828679.1:carbamoyl phosphate synthase small subunit >Feature sequence050 1921 875 gene locus_tag LOCUS_04320 1921 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1857 2471 gene locus_tag LOCUS_04330 1857 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2484 3353 gene locus_tag LOCUS_04340 2484 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3472 5511 gene locus_tag LOCUS_04350 3472 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5708 6397 gene locus_tag LOCUS_04360 5708 6397 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986772.1 protein_id gnl|my_center|LOCUS_04360 6381 7115 gene locus_tag LOCUS_04370 6381 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence051 1988 198 gene locus_tag LOCUS_04380 1988 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4334 2001 gene locus_tag LOCUS_04390 4334 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5156 4494 gene locus_tag LOCUS_04400 5156 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6116 5232 gene locus_tag LOCUS_04410 gene dapA 6116 5232 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_04410 <7146 6216 gene locus_tag LOCUS_04420 <7146 6216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048254.1:insulinase family protein >Feature sequence052 <1 1659 gene locus_tag LOCUS_04430 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157567585.1:multidrug efflux RND transporter permease subunit 1672 2811 gene locus_tag LOCUS_04440 1672 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 4707 3154 gene locus_tag LOCUS_04450 4707 3154 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 protein_id gnl|my_center|LOCUS_04450 5621 4722 gene locus_tag LOCUS_04460 5621 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 <7129 5728 gene locus_tag LOCUS_04470 <7129 5728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027722.1:PTS beta-glucoside transporter subunit IIBCA >Feature sequence053 1899 13 gene locus_tag LOCUS_04480 gene rnr 1899 13 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 protein_id gnl|my_center|LOCUS_04480 2288 1896 gene locus_tag LOCUS_04490 2288 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2891 2301 gene locus_tag LOCUS_04500 2891 2301 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393557.1 protein_id gnl|my_center|LOCUS_04500 3631 2897 gene locus_tag LOCUS_04510 3631 2897 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 protein_id gnl|my_center|LOCUS_04510 3923 3696 gene locus_tag LOCUS_04520 gene secG 3923 3696 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_04520 4557 3931 gene locus_tag LOCUS_04530 4557 3931 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141850309.1 protein_id gnl|my_center|LOCUS_04530 6166 4565 gene locus_tag LOCUS_04540 6166 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6417 6184 gene locus_tag LOCUS_04550 6417 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6591 6418 gene locus_tag LOCUS_04560 6591 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence054 264 641 gene locus_tag LOCUS_04570 264 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 751 2286 gene locus_tag LOCUS_04580 gene gpmI 751 2286 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_04580 2363 3271 gene locus_tag LOCUS_04590 2363 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3306 4232 gene locus_tag LOCUS_04600 3306 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4248 4817 gene locus_tag LOCUS_04610 4248 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5294 6400 gene locus_tag LOCUS_04620 5294 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence055 238 1803 gene locus_tag LOCUS_04630 238 1803 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_04630 4128 1900 gene locus_tag LOCUS_04640 gene hypF 4128 1900 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_04640 6475 4178 gene locus_tag LOCUS_04650 6475 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence056 716 150 gene locus_tag LOCUS_04660 716 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 849 1475 gene locus_tag LOCUS_04670 849 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1476 2276 gene locus_tag LOCUS_04680 gene larE 1476 2276 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_04680 2355 3650 gene locus_tag LOCUS_04690 2355 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 3735 5315 gene locus_tag LOCUS_04700 3735 5315 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_04700 5312 6652 gene locus_tag LOCUS_04710 gene trkA 5312 6652 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence057 311 1402 gene locus_tag LOCUS_04720 311 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1428 2561 gene locus_tag LOCUS_04730 1428 2561 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_04730 2948 4321 gene locus_tag LOCUS_04740 2948 4321 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015793.1 protein_id gnl|my_center|LOCUS_04740 4684 4442 gene locus_tag LOCUS_04750 4684 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4753 5337 gene locus_tag LOCUS_04760 gene hisB 4753 5337 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_04760 5585 6304 gene locus_tag LOCUS_04770 gene rpsB 5585 6304 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence058 897 322 gene locus_tag LOCUS_04780 897 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1680 907 gene locus_tag LOCUS_04790 1680 907 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047711.1 protein_id gnl|my_center|LOCUS_04790 2525 1677 gene locus_tag LOCUS_04800 2525 1677 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_04800 4073 2625 gene locus_tag LOCUS_04810 4073 2625 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_04810 4530 4066 gene locus_tag LOCUS_04820 4530 4066 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_04820 4642 4986 gene locus_tag LOCUS_04830 4642 4986 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_04830 4988 5188 gene locus_tag LOCUS_04840 4988 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 6426 5257 gene locus_tag LOCUS_04850 6426 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence059 3 155 gene locus_tag LOCUS_04860 3 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 160 378 gene locus_tag LOCUS_04870 160 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 478 1098 gene locus_tag LOCUS_04880 478 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1843 1196 gene locus_tag LOCUS_04890 1843 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2833 2003 gene locus_tag LOCUS_04900 2833 2003 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_04900 3267 2830 gene locus_tag LOCUS_04910 gene queF 3267 2830 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762202.1 protein_id gnl|my_center|LOCUS_04910 4418 3339 gene locus_tag LOCUS_04920 gene agp 4418 3339 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 protein_id gnl|my_center|LOCUS_04920 5435 4431 gene locus_tag LOCUS_04930 gene tsaD 5435 4431 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_04930 6057 5428 gene locus_tag LOCUS_04940 gene trmB 6057 5428 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889910.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence060 1168 2 gene locus_tag LOCUS_04950 1168 2 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_04950 1404 1997 gene locus_tag LOCUS_04960 1404 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2902 1973 gene locus_tag LOCUS_04970 2902 1973 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_04970 4025 2910 gene locus_tag LOCUS_04980 gene msrB 4025 2910 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_04980 4228 4152 gene locus_tag LOCUS_t00040 4228 4152 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5845 4286 gene locus_tag LOCUS_04990 5845 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 <6550 5842 gene locus_tag LOCUS_05000 <6550 5842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390482.1:tetratricopeptide repeat protein >Feature sequence061 406 630 gene locus_tag LOCUS_05010 406 630 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05010 640 2541 gene locus_tag LOCUS_05020 gene feoB 640 2541 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_05020 2633 3043 gene locus_tag LOCUS_05030 2633 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3608 3078 gene locus_tag LOCUS_05040 gene ilvN 3608 3078 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_05040 3796 3723 gene locus_tag LOCUS_t00050 3796 3723 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4684 3806 gene locus_tag LOCUS_05050 4684 3806 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987022.1 protein_id gnl|my_center|LOCUS_05050 4907 5665 gene locus_tag LOCUS_05060 gene cobM 4907 5665 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence062 2 457 gene locus_tag LOCUS_05070 2 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2979 520 gene locus_tag LOCUS_05080 2979 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3542 3132 gene locus_tag LOCUS_05090 3542 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 5331 3607 gene locus_tag LOCUS_05100 5331 3607 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_05100 5561 5328 gene locus_tag LOCUS_05110 5561 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5824 5558 gene locus_tag LOCUS_05120 5824 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 <6432 5821 gene locus_tag LOCUS_05130 <6432 5821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005901943.1:lipid-A-disaccharide synthase >Feature sequence063 441 181 gene locus_tag LOCUS_05140 441 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1760 510 gene locus_tag LOCUS_05150 gene fabF 1760 510 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 protein_id gnl|my_center|LOCUS_05150 4017 1828 gene locus_tag LOCUS_05160 4017 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4396 4004 gene locus_tag LOCUS_05170 4396 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4727 4389 gene locus_tag LOCUS_05180 4727 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 <6414 4728 gene locus_tag LOCUS_05190 <6414 4728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000963214.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence064 515 784 gene locus_tag LOCUS_05200 515 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 808 1080 gene locus_tag LOCUS_05210 808 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1625 1095 gene locus_tag LOCUS_05220 1625 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1885 1622 gene locus_tag LOCUS_05230 1885 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2657 1878 gene locus_tag LOCUS_05240 gene lgt 2657 1878 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_05240 2821 4449 gene locus_tag LOCUS_05250 2821 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4593 5849 gene locus_tag LOCUS_05260 4593 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence065 1703 780 gene locus_tag LOCUS_05270 1703 780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_05270 2028 3371 gene locus_tag LOCUS_05280 2028 3371 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_05280 3500 4156 gene locus_tag LOCUS_05290 3500 4156 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_05290 4916 4428 gene locus_tag LOCUS_05300 4916 4428 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_05300 5564 4971 gene locus_tag LOCUS_05310 5564 4971 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence066 1691 1245 gene locus_tag LOCUS_05320 gene rplI 1691 1245 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_05320 1877 1789 gene locus_tag LOCUS_t00060 1877 1789 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2461 3075 gene locus_tag LOCUS_05330 gene yihA 2461 3075 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_05330 3607 4065 gene locus_tag LOCUS_05340 3607 4065 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_05340 4081 4554 gene locus_tag LOCUS_05350 4081 4554 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966078.1 protein_id gnl|my_center|LOCUS_05350 6143 4758 gene locus_tag LOCUS_05360 6143 4758 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861696.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence067 1481 66 gene locus_tag LOCUS_05370 1481 66 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 protein_id gnl|my_center|LOCUS_05370 2412 1564 gene locus_tag LOCUS_05380 2412 1564 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_05380 2497 3627 gene locus_tag LOCUS_05390 2497 3627 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_05390 3641 4294 gene locus_tag LOCUS_05400 3641 4294 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031905.1 protein_id gnl|my_center|LOCUS_05400 4304 4831 gene locus_tag LOCUS_05410 4304 4831 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence068 418 621 gene locus_tag LOCUS_05420 418 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 635 1081 gene locus_tag LOCUS_05430 635 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1853 1110 gene locus_tag LOCUS_05440 gene tatC 1853 1110 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880807.1 protein_id gnl|my_center|LOCUS_05440 2056 1850 gene locus_tag LOCUS_05450 2056 1850 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392792.1 protein_id gnl|my_center|LOCUS_05450 2150 3256 gene locus_tag LOCUS_05460 2150 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3571 4638 gene locus_tag LOCUS_05470 3571 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4654 6066 gene locus_tag LOCUS_05480 4654 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence069 88 858 gene locus_tag LOCUS_05490 gene cobS 88 858 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095065899.1 protein_id gnl|my_center|LOCUS_05490 927 1724 gene locus_tag LOCUS_05500 927 1724 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392617.1 protein_id gnl|my_center|LOCUS_05500 1808 2884 gene locus_tag LOCUS_05510 gene triB 1808 2884 CDS product triclosan efflux RND transporter adaptor protein TriB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083872.1 protein_id gnl|my_center|LOCUS_05510 2903 3106 gene locus_tag LOCUS_05520 2903 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3099 3296 gene locus_tag LOCUS_05530 3099 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence070 587 1480 gene locus_tag LOCUS_05540 587 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1480 1635 gene locus_tag LOCUS_05550 1480 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1674 3221 gene locus_tag LOCUS_05560 1674 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3398 3871 gene locus_tag LOCUS_05570 3398 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3884 4324 gene locus_tag LOCUS_05580 3884 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4321 4476 gene locus_tag LOCUS_05590 4321 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence071 82 288 gene locus_tag LOCUS_05600 82 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 270 602 gene locus_tag LOCUS_05610 270 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 602 1645 gene locus_tag LOCUS_05620 gene aroB 602 1645 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_05620 1707 2525 gene locus_tag LOCUS_05630 1707 2525 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_05630 2634 3431 gene locus_tag LOCUS_05640 2634 3431 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637459.1 protein_id gnl|my_center|LOCUS_05640 3460 4413 gene locus_tag LOCUS_05650 3460 4413 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_05650 4419 5510 gene locus_tag LOCUS_05660 4419 5510 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454526.1 protein_id gnl|my_center|LOCUS_05660 5515 6027 gene locus_tag LOCUS_05670 5515 6027 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence072 1422 2018 gene locus_tag LOCUS_05680 gene coaE 1422 2018 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_05680 2613 2095 gene locus_tag LOCUS_05690 2613 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4592 2610 gene locus_tag LOCUS_05700 gene uvrB 4592 2610 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_05700 <6074 4607 gene locus_tag LOCUS_05710 <6074 4607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257646.1:clostripain-related cysteine peptidase >Feature sequence073 1134 676 gene locus_tag LOCUS_05720 1134 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1630 1145 gene locus_tag LOCUS_05730 1630 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 1976 1641 gene locus_tag LOCUS_05740 1976 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2095 2703 gene locus_tag LOCUS_05750 gene pth 2095 2703 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 protein_id gnl|my_center|LOCUS_05750 2672 3910 gene locus_tag LOCUS_05760 2672 3910 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_05760 4992 4087 gene locus_tag LOCUS_05770 4992 4087 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673990.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence074 585 13 gene locus_tag LOCUS_05780 gene grpE 585 13 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_05780 732 1529 gene locus_tag LOCUS_05790 732 1529 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_05790 2043 2942 gene locus_tag LOCUS_05800 gene rapZ 2043 2942 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_05800 3026 4315 gene locus_tag LOCUS_05810 3026 4315 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 protein_id gnl|my_center|LOCUS_05810 5232 5005 gene locus_tag LOCUS_05820 5232 5005 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_05820 5545 5264 gene locus_tag LOCUS_05830 gene rpsP 5545 5264 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence075 1119 34 gene locus_tag LOCUS_05840 gene dprA 1119 34 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_05840 1244 2404 gene locus_tag LOCUS_05850 1244 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2409 2654 gene locus_tag LOCUS_05860 2409 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2656 2841 gene locus_tag LOCUS_05870 2656 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2838 3623 gene locus_tag LOCUS_05880 gene proC 2838 3623 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_05880 3642 3800 gene locus_tag LOCUS_05890 3642 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3846 4211 gene locus_tag LOCUS_05900 3846 4211 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764951.1 protein_id gnl|my_center|LOCUS_05900 4234 4602 gene locus_tag LOCUS_05910 4234 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4724 5671 gene locus_tag LOCUS_05920 gene cheV 4724 5671 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence076 1407 445 gene locus_tag LOCUS_05930 gene hemB 1407 445 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_05930 1524 2540 gene locus_tag LOCUS_05940 gene gmd 1524 2540 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_05940 2547 2777 gene locus_tag LOCUS_05950 2547 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2770 3825 gene locus_tag LOCUS_05960 2770 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05960 3825 4823 gene locus_tag LOCUS_05970 3825 4823 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_05970 4836 5765 gene locus_tag LOCUS_05980 4836 5765 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence077 246 1319 gene locus_tag LOCUS_05990 gene ispG 246 1319 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_05990 1316 2404 gene locus_tag LOCUS_06000 gene ribD 1316 2404 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_06000 2407 3018 gene locus_tag LOCUS_06010 2407 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3008 3295 gene locus_tag LOCUS_06020 3008 3295 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 protein_id gnl|my_center|LOCUS_06020 3474 4088 gene locus_tag LOCUS_06030 3474 4088 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_06030 4085 5236 gene locus_tag LOCUS_06040 4085 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5256 5540 gene locus_tag LOCUS_06050 5256 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence078 150 1766 gene locus_tag LOCUS_06060 150 1766 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_06060 3304 1835 gene locus_tag LOCUS_06070 3304 1835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016512.1 protein_id gnl|my_center|LOCUS_06070 4575 3301 gene locus_tag LOCUS_06080 4575 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4742 4602 gene locus_tag LOCUS_06090 4742 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5133 4933 gene locus_tag LOCUS_06100 5133 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5536 5138 gene locus_tag LOCUS_06110 5536 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence079 1362 481 gene locus_tag LOCUS_06120 1362 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1730 1422 gene locus_tag LOCUS_06130 1730 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3218 2043 gene locus_tag LOCUS_06140 3218 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3974 3222 gene locus_tag LOCUS_06150 gene surE 3974 3222 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_06150 4891 4103 gene locus_tag LOCUS_06160 4891 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 <5848 5073 gene locus_tag LOCUS_06170 <5848 5073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263649.1:sodium/proline symporter PutP >Feature sequence080 109 690 gene locus_tag LOCUS_06180 109 690 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869892.1 protein_id gnl|my_center|LOCUS_06180 692 1069 gene locus_tag LOCUS_06190 692 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1059 1271 gene locus_tag LOCUS_06200 1059 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1389 2459 gene locus_tag LOCUS_06210 1389 2459 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_06210 2472 2885 gene locus_tag LOCUS_06220 2472 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4098 3223 gene locus_tag LOCUS_06230 gene rsgA 4098 3223 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_06230 <5820 4407 gene locus_tag LOCUS_06240 <5820 4407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence081 1150 497 gene locus_tag LOCUS_06250 1150 497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 protein_id gnl|my_center|LOCUS_06250 2180 1119 gene locus_tag LOCUS_06260 2180 1119 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388546.1 protein_id gnl|my_center|LOCUS_06260 2818 2246 gene locus_tag LOCUS_06270 2818 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06270 3151 2840 gene locus_tag LOCUS_06280 3151 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06280 4112 3234 gene locus_tag LOCUS_06290 4112 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06290 4547 4161 gene locus_tag LOCUS_06300 4547 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06300 4728 5522 gene locus_tag LOCUS_06310 4728 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 5541 5741 gene locus_tag LOCUS_06320 gene rpmE 5541 5741 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence082 1919 810 gene locus_tag LOCUS_06330 gene murG 1919 810 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_06330 2326 1970 gene locus_tag LOCUS_06340 2326 1970 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_06340 2698 2375 gene locus_tag LOCUS_06350 2698 2375 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198610.1 protein_id gnl|my_center|LOCUS_06350 4049 2700 gene locus_tag LOCUS_06360 gene murD 4049 2700 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_06360 5015 4053 gene locus_tag LOCUS_06370 gene mraY 5015 4053 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_06370 5432 5049 gene locus_tag LOCUS_06380 5432 5049 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993678.1 protein_id gnl|my_center|LOCUS_06380 5682 5452 gene locus_tag LOCUS_06390 5682 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence083 433 606 gene locus_tag LOCUS_06400 433 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 603 821 gene locus_tag LOCUS_06410 603 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1245 1517 gene locus_tag LOCUS_06420 1245 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 1650 1883 gene locus_tag LOCUS_06430 1650 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1867 2085 gene locus_tag LOCUS_06440 1867 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2255 3082 gene locus_tag LOCUS_06450 2255 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3086 3919 gene locus_tag LOCUS_06460 3086 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3932 4129 gene locus_tag LOCUS_06470 3932 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence084 4077 706 gene locus_tag LOCUS_06480 gene addA 4077 706 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572298.1 protein_id gnl|my_center|LOCUS_06480 4645 4085 gene locus_tag LOCUS_06490 gene rfbC 4645 4085 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_06490 4711 4998 gene locus_tag LOCUS_06500 4711 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence085 2985 1216 gene locus_tag LOCUS_06510 2985 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3147 3953 gene locus_tag LOCUS_06520 gene cdaA 3147 3953 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_06520 3950 4885 gene locus_tag LOCUS_06530 3950 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4943 5575 gene locus_tag LOCUS_06540 4943 5575 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816766.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence086 1244 180 gene locus_tag LOCUS_06550 gene ispG 1244 180 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_06550 1693 2928 gene locus_tag LOCUS_06560 1693 2928 CDS product NAD-dependent malic enzyme 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199012.1 protein_id gnl|my_center|LOCUS_06560 2933 3007 gene locus_tag LOCUS_t00070 2933 3007 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5154 3061 gene locus_tag LOCUS_06570 5154 3061 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861529.1 protein_id gnl|my_center|LOCUS_06570 <5769 5167 gene locus_tag LOCUS_06580 <5769 5167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964127.1:hydrogenase expression/formation protein HypE >Feature sequence087 <1 583 gene locus_tag LOCUS_06590 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392225.1:class II aldolase/adducin family protein 610 1680 gene locus_tag LOCUS_06600 gene mtnA 610 1680 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_06600 1685 3394 gene locus_tag LOCUS_06610 1685 3394 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964267.1 protein_id gnl|my_center|LOCUS_06610 3396 5588 gene locus_tag LOCUS_06620 3396 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence088 1094 1705 gene locus_tag LOCUS_06630 gene cobC 1094 1705 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_06630 1869 2990 gene locus_tag LOCUS_06640 1869 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3106 3375 gene locus_tag LOCUS_06650 3106 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3368 3625 gene locus_tag LOCUS_06660 3368 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3650 4687 gene locus_tag LOCUS_06670 gene argC 3650 4687 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence089 <1 1645 gene locus_tag LOCUS_06680 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243811.1:calcium-binding protein 1754 2248 gene locus_tag LOCUS_06690 1754 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06690 2264 3064 gene locus_tag LOCUS_06700 2264 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06700 3081 3776 gene locus_tag LOCUS_06710 3081 3776 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651524.1 protein_id gnl|my_center|LOCUS_06710 4067 4951 gene locus_tag LOCUS_06720 4067 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5634 4999 gene locus_tag LOCUS_06730 5634 4999 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence090 908 141 gene locus_tag LOCUS_06740 gene rnc 908 141 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392467.1 protein_id gnl|my_center|LOCUS_06740 2123 915 gene locus_tag LOCUS_06750 2123 915 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143733.1 protein_id gnl|my_center|LOCUS_06750 2634 2215 gene locus_tag LOCUS_06760 2634 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3264 2650 gene locus_tag LOCUS_06770 3264 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 4994 3261 gene locus_tag LOCUS_06780 4994 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence091 1148 981 gene locus_tag LOCUS_06790 1148 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1957 1145 gene locus_tag LOCUS_06800 1957 1145 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261879.1 protein_id gnl|my_center|LOCUS_06800 2388 1954 gene locus_tag LOCUS_06810 2388 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2371 2535 gene locus_tag LOCUS_06820 2371 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3783 2659 gene locus_tag LOCUS_06830 3783 2659 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583956.1 protein_id gnl|my_center|LOCUS_06830 5406 3787 gene locus_tag LOCUS_06840 5406 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence092 3241 152 gene locus_tag LOCUS_06850 3241 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4567 3530 gene locus_tag LOCUS_06860 4567 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5046 4564 gene locus_tag LOCUS_06870 gene ybaK 5046 4564 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_06870 5361 5056 gene locus_tag LOCUS_06880 5361 5056 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence093 1065 2282 gene locus_tag LOCUS_06890 1065 2282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_06890 3144 2566 gene locus_tag LOCUS_06900 3144 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3763 3155 gene locus_tag LOCUS_06910 3763 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4169 3753 gene locus_tag LOCUS_06920 4169 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 4702 4166 gene locus_tag LOCUS_06930 4702 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5435 4707 gene locus_tag LOCUS_06940 gene ftsE 5435 4707 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence094 1515 1889 gene locus_tag LOCUS_06950 gene flgB 1515 1889 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_06950 1956 2405 gene locus_tag LOCUS_06960 gene flgC 1956 2405 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_06960 2480 2782 gene locus_tag LOCUS_06970 2480 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2987 4672 gene locus_tag LOCUS_06980 gene fliF 2987 4672 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence095 693 361 gene locus_tag LOCUS_06990 693 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1653 730 gene locus_tag LOCUS_07000 1653 730 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_07000 2564 1734 gene locus_tag LOCUS_07010 2564 1734 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_07010 3009 2644 gene locus_tag LOCUS_07020 3009 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3586 3023 gene locus_tag LOCUS_07030 3586 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4253 3597 gene locus_tag LOCUS_07040 4253 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5569 4286 gene locus_tag LOCUS_07050 5569 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence096 1230 5519 gene locus_tag LOCUS_07060 1230 5519 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence097 1268 18 gene locus_tag LOCUS_07070 1268 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence098 415 2316 gene locus_tag LOCUS_07080 415 2316 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880393.1 protein_id gnl|my_center|LOCUS_07080 2323 3021 gene locus_tag LOCUS_07090 gene cybH 2323 3021 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880394.1 protein_id gnl|my_center|LOCUS_07090 3649 3071 gene locus_tag LOCUS_07100 3649 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5200 4529 gene locus_tag LOCUS_07110 5200 4529 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence099 1255 326 gene locus_tag LOCUS_07120 1255 326 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_07120 1833 1468 gene locus_tag LOCUS_07130 1833 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2973 1846 gene locus_tag LOCUS_07140 2973 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 3192 3022 gene locus_tag LOCUS_07150 3192 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3345 5351 gene locus_tag LOCUS_07160 3345 5351 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107440.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence100 1254 118 gene locus_tag LOCUS_07170 gene spoVE 1254 118 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_07170 2104 1280 gene locus_tag LOCUS_07180 2104 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3646 2132 gene locus_tag LOCUS_07190 3646 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5311 3830 gene locus_tag LOCUS_07200 5311 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence101 1862 1149 gene locus_tag LOCUS_07210 1862 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3010 1952 gene locus_tag LOCUS_07220 gene prfB 3010 1952 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_07220 5162 3084 gene locus_tag LOCUS_07230 5162 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence102 <1 1588 gene locus_tag LOCUS_07240 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861529.1:BglG family transcription antiterminator 2269 1628 gene locus_tag LOCUS_07250 2269 1628 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837401.1 protein_id gnl|my_center|LOCUS_07250 3152 2256 gene locus_tag LOCUS_07260 3152 2256 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367416.1 protein_id gnl|my_center|LOCUS_07260 4452 3349 gene locus_tag LOCUS_07270 gene hemW 4452 3349 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_07270 5512 4454 gene locus_tag LOCUS_07280 gene radA 5512 4454 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence103 1361 57 gene locus_tag LOCUS_07290 1361 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2008 1361 gene locus_tag LOCUS_07300 2008 1361 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_07300 2746 2021 gene locus_tag LOCUS_07310 2746 2021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_07310 3526 2753 gene locus_tag LOCUS_07320 3526 2753 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_07320 3894 5273 gene locus_tag LOCUS_07330 3894 5273 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence104 1143 2162 gene locus_tag LOCUS_07340 gene ilvC 1143 2162 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_07340 2245 3603 gene locus_tag LOCUS_07350 2245 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 3625 4884 gene locus_tag LOCUS_07360 gene leuC 3625 4884 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_07360 4886 5374 gene locus_tag LOCUS_07370 gene leuD 4886 5374 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence105 585 274 gene locus_tag LOCUS_07380 585 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1117 599 gene locus_tag LOCUS_07390 1117 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2943 1291 gene locus_tag LOCUS_07400 2943 1291 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_07400 3284 2988 gene locus_tag LOCUS_07410 3284 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 3615 3313 gene locus_tag LOCUS_07420 3615 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 4408 3629 gene locus_tag LOCUS_07430 4408 3629 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_07430 4559 4987 gene locus_tag LOCUS_07440 4559 4987 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence106 993 307 gene locus_tag LOCUS_07450 993 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1782 1012 gene locus_tag LOCUS_07460 1782 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07460 2610 1807 gene locus_tag LOCUS_07470 2610 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07470 <5465 2679 gene locus_tag LOCUS_07480 <5465 2679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259705.1:4-alpha-glucanotransferase >Feature sequence107 940 587 gene locus_tag LOCUS_07490 940 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1750 941 gene locus_tag LOCUS_07500 gene lpxA 1750 941 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_07500 2209 1769 gene locus_tag LOCUS_07510 gene fabZ 2209 1769 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966834.1 protein_id gnl|my_center|LOCUS_07510 3059 2226 gene locus_tag LOCUS_07520 gene lpxC 3059 2226 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814567.1 protein_id gnl|my_center|LOCUS_07520 3866 3414 gene locus_tag LOCUS_07530 3866 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4448 3882 gene locus_tag LOCUS_07540 4448 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07540 4994 4467 gene locus_tag LOCUS_07550 4994 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07550 >Feature sequence108 <1 1335 gene locus_tag LOCUS_07560 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003226923.1:replicative DNA helicase 1388 1855 gene locus_tag LOCUS_07570 1388 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07570 1856 2938 gene locus_tag LOCUS_07580 1856 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07580 >Feature sequence109 <1 960 gene locus_tag LOCUS_07590 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986978.1:DUF4422 domain-containing protein 976 1236 gene locus_tag LOCUS_07600 976 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1246 1857 gene locus_tag LOCUS_07610 1246 1857 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_07610 4757 2199 gene locus_tag LOCUS_07620 gene mutS 4757 2199 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_07620 5327 5243 gene locus_tag LOCUS_t00080 5327 5243 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 165 46 gene locus_tag LOCUS_07630 165 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 772 293 gene locus_tag LOCUS_07640 772 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1376 1071 gene locus_tag LOCUS_07650 1376 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2082 1366 gene locus_tag LOCUS_07660 2082 1366 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 protein_id gnl|my_center|LOCUS_07660 2947 2300 gene locus_tag LOCUS_07670 2947 2300 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_07670 3942 2944 gene locus_tag LOCUS_07680 3942 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4401 3955 gene locus_tag LOCUS_07690 4401 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 <5230 4403 gene locus_tag LOCUS_07700 <5230 4403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460756.1:flagellar protein export ATPase FliI >Feature sequence111 <1 1464 gene locus_tag LOCUS_07710 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945258.1:N-acetylmuramoyl-L-alanine amidase 2081 1560 gene locus_tag LOCUS_07720 2081 1560 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_07720 2492 2109 gene locus_tag LOCUS_07730 2492 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4885 2606 gene locus_tag LOCUS_07740 gene pnp 4885 2606 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence112 1 255 gene locus_tag LOCUS_07750 1 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 259 669 gene locus_tag LOCUS_07760 259 669 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_07760 777 1568 gene locus_tag LOCUS_07770 777 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1708 2940 gene locus_tag LOCUS_07780 1708 2940 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_07780 3285 4652 gene locus_tag LOCUS_07790 3285 4652 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence113 1762 815 gene locus_tag LOCUS_07800 1762 815 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_07800 2681 1854 gene locus_tag LOCUS_07810 2681 1854 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 protein_id gnl|my_center|LOCUS_07810 3504 2695 gene locus_tag LOCUS_07820 3504 2695 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721899.1 protein_id gnl|my_center|LOCUS_07820 4084 3593 gene locus_tag LOCUS_07830 4084 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07830 4544 4110 gene locus_tag LOCUS_07840 4544 4110 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721901.1 protein_id gnl|my_center|LOCUS_07840 4787 5185 gene locus_tag LOCUS_07850 4787 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence114 1692 388 gene locus_tag LOCUS_07860 gene lysA 1692 388 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 protein_id gnl|my_center|LOCUS_07860 2507 1746 gene locus_tag LOCUS_07870 2507 1746 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381054.1 protein_id gnl|my_center|LOCUS_07870 4649 2712 gene locus_tag LOCUS_07880 4649 2712 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079722.1 protein_id gnl|my_center|LOCUS_07880 4970 5149 gene locus_tag LOCUS_07890 gene rpsU 4970 5149 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816464.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence115 206 1477 gene locus_tag LOCUS_07900 gene hemA 206 1477 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_07900 1464 2381 gene locus_tag LOCUS_07910 gene hemC 1464 2381 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_07910 2643 2801 gene locus_tag LOCUS_07920 2643 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2798 3325 gene locus_tag LOCUS_07930 2798 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3384 3719 gene locus_tag LOCUS_07940 3384 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4632 3985 gene locus_tag LOCUS_07950 4632 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence116 2443 1643 gene locus_tag LOCUS_07960 2443 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2610 3629 gene locus_tag LOCUS_07970 gene cobD 2610 3629 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_07970 3607 4737 gene locus_tag LOCUS_07980 3607 4737 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence117 <1 1065 gene locus_tag LOCUS_07990 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139328014.1:SH3 domain-containing protein 1067 2836 gene locus_tag LOCUS_08000 1067 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2945 3145 gene locus_tag LOCUS_08010 2945 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3200 4456 gene locus_tag LOCUS_08020 3200 4456 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_08020 4655 4882 gene locus_tag LOCUS_08030 4655 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence118 731 285 gene locus_tag LOCUS_08040 731 285 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_08040 1942 728 gene locus_tag LOCUS_08050 1942 728 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_08050 2070 3221 gene locus_tag LOCUS_08060 gene fucO 2070 3221 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_08060 4262 3291 gene locus_tag LOCUS_08070 4262 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 <4970 4281 gene locus_tag LOCUS_08080 <4970 4281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026199033.1:peptide chain release factor 1 >Feature sequence119 <1 1146 gene locus_tag LOCUS_08090 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393817.1:DUF4127 family protein 3051 1270 gene locus_tag LOCUS_08100 3051 1270 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165448192.1 protein_id gnl|my_center|LOCUS_08100 4814 3267 gene locus_tag LOCUS_08110 4814 3267 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence120 <1 1115 gene locus_tag LOCUS_08120 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943680.1:flagellar biosynthesis protein FlhF 1128 2027 gene locus_tag LOCUS_08130 1128 2027 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556868.1 protein_id gnl|my_center|LOCUS_08130 2083 2763 gene locus_tag LOCUS_08140 2083 2763 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_08140 3773 3183 gene locus_tag LOCUS_08150 3773 3183 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_08150 <4924 3777 gene locus_tag LOCUS_08160 <4924 3777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722206.1:tryptophan synthase subunit beta >Feature sequence121 622 1830 gene locus_tag LOCUS_08170 622 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1827 2825 gene locus_tag LOCUS_08180 1827 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2834 2956 gene locus_tag LOCUS_08190 2834 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3036 4196 gene locus_tag LOCUS_08200 3036 4196 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_08200 3664 3748 gene locus_tag LOCUS_t00090 3664 3748 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4352 4277 gene locus_tag LOCUS_t00100 4352 4277 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4429 4354 gene locus_tag LOCUS_t00110 4429 4354 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4594 4489 gene locus_tag LOCUS_r00010 4594 4489 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence122 796 1140 gene locus_tag LOCUS_08210 796 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2574 1279 gene locus_tag LOCUS_08220 2574 1279 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_08220 2646 3476 gene locus_tag LOCUS_08230 2646 3476 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986912.1 protein_id gnl|my_center|LOCUS_08230 <4856 3463 gene locus_tag LOCUS_08240 <4856 3463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence123 982 158 gene locus_tag LOCUS_08250 gene kdsA 982 158 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_08250 1307 1161 gene locus_tag LOCUS_08260 1307 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2319 1585 gene locus_tag LOCUS_08270 gene kdsB 2319 1585 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_08270 2461 4251 gene locus_tag LOCUS_08280 2461 4251 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_08280 4528 4304 gene locus_tag LOCUS_08290 4528 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence124 <1 3990 gene locus_tag LOCUS_08300 <1 3990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025773568.1:DNA-directed RNA polymerase subunit beta' 4712 4311 gene locus_tag LOCUS_08310 4712 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence125 1230 208 gene locus_tag LOCUS_08320 1230 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2533 1880 gene locus_tag LOCUS_08330 2533 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2692 4077 gene locus_tag LOCUS_08340 2692 4077 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461052.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence126 1480 377 gene locus_tag LOCUS_08350 1480 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3352 1640 gene locus_tag LOCUS_08360 3352 1640 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165448192.1 protein_id gnl|my_center|LOCUS_08360 3840 3568 gene locus_tag LOCUS_08370 3840 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 <4712 3845 gene locus_tag LOCUS_08380 <4712 3845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965653.1:phenylalanine--tRNA ligase subunit beta >Feature sequence127 1954 812 gene locus_tag LOCUS_08390 1954 812 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_08390 2160 1951 gene locus_tag LOCUS_08400 2160 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2387 2157 gene locus_tag LOCUS_08410 2387 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2553 2380 gene locus_tag LOCUS_08420 2553 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence128 2361 1732 gene locus_tag LOCUS_08430 gene cmk 2361 1732 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_08430 2495 4447 gene locus_tag LOCUS_08440 2495 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence129 184 624 gene locus_tag LOCUS_08450 gene rplM 184 624 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727703.1 protein_id gnl|my_center|LOCUS_08450 637 1029 gene locus_tag LOCUS_08460 gene rpsI 637 1029 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_08460 1090 2013 gene locus_tag LOCUS_08470 1090 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2775 2122 gene locus_tag LOCUS_08480 2775 2122 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_08480 3476 2886 gene locus_tag LOCUS_08490 3476 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence130 1012 314 gene locus_tag LOCUS_08500 gene hisIE 1012 314 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_08500 3596 1134 gene locus_tag LOCUS_08510 gene leuS 3596 1134 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_08510 4584 3898 gene locus_tag LOCUS_08520 4584 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence131 620 204 gene locus_tag LOCUS_08530 620 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 851 657 gene locus_tag LOCUS_08540 851 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4196 870 gene locus_tag LOCUS_08550 4196 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4589 4200 gene locus_tag LOCUS_08560 4589 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence132 207 863 gene locus_tag LOCUS_08570 207 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08570 912 3860 gene locus_tag LOCUS_08580 912 3860 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08580 >Feature sequence133 1497 61 gene locus_tag LOCUS_08590 1497 61 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_08590 1681 4164 gene locus_tag LOCUS_08600 1681 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence134 2677 380 gene locus_tag LOCUS_08610 2677 380 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_08610 4084 2729 gene locus_tag LOCUS_08620 4084 2729 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence135 1762 593 gene locus_tag LOCUS_08630 1762 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3492 1759 gene locus_tag LOCUS_08640 3492 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3973 3467 gene locus_tag LOCUS_08650 3973 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4055 4180 gene locus_tag LOCUS_08660 4055 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence136 1544 1377 gene locus_tag LOCUS_08670 1544 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2623 1553 gene locus_tag LOCUS_08680 2623 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3999 2713 gene locus_tag LOCUS_08690 3999 2713 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_08690 4371 4015 gene locus_tag LOCUS_08700 4371 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence137 <1 4345 gene locus_tag LOCUS_08710 <1 4345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210190849.1:FG-GAP-like repeat-containing protein >Feature sequence138 700 2010 gene locus_tag LOCUS_08720 700 2010 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_08720 2072 2548 gene locus_tag LOCUS_08730 gene def 2072 2548 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460527.1 protein_id gnl|my_center|LOCUS_08730 2555 3319 gene locus_tag LOCUS_08740 2555 3319 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545555.1 protein_id gnl|my_center|LOCUS_08740 3316 3687 gene locus_tag LOCUS_08750 3316 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence139 38 4444 gene locus_tag LOCUS_08760 38 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence140 289 1476 gene locus_tag LOCUS_08770 289 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1582 2571 gene locus_tag LOCUS_08780 1582 2571 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_08780 2583 3464 gene locus_tag LOCUS_08790 gene whiA 2583 3464 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_08790 3482 3982 gene locus_tag LOCUS_08800 3482 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence141 <1 543 gene locus_tag LOCUS_08810 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870466.1:diphosphate--fructose-6-phosphate 1-phosphotransferase 673 1074 gene locus_tag LOCUS_08820 673 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1086 1826 gene locus_tag LOCUS_08830 1086 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1884 4280 gene locus_tag LOCUS_08840 1884 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476642.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence142 2288 1881 gene locus_tag LOCUS_08850 2288 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2597 2301 gene locus_tag LOCUS_08860 2597 2301 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883149.1 protein_id gnl|my_center|LOCUS_08860 4245 2611 gene locus_tag LOCUS_08870 4245 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence143 <1 1515 gene locus_tag LOCUS_08880 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948686.1:L-lactate permease 1596 2327 gene locus_tag LOCUS_08890 1596 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence144 2419 794 gene locus_tag LOCUS_08900 2419 794 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228000.1 protein_id gnl|my_center|LOCUS_08900 3568 2429 gene locus_tag LOCUS_08910 3568 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896664.1 protein_id gnl|my_center|LOCUS_08910 4313 3579 gene locus_tag LOCUS_08920 4313 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence145 173 1165 gene locus_tag LOCUS_08930 gene dhaK 173 1165 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 protein_id gnl|my_center|LOCUS_08930 1169 1798 gene locus_tag LOCUS_08940 gene dhaL 1169 1798 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_08940 1800 2180 gene locus_tag LOCUS_08950 gene dhaM 1800 2180 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257204.1 protein_id gnl|my_center|LOCUS_08950 3688 2450 gene locus_tag LOCUS_08960 3688 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence146 1119 961 gene locus_tag LOCUS_08970 1119 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2551 1391 gene locus_tag LOCUS_08980 2551 1391 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_08980 4161 2662 gene locus_tag LOCUS_08990 4161 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence147 334 1395 gene locus_tag LOCUS_09000 gene hisC 334 1395 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931013.1 protein_id gnl|my_center|LOCUS_09000 3829 1511 gene locus_tag LOCUS_09010 gene lon 3829 1511 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence148 <1 538 gene locus_tag LOCUS_09020 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964308.1:glutamate--tRNA ligase 720 1574 gene locus_tag LOCUS_09030 720 1574 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267456.1 protein_id gnl|my_center|LOCUS_09030 1599 1868 gene locus_tag LOCUS_09040 1599 1868 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_09040 1872 2339 gene locus_tag LOCUS_09050 1872 2339 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_09050 2326 3687 gene locus_tag LOCUS_09060 2326 3687 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_09060 3843 4289 gene locus_tag LOCUS_09070 3843 4289 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence149 55 1080 gene locus_tag LOCUS_09080 gene mnmA 55 1080 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_09080 1850 1038 gene locus_tag LOCUS_09090 1850 1038 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_09090 2014 1862 gene locus_tag LOCUS_09100 2014 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2537 1980 gene locus_tag LOCUS_09110 2537 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2653 3741 gene locus_tag LOCUS_09120 gene csaB 2653 3741 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence150 1472 1254 gene locus_tag LOCUS_09130 1472 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2231 1590 gene locus_tag LOCUS_09140 2231 1590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476110.1 protein_id gnl|my_center|LOCUS_09140 2459 3337 gene locus_tag LOCUS_09150 2459 3337 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_09150 3391 3534 gene locus_tag LOCUS_09160 3391 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence151 2585 771 gene locus_tag LOCUS_09170 gene dnaG 2585 771 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence152 65 1024 gene locus_tag LOCUS_09180 65 1024 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905576.1 protein_id gnl|my_center|LOCUS_09180 1148 1438 gene locus_tag LOCUS_09190 1148 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1462 3363 gene locus_tag LOCUS_09200 gene htpG 1462 3363 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_09200 3462 4220 gene locus_tag LOCUS_09210 3462 4220 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048208.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence153 292 3354 gene locus_tag LOCUS_09220 292 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence154 1708 890 gene locus_tag LOCUS_09230 1708 890 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_09230 2452 1736 gene locus_tag LOCUS_09240 2452 1736 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_09240 3359 2562 gene locus_tag LOCUS_09250 3359 2562 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_09250 3930 3388 gene locus_tag LOCUS_09260 3930 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence155 <1 626 gene locus_tag LOCUS_09270 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021861.1:flavodoxin family protein 623 1252 gene locus_tag LOCUS_09280 623 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1579 2502 gene locus_tag LOCUS_09290 1579 2502 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081766.1 protein_id gnl|my_center|LOCUS_09290 2486 3877 gene locus_tag LOCUS_09300 gene rlmD 2486 3877 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence156 <1 1328 gene locus_tag LOCUS_09310 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947939.1:methionine--tRNA ligase 1676 3850 gene locus_tag LOCUS_09320 1676 3850 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence157 3535 1742 gene locus_tag LOCUS_09330 3535 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 <4226 3513 gene locus_tag LOCUS_09340 <4226 3513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein >Feature sequence158 <1 1226 gene locus_tag LOCUS_09350 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390482.1:tetratricopeptide repeat protein 1227 1832 gene locus_tag LOCUS_09360 1227 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1839 2129 gene locus_tag LOCUS_09370 1839 2129 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_09370 2116 2505 gene locus_tag LOCUS_09380 2116 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2510 3370 gene locus_tag LOCUS_09390 2510 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4107 3640 gene locus_tag LOCUS_09400 4107 3640 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence159 653 207 gene locus_tag LOCUS_09410 gene rimI 653 207 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_09410 1519 800 gene locus_tag LOCUS_09420 gene tsaB 1519 800 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_09420 2004 1522 gene locus_tag LOCUS_09430 gene tsaE 2004 1522 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_09430 2185 2835 gene locus_tag LOCUS_09440 2185 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence160 2181 700 gene locus_tag LOCUS_09450 2181 700 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_09450 2658 2206 gene locus_tag LOCUS_09460 2658 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3042 2824 gene locus_tag LOCUS_09470 3042 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4084 3125 gene locus_tag LOCUS_09480 4084 3125 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence161 1131 667 gene locus_tag LOCUS_09490 1131 667 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_09490 1517 1128 gene locus_tag LOCUS_09500 1517 1128 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142305.1 protein_id gnl|my_center|LOCUS_09500 2773 1517 gene locus_tag LOCUS_09510 2773 1517 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925128.1 protein_id gnl|my_center|LOCUS_09510 <4189 2774 gene locus_tag LOCUS_09520 <4189 2774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810772.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence162 144 1769 gene locus_tag LOCUS_09530 144 1769 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 protein_id gnl|my_center|LOCUS_09530 3293 1896 gene locus_tag LOCUS_09540 3293 1896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_09540 <4161 3397 gene locus_tag LOCUS_09550 <4161 3397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256274.1:TIM barrel protein >Feature sequence163 1471 524 gene locus_tag LOCUS_09560 gene fabK 1471 524 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 protein_id gnl|my_center|LOCUS_09560 2556 1564 gene locus_tag LOCUS_09570 gene rfaE1 2556 1564 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_09570 2721 2569 gene locus_tag LOCUS_09580 2721 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3260 2772 gene locus_tag LOCUS_09590 3260 2772 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_09590 <4155 3251 gene locus_tag LOCUS_09600 <4155 3251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143571.1:glycosyltransferase family 39 protein >Feature sequence164 680 114 gene locus_tag LOCUS_09610 680 114 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_09610 2163 664 gene locus_tag LOCUS_09620 gene trpE 2163 664 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257292.1 protein_id gnl|my_center|LOCUS_09620 2460 2176 gene locus_tag LOCUS_09630 2460 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3700 2645 gene locus_tag LOCUS_09640 gene cbiD 3700 2645 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392602.1 protein_id gnl|my_center|LOCUS_09640 4083 3736 gene locus_tag LOCUS_09650 4083 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence165 442 1362 gene locus_tag LOCUS_09660 gene murB 442 1362 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_09660 1465 2553 gene locus_tag LOCUS_09670 1465 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2573 3595 gene locus_tag LOCUS_09680 gene trpD 2573 3595 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence166 <1 630 gene locus_tag LOCUS_09690 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257858.1:DUF3662 and FHA domain-containing protein 933 1334 gene locus_tag LOCUS_09700 933 1334 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_09700 1375 1938 gene locus_tag LOCUS_09710 1375 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1948 2361 gene locus_tag LOCUS_09720 1948 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2367 2618 gene locus_tag LOCUS_09730 2367 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2647 3066 gene locus_tag LOCUS_09740 gene nusB 2647 3066 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082311.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence167 3703 2915 gene locus_tag LOCUS_09750 3703 2915 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence168 175 327 gene locus_tag LOCUS_09760 175 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1213 329 gene locus_tag LOCUS_09770 1213 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 1779 1225 gene locus_tag LOCUS_09780 1779 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 3004 1991 gene locus_tag LOCUS_09790 3004 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3218 3302 gene locus_tag LOCUS_t00120 3218 3302 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3336 3914 gene locus_tag LOCUS_09800 gene plsY 3336 3914 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811145.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence169 3646 3886 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatcgttgcccgcgcccccgt >Feature sequence170 1007 852 gene locus_tag LOCUS_09810 1007 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2144 1017 gene locus_tag LOCUS_09820 2144 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3320 2163 gene locus_tag LOCUS_09830 3320 2163 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967060.1 protein_id gnl|my_center|LOCUS_09830 3619 3317 gene locus_tag LOCUS_09840 3619 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence171 431 1051 gene locus_tag LOCUS_09850 431 1051 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_09850 1167 3491 gene locus_tag LOCUS_09860 1167 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence172 1010 2581 gene locus_tag LOCUS_09870 gene rny 1010 2581 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_09870 2654 3181 gene locus_tag LOCUS_09880 2654 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence173 1 1293 gene locus_tag LOCUS_09890 1 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1601 2386 gene locus_tag LOCUS_09900 1601 2386 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_09900 2399 3481 gene locus_tag LOCUS_09910 gene aroC 2399 3481 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence174 1099 131 gene locus_tag LOCUS_09920 1099 131 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 protein_id gnl|my_center|LOCUS_09920 2310 1240 gene locus_tag LOCUS_09930 gene rlmN 2310 1240 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_09930 2412 2894 gene locus_tag LOCUS_09940 2412 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3168 3884 gene locus_tag LOCUS_09950 3168 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence175 723 304 gene locus_tag LOCUS_09960 723 304 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_09960 1394 774 gene locus_tag LOCUS_09970 1394 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1762 1535 gene locus_tag LOCUS_09980 1762 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2595 1726 gene locus_tag LOCUS_09990 gene prmC 2595 1726 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_09990 3652 2669 gene locus_tag LOCUS_10000 3652 2669 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964682.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence176 36 1298 gene locus_tag LOCUS_10010 36 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2861 1593 gene locus_tag LOCUS_10020 2861 1593 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence177 749 306 gene locus_tag LOCUS_10030 749 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2105 945 gene locus_tag LOCUS_10040 gene meaB 2105 945 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_10040 2766 2203 gene locus_tag LOCUS_10050 2766 2203 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_10050 3013 2780 gene locus_tag LOCUS_10060 3013 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3702 3142 gene locus_tag LOCUS_10070 3702 3142 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence178 482 75 gene locus_tag LOCUS_10080 482 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1063 551 gene locus_tag LOCUS_10090 gene moaC 1063 551 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_10090 1964 1101 gene locus_tag LOCUS_10100 1964 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10100 3668 2046 gene locus_tag LOCUS_10110 3668 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10110 >Feature sequence179 1358 480 gene locus_tag LOCUS_10120 1358 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2330 1455 gene locus_tag LOCUS_10130 2330 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3203 2349 gene locus_tag LOCUS_10140 3203 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3824 3279 gene locus_tag LOCUS_10150 3824 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence180 <1 675 gene locus_tag LOCUS_10160 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583924.1:aspartate carbamoyltransferase catalytic subunit 762 929 gene locus_tag LOCUS_10170 762 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 926 2254 gene locus_tag LOCUS_10180 926 2254 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_10180 2315 3553 gene locus_tag LOCUS_10190 2315 3553 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence181 277 606 gene locus_tag LOCUS_10200 277 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 613 1689 gene locus_tag LOCUS_10210 gene hypD 613 1689 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964129.1 protein_id gnl|my_center|LOCUS_10210 1815 2810 gene locus_tag LOCUS_10220 gene hypE 1815 2810 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence182 1320 301 gene locus_tag LOCUS_10230 gene trpS 1320 301 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_10230 2221 1727 gene locus_tag LOCUS_10240 2221 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3036 2233 gene locus_tag LOCUS_10250 3036 2233 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_10250 3092 3529 gene locus_tag LOCUS_10260 3092 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence183 2560 1100 gene locus_tag LOCUS_10270 2560 1100 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_10270 <3710 2917 gene locus_tag LOCUS_10280 <3710 2917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229860.1:glutamate racemase >Feature sequence184 1369 281 gene locus_tag LOCUS_10290 1369 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1922 1389 gene locus_tag LOCUS_10300 1922 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3363 2191 gene locus_tag LOCUS_10310 3363 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence185 <1 1028 gene locus_tag LOCUS_10320 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583398.1:AMIN domain-containing protein 1042 1848 gene locus_tag LOCUS_10330 1042 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1852 2946 gene locus_tag LOCUS_10340 1852 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2936 3517 gene locus_tag LOCUS_10350 2936 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence186 747 424 gene locus_tag LOCUS_10360 gene rplX 747 424 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_10360 1134 766 gene locus_tag LOCUS_10370 gene rplN 1134 766 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_10370 1476 1213 gene locus_tag LOCUS_10380 gene rpsQ 1476 1213 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904137.1 protein_id gnl|my_center|LOCUS_10380 1691 1491 gene locus_tag LOCUS_10390 gene rpmC 1691 1491 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_10390 2229 1681 gene locus_tag LOCUS_10400 2229 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2906 2229 gene locus_tag LOCUS_10410 gene rpsC 2906 2229 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_10410 3284 2925 gene locus_tag LOCUS_10420 gene rplV 3284 2925 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727697.1 protein_id gnl|my_center|LOCUS_10420 3660 3379 gene locus_tag LOCUS_10430 gene rpsS 3660 3379 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence187 83 1240 gene locus_tag LOCUS_10440 83 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1314 1841 gene locus_tag LOCUS_10450 1314 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1858 2649 gene locus_tag LOCUS_10460 gene ymdB 1858 2649 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_10460 3656 3531 gene locus_tag LOCUS_10470 3656 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence188 250 612 gene locus_tag LOCUS_10480 250 612 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_10480 619 1914 gene locus_tag LOCUS_10490 619 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2911 1973 gene locus_tag LOCUS_10500 2911 1973 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_10500 <3665 3065 gene locus_tag LOCUS_10510 <3665 3065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068494.1:NAD(P)H-binding protein >Feature sequence189 390 1079 gene locus_tag LOCUS_10520 390 1079 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_10520 1259 2044 gene locus_tag LOCUS_10530 1259 2044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020502619.1 protein_id gnl|my_center|LOCUS_10530 2245 3519 gene locus_tag LOCUS_10540 2245 3519 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence190 <1 1114 gene locus_tag LOCUS_10550 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387742.1:methyltransferase regulatory domain-containing protein 1199 2509 gene locus_tag LOCUS_10560 gene hisD 1199 2509 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_10560 2506 3609 gene locus_tag LOCUS_10570 2506 3609 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence191 600 1421 gene locus_tag LOCUS_10580 600 1421 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_10580 1541 2707 gene locus_tag LOCUS_10590 1541 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 <3649 2766 gene locus_tag LOCUS_10600 <3649 2766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902082.1:sodium/pantothenate symporter >Feature sequence192 627 749 gene locus_tag LOCUS_10610 627 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 746 2584 gene locus_tag LOCUS_10620 746 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2604 3002 gene locus_tag LOCUS_10630 gene rbfA 2604 3002 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence193 <1 562 gene locus_tag LOCUS_10640 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000712231.1:YjiH family protein 2206 923 gene locus_tag LOCUS_10650 2206 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3020 2199 gene locus_tag LOCUS_10660 3020 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence194 373 137 gene locus_tag LOCUS_10670 373 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1460 387 gene locus_tag LOCUS_10680 1460 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2995 1463 gene locus_tag LOCUS_10690 2995 1463 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence195 997 1482 gene locus_tag LOCUS_10700 gene thiW 997 1482 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_10700 2249 3556 gene locus_tag LOCUS_10710 gene thiC 2249 3556 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence196 2958 1192 gene locus_tag LOCUS_10720 2958 1192 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence197 >Feature sequence198 <3620 2587 gene locus_tag LOCUS_10730 <3620 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005167439.1:anaerobic C4-dicarboxylate transporter >Feature sequence199 <1 990 gene locus_tag LOCUS_10740 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583398.1:AMIN domain-containing protein 1260 2102 gene locus_tag LOCUS_10750 1260 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2193 3299 gene locus_tag LOCUS_10760 2193 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence200 1092 886 gene locus_tag LOCUS_10770 1092 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1176 2720 gene locus_tag LOCUS_10780 1176 2720 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence201 268 1983 gene locus_tag LOCUS_10790 268 1983 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_10790 1985 2782 gene locus_tag LOCUS_10800 gene thiD 1985 2782 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence202 1011 1490 gene locus_tag LOCUS_10810 1011 1490 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016387.1 protein_id gnl|my_center|LOCUS_10810 2326 1517 gene locus_tag LOCUS_10820 2326 1517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_10820 3007 2336 gene locus_tag LOCUS_10830 3007 2336 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_10830 <3574 2991 gene locus_tag LOCUS_10840 <3574 2991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989899.1:mannose-6-phosphate isomerase, class I >Feature sequence203 <3569 1316 gene locus_tag LOCUS_10850 <3569 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037400800.1:calcium-binding protein >Feature sequence204 731 1366 gene locus_tag LOCUS_10860 731 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2374 1661 gene locus_tag LOCUS_10870 2374 1661 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682098.1 protein_id gnl|my_center|LOCUS_10870 <3566 2449 gene locus_tag LOCUS_10880 <3566 2449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130435197.1:ATP-binding protein >Feature sequence205 <1 765 gene locus_tag LOCUS_10890 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765720.1:dihydroorotate dehydrogenase 1089 841 gene locus_tag LOCUS_10900 1089 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2292 1102 gene locus_tag LOCUS_10910 gene gltS 2292 1102 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_10910 3426 2422 gene locus_tag LOCUS_10920 3426 2422 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence206 474 674 gene locus_tag LOCUS_10930 474 674 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920812.1 protein_id gnl|my_center|LOCUS_10930 780 2369 gene locus_tag LOCUS_10940 780 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3394 2375 gene locus_tag LOCUS_10950 3394 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence207 3474 271 gene locus_tag LOCUS_10960 3474 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence208 1446 484 gene locus_tag LOCUS_10970 gene pfkA 1446 484 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_10970 1609 2262 gene locus_tag LOCUS_10980 1609 2262 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_10980 2279 3046 gene locus_tag LOCUS_10990 2279 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence209 1827 814 gene locus_tag LOCUS_11000 gene aroF 1827 814 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_11000 2782 1961 gene locus_tag LOCUS_11010 2782 1961 CDS product MTAP family purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393347.1 protein_id gnl|my_center|LOCUS_11010 <3467 2779 gene locus_tag LOCUS_11020 <3467 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944692.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence210 <1 588 gene locus_tag LOCUS_11030 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286449.1:glucose-1-phosphate thymidylyltransferase RfbA 632 1231 gene locus_tag LOCUS_11040 632 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1171 1803 gene locus_tag LOCUS_11050 1171 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence211 1921 1169 gene locus_tag LOCUS_11060 1921 1169 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_11060 3050 1941 gene locus_tag LOCUS_11070 gene alr 3050 1941 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence212 2209 764 gene locus_tag LOCUS_11080 2209 764 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence213 567 178 gene locus_tag LOCUS_11090 567 178 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142305.1 protein_id gnl|my_center|LOCUS_11090 1151 567 gene locus_tag LOCUS_11100 1151 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1829 1479 gene locus_tag LOCUS_11110 1829 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 <3432 1830 gene locus_tag LOCUS_11120 <3432 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768340.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence214 647 291 gene locus_tag LOCUS_11130 647 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 835 653 gene locus_tag LOCUS_11140 835 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1068 832 gene locus_tag LOCUS_11150 1068 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1215 2021 gene locus_tag LOCUS_11160 1215 2021 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence215 <1 880 gene locus_tag LOCUS_11170 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808619.1:argininosuccinate synthase 898 1704 gene locus_tag LOCUS_11180 898 1704 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_11180 1716 3101 gene locus_tag LOCUS_11190 gene argH 1716 3101 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence216 1399 62 gene locus_tag LOCUS_11200 1399 62 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812351.1 protein_id gnl|my_center|LOCUS_11200 2226 1483 gene locus_tag LOCUS_11210 2226 1483 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_11210 3253 2273 gene locus_tag LOCUS_11220 3253 2273 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence217 74 2281 gene locus_tag LOCUS_11230 74 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence218 <1 1132 gene locus_tag LOCUS_11240 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875983.1:UDP-galactopyranose mutase 1129 1326 gene locus_tag LOCUS_11250 1129 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1358 1549 gene locus_tag LOCUS_11260 1358 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1604 2149 gene locus_tag LOCUS_11270 1604 2149 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814921.1 protein_id gnl|my_center|LOCUS_11270 2203 2397 gene locus_tag LOCUS_11280 2203 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2594 3244 gene locus_tag LOCUS_11290 2594 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence219 <1 932 gene locus_tag LOCUS_11300 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393939.1:elongation factor Tu 1201 1512 gene locus_tag LOCUS_11310 gene rpsJ 1201 1512 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_11310 1526 2176 gene locus_tag LOCUS_11320 gene rplC 1526 2176 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_11320 2201 2827 gene locus_tag LOCUS_11330 gene rplD 2201 2827 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_11330 2827 3108 gene locus_tag LOCUS_11340 gene rplW 2827 3108 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183022.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence220 1 1785 gene locus_tag LOCUS_11350 1 1785 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040347516.1 protein_id gnl|my_center|LOCUS_11350 2717 1848 gene locus_tag LOCUS_11360 2717 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 <3364 2752 gene locus_tag LOCUS_11370 <3364 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000821952.1:metallophosphoesterase family protein >Feature sequence221 127 387 gene locus_tag LOCUS_11380 127 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 489 1661 gene locus_tag LOCUS_11390 489 1661 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_11390 1658 2620 gene locus_tag LOCUS_11400 1658 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence222 3 281 gene locus_tag LOCUS_11410 3 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 368 1099 gene locus_tag LOCUS_11420 368 1099 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_11420 1161 1970 gene locus_tag LOCUS_11430 1161 1970 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_11430 2525 2049 gene locus_tag LOCUS_11440 2525 2049 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810233.1 protein_id gnl|my_center|LOCUS_11440 2648 3157 gene locus_tag LOCUS_11450 2648 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence223 496 2019 gene locus_tag LOCUS_11460 gene atpA 496 2019 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_11460 2033 3151 gene locus_tag LOCUS_11470 2033 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence224 964 491 gene locus_tag LOCUS_11480 gene ribE 964 491 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_11480 1813 983 gene locus_tag LOCUS_11490 1813 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3112 1907 gene locus_tag LOCUS_11500 3112 1907 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence225 817 92 gene locus_tag LOCUS_11510 817 92 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770693.1 protein_id gnl|my_center|LOCUS_11510 1649 909 gene locus_tag LOCUS_11520 1649 909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_11520 2027 1659 gene locus_tag LOCUS_11530 2027 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 <3330 2053 gene locus_tag LOCUS_11540 <3330 2053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986978.1:DUF4422 domain-containing protein >Feature sequence226 493 347 gene locus_tag LOCUS_11550 493 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1408 530 gene locus_tag LOCUS_11560 1408 530 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_11560 2193 1378 gene locus_tag LOCUS_11570 2193 1378 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_11570 3151 2183 gene locus_tag LOCUS_11580 3151 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence227 180 938 gene locus_tag LOCUS_11590 180 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1109 942 gene locus_tag LOCUS_11600 1109 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1520 1113 gene locus_tag LOCUS_11610 1520 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2185 1517 gene locus_tag LOCUS_11620 2185 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2778 2182 gene locus_tag LOCUS_11630 gene thyX 2778 2182 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_11630 3163 2765 gene locus_tag LOCUS_11640 3163 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence228 1940 1224 gene locus_tag LOCUS_11650 1940 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2953 1973 gene locus_tag LOCUS_11660 2953 1973 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence229 73 846 gene locus_tag LOCUS_11670 73 846 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_11670 987 1919 gene locus_tag LOCUS_11680 gene dusB 987 1919 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence230 367 1470 gene locus_tag LOCUS_11690 367 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1483 1749 gene locus_tag LOCUS_11700 1483 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1886 2701 gene locus_tag LOCUS_11710 1886 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2679 3077 gene locus_tag LOCUS_11720 2679 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence231 751 230 gene locus_tag LOCUS_11730 751 230 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_11730 1438 776 gene locus_tag LOCUS_11740 1438 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2529 1588 gene locus_tag LOCUS_11750 2529 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3268 2615 gene locus_tag LOCUS_11760 3268 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence232 1136 915 gene locus_tag LOCUS_11770 1136 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1741 1133 gene locus_tag LOCUS_11780 gene gmk 1741 1133 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965025.1 protein_id gnl|my_center|LOCUS_11780 2597 1782 gene locus_tag LOCUS_11790 gene dapF 2597 1782 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_11790 <3267 2656 gene locus_tag LOCUS_11800 <3267 2656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000645480.1:HXXEE domain-containing protein >Feature sequence233 1269 799 gene locus_tag LOCUS_11810 gene greA 1269 799 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_11810 2236 1511 gene locus_tag LOCUS_11820 2236 1511 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107872.1 protein_id gnl|my_center|LOCUS_11820 <3260 2460 gene locus_tag LOCUS_11830 <3260 2460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430304.1:YitT family protein >Feature sequence234 716 216 gene locus_tag LOCUS_11840 gene ruvC 716 216 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_11840 1947 727 gene locus_tag LOCUS_11850 1947 727 CDS product autotransporter strand-loop-strand O-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200982.1 protein_id gnl|my_center|LOCUS_11850 2671 1949 gene locus_tag LOCUS_11860 2671 1949 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460362.1 protein_id gnl|my_center|LOCUS_11860 3151 2687 gene locus_tag LOCUS_11870 3151 2687 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838770.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence235 840 43 gene locus_tag LOCUS_11880 840 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1832 840 gene locus_tag LOCUS_11890 1832 840 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_11890 2426 1866 gene locus_tag LOCUS_11900 2426 1866 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_11900 <3246 2423 gene locus_tag LOCUS_11910 <3246 2423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000859695.1:alpha/beta fold hydrolase >Feature sequence236 <3234 749 gene locus_tag LOCUS_11920 <3234 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037400800.1:calcium-binding protein >Feature sequence237 220 480 gene locus_tag LOCUS_11930 gene spoVS 220 480 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_11930 549 1373 gene locus_tag LOCUS_11940 549 1373 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_11940 2603 1431 gene locus_tag LOCUS_11950 gene dnaJ 2603 1431 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_11950 <3229 2685 gene locus_tag LOCUS_11960 <3229 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398786.1:molecular chaperone DnaK >Feature sequence238 <1 701 gene locus_tag LOCUS_11970 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein 2214 961 gene locus_tag LOCUS_11980 gene sstT 2214 961 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_11980 3170 2502 gene locus_tag LOCUS_11990 gene hisG 3170 2502 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence239 791 1783 gene locus_tag LOCUS_12000 791 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1817 2812 gene locus_tag LOCUS_12010 1817 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence240 1057 65 gene locus_tag LOCUS_12020 gene floA 1057 65 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_12020 1650 1087 gene locus_tag LOCUS_12030 1650 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2183 1647 gene locus_tag LOCUS_12040 2183 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 <3212 2190 gene locus_tag LOCUS_12050 <3212 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392040.1:long-chain fatty acid--CoA ligase >Feature sequence241 1262 75 gene locus_tag LOCUS_12060 gene metK 1262 75 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_12060 1472 2380 gene locus_tag LOCUS_12070 gene pfkB 1472 2380 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence242 <1 675 gene locus_tag LOCUS_12080 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263015.1:fructose-phosphate phosphohydrolase SppA 1909 653 gene locus_tag LOCUS_12090 1909 653 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_12090 2683 2012 gene locus_tag LOCUS_12100 2683 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence243 1321 137 gene locus_tag LOCUS_12110 1321 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2283 1318 gene locus_tag LOCUS_12120 2283 1318 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_12120 <3172 2331 gene locus_tag LOCUS_12130 <3172 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963353.1:DUF2142 domain-containing protein >Feature sequence244 <1 1263 gene locus_tag LOCUS_12140 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460903.1:aspartate ammonia-lyase 1331 2017 gene locus_tag LOCUS_12150 1331 2017 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869654.1 protein_id gnl|my_center|LOCUS_12150 2416 2066 gene locus_tag LOCUS_12160 2416 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_12160 3091 2828 gene locus_tag LOCUS_12170 3091 2828 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891710.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence245 68 562 gene locus_tag LOCUS_12180 gene nrdG 68 562 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_12180 566 862 gene locus_tag LOCUS_12190 566 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2010 1000 gene locus_tag LOCUS_12200 2010 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3071 2094 gene locus_tag LOCUS_12210 3071 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence246 280 128 gene locus_tag LOCUS_12220 280 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 871 320 gene locus_tag LOCUS_12230 871 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12230 1107 880 gene locus_tag LOCUS_12240 1107 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1886 1104 gene locus_tag LOCUS_12250 1886 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2002 2856 gene locus_tag LOCUS_12260 2002 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence247 721 1368 gene locus_tag LOCUS_12270 721 1368 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_12270 1418 2806 gene locus_tag LOCUS_12280 1418 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence248 586 1209 gene locus_tag LOCUS_12290 586 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence249 2152 803 gene locus_tag LOCUS_12300 2152 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3019 2327 gene locus_tag LOCUS_12310 3019 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence250 637 2016 gene locus_tag LOCUS_12320 637 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2016 2639 gene locus_tag LOCUS_12330 2016 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence251 >Feature sequence252 113 475 gene locus_tag LOCUS_12340 113 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 595 2523 gene locus_tag LOCUS_12350 595 2523 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence253 375 2090 gene locus_tag LOCUS_12360 375 2090 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 protein_id gnl|my_center|LOCUS_12360 2080 2916 gene locus_tag LOCUS_12370 2080 2916 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280060.1 protein_id gnl|my_center|LOCUS_12370 2973 3047 gene locus_tag LOCUS_t00130 2973 3047 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence254 258 52 gene locus_tag LOCUS_12380 258 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 772 272 gene locus_tag LOCUS_12390 gene rpsE 772 272 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_12390 1150 791 gene locus_tag LOCUS_12400 gene rplR 1150 791 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_12400 1594 1190 gene locus_tag LOCUS_12410 1594 1190 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671440.1 protein_id gnl|my_center|LOCUS_12410 2023 1625 gene locus_tag LOCUS_12420 2023 1625 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671440.1 protein_id gnl|my_center|LOCUS_12420 2663 2112 gene locus_tag LOCUS_12430 gene rplF 2663 2112 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence255 <1 1152 gene locus_tag LOCUS_12440 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870743.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 1355 2089 gene locus_tag LOCUS_12450 gene sufC 1355 2089 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence256 282 509 gene locus_tag LOCUS_12460 282 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 592 1218 gene locus_tag LOCUS_12470 592 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1238 1474 gene locus_tag LOCUS_12480 1238 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1577 2494 gene locus_tag LOCUS_12490 1577 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 <3026 2447 gene locus_tag LOCUS_12500 <3026 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211251.1:flavodoxin >Feature sequence257 982 275 gene locus_tag LOCUS_12510 982 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1780 989 gene locus_tag LOCUS_12520 gene flgG 1780 989 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_12520 1977 2921 gene locus_tag LOCUS_12530 1977 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence258 <1 1641 gene locus_tag LOCUS_12540 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048401.1:glutamine synthetase 2494 1655 gene locus_tag LOCUS_12550 2494 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 <3017 2491 gene locus_tag LOCUS_12560 <3017 2491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942116.1:2-oxoacid:acceptor oxidoreductase family protein >Feature sequence259 >Feature sequence260 851 177 gene locus_tag LOCUS_12570 851 177 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013857.1 protein_id gnl|my_center|LOCUS_12570 970 2313 gene locus_tag LOCUS_12580 970 2313 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459021.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence261 147 995 gene locus_tag LOCUS_12590 147 995 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_12590 1043 1118 gene locus_tag LOCUS_t00140 1043 1118 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2811 1543 gene locus_tag LOCUS_12600 2811 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence262 1605 772 gene locus_tag LOCUS_12610 1605 772 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_12610 2159 1647 gene locus_tag LOCUS_12620 gene lspA 2159 1647 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_12620 2923 2162 gene locus_tag LOCUS_12630 2923 2162 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476134.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence263 506 183 gene locus_tag LOCUS_12640 506 183 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_12640 955 503 gene locus_tag LOCUS_12650 955 503 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902778.1 protein_id gnl|my_center|LOCUS_12650 1625 972 gene locus_tag LOCUS_12660 1625 972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902779.1 protein_id gnl|my_center|LOCUS_12660 2778 1696 gene locus_tag LOCUS_12670 2778 1696 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671214.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence264 294 1010 gene locus_tag LOCUS_12680 294 1010 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903177.1 protein_id gnl|my_center|LOCUS_12680 1797 949 gene locus_tag LOCUS_12690 1797 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2857 1889 gene locus_tag LOCUS_12700 2857 1889 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399741.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence265 2016 331 gene locus_tag LOCUS_12710 gene tlpC 2016 331 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence266 1002 223 gene locus_tag LOCUS_12720 1002 223 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392418.1 protein_id gnl|my_center|LOCUS_12720 2890 1328 gene locus_tag LOCUS_12730 gene rqcH 2890 1328 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence267 2609 1416 gene locus_tag LOCUS_12740 2609 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence268 806 261 gene locus_tag LOCUS_12750 806 261 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_12750 1052 819 gene locus_tag LOCUS_12760 1052 819 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356779.1 protein_id gnl|my_center|LOCUS_12760 1361 1065 gene locus_tag LOCUS_12770 1361 1065 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_12770 2427 1498 gene locus_tag LOCUS_12780 gene trxB 2427 1498 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964187.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence269 2 1942 gene locus_tag LOCUS_12790 2 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1960 2700 gene locus_tag LOCUS_12800 1960 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence270 1591 971 gene locus_tag LOCUS_12810 1591 971 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_12810 1745 2701 gene locus_tag LOCUS_12820 1745 2701 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence271 1371 514 gene locus_tag LOCUS_12830 1371 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2214 1381 gene locus_tag LOCUS_12840 2214 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence272 1648 755 gene locus_tag LOCUS_12850 1648 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1809 1636 gene locus_tag LOCUS_12860 1809 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2227 1802 gene locus_tag LOCUS_12870 2227 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2349 2561 gene locus_tag LOCUS_12880 2349 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence273 <1 886 gene locus_tag LOCUS_12890 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964317.1:threonine synthase 2827 1040 gene locus_tag LOCUS_12900 2827 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence274 1784 84 gene locus_tag LOCUS_12910 1784 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2804 1875 gene locus_tag LOCUS_12920 gene bpeA 2804 1875 CDS product efflux RND transporter periplasmic adaptor BpeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197561.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence275 60 1079 gene locus_tag LOCUS_12930 60 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1101 1445 gene locus_tag LOCUS_12940 gene rsfS 1101 1445 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266441.1 protein_id gnl|my_center|LOCUS_12940 1459 2298 gene locus_tag LOCUS_12950 1459 2298 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214046.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence276 <1 1936 gene locus_tag LOCUS_12960 <1 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945439.1:preprotein translocase subunit SecA 1937 2152 gene locus_tag LOCUS_12970 1937 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2168 2455 gene locus_tag LOCUS_12980 2168 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2468 2722 gene locus_tag LOCUS_12990 2468 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence277 1976 33 gene locus_tag LOCUS_13000 1976 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2346 1996 gene locus_tag LOCUS_13010 2346 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 >Feature sequence278 <1 1008 gene locus_tag LOCUS_13020 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723899.1:PIN/TRAM domain-containing protein >Feature sequence279 1143 265 gene locus_tag LOCUS_13030 1143 265 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_13030 2097 1144 gene locus_tag LOCUS_13040 2097 1144 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949061.1 protein_id gnl|my_center|LOCUS_13040 2220 2573 gene locus_tag LOCUS_13050 2220 2573 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence280 <1 893 gene locus_tag LOCUS_13060 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869824.1:ATP-dependent chaperone ClpB 1357 2706 gene locus_tag LOCUS_13070 1357 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence281 <1 692 gene locus_tag LOCUS_13080 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964082.1:NAD(P)-dependent oxidoreductase 1038 1361 gene locus_tag LOCUS_13090 1038 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence282 <1 889 gene locus_tag LOCUS_13100 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005420308.1:chemotaxis response regulator protein-glutamate methylesterase note possible pseudo, internal stop codon 893 1054 gene locus_tag LOCUS_13110 893 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 >Feature sequence283 215 1144 gene locus_tag LOCUS_13120 215 1144 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309545.1 protein_id gnl|my_center|LOCUS_13120 <2786 1279 gene locus_tag LOCUS_13130 <2786 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048268.1:peptide chain release factor 3 >Feature sequence284 768 1892 gene locus_tag LOCUS_13140 768 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 <2782 2139 gene locus_tag LOCUS_13150 <2782 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947933.1:polysaccharide deacetylase family protein >Feature sequence285 693 70 gene locus_tag LOCUS_13160 gene gmhA 693 70 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_13160 1167 781 gene locus_tag LOCUS_13170 1167 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1756 1244 gene locus_tag LOCUS_13180 1756 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2331 1855 gene locus_tag LOCUS_13190 2331 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence286 107 1108 gene locus_tag LOCUS_13200 107 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1257 2408 gene locus_tag LOCUS_13210 1257 2408 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence287 766 380 gene locus_tag LOCUS_13220 766 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1132 1959 gene locus_tag LOCUS_13230 1132 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <2759 2252 gene locus_tag LOCUS_13240 <2759 2252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817232.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence288 <1 729 gene locus_tag LOCUS_13250 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392140.1:glycine--tRNA ligase subunit alpha >Feature sequence289 <1 612 gene locus_tag LOCUS_13260 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein 824 1099 gene locus_tag LOCUS_13270 824 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence290 <1 1071 gene locus_tag LOCUS_13280 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454642.1:toxic anion resistance protein >Feature sequence291 <1 843 gene locus_tag LOCUS_13290 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392478.1:amidohydrolase 1369 2202 gene locus_tag LOCUS_13300 1369 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence292 490 651 gene locus_tag LOCUS_13310 490 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1793 696 gene locus_tag LOCUS_13320 gene ychF 1793 696 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence293 1679 813 gene locus_tag LOCUS_13330 1679 813 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_13330 1935 1669 gene locus_tag LOCUS_13340 1935 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence294 <2707 240 gene locus_tag LOCUS_13350 <2707 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein >Feature sequence295 59 2617 gene locus_tag LOCUS_13360 gene mutS 59 2617 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence296 1417 140 gene locus_tag LOCUS_13370 gene obgE 1417 140 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence297 400 1257 gene locus_tag LOCUS_13380 400 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1285 1650 gene locus_tag LOCUS_13390 gene folB 1285 1650 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853806.1 protein_id gnl|my_center|LOCUS_13390 1718 2629 gene locus_tag LOCUS_13400 1718 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence298 1687 839 gene locus_tag LOCUS_13410 1687 839 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_13410 2208 1684 gene locus_tag LOCUS_13420 gene lepB 2208 1684 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence299 823 1665 gene locus_tag LOCUS_13430 gene hpnK 823 1665 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_13430 1670 1885 gene locus_tag LOCUS_13440 1670 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1882 2265 gene locus_tag LOCUS_13450 1882 2265 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011019287.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence300 <1 793 gene locus_tag LOCUS_13460 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002656446.1:flagellar motor switch protein FliM 783 2015 gene locus_tag LOCUS_13470 gene fliY 783 2015 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392326.1 protein_id gnl|my_center|LOCUS_13470 2127 2489 gene locus_tag LOCUS_13480 2127 2489 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence301 1558 2184 gene locus_tag LOCUS_13490 1558 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2233 2324 gene locus_tag LOCUS_t00150 2233 2324 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence302 71 268 gene locus_tag LOCUS_13500 71 268 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674407.1 protein_id gnl|my_center|LOCUS_13500 281 562 gene locus_tag LOCUS_13510 281 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 577 1791 gene locus_tag LOCUS_13520 gene tyrS 577 1791 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 protein_id gnl|my_center|LOCUS_13520 1849 2439 gene locus_tag LOCUS_13530 1849 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence303 1856 1074 gene locus_tag LOCUS_13540 gene hisA 1856 1074 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_13540 2344 1853 gene locus_tag LOCUS_13550 2344 1853 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence304 491 2401 gene locus_tag LOCUS_13560 491 2401 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence305 >Feature sequence306 2174 1029 gene locus_tag LOCUS_13570 gene waaF 2174 1029 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence307 1101 163 gene locus_tag LOCUS_13580 1101 163 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_13580 2510 1128 gene locus_tag LOCUS_13590 2510 1128 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_13590 1711 1639 gene locus_tag LOCUS_t00160 1711 1639 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence308 184 495 gene locus_tag LOCUS_13600 184 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 847 1143 gene locus_tag LOCUS_13610 847 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2580 1198 gene locus_tag LOCUS_13620 2580 1198 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812211.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence309 <1 911 gene locus_tag LOCUS_13630 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943823.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence310 1722 739 gene locus_tag LOCUS_13640 1722 739 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808265.1 protein_id gnl|my_center|LOCUS_13640 <2562 1774 gene locus_tag LOCUS_13650 <2562 1774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583490.1:PBP1A family penicillin-binding protein >Feature sequence311 336 103 gene locus_tag LOCUS_13660 336 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1599 346 gene locus_tag LOCUS_13670 1599 346 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671216.1 protein_id gnl|my_center|LOCUS_13670 2275 1718 gene locus_tag LOCUS_13680 2275 1718 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212053.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence312 2 817 gene locus_tag LOCUS_13690 2 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 907 2187 gene locus_tag LOCUS_13700 907 2187 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence313 >Feature sequence314 <1 597 gene locus_tag LOCUS_13710 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965910.1:ComEC/Rec2 family competence protein 614 1600 gene locus_tag LOCUS_13720 614 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1617 1865 gene locus_tag LOCUS_13730 1617 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence315 1530 700 gene locus_tag LOCUS_13740 1530 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2046 1624 gene locus_tag LOCUS_13750 2046 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2377 2231 gene locus_tag LOCUS_13760 gene scfA 2377 2231 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence316 <1 711 gene locus_tag LOCUS_13770 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392654.1:D-alanine--D-alanine ligase 771 1508 gene locus_tag LOCUS_13780 771 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1875 2453 gene locus_tag LOCUS_13790 1875 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence317 757 1605 gene locus_tag LOCUS_13800 gene rfbD 757 1605 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 protein_id gnl|my_center|LOCUS_13800 1767 1958 gene locus_tag LOCUS_13810 gene rpmB 1767 1958 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence318 962 195 gene locus_tag LOCUS_13820 962 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1310 1113 gene locus_tag LOCUS_13830 1310 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 <2489 1329 gene locus_tag LOCUS_13840 <2489 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001020785.1:ADP-forming succinate--CoA ligase subunit beta >Feature sequence319 100 25 gene locus_tag LOCUS_t00170 100 25 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 339 488 gene locus_tag LOCUS_13850 339 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence320 <1 1929 gene locus_tag LOCUS_13860 <1 1929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101267.1:NAD-dependent DNA ligase LigA >Feature sequence321 1120 401 gene locus_tag LOCUS_13870 1120 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1859 1209 gene locus_tag LOCUS_13880 1859 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2040 2300 gene locus_tag LOCUS_13890 2040 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence322 611 222 gene locus_tag LOCUS_13900 611 222 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_13900 1792 668 gene locus_tag LOCUS_13910 1792 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence323 144 1529 gene locus_tag LOCUS_13920 gene hslU 144 1529 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550088.1 protein_id gnl|my_center|LOCUS_13920 <2445 1695 gene locus_tag LOCUS_13930 <2445 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966271.1:TatD family hydrolase >Feature sequence324 190 390 gene locus_tag LOCUS_13940 190 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 395 1180 gene locus_tag LOCUS_13950 395 1180 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695696.1 protein_id gnl|my_center|LOCUS_13950 1270 2310 gene locus_tag LOCUS_13960 1270 2310 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880036.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence325 392 1498 gene locus_tag LOCUS_13970 gene nagZ 392 1498 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_13970 1514 1807 gene locus_tag LOCUS_13980 1514 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence326 1053 481 gene locus_tag LOCUS_13990 1053 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 <2422 1127 gene locus_tag LOCUS_14000 <2422 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942598.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence327 248 757 gene locus_tag LOCUS_14010 248 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 775 1176 gene locus_tag LOCUS_14020 775 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1166 1543 gene locus_tag LOCUS_14030 1166 1543 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence328 1194 166 gene locus_tag LOCUS_14040 gene waaC 1194 166 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_14040 1661 1191 gene locus_tag LOCUS_14050 gene rfaE2 1661 1191 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_14050 <2417 1704 gene locus_tag LOCUS_14060 <2417 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272448.1:phosphate acyltransferase PlsX >Feature sequence329 175 864 gene locus_tag LOCUS_14070 175 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 857 1603 gene locus_tag LOCUS_14080 857 1603 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964682.1 protein_id gnl|my_center|LOCUS_14080 1770 1946 gene locus_tag LOCUS_14090 1770 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1985 2353 gene locus_tag LOCUS_14100 1985 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence330 1219 206 gene locus_tag LOCUS_14110 1219 206 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_14110 1973 1197 gene locus_tag LOCUS_14120 gene modA 1973 1197 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence331 1708 131 gene locus_tag LOCUS_14130 1708 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 <2406 1710 gene locus_tag LOCUS_14140 <2406 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965562.1:serine hydroxymethyltransferase >Feature sequence332 141 1079 gene locus_tag LOCUS_14150 141 1079 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048331.1 protein_id gnl|my_center|LOCUS_14150 1093 1497 gene locus_tag LOCUS_14160 1093 1497 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437466.1 protein_id gnl|my_center|LOCUS_14160 1575 2123 gene locus_tag LOCUS_14170 1575 2123 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357373.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence333 <1 569 gene locus_tag LOCUS_14180 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870741.1:acetyl-CoA carboxylase biotin carboxylase subunit 586 885 gene locus_tag LOCUS_14190 586 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14190 988 1326 gene locus_tag LOCUS_14200 988 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2196 1345 gene locus_tag LOCUS_14210 gene speE 2196 1345 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence334 1383 724 gene locus_tag LOCUS_14220 1383 724 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence335 369 2144 gene locus_tag LOCUS_14230 gene uvrC 369 2144 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence336 >Feature sequence337 <1 513 gene locus_tag LOCUS_14240 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436250.1:pyruvate kinase 634 1125 gene locus_tag LOCUS_14250 634 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence338 19 753 gene locus_tag LOCUS_14260 gene sufC 19 753 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_14260 750 2144 gene locus_tag LOCUS_14270 gene sufB 750 2144 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence339 <2365 125 gene locus_tag LOCUS_14280 <2365 125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393251.1:phenylalanine--tRNA ligase subunit beta >Feature sequence340 133 690 gene locus_tag LOCUS_14290 gene hpt 133 690 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981838.1 protein_id gnl|my_center|LOCUS_14290 749 1225 gene locus_tag LOCUS_14300 749 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1222 1383 gene locus_tag LOCUS_14310 1222 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence341 2134 1202 gene locus_tag LOCUS_14320 gene fabD 2134 1202 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence342 1983 280 gene locus_tag LOCUS_14330 1983 280 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225156.1 protein_id gnl|my_center|LOCUS_14330 2209 2015 gene locus_tag LOCUS_14340 2209 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence343 370 1245 gene locus_tag LOCUS_14350 370 1245 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356507.1 protein_id gnl|my_center|LOCUS_14350 <2347 1365 gene locus_tag LOCUS_14360 <2347 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393179.1:histidine--tRNA ligase >Feature sequence344 1101 583 gene locus_tag LOCUS_14370 1101 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2056 1115 gene locus_tag LOCUS_14380 gene fliH 2056 1115 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096786.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence345 131 268 gene locus_tag LOCUS_14390 131 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 414 1475 gene locus_tag LOCUS_14400 414 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2316 1441 gene locus_tag LOCUS_14410 2316 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence346 918 992 gene locus_tag LOCUS_t00180 918 992 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1058 1942 gene locus_tag LOCUS_14420 1058 1942 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817328.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence347 837 1082 gene locus_tag LOCUS_14430 837 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1088 2077 gene locus_tag LOCUS_14440 1088 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2074 2250 gene locus_tag LOCUS_14450 2074 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence348 1470 742 gene locus_tag LOCUS_14460 1470 742 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_14460 2202 1492 gene locus_tag LOCUS_14470 2202 1492 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404569.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence349 588 2228 gene locus_tag LOCUS_14480 588 2228 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence350 <1 1050 gene locus_tag LOCUS_14490 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817317.1:chaperonin GroEL 2156 1161 gene locus_tag LOCUS_14500 2156 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence351 943 452 gene locus_tag LOCUS_14510 943 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2004 940 gene locus_tag LOCUS_14520 2004 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence352 1885 659 gene locus_tag LOCUS_14530 1885 659 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence353 >Feature sequence354 >Feature sequence355 311 1042 gene locus_tag LOCUS_14540 311 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1056 1895 gene locus_tag LOCUS_14550 1056 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence356 50 790 gene locus_tag LOCUS_14560 50 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1795 890 gene locus_tag LOCUS_14570 1795 890 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence357 >Feature sequence358 755 1474 gene locus_tag LOCUS_14580 755 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1584 2054 gene locus_tag LOCUS_14590 1584 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence359 1388 114 gene locus_tag LOCUS_14600 1388 114 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861472.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence360 <1 544 gene locus_tag LOCUS_14610 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272513.1:flagellin 708 2204 gene locus_tag LOCUS_14620 gene lysS 708 2204 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence361 131 1996 gene locus_tag LOCUS_14630 gene mnmG 131 1996 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence362 <1 1966 gene locus_tag LOCUS_14640 <1 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence363 2235 223 gene locus_tag LOCUS_14650 2235 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence364 2232 508 gene locus_tag LOCUS_14660 2232 508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence365 708 1883 gene locus_tag LOCUS_14670 708 1883 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence366 219 878 gene locus_tag LOCUS_14680 219 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 914 1372 gene locus_tag LOCUS_14690 914 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence367 30 224 gene locus_tag LOCUS_14700 30 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 230 1879 gene locus_tag LOCUS_14710 230 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence368 <1 941 gene locus_tag LOCUS_14720 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002724361.1:calcium-binding protein >Feature sequence369 1029 1463 gene locus_tag LOCUS_14730 1029 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence370 780 220 gene locus_tag LOCUS_14740 780 220 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136487.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence371 1170 541 gene locus_tag LOCUS_14750 gene trmB 1170 541 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889910.1 protein_id gnl|my_center|LOCUS_14750 <2186 1142 gene locus_tag LOCUS_14760 <2186 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392848.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence372 2177 1158 gene locus_tag LOCUS_14770 2177 1158 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071849.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence373 201 1541 gene locus_tag LOCUS_14780 gene hlyD 201 1541 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391779.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence374 <1 763 gene locus_tag LOCUS_14790 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000900828.1:5-deoxy-glucuronate isomerase >Feature sequence375 204 1166 gene locus_tag LOCUS_14800 204 1166 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085528.1 protein_id gnl|my_center|LOCUS_14800 1233 1946 gene locus_tag LOCUS_14810 1233 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence376 192 794 gene locus_tag LOCUS_14820 gene clpP 192 794 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_14820 861 2123 gene locus_tag LOCUS_14830 gene clpX 861 2123 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence377 1206 16 gene locus_tag LOCUS_14840 gene trpB 1206 16 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_14840 1790 1203 gene locus_tag LOCUS_14850 1790 1203 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence378 <1 657 gene locus_tag LOCUS_14860 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869054.1:acetyl-CoA hydrolase/transferase family protein 691 975 gene locus_tag LOCUS_14870 691 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1012 1614 gene locus_tag LOCUS_14880 1012 1614 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966586.1 protein_id gnl|my_center|LOCUS_14880 1713 2126 gene locus_tag LOCUS_14890 gene mce 1713 2126 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence379 635 1036 gene locus_tag LOCUS_14900 635 1036 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence380 457 2037 gene locus_tag LOCUS_14910 gene pnbA 457 2037 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence381 621 301 gene locus_tag LOCUS_14920 621 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044391358.1 protein_id gnl|my_center|LOCUS_14920 1360 542 gene locus_tag LOCUS_14930 1360 542 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236089.1 protein_id gnl|my_center|LOCUS_14930 1992 1357 gene locus_tag LOCUS_14940 1992 1357 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence382 <1 638 gene locus_tag LOCUS_14950 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436320.1:anaerobic ribonucleoside triphosphate reductase 1457 687 gene locus_tag LOCUS_14960 1457 687 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434038.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence383 >Feature sequence384 61 1398 gene locus_tag LOCUS_14970 gene der 61 1398 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence385 315 1811 gene locus_tag LOCUS_14980 gene glpK 315 1811 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732584.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence386 >Feature sequence387 318 1988 gene locus_tag LOCUS_14990 318 1988 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence388 >Feature sequence389 <1 715 gene locus_tag LOCUS_15000 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890959.1:UTP--glucose-1-phosphate uridylyltransferase GalU 708 1919 gene locus_tag LOCUS_15010 gene dpaL 708 1919 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence390 110 937 gene locus_tag LOCUS_15020 gene pgeF 110 937 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence391 729 127 gene locus_tag LOCUS_15030 gene ccmA 729 127 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_15030 1391 726 gene locus_tag LOCUS_15040 1391 726 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence392 >Feature sequence393 312 1520 gene locus_tag LOCUS_15050 312 1520 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_15050 1525 1872 gene locus_tag LOCUS_15060 1525 1872 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054380.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence394 1092 490 gene locus_tag LOCUS_15070 gene nadD 1092 490 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_15070 1354 1214 gene locus_tag LOCUS_15080 1354 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 <2054 1354 gene locus_tag LOCUS_15090 <2054 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009932313.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence395 98 2014 gene locus_tag LOCUS_15100 98 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence396 159 803 gene locus_tag LOCUS_15110 gene minC 159 803 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_15110 876 1667 gene locus_tag LOCUS_15120 gene minD 876 1667 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_15120 1680 1946 gene locus_tag LOCUS_15130 gene minE 1680 1946 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392080.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence397 <1 807 gene locus_tag LOCUS_15140 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454871.1:ATP-dependent DNA helicase RecG 1800 856 gene locus_tag LOCUS_15150 1800 856 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence398 741 163 gene locus_tag LOCUS_15160 741 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1346 738 gene locus_tag LOCUS_15170 1346 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2042 1782 gene locus_tag LOCUS_15180 2042 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence399 <1 965 gene locus_tag LOCUS_15190 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966712.1:TFIIB-type zinc ribbon-containing protein 978 1748 gene locus_tag LOCUS_15200 978 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence400 316 705 gene locus_tag LOCUS_15210 316 705 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721969.1 protein_id gnl|my_center|LOCUS_15210 1189 830 gene locus_tag LOCUS_15220 1189 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 <2027 1173 gene locus_tag LOCUS_15230 <2027 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949033.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence401 228 764 gene locus_tag LOCUS_15240 gene hslV 228 764 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence402 >Feature sequence403 92 1390 gene locus_tag LOCUS_15250 92 1390 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_15250 1403 1714 gene locus_tag LOCUS_15260 1403 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence404 >Feature sequence405 >Feature sequence406 1306 77 gene locus_tag LOCUS_15270 1306 77 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_15270 1483 1395 gene locus_tag LOCUS_t00190 1483 1395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1785 1597 gene locus_tag LOCUS_15280 1785 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence407 93 1163 gene locus_tag LOCUS_15290 93 1163 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_15290 1165 1875 gene locus_tag LOCUS_15300 1165 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence408 <1 1812 gene locus_tag LOCUS_15310 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000729064.1:nitrate reductase subunit alpha >Feature sequence409 <1 1061 gene locus_tag LOCUS_15320 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461052.1:DUF445 domain-containing protein 1058 1840 gene locus_tag LOCUS_15330 gene murI 1058 1840 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence410 549 166 gene locus_tag LOCUS_15340 549 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 661 1392 gene locus_tag LOCUS_15350 661 1392 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence411 1239 940 gene locus_tag LOCUS_15360 1239 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence412 1106 291 gene locus_tag LOCUS_15370 1106 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1359 1078 gene locus_tag LOCUS_15380 1359 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1778 1371 gene locus_tag LOCUS_15390 1778 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence413 318 1424 gene locus_tag LOCUS_15400 318 1424 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_15400 1449 1787 gene locus_tag LOCUS_15410 gene rplQ 1449 1787 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459109.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence414 <1976 1275 gene locus_tag LOCUS_15420 <1976 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814910.1:NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit >Feature sequence415 <1976 994 gene locus_tag LOCUS_15430 <1976 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338726.1:calcium-binding protein >Feature sequence416 760 1338 gene locus_tag LOCUS_15440 760 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence417 <1967 183 gene locus_tag LOCUS_15450 <1967 183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714181.1:VapE family protein >Feature sequence418 1840 398 gene locus_tag LOCUS_15460 gene gatB 1840 398 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence419 <1 1218 gene locus_tag LOCUS_15470 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014748675.1:DNA polymerase I 1571 1284 gene locus_tag LOCUS_15480 1571 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence420 173 1021 gene locus_tag LOCUS_15490 173 1021 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence421 <1 1377 gene locus_tag LOCUS_15500 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902545.1:c-di-GMP phosphodiesterase PdcA 1397 1837 gene locus_tag LOCUS_15510 1397 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence422 1255 446 gene locus_tag LOCUS_15520 1255 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1399 1641 gene locus_tag LOCUS_15530 1399 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence423 >Feature sequence424 977 312 gene locus_tag LOCUS_15540 977 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence425 <1 889 gene locus_tag LOCUS_15550 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101851.1:Gfo/Idh/MocA family oxidoreductase <1925 1080 gene locus_tag LOCUS_15560 <1925 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037396632.1:NAD+ synthase >Feature sequence426 >Feature sequence427 <1 539 gene locus_tag LOCUS_15570 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256414.1:type II secretion system F family protein >Feature sequence428 227 1078 gene locus_tag LOCUS_15580 gene ubiA 227 1078 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_15580 <1921 1137 gene locus_tag LOCUS_15590 <1921 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035214046.1:S1-like domain-containing RNA-binding protein >Feature sequence429 <1914 210 gene locus_tag LOCUS_15600 <1914 210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175076.1:PTS mannitol transporter subunit IICBA >Feature sequence430 >Feature sequence431 >Feature sequence432 <1 694 gene locus_tag LOCUS_15610 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244150.1:ABC-F family ATP-binding cassette domain-containing protein 708 1076 gene locus_tag LOCUS_15620 gene aroH 708 1076 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924600.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence433 1118 915 gene locus_tag LOCUS_15630 1118 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1652 1152 gene locus_tag LOCUS_15640 1652 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence434 84 1037 gene locus_tag LOCUS_15650 84 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1034 1396 gene locus_tag LOCUS_15660 1034 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1421 1594 gene locus_tag LOCUS_15670 1421 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence435 >Feature sequence436 408 124 gene locus_tag LOCUS_15680 408 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1152 562 gene locus_tag LOCUS_15690 1152 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence437 360 1616 gene locus_tag LOCUS_15700 gene secY 360 1616 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence438 129 578 gene locus_tag LOCUS_15710 129 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 589 1467 gene locus_tag LOCUS_15720 589 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence439 <1 737 gene locus_tag LOCUS_15730 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272494.1:molybdopterin molybdotransferase MoeA 734 1084 gene locus_tag LOCUS_15740 734 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15740 1148 1702 gene locus_tag LOCUS_15750 1148 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15750 >Feature sequence440 53 1342 gene locus_tag LOCUS_15760 53 1342 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence441 >Feature sequence442 1073 417 gene locus_tag LOCUS_15770 1073 417 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_15770 <1866 1048 gene locus_tag LOCUS_15780 <1866 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000017090.1:type II secretion system secretin GspD >Feature sequence443 <1846 212 gene locus_tag LOCUS_15790 <1846 212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047858.1:type I DNA topoisomerase >Feature sequence444 428 1216 gene locus_tag LOCUS_15800 428 1216 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 protein_id gnl|my_center|LOCUS_15800 1241 1642 gene locus_tag LOCUS_15810 1241 1642 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477396.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence445 <1 709 gene locus_tag LOCUS_15820 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392103.1:bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK 751 1770 gene locus_tag LOCUS_15830 751 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence446 404 652 gene locus_tag LOCUS_15840 404 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 746 1324 gene locus_tag LOCUS_15850 746 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15850 >Feature sequence447 449 1714 gene locus_tag LOCUS_15860 gene aroA 449 1714 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence448 276 830 gene locus_tag LOCUS_15870 276 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence449 200 562 gene locus_tag LOCUS_15880 200 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 801 1112 gene locus_tag LOCUS_15890 gene rpsJ 801 1112 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_15890 1126 1776 gene locus_tag LOCUS_15900 gene rplC 1126 1776 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence450 1367 21 gene locus_tag LOCUS_15910 1367 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence451 1176 1637 gene locus_tag LOCUS_15920 1176 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence452 >Feature sequence453 109 399 gene locus_tag LOCUS_15930 gene gatC 109 399 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_15930 403 1212 gene locus_tag LOCUS_15940 gene budA 403 1212 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966250.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence454 <1798 581 gene locus_tag LOCUS_15950 <1798 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256949.1:STAS domain-containing protein >Feature sequence455 1205 108 gene locus_tag LOCUS_15960 1205 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15960 >Feature sequence456 50 508 gene locus_tag LOCUS_15970 50 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 505 1707 gene locus_tag LOCUS_15980 505 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence457 257 1003 gene locus_tag LOCUS_15990 gene sdhB 257 1003 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_15990 1329 1054 gene locus_tag LOCUS_16000 1329 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence458 <1 844 gene locus_tag LOCUS_16010 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680398.1:AmmeMemoRadiSam system protein A 860 1081 gene locus_tag LOCUS_16020 860 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence459 <1 533 gene locus_tag LOCUS_16030 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546828.1:A24 family peptidase <1782 831 gene locus_tag LOCUS_16040 <1782 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006996423.1:Na+/H+ antiporter NhaC family protein >Feature sequence460 1418 144 gene locus_tag LOCUS_16050 1418 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence461 245 87 gene locus_tag LOCUS_16060 245 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16060 762 313 gene locus_tag LOCUS_16070 762 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1564 776 gene locus_tag LOCUS_16080 1564 776 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence462 121 1065 gene locus_tag LOCUS_16090 121 1065 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence463 212 1027 gene locus_tag LOCUS_16100 gene rsmI 212 1027 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267808.1 protein_id gnl|my_center|LOCUS_16100 1029 1370 gene locus_tag LOCUS_16110 1029 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence464 1773 1525 gene locus_tag LOCUS_16120 1773 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence465 >Feature sequence466 <1765 316 gene locus_tag LOCUS_16130 <1765 316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392357.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence467 1560 139 gene locus_tag LOCUS_16140 gene narH 1560 139 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692661.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence468 <1 944 gene locus_tag LOCUS_16150 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000748469.1:ABC transporter substrate-binding protein >Feature sequence469 431 1711 gene locus_tag LOCUS_16160 431 1711 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence470 1102 107 gene locus_tag LOCUS_16170 1102 107 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_16170 <1749 1153 gene locus_tag LOCUS_16180 <1749 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980934.1:iron-regulated protein FrpC >Feature sequence471 2 1444 gene locus_tag LOCUS_16190 2 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence472 >Feature sequence473 >Feature sequence474 <1 1054 gene locus_tag LOCUS_16200 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460907.1:valine--tRNA ligase >Feature sequence475 <1 704 gene locus_tag LOCUS_16210 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000071041.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU 795 1697 gene locus_tag LOCUS_16220 795 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence476 1419 940 gene locus_tag LOCUS_16230 1419 940 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence477 >Feature sequence478 959 30 gene locus_tag LOCUS_16240 959 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 <1720 970 gene locus_tag LOCUS_16250 <1720 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398643.1:acetolactate synthase large subunit >Feature sequence479 833 1453 gene locus_tag LOCUS_16260 833 1453 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence480 <1 515 gene locus_tag LOCUS_16270 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392101.1:nicotinate-nucleotide adenylyltransferase 520 1365 gene locus_tag LOCUS_16280 520 1365 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682246.1 protein_id gnl|my_center|LOCUS_16280 1574 1696 gene locus_tag LOCUS_16290 1574 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence481 206 18 gene locus_tag LOCUS_16300 206 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16300 1002 178 gene locus_tag LOCUS_16310 1002 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16310 1474 995 gene locus_tag LOCUS_16320 1474 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence482 >Feature sequence483 259 1623 gene locus_tag LOCUS_16330 gene mnmE 259 1623 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393757.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence484 >Feature sequence485 >Feature sequence486 1050 1397 gene locus_tag LOCUS_16340 1050 1397 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence487 >Feature sequence488 <1 549 gene locus_tag LOCUS_16350 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810195.1:50S ribosomal protein L10 580 954 gene locus_tag LOCUS_16360 gene rplL 580 954 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_16360 1080 1156 gene locus_tag LOCUS_t00200 1080 1156 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1172 1247 gene locus_tag LOCUS_t00210 1172 1247 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence489 1520 201 gene locus_tag LOCUS_16370 1520 201 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392281.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence490 <1680 315 gene locus_tag LOCUS_16380 <1680 315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein >Feature sequence491 156 851 gene locus_tag LOCUS_16390 156 851 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_16390 844 1209 gene locus_tag LOCUS_16400 844 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1518 1210 gene locus_tag LOCUS_16410 1518 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1671 1528 gene locus_tag LOCUS_16420 1671 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence492 1641 211 gene locus_tag LOCUS_16430 gene gatA 1641 211 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence493 1234 347 gene locus_tag LOCUS_16440 1234 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence494 82 825 gene locus_tag LOCUS_16450 gene deoD 82 825 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255010.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence495 139 807 gene locus_tag LOCUS_16460 139 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1203 889 gene locus_tag LOCUS_16470 1203 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence496 >Feature sequence497 <1650 887 gene locus_tag LOCUS_16480 <1650 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966527.1:glutamate 5-kinase >Feature sequence498 1460 861 gene locus_tag LOCUS_16490 1460 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence499 <1 1419 gene locus_tag LOCUS_16500 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001143843.1:DEAD/DEAH box helicase family protein >Feature sequence500 1607 1029 gene locus_tag LOCUS_16510 1607 1029 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence501 >Feature sequence502 2 937 gene locus_tag LOCUS_16520 gene thrB 2 937 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_16520 1256 924 gene locus_tag LOCUS_16530 1256 924 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence503 65 856 gene locus_tag LOCUS_16540 65 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence504 853 89 gene locus_tag LOCUS_16550 gene cobK 853 89 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 protein_id gnl|my_center|LOCUS_16550 951 1394 gene locus_tag LOCUS_16560 951 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence505 <1 762 gene locus_tag LOCUS_16570 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288363.1:DNA replication/repair protein RecF >Feature sequence506 <1 517 gene locus_tag LOCUS_16580 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140198.1:1-deoxy-D-xylulose-5-phosphate synthase 514 1308 gene locus_tag LOCUS_16590 514 1308 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence507 >Feature sequence508 145 285 gene locus_tag LOCUS_16600 145 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 403 1503 gene locus_tag LOCUS_16610 403 1503 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16610 >Feature sequence509 278 1468 gene locus_tag LOCUS_16620 gene wlbF 278 1468 CDS product O-antigen biosynthesis aminotransferase WlbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853419.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence510 1191 400 gene locus_tag LOCUS_16630 1191 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16630 1479 1261 gene locus_tag LOCUS_16640 1479 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence511 >Feature sequence512 928 506 gene locus_tag LOCUS_16650 928 506 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906378.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence513 327 1400 gene locus_tag LOCUS_16660 327 1400 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832304.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence514 139 516 gene locus_tag LOCUS_16670 139 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 529 1458 gene locus_tag LOCUS_16680 529 1458 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence515 <1 754 gene locus_tag LOCUS_16690 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222142.1:aspartate aminotransferase family protein 741 1415 gene locus_tag LOCUS_16700 741 1415 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314298.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence516 >Feature sequence517 >Feature sequence518 >Feature sequence519 1245 97 gene locus_tag LOCUS_16710 1245 97 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence520 1146 13 gene locus_tag LOCUS_16720 1146 13 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence521 551 973 gene locus_tag LOCUS_16730 551 973 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_16730 1022 1339 gene locus_tag LOCUS_16740 1022 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence522 <1 654 gene locus_tag LOCUS_16750 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000700204.1:alpha/beta hydrolase >Feature sequence523 <1 708 gene locus_tag LOCUS_16760 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393542.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence524 87 287 gene locus_tag LOCUS_16770 gene rpmE 87 287 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_16770 649 1536 gene locus_tag LOCUS_16780 649 1536 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence525 50 1366 gene locus_tag LOCUS_16790 50 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence526 <1553 240 gene locus_tag LOCUS_16800 <1553 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989642.1:L-fucose/L-arabinose isomerase family protein >Feature sequence527 106 1308 gene locus_tag LOCUS_16810 106 1308 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903449.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence528 >Feature sequence529 >Feature sequence530 1502 1188 gene locus_tag LOCUS_16820 1502 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence531 1494 880 gene locus_tag LOCUS_16830 1494 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence532 >Feature sequence533 <1 1174 gene locus_tag LOCUS_16840 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234027.1:myo-inositol transporter IolT >Feature sequence534 >Feature sequence535 255 1490 gene locus_tag LOCUS_16850 gene ftsZ 255 1490 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence536 285 1406 gene locus_tag LOCUS_16860 gene ald 285 1406 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence537 838 566 gene locus_tag LOCUS_16870 838 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence538 <1 980 gene locus_tag LOCUS_16880 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268199.1:type I secretion system permease/ATPase