>Feature sequence001 1330 176 gene locus_tag LOCUS_00010 1330 176 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_00010 3402 1477 gene locus_tag LOCUS_00020 3402 1477 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_00020 4039 3404 gene locus_tag LOCUS_00030 4039 3404 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_00030 5454 4087 gene locus_tag LOCUS_00040 5454 4087 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_00040 5795 6307 gene locus_tag LOCUS_00050 5795 6307 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015829.1 protein_id gnl|my_center|LOCUS_00050 7549 6356 gene locus_tag LOCUS_00060 7549 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8684 7551 gene locus_tag LOCUS_00070 8684 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9364 8846 gene locus_tag LOCUS_00080 9364 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10542 9523 gene locus_tag LOCUS_00090 gene rfbB 10542 9523 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_00090 11824 10592 gene locus_tag LOCUS_00100 11824 10592 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_00100 12903 11821 gene locus_tag LOCUS_00110 12903 11821 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_00110 13860 12955 gene locus_tag LOCUS_00120 gene rfbA 13860 12955 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068370.1 protein_id gnl|my_center|LOCUS_00120 14773 13925 gene locus_tag LOCUS_00130 14773 13925 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876594.1 protein_id gnl|my_center|LOCUS_00130 15286 14783 gene locus_tag LOCUS_00140 15286 14783 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_00140 16454 15306 gene locus_tag LOCUS_00150 16454 15306 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_00150 17625 16465 gene locus_tag LOCUS_00160 17625 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19058 17649 gene locus_tag LOCUS_00170 19058 17649 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_00170 19980 19048 gene locus_tag LOCUS_00180 19980 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_00180 21290 19992 gene locus_tag LOCUS_00190 21290 19992 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_00190 22270 21308 gene locus_tag LOCUS_00200 22270 21308 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_00200 23581 22283 gene locus_tag LOCUS_00210 23581 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24606 23599 gene locus_tag LOCUS_00220 24606 23599 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_00220 25912 24623 gene locus_tag LOCUS_00230 25912 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27117 26014 gene locus_tag LOCUS_00240 27117 26014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28307 27177 gene locus_tag LOCUS_00250 gene rffA 28307 27177 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_00250 30068 28320 gene locus_tag LOCUS_00260 30068 28320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31647 30088 gene locus_tag LOCUS_00270 31647 30088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202254.1 protein_id gnl|my_center|LOCUS_00270 32619 31696 gene locus_tag LOCUS_00280 32619 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33730 32621 gene locus_tag LOCUS_00290 33730 32621 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_00290 34743 33727 gene locus_tag LOCUS_00300 34743 33727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35295 34747 gene locus_tag LOCUS_00310 35295 34747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36377 35292 gene locus_tag LOCUS_00320 gene wecB 36377 35292 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 protein_id gnl|my_center|LOCUS_00320 37112 36390 gene locus_tag LOCUS_00330 37112 36390 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_00330 37932 37126 gene locus_tag LOCUS_00340 gene epsE 37932 37126 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_00340 38923 37949 gene locus_tag LOCUS_00350 38923 37949 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_00350 40301 38997 gene locus_tag LOCUS_00360 40301 38997 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_00360 41118 40303 gene locus_tag LOCUS_00370 gene epsE 41118 40303 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_00370 42213 41128 gene locus_tag LOCUS_00380 42213 41128 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_00380 43324 42206 gene locus_tag LOCUS_00390 43324 42206 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107244.1 protein_id gnl|my_center|LOCUS_00390 44488 43346 gene locus_tag LOCUS_00400 44488 43346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45420 44488 gene locus_tag LOCUS_00410 45420 44488 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_00410 46432 45494 gene locus_tag LOCUS_00420 46432 45494 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_00420 47458 46436 gene locus_tag LOCUS_00430 47458 46436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48401 47460 gene locus_tag LOCUS_00440 48401 47460 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246289.1 protein_id gnl|my_center|LOCUS_00440 48803 48573 gene locus_tag LOCUS_00450 48803 48573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00450 49563 48859 gene locus_tag LOCUS_00460 49563 48859 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922203.1 protein_id gnl|my_center|LOCUS_00460 50954 49824 gene locus_tag LOCUS_00470 50954 49824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 52014 51460 gene locus_tag LOCUS_00480 52014 51460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence002 <1 617 gene locus_tag LOCUS_00490 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048076.1:histidine--tRNA ligase 610 2400 gene locus_tag LOCUS_00500 gene aspS 610 2400 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_00500 2472 3050 gene locus_tag LOCUS_00510 2472 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3200 3580 gene locus_tag LOCUS_00520 3200 3580 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_00520 3573 4481 gene locus_tag LOCUS_00530 3573 4481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_00530 4450 6666 gene locus_tag LOCUS_00540 4450 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7235 6732 gene locus_tag LOCUS_00550 7235 6732 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_00550 9052 7343 gene locus_tag LOCUS_00560 9052 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 11614 9068 gene locus_tag LOCUS_00570 gene gyrA 11614 9068 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_00570 13681 11678 gene locus_tag LOCUS_00580 gene gyrB 13681 11678 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_00580 13941 13678 gene locus_tag LOCUS_00590 13941 13678 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_00590 15061 13964 gene locus_tag LOCUS_00600 gene recF 15061 13964 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_00600 15267 15058 gene locus_tag LOCUS_00610 gene yaaA 15267 15058 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_00610 16372 15269 gene locus_tag LOCUS_00620 gene dnaN 16372 15269 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_00620 17932 16601 gene locus_tag LOCUS_00630 gene dnaA 17932 16601 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00630 18271 18405 gene locus_tag LOCUS_00640 gene rpmH 18271 18405 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_00640 18414 18764 gene locus_tag LOCUS_00650 gene rnpA 18414 18764 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_00650 19002 19988 gene locus_tag LOCUS_00660 19002 19988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 20027 20992 gene locus_tag LOCUS_00670 20027 20992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 >Feature sequence003 77 250 gene locus_tag LOCUS_00680 77 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 258 953 gene locus_tag LOCUS_00690 258 953 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_00690 953 1432 gene locus_tag LOCUS_00700 953 1432 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_00700 1787 1617 gene locus_tag LOCUS_00710 1787 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 1929 3197 gene locus_tag LOCUS_00720 1929 3197 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434259.1 protein_id gnl|my_center|LOCUS_00720 3417 4928 gene locus_tag LOCUS_00730 3417 4928 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_00730 4986 5297 gene locus_tag LOCUS_00740 4986 5297 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_00740 5372 6337 gene locus_tag LOCUS_00750 5372 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 7386 6508 gene locus_tag LOCUS_00760 7386 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9506 7923 gene locus_tag LOCUS_00770 9506 7923 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_00770 9985 10058 gene locus_tag LOCUS_t00010 9985 10058 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10534 11001 gene locus_tag LOCUS_00780 10534 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 11011 11331 gene locus_tag LOCUS_00790 11011 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 11348 11536 gene locus_tag LOCUS_00800 11348 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 11571 11756 gene locus_tag LOCUS_00810 11571 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11812 12012 gene locus_tag LOCUS_00820 11812 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 12002 12391 gene locus_tag LOCUS_00830 12002 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 12983 13378 gene locus_tag LOCUS_00840 12983 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 13766 13563 gene locus_tag LOCUS_00850 13766 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 14913 13819 gene locus_tag LOCUS_00860 14913 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 15542 14910 gene locus_tag LOCUS_00870 15542 14910 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_00870 15680 16831 gene locus_tag LOCUS_00880 15680 16831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 16856 17545 gene locus_tag LOCUS_00890 16856 17545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_00890 17538 19034 gene locus_tag LOCUS_00900 17538 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 19147 20400 gene locus_tag LOCUS_00910 19147 20400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_00910 20852 20469 gene locus_tag LOCUS_00920 20852 20469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 21193 20918 gene locus_tag LOCUS_00930 21193 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 <21706 21196 gene locus_tag LOCUS_00940 <21706 21196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941578.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence004 24 794 gene locus_tag LOCUS_00950 24 794 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_00950 841 1674 gene locus_tag LOCUS_00960 841 1674 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202934.1 protein_id gnl|my_center|LOCUS_00960 1678 2772 gene locus_tag LOCUS_00970 1678 2772 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_00970 3373 3161 gene locus_tag LOCUS_00980 3373 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 4111 5010 gene locus_tag LOCUS_00990 gene rfbA 4111 5010 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_00990 5160 5435 gene locus_tag LOCUS_01000 5160 5435 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_01000 5569 6588 gene locus_tag LOCUS_01010 gene rfbB 5569 6588 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_01010 7156 8439 gene locus_tag LOCUS_01020 7156 8439 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739314.1 protein_id gnl|my_center|LOCUS_01020 8510 9076 gene locus_tag LOCUS_01030 8510 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 9323 9931 gene locus_tag LOCUS_01040 9323 9931 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_01040 10098 11228 gene locus_tag LOCUS_01050 10098 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 11231 12403 gene locus_tag LOCUS_01060 11231 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 13179 12667 gene locus_tag LOCUS_01070 gene cobO 13179 12667 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251080.1 protein_id gnl|my_center|LOCUS_01070 13533 14903 gene locus_tag LOCUS_01080 13533 14903 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_01080 14908 15582 gene locus_tag LOCUS_01090 14908 15582 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_01090 15585 17510 gene locus_tag LOCUS_01100 15585 17510 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_01100 17659 18810 gene locus_tag LOCUS_01110 17659 18810 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence005 249 791 gene locus_tag LOCUS_01120 249 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1367 1762 gene locus_tag LOCUS_01130 gene nusB 1367 1762 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_01130 1762 2709 gene locus_tag LOCUS_01140 1762 2709 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_01140 2688 3896 gene locus_tag LOCUS_01150 gene xseA 2688 3896 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_01150 3899 4084 gene locus_tag LOCUS_01160 3899 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4081 4962 gene locus_tag LOCUS_01170 4081 4962 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_01170 5065 6924 gene locus_tag LOCUS_01180 gene dxs 5065 6924 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_01180 6917 7717 gene locus_tag LOCUS_01190 6917 7717 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_01190 7717 8592 gene locus_tag LOCUS_01200 7717 8592 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_01200 8625 9077 gene locus_tag LOCUS_01210 8625 9077 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_01210 9088 10758 gene locus_tag LOCUS_01220 gene recN 9088 10758 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_01220 10745 11971 gene locus_tag LOCUS_01230 gene tyrS 10745 11971 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_01230 13502 12228 gene locus_tag LOCUS_01240 13502 12228 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_01240 13592 14866 gene locus_tag LOCUS_01250 13592 14866 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967022.1 protein_id gnl|my_center|LOCUS_01250 14847 15431 gene locus_tag LOCUS_01260 14847 15431 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_01260 15424 15894 gene locus_tag LOCUS_01270 15424 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01270 15907 16362 gene locus_tag LOCUS_01280 15907 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 16395 18317 gene locus_tag LOCUS_01290 16395 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence006 1150 437 gene locus_tag LOCUS_01300 gene rsmG 1150 437 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_01300 2120 1143 gene locus_tag LOCUS_01310 2120 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01310 3020 2214 gene locus_tag LOCUS_01320 3020 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01320 4259 3027 gene locus_tag LOCUS_01330 gene mnmE 4259 3027 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_01330 4393 4256 gene locus_tag LOCUS_01340 4393 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01340 5429 4464 gene locus_tag LOCUS_01350 5429 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 6457 5471 gene locus_tag LOCUS_01360 6457 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7045 6695 gene locus_tag LOCUS_01370 gene rnpA 7045 6695 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_01370 7192 7058 gene locus_tag LOCUS_01380 gene rpmH 7192 7058 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_01380 7538 8866 gene locus_tag LOCUS_01390 gene dnaA 7538 8866 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_01390 9087 10190 gene locus_tag LOCUS_01400 gene dnaN 9087 10190 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_01400 10192 10401 gene locus_tag LOCUS_01410 gene yaaA 10192 10401 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359394.1 protein_id gnl|my_center|LOCUS_01410 10398 11504 gene locus_tag LOCUS_01420 gene recF 10398 11504 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_01420 11544 11807 gene locus_tag LOCUS_01430 11544 11807 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_01430 11804 13807 gene locus_tag LOCUS_01440 gene gyrB 11804 13807 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_01440 13868 16423 gene locus_tag LOCUS_01450 gene gyrA 13868 16423 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_01450 16439 18148 gene locus_tag LOCUS_01460 16439 18148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 >Feature sequence007 <1 512 gene locus_tag LOCUS_01470 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223493.1:class I mannose-6-phosphate isomerase 509 1369 gene locus_tag LOCUS_01480 509 1369 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704926.1 protein_id gnl|my_center|LOCUS_01480 2280 1537 gene locus_tag LOCUS_01490 2280 1537 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_01490 3440 2388 gene locus_tag LOCUS_01500 3440 2388 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_01500 4076 3459 gene locus_tag LOCUS_01510 4076 3459 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_01510 4764 4228 gene locus_tag LOCUS_01520 4764 4228 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_01520 6349 5123 gene locus_tag LOCUS_01530 6349 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 7231 6362 gene locus_tag LOCUS_01540 7231 6362 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966513.1 protein_id gnl|my_center|LOCUS_01540 10312 7232 gene locus_tag LOCUS_01550 gene lacZ 10312 7232 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_01550 12157 10439 gene locus_tag LOCUS_01560 12157 10439 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_01560 12353 13885 gene locus_tag LOCUS_01570 12353 13885 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_01570 13886 14551 gene locus_tag LOCUS_01580 13886 14551 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948055.1 protein_id gnl|my_center|LOCUS_01580 14564 15124 gene locus_tag LOCUS_01590 14564 15124 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948056.1 protein_id gnl|my_center|LOCUS_01590 15190 15501 gene locus_tag LOCUS_01600 gene trxA 15190 15501 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_01600 15559 16209 gene locus_tag LOCUS_01610 15559 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 17396 16257 gene locus_tag LOCUS_01620 gene spoIVA 17396 16257 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence008 185 451 gene locus_tag LOCUS_01630 185 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1395 868 gene locus_tag LOCUS_01640 1395 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2348 1413 gene locus_tag LOCUS_01650 2348 1413 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_01650 4599 2350 gene locus_tag LOCUS_01660 4599 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 5008 4592 gene locus_tag LOCUS_01670 5008 4592 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_01670 6243 5254 gene locus_tag LOCUS_01680 6243 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6389 6580 gene locus_tag LOCUS_01690 6389 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6601 6777 gene locus_tag LOCUS_01700 6601 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6814 9093 gene locus_tag LOCUS_01710 6814 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 9215 9451 gene locus_tag LOCUS_01720 9215 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9464 9712 gene locus_tag LOCUS_01730 9464 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 9899 10798 gene locus_tag LOCUS_01740 9899 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 10830 10994 gene locus_tag LOCUS_01750 10830 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 11074 12732 gene locus_tag LOCUS_01760 11074 12732 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_01760 12856 13956 gene locus_tag LOCUS_01770 12856 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 15385 14273 gene locus_tag LOCUS_01780 15385 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 16653 15361 gene locus_tag LOCUS_01790 16653 15361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 16800 17099 gene locus_tag LOCUS_01800 16800 17099 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence009 1549 554 gene locus_tag LOCUS_01810 1549 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 1995 1741 gene locus_tag LOCUS_01820 1995 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 2058 3101 gene locus_tag LOCUS_01830 gene ylbJ 2058 3101 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965047.1 protein_id gnl|my_center|LOCUS_01830 3293 3096 gene locus_tag LOCUS_01840 3293 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 3754 3290 gene locus_tag LOCUS_01850 3754 3290 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_01850 3822 4025 gene locus_tag LOCUS_01860 3822 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4081 4347 gene locus_tag LOCUS_01870 4081 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 4344 4646 gene locus_tag LOCUS_01880 4344 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 5273 4695 gene locus_tag LOCUS_01890 5273 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5534 6337 gene locus_tag LOCUS_01900 gene thiT 5534 6337 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246588.1 protein_id gnl|my_center|LOCUS_01900 7602 6619 gene locus_tag LOCUS_01910 7602 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8656 7715 gene locus_tag LOCUS_01920 8656 7715 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017005.1 protein_id gnl|my_center|LOCUS_01920 10326 8857 gene locus_tag LOCUS_01930 10326 8857 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_01930 11062 10478 gene locus_tag LOCUS_01940 11062 10478 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_01940 12730 11390 gene locus_tag LOCUS_01950 12730 11390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_01950 14386 13595 gene locus_tag LOCUS_01960 14386 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 15465 14581 gene locus_tag LOCUS_01970 15465 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 15804 15598 gene locus_tag LOCUS_01980 15804 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 17030 15810 gene locus_tag LOCUS_01990 17030 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence010 1444 737 gene locus_tag LOCUS_02000 1444 737 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_02000 1946 1728 gene locus_tag LOCUS_02010 1946 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 2204 4576 gene locus_tag LOCUS_02020 2204 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 5305 4673 gene locus_tag LOCUS_02030 5305 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 5478 5305 gene locus_tag LOCUS_02040 5478 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5840 5478 gene locus_tag LOCUS_02050 5840 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6965 7363 gene locus_tag LOCUS_02060 6965 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7783 8451 gene locus_tag LOCUS_02070 7783 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 8528 8824 gene locus_tag LOCUS_02080 8528 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 9030 9500 gene locus_tag LOCUS_02090 9030 9500 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_02090 10459 9746 gene locus_tag LOCUS_02100 10459 9746 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294400.1 protein_id gnl|my_center|LOCUS_02100 10614 11114 gene locus_tag LOCUS_02110 10614 11114 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_02110 11101 11748 gene locus_tag LOCUS_02120 11101 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 11781 12239 gene locus_tag LOCUS_02130 11781 12239 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_02130 12249 12617 gene locus_tag LOCUS_02140 12249 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 13103 12669 gene locus_tag LOCUS_02150 13103 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 13474 13274 gene locus_tag LOCUS_02160 13474 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 13742 15061 gene locus_tag LOCUS_02170 13742 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 15065 15241 gene locus_tag LOCUS_02180 15065 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence011 1257 388 gene locus_tag LOCUS_02190 gene cdaA 1257 388 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_02190 2456 1311 gene locus_tag LOCUS_02200 2456 1311 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_02200 2670 2440 gene locus_tag LOCUS_02210 2670 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3632 3165 gene locus_tag LOCUS_02220 gene ispF 3632 3165 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_02220 5354 3687 gene locus_tag LOCUS_02230 5354 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7117 5429 gene locus_tag LOCUS_02240 7117 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 7659 7584 gene locus_tag LOCUS_t00020 7659 7584 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7813 8514 gene locus_tag LOCUS_02250 7813 8514 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012644897.1 protein_id gnl|my_center|LOCUS_02250 9244 8564 gene locus_tag LOCUS_02260 9244 8564 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421533.1 protein_id gnl|my_center|LOCUS_02260 10689 9892 gene locus_tag LOCUS_02270 10689 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11315 10704 gene locus_tag LOCUS_02280 11315 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02280 11810 11388 gene locus_tag LOCUS_02290 11810 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02290 12782 11844 gene locus_tag LOCUS_02300 12782 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 14201 12846 gene locus_tag LOCUS_02310 14201 12846 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_02310 14839 14342 gene locus_tag LOCUS_02320 14839 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence012 298 224 gene locus_tag LOCUS_t00030 298 224 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 542 315 gene locus_tag LOCUS_02330 542 315 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_02330 2434 1346 gene locus_tag LOCUS_02340 2434 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3073 2471 gene locus_tag LOCUS_02350 3073 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3449 3189 gene locus_tag LOCUS_02360 3449 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 3777 3607 gene locus_tag LOCUS_02370 3777 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 4265 3795 gene locus_tag LOCUS_02380 4265 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6634 4592 gene locus_tag LOCUS_02390 6634 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7336 6647 gene locus_tag LOCUS_02400 7336 6647 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963408.1 protein_id gnl|my_center|LOCUS_02400 7787 7302 gene locus_tag LOCUS_02410 7787 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 8439 7798 gene locus_tag LOCUS_02420 8439 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9054 8464 gene locus_tag LOCUS_02430 9054 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 9846 9097 gene locus_tag LOCUS_02440 9846 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 12557 9876 gene locus_tag LOCUS_02450 12557 9876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775498.1 protein_id gnl|my_center|LOCUS_02450 13490 12885 gene locus_tag LOCUS_02460 13490 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 13766 14083 gene locus_tag LOCUS_02470 13766 14083 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_02470 14891 14382 gene locus_tag LOCUS_02480 14891 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence013 93 1313 gene locus_tag LOCUS_02490 93 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1677 3002 gene locus_tag LOCUS_02500 1677 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3645 3968 gene locus_tag LOCUS_02510 3645 3968 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513548.1 protein_id gnl|my_center|LOCUS_02510 3973 4284 gene locus_tag LOCUS_02520 3973 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4593 5036 gene locus_tag LOCUS_02530 4593 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105305154.1 protein_id gnl|my_center|LOCUS_02530 6600 6400 gene locus_tag LOCUS_02540 6600 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7073 8632 gene locus_tag LOCUS_02550 7073 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 9081 9812 gene locus_tag LOCUS_02560 9081 9812 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_02560 9809 10591 gene locus_tag LOCUS_02570 9809 10591 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535365.1 protein_id gnl|my_center|LOCUS_02570 10592 11509 gene locus_tag LOCUS_02580 10592 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 11601 12590 gene locus_tag LOCUS_02590 11601 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 12592 13281 gene locus_tag LOCUS_02600 12592 13281 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_02600 13278 14378 gene locus_tag LOCUS_02610 13278 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 14727 14521 gene locus_tag LOCUS_02620 14727 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence014 341 3763 gene locus_tag LOCUS_02630 341 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 3907 3833 gene locus_tag LOCUS_t00040 3907 3833 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4890 3973 gene locus_tag LOCUS_02640 4890 3973 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_02640 5317 5544 gene locus_tag LOCUS_02650 5317 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5804 6493 gene locus_tag LOCUS_02660 5804 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 8078 6834 gene locus_tag LOCUS_02670 8078 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8255 9952 gene locus_tag LOCUS_02680 8255 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 10183 11727 gene locus_tag LOCUS_02690 10183 11727 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_02690 11720 12343 gene locus_tag LOCUS_02700 11720 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12343 13026 gene locus_tag LOCUS_02710 12343 13026 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_02710 13339 14166 gene locus_tag LOCUS_02720 13339 14166 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477258.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence015 1331 165 gene locus_tag LOCUS_02730 gene ftsW 1331 165 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965425.1 protein_id gnl|my_center|LOCUS_02730 2511 1408 gene locus_tag LOCUS_02740 gene mraY 2511 1408 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_02740 3874 2504 gene locus_tag LOCUS_02750 3874 2504 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_02750 5310 3871 gene locus_tag LOCUS_02760 5310 3871 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_02760 7738 5477 gene locus_tag LOCUS_02770 7738 5477 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_02770 8307 7846 gene locus_tag LOCUS_02780 8307 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9252 8332 gene locus_tag LOCUS_02790 gene rsmH 9252 8332 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_02790 9718 9242 gene locus_tag LOCUS_02800 9718 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 10534 10019 gene locus_tag LOCUS_02810 10534 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258265.1 protein_id gnl|my_center|LOCUS_02810 11049 10564 gene locus_tag LOCUS_02820 gene coaD 11049 10564 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_02820 11586 11053 gene locus_tag LOCUS_02830 gene rsmD 11586 11053 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_02830 13513 11690 gene locus_tag LOCUS_02840 gene uvrC 13513 11690 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence016 908 252 gene locus_tag LOCUS_02850 908 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1009 1084 gene locus_tag LOCUS_t00050 1009 1084 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2342 1473 gene locus_tag LOCUS_02860 2342 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2436 3020 gene locus_tag LOCUS_02870 2436 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3013 3636 gene locus_tag LOCUS_02880 gene lacA 3013 3636 CDS product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640105.1 protein_id gnl|my_center|LOCUS_02880 3722 3994 gene locus_tag LOCUS_02890 3722 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4583 4302 gene locus_tag LOCUS_02900 4583 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4994 5923 gene locus_tag LOCUS_02910 4994 5923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_02910 5936 6994 gene locus_tag LOCUS_02920 5936 6994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_02920 7007 8020 gene locus_tag LOCUS_02930 7007 8020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_02930 8020 9000 gene locus_tag LOCUS_02940 8020 9000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_02940 9085 10899 gene locus_tag LOCUS_02950 9085 10899 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_02950 11141 11623 gene locus_tag LOCUS_02960 11141 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12180 11719 gene locus_tag LOCUS_02970 12180 11719 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861387.1 protein_id gnl|my_center|LOCUS_02970 12539 12180 gene locus_tag LOCUS_02980 12539 12180 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423973.1 protein_id gnl|my_center|LOCUS_02980 13511 12963 gene locus_tag LOCUS_02990 13511 12963 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933856.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence017 3630 2587 gene locus_tag LOCUS_03000 gene ispG 3630 2587 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_03000 4694 3627 gene locus_tag LOCUS_03010 gene rseP 4694 3627 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_03010 5856 4708 gene locus_tag LOCUS_03020 5856 4708 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_03020 6755 5853 gene locus_tag LOCUS_03030 6755 5853 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 protein_id gnl|my_center|LOCUS_03030 7489 6755 gene locus_tag LOCUS_03040 7489 6755 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_03040 8052 7489 gene locus_tag LOCUS_03050 gene frr 8052 7489 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_03050 8826 8125 gene locus_tag LOCUS_03060 gene pyrH 8826 8125 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_03060 9844 9653 gene locus_tag LOCUS_03070 9844 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 10526 10074 gene locus_tag LOCUS_03080 10526 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 10593 10784 gene locus_tag LOCUS_03090 10593 10784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 10748 11002 gene locus_tag LOCUS_03100 10748 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 12489 11374 gene locus_tag LOCUS_03110 12489 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 12921 12514 gene locus_tag LOCUS_03120 12921 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence018 771 307 gene locus_tag LOCUS_03130 771 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 1898 768 gene locus_tag LOCUS_03140 1898 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2281 1895 gene locus_tag LOCUS_03150 2281 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2475 2281 gene locus_tag LOCUS_03160 2475 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2964 2485 gene locus_tag LOCUS_03170 2964 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3890 2961 gene locus_tag LOCUS_03180 3890 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4030 6957 gene locus_tag LOCUS_03190 4030 6957 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_03190 7232 8410 gene locus_tag LOCUS_03200 7232 8410 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_03200 10261 8531 gene locus_tag LOCUS_03210 10261 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 10959 10279 gene locus_tag LOCUS_03220 10959 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 11047 12435 gene locus_tag LOCUS_03230 gene dacF 11047 12435 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence019 367 179 gene locus_tag LOCUS_03240 367 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1420 650 gene locus_tag LOCUS_03250 1420 650 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_03250 1665 2231 gene locus_tag LOCUS_03260 1665 2231 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068193.1 protein_id gnl|my_center|LOCUS_03260 4239 2398 gene locus_tag LOCUS_03270 4239 2398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_03270 6953 4236 gene locus_tag LOCUS_03280 6953 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 7398 6946 gene locus_tag LOCUS_03290 7398 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8921 7638 gene locus_tag LOCUS_03300 8921 7638 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361811.1 protein_id gnl|my_center|LOCUS_03300 10239 8932 gene locus_tag LOCUS_03310 10239 8932 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_03310 11220 10486 gene locus_tag LOCUS_03320 11220 10486 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence020 355 4437 gene locus_tag LOCUS_03330 355 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 4530 4706 gene locus_tag LOCUS_03340 4530 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 5013 5135 gene locus_tag LOCUS_03350 5013 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5135 5440 gene locus_tag LOCUS_03360 5135 5440 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_03360 5829 5461 gene locus_tag LOCUS_03370 5829 5461 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_03370 6474 7283 gene locus_tag LOCUS_03380 6474 7283 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_03380 7283 7699 gene locus_tag LOCUS_03390 7283 7699 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774961.1 protein_id gnl|my_center|LOCUS_03390 7763 8764 gene locus_tag LOCUS_03400 7763 8764 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 protein_id gnl|my_center|LOCUS_03400 8777 9424 gene locus_tag LOCUS_03410 8777 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10338 9472 gene locus_tag LOCUS_03420 10338 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 11109 10357 gene locus_tag LOCUS_03430 11109 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 11848 11411 gene locus_tag LOCUS_03440 11848 11411 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776018.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence021 7602 6682 gene locus_tag LOCUS_03450 7602 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 8202 7615 gene locus_tag LOCUS_03460 8202 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 8380 8195 gene locus_tag LOCUS_03470 8380 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 10614 8380 gene locus_tag LOCUS_03480 10614 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 11029 10589 gene locus_tag LOCUS_03490 11029 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11303 11088 gene locus_tag LOCUS_03500 11303 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence022 1405 260 gene locus_tag LOCUS_03510 gene ytvI 1405 260 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_03510 1570 2784 gene locus_tag LOCUS_03520 1570 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4579 2834 gene locus_tag LOCUS_03530 4579 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4747 6210 gene locus_tag LOCUS_03540 4747 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 7015 6329 gene locus_tag LOCUS_03550 7015 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 7129 7290 gene locus_tag LOCUS_03560 7129 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7814 8752 gene locus_tag LOCUS_03570 7814 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 9015 9158 gene locus_tag LOCUS_03580 9015 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 10351 9371 gene locus_tag LOCUS_03590 10351 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 11742 10771 gene locus_tag LOCUS_03600 11742 10771 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017005.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence023 1883 1119 gene locus_tag LOCUS_03610 1883 1119 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_03610 2580 1984 gene locus_tag LOCUS_03620 gene spoIIR 2580 1984 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_03620 3521 2661 gene locus_tag LOCUS_03630 gene ispE 3521 2661 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_03630 4692 3511 gene locus_tag LOCUS_03640 4692 3511 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_03640 5171 4689 gene locus_tag LOCUS_03650 5171 4689 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_03650 5351 5572 gene locus_tag LOCUS_03660 5351 5572 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_03660 6251 5643 gene locus_tag LOCUS_03670 6251 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 6432 7478 gene locus_tag LOCUS_03680 gene mltG 6432 7478 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440261.1 protein_id gnl|my_center|LOCUS_03680 7564 7716 gene locus_tag LOCUS_03690 7564 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 9521 7779 gene locus_tag LOCUS_03700 9521 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10219 9542 gene locus_tag LOCUS_03710 10219 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 10356 11744 gene locus_tag LOCUS_03720 gene dacB 10356 11744 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252638.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence024 1094 465 gene locus_tag LOCUS_03730 gene vraR 1094 465 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830439.1 protein_id gnl|my_center|LOCUS_03730 2656 1421 gene locus_tag LOCUS_03740 2656 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4317 2656 gene locus_tag LOCUS_03750 4317 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4780 5787 gene locus_tag LOCUS_03760 4780 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 6217 5978 gene locus_tag LOCUS_03770 6217 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6632 7018 gene locus_tag LOCUS_03780 6632 7018 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080932.1 protein_id gnl|my_center|LOCUS_03780 7011 7901 gene locus_tag LOCUS_03790 7011 7901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_03790 7888 10119 gene locus_tag LOCUS_03800 7888 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 10339 10863 gene locus_tag LOCUS_03810 10339 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence025 444 190 gene locus_tag LOCUS_03820 444 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1310 450 gene locus_tag LOCUS_03830 1310 450 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048193.1 protein_id gnl|my_center|LOCUS_03830 2286 1315 gene locus_tag LOCUS_03840 gene dusB 2286 1315 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_03840 2408 4999 gene locus_tag LOCUS_03850 gene polA 2408 4999 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_03850 4978 5433 gene locus_tag LOCUS_03860 gene rimI 4978 5433 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_03860 5430 6449 gene locus_tag LOCUS_03870 gene tsaD 5430 6449 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964219.1 protein_id gnl|my_center|LOCUS_03870 6591 8366 gene locus_tag LOCUS_03880 6591 8366 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_03880 8951 8721 gene locus_tag LOCUS_03890 8951 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 11016 9577 gene locus_tag LOCUS_03900 gene proS 11016 9577 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence026 264 824 gene locus_tag LOCUS_03910 264 824 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_03910 808 1773 gene locus_tag LOCUS_03920 808 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2011 1748 gene locus_tag LOCUS_03930 2011 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2436 3401 gene locus_tag LOCUS_03940 gene fba 2436 3401 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_03940 3775 4260 gene locus_tag LOCUS_03950 3775 4260 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_03950 4295 5107 gene locus_tag LOCUS_03960 4295 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325235.1 protein_id gnl|my_center|LOCUS_03960 5785 5165 gene locus_tag LOCUS_03970 5785 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6568 6200 gene locus_tag LOCUS_03980 6568 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7293 6646 gene locus_tag LOCUS_03990 7293 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8318 7404 gene locus_tag LOCUS_04000 8318 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10415 8400 gene locus_tag LOCUS_04010 10415 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence027 378 1652 gene locus_tag LOCUS_04020 378 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 1987 2454 gene locus_tag LOCUS_04030 1987 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2504 3028 gene locus_tag LOCUS_04040 2504 3028 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_04040 5219 3519 gene locus_tag LOCUS_04050 5219 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5890 5216 gene locus_tag LOCUS_04060 5890 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 7102 6239 gene locus_tag LOCUS_04070 7102 6239 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_04070 7783 7103 gene locus_tag LOCUS_04080 7783 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 8837 8226 gene locus_tag LOCUS_04090 8837 8226 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_04090 8926 9684 gene locus_tag LOCUS_04100 gene pdaB 8926 9684 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 protein_id gnl|my_center|LOCUS_04100 10069 10503 gene locus_tag LOCUS_04110 10069 10503 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence028 2198 1602 gene locus_tag LOCUS_04120 2198 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4651 2195 gene locus_tag LOCUS_04130 4651 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6208 4733 gene locus_tag LOCUS_04140 6208 4733 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_04140 7671 6235 gene locus_tag LOCUS_04150 7671 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 8400 7681 gene locus_tag LOCUS_04160 8400 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10078 8855 gene locus_tag LOCUS_04170 gene tyrS 10078 8855 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence029 <1 1026 gene locus_tag LOCUS_04180 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898459.1:Na/Pi cotransporter family protein 1793 2764 gene locus_tag LOCUS_04190 1793 2764 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_04190 3395 2775 gene locus_tag LOCUS_04200 3395 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3768 3364 gene locus_tag LOCUS_04210 3768 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4236 3832 gene locus_tag LOCUS_04220 4236 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5428 4301 gene locus_tag LOCUS_04230 gene tgt 5428 4301 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_04230 6459 5437 gene locus_tag LOCUS_04240 gene queA 6459 5437 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_04240 6592 7683 gene locus_tag LOCUS_04250 gene asd 6592 7683 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_04250 7701 8594 gene locus_tag LOCUS_04260 gene dapA 7701 8594 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_04260 8613 9368 gene locus_tag LOCUS_04270 gene dapB 8613 9368 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence030 71 649 gene locus_tag LOCUS_04280 71 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 723 2603 gene locus_tag LOCUS_04290 723 2603 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_04290 2620 3453 gene locus_tag LOCUS_04300 2620 3453 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_04300 3446 4057 gene locus_tag LOCUS_04310 3446 4057 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_04310 4050 5048 gene locus_tag LOCUS_04320 4050 5048 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 protein_id gnl|my_center|LOCUS_04320 5064 6065 gene locus_tag LOCUS_04330 5064 6065 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 protein_id gnl|my_center|LOCUS_04330 6055 6645 gene locus_tag LOCUS_04340 6055 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 7933 6905 gene locus_tag LOCUS_04350 gene gap 7933 6905 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_04350 8170 9012 gene locus_tag LOCUS_04360 8170 9012 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_04360 9916 9362 gene locus_tag LOCUS_04370 9916 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence031 1251 2819 gene locus_tag LOCUS_04380 gene rny 1251 2819 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_04380 2981 5494 gene locus_tag LOCUS_04390 2981 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5655 5873 gene locus_tag LOCUS_04400 5655 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6339 8285 gene locus_tag LOCUS_04410 gene thrS 6339 8285 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_04410 8296 9327 gene locus_tag LOCUS_04420 8296 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence032 257 409 gene locus_tag LOCUS_04430 257 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 467 1075 gene locus_tag LOCUS_04440 467 1075 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_04440 1078 2076 gene locus_tag LOCUS_04450 1078 2076 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_04450 5190 2617 gene locus_tag LOCUS_04460 5190 2617 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126039474.1 protein_id gnl|my_center|LOCUS_04460 5710 5637 gene locus_tag LOCUS_t00060 5710 5637 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6635 8218 gene locus_tag LOCUS_04470 6635 8218 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_04470 9943 8432 gene locus_tag LOCUS_04480 9943 8432 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence033 338 1279 gene locus_tag LOCUS_04490 338 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1550 1335 gene locus_tag LOCUS_04500 1550 1335 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_04500 1852 1547 gene locus_tag LOCUS_04510 1852 1547 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_04510 2137 4056 gene locus_tag LOCUS_04520 2137 4056 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476616.1 protein_id gnl|my_center|LOCUS_04520 4043 4609 gene locus_tag LOCUS_04530 4043 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4660 5118 gene locus_tag LOCUS_04540 4660 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6679 5213 gene locus_tag LOCUS_04550 6679 5213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_04550 6768 6938 gene locus_tag LOCUS_04560 6768 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 6967 9165 gene locus_tag LOCUS_04570 6967 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence034 94 1209 gene locus_tag LOCUS_04580 94 1209 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_04580 1202 1615 gene locus_tag LOCUS_04590 1202 1615 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036847.1 protein_id gnl|my_center|LOCUS_04590 1675 2619 gene locus_tag LOCUS_04600 1675 2619 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_04600 2819 3835 gene locus_tag LOCUS_04610 2819 3835 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_04610 3867 4904 gene locus_tag LOCUS_04620 3867 4904 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_04620 5347 7080 gene locus_tag LOCUS_04630 5347 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 7697 8242 gene locus_tag LOCUS_04640 7697 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 8255 9577 gene locus_tag LOCUS_04650 gene fumC 8255 9577 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160526.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence035 978 2261 gene locus_tag LOCUS_04660 gene mtaB 978 2261 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_04660 2296 2637 gene locus_tag LOCUS_04670 2296 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4741 3173 gene locus_tag LOCUS_04680 4741 3173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211645.1 protein_id gnl|my_center|LOCUS_04680 4918 5835 gene locus_tag LOCUS_04690 4918 5835 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_04690 8159 6600 gene locus_tag LOCUS_04700 8159 6600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_04700 9521 8301 gene locus_tag LOCUS_04710 9521 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence036 4092 1453 gene locus_tag LOCUS_04720 4092 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4972 4250 gene locus_tag LOCUS_04730 4972 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 5398 6354 gene locus_tag LOCUS_04740 5398 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6394 6726 gene locus_tag LOCUS_04750 6394 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 7456 7073 gene locus_tag LOCUS_04760 7456 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 8324 7449 gene locus_tag LOCUS_04770 8324 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 9054 9260 gene locus_tag LOCUS_04780 9054 9260 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence037 2557 1667 gene locus_tag LOCUS_04790 2557 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2998 2570 gene locus_tag LOCUS_04800 2998 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4236 2995 gene locus_tag LOCUS_04810 4236 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4981 4223 gene locus_tag LOCUS_04820 gene truA 4981 4223 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_04820 5796 4981 gene locus_tag LOCUS_04830 5796 4981 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_04830 6646 5789 gene locus_tag LOCUS_04840 6646 5789 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_04840 7469 6639 gene locus_tag LOCUS_04850 7469 6639 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_04850 8332 7466 gene locus_tag LOCUS_04860 8332 7466 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_04860 9678 8332 gene locus_tag LOCUS_04870 gene glmM 9678 8332 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence038 2 439 gene locus_tag LOCUS_04880 2 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1726 548 gene locus_tag LOCUS_04890 1726 548 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_04890 4897 1976 gene locus_tag LOCUS_04900 4897 1976 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_04900 5041 5967 gene locus_tag LOCUS_04910 gene spoIIIAA 5041 5967 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_04910 5964 6443 gene locus_tag LOCUS_04920 5964 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6452 6646 gene locus_tag LOCUS_04930 6452 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 6643 7032 gene locus_tag LOCUS_04940 6643 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7029 8156 gene locus_tag LOCUS_04950 7029 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8153 8617 gene locus_tag LOCUS_04960 8153 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 8618 9178 gene locus_tag LOCUS_04970 8618 9178 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428419.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence039 2063 1512 gene locus_tag LOCUS_04980 gene hpt 2063 1512 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_04980 3382 2069 gene locus_tag LOCUS_04990 gene tilS 3382 2069 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_04990 4755 3382 gene locus_tag LOCUS_05000 gene dnaB 4755 3382 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702157.1 protein_id gnl|my_center|LOCUS_05000 5583 5137 gene locus_tag LOCUS_05010 gene rplI 5583 5137 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_05010 7694 5805 gene locus_tag LOCUS_05020 7694 5805 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_05020 7863 8300 gene locus_tag LOCUS_05030 gene rnhA 7863 8300 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_05030 9271 8420 gene locus_tag LOCUS_05040 9271 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence040 <1 963 gene locus_tag LOCUS_05050 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861810.1:glycerate kinase 1575 1057 gene locus_tag LOCUS_05060 1575 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1859 2416 gene locus_tag LOCUS_05070 1859 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3594 2671 gene locus_tag LOCUS_05080 3594 2671 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_05080 4347 3607 gene locus_tag LOCUS_05090 4347 3607 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_05090 4685 4966 gene locus_tag LOCUS_05100 4685 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5089 5301 gene locus_tag LOCUS_05110 5089 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5674 6510 gene locus_tag LOCUS_05120 5674 6510 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_05120 7719 6865 gene locus_tag LOCUS_05130 7719 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9081 7882 gene locus_tag LOCUS_05140 gene tuf 9081 7882 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence041 324 2009 gene locus_tag LOCUS_05150 324 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2077 3741 gene locus_tag LOCUS_05160 2077 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3772 4242 gene locus_tag LOCUS_05170 gene ispF 3772 4242 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947931.1 protein_id gnl|my_center|LOCUS_05170 4470 4700 gene locus_tag LOCUS_05180 4470 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4684 5829 gene locus_tag LOCUS_05190 4684 5829 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965651.1 protein_id gnl|my_center|LOCUS_05190 5882 6751 gene locus_tag LOCUS_05200 gene cdaA 5882 6751 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_05200 6744 8000 gene locus_tag LOCUS_05210 6744 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence042 4856 4107 gene locus_tag LOCUS_05220 4856 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6160 4874 gene locus_tag LOCUS_05230 6160 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7102 6164 gene locus_tag LOCUS_05240 7102 6164 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_05240 7836 7099 gene locus_tag LOCUS_05250 7836 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 9117 7852 gene locus_tag LOCUS_05260 9117 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence043 6542 5541 gene locus_tag LOCUS_05270 6542 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 6922 7557 gene locus_tag LOCUS_05280 6922 7557 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_05280 7901 9085 gene locus_tag LOCUS_05290 gene metK 7901 9085 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence044 <1 2314 gene locus_tag LOCUS_05300 <1 2314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232079.1:primosomal protein N' 2336 2800 gene locus_tag LOCUS_05310 gene def 2336 2800 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_05310 2806 3711 gene locus_tag LOCUS_05320 gene fmt 2806 3711 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_05320 3713 4438 gene locus_tag LOCUS_05330 3713 4438 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_05330 4435 5703 gene locus_tag LOCUS_05340 gene rsmB 4435 5703 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_05340 5696 6757 gene locus_tag LOCUS_05350 gene rlmN 5696 6757 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_05350 6754 7482 gene locus_tag LOCUS_05360 gene prpC 6754 7482 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence045 303 1127 gene locus_tag LOCUS_05370 303 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521059.1 protein_id gnl|my_center|LOCUS_05370 1247 1453 gene locus_tag LOCUS_05380 1247 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1459 1596 gene locus_tag LOCUS_05390 1459 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 1593 1988 gene locus_tag LOCUS_05400 1593 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905370.1 protein_id gnl|my_center|LOCUS_05400 2042 2425 gene locus_tag LOCUS_05410 2042 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3058 3357 gene locus_tag LOCUS_05420 3058 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3335 5014 gene locus_tag LOCUS_05430 3335 5014 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625088.1 protein_id gnl|my_center|LOCUS_05430 5032 6216 gene locus_tag LOCUS_05440 5032 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 6218 6673 gene locus_tag LOCUS_05450 6218 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05450 6686 7030 gene locus_tag LOCUS_05460 6686 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7048 8247 gene locus_tag LOCUS_05470 7048 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 8250 8567 gene locus_tag LOCUS_05480 8250 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8557 8754 gene locus_tag LOCUS_05490 8557 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence046 460 1980 gene locus_tag LOCUS_05500 460 1980 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_05500 1977 3146 gene locus_tag LOCUS_05510 1977 3146 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 protein_id gnl|my_center|LOCUS_05510 3209 3439 gene locus_tag LOCUS_05520 3209 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3473 5080 gene locus_tag LOCUS_05530 3473 5080 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_05530 5093 6046 gene locus_tag LOCUS_05540 5093 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6149 8776 gene locus_tag LOCUS_05550 6149 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence047 263 799 gene locus_tag LOCUS_05560 263 799 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_05560 823 3054 gene locus_tag LOCUS_05570 823 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3042 4079 gene locus_tag LOCUS_05580 gene holA 3042 4079 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964585.1 protein_id gnl|my_center|LOCUS_05580 4076 4657 gene locus_tag LOCUS_05590 gene rnmV 4076 4657 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016097.1 protein_id gnl|my_center|LOCUS_05590 4650 5240 gene locus_tag LOCUS_05600 4650 5240 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035058.1 protein_id gnl|my_center|LOCUS_05600 5288 6097 gene locus_tag LOCUS_05610 gene spoIIGA 5288 6097 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 protein_id gnl|my_center|LOCUS_05610 6094 6807 gene locus_tag LOCUS_05620 gene sigE 6094 6807 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_05620 6877 7551 gene locus_tag LOCUS_05630 6877 7551 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_05630 7548 8306 gene locus_tag LOCUS_05640 7548 8306 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence048 339 2255 gene locus_tag LOCUS_05650 339 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2312 4225 gene locus_tag LOCUS_05660 2312 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4267 6168 gene locus_tag LOCUS_05670 4267 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6181 6570 gene locus_tag LOCUS_05680 6181 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 7068 8339 gene locus_tag LOCUS_05690 7068 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence049 578 2464 gene locus_tag LOCUS_05700 578 2464 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_05700 2571 3725 gene locus_tag LOCUS_05710 2571 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 4176 3796 gene locus_tag LOCUS_05720 4176 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4850 4173 gene locus_tag LOCUS_05730 4850 4173 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_05730 5532 4906 gene locus_tag LOCUS_05740 5532 4906 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_05740 6331 5534 gene locus_tag LOCUS_05750 6331 5534 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_05750 6713 7159 gene locus_tag LOCUS_05760 gene mscL 6713 7159 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_05760 7180 8109 gene locus_tag LOCUS_05770 7180 8109 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_05770 <8807 8168 gene locus_tag LOCUS_05780 <8807 8168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405702.1:glycerophosphodiester phosphodiesterase >Feature sequence050 3180 2242 gene locus_tag LOCUS_05790 3180 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4647 3208 gene locus_tag LOCUS_05800 4647 3208 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_05800 6758 5289 gene locus_tag LOCUS_05810 6758 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 7370 7017 gene locus_tag LOCUS_05820 7370 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 <8554 7519 gene locus_tag LOCUS_05830 <8554 7519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020474.1:aldo/keto reductase >Feature sequence051 2695 398 gene locus_tag LOCUS_05840 2695 398 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704830.1 protein_id gnl|my_center|LOCUS_05840 4032 2695 gene locus_tag LOCUS_05850 4032 2695 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096659.1 protein_id gnl|my_center|LOCUS_05850 4263 4940 gene locus_tag LOCUS_05860 4263 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4906 5079 gene locus_tag LOCUS_05870 4906 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5210 5866 gene locus_tag LOCUS_05880 5210 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 5943 6344 gene locus_tag LOCUS_05890 5943 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6573 6400 gene locus_tag LOCUS_05900 6573 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6738 7061 gene locus_tag LOCUS_05910 6738 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7741 7418 gene locus_tag LOCUS_05920 7741 7418 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_05920 8207 7734 gene locus_tag LOCUS_05930 8207 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence052 262 35 gene locus_tag LOCUS_05940 262 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 598 5058 gene locus_tag LOCUS_05950 598 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5470 5775 gene locus_tag LOCUS_05960 5470 5775 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_05960 5762 6907 gene locus_tag LOCUS_05970 gene nagA 5762 6907 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence053 77 1057 gene locus_tag LOCUS_05980 77 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05980 1918 1130 gene locus_tag LOCUS_05990 gene proC 1918 1130 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476242.1 protein_id gnl|my_center|LOCUS_05990 2219 1965 gene locus_tag LOCUS_06000 gene spoIIID 2219 1965 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_06000 2340 2567 gene locus_tag LOCUS_06010 2340 2567 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925352.1 protein_id gnl|my_center|LOCUS_06010 2651 4822 gene locus_tag LOCUS_06020 2651 4822 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808242.1 protein_id gnl|my_center|LOCUS_06020 4905 5561 gene locus_tag LOCUS_06030 4905 5561 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812049.1 protein_id gnl|my_center|LOCUS_06030 5573 5986 gene locus_tag LOCUS_06040 gene ruvX 5573 5986 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384481.1 protein_id gnl|my_center|LOCUS_06040 6042 6128 gene locus_tag LOCUS_t00070 6042 6128 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6286 6789 gene locus_tag LOCUS_06050 gene ruvC 6286 6789 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_06050 6790 7386 gene locus_tag LOCUS_06060 gene ruvA 6790 7386 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052857.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence054 1260 3101 gene locus_tag LOCUS_06070 1260 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3105 3851 gene locus_tag LOCUS_06080 3105 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3848 5662 gene locus_tag LOCUS_06090 3848 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5687 6058 gene locus_tag LOCUS_06100 5687 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6062 7963 gene locus_tag LOCUS_06110 6062 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence055 2006 306 gene locus_tag LOCUS_06120 2006 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 2847 2020 gene locus_tag LOCUS_06130 2847 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4589 2847 gene locus_tag LOCUS_06140 4589 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5481 4582 gene locus_tag LOCUS_06150 5481 4582 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_06150 7044 5656 gene locus_tag LOCUS_06160 gene cysS 7044 5656 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_06160 7718 7044 gene locus_tag LOCUS_06170 gene cysE 7718 7044 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence056 1693 1608 gene locus_tag LOCUS_t00080 1693 1608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2090 3277 gene locus_tag LOCUS_06180 2090 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3897 3412 gene locus_tag LOCUS_06190 3897 3412 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043263.1 protein_id gnl|my_center|LOCUS_06190 4808 3906 gene locus_tag LOCUS_06200 4808 3906 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574972.1 protein_id gnl|my_center|LOCUS_06200 5413 4877 gene locus_tag LOCUS_06210 5413 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5527 6645 gene locus_tag LOCUS_06220 5527 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6648 7724 gene locus_tag LOCUS_06230 gene mnmA 6648 7724 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence057 2477 1287 gene locus_tag LOCUS_06240 2477 1287 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811798.1 protein_id gnl|my_center|LOCUS_06240 2915 4507 gene locus_tag LOCUS_06250 2915 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4551 6794 gene locus_tag LOCUS_06260 4551 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6813 7871 gene locus_tag LOCUS_06270 6813 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence058 862 83 gene locus_tag LOCUS_06280 862 83 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812431.1 protein_id gnl|my_center|LOCUS_06280 1430 1068 gene locus_tag LOCUS_06290 1430 1068 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_06290 1732 1538 gene locus_tag LOCUS_06300 1732 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3639 1927 gene locus_tag LOCUS_06310 3639 1927 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_06310 5465 3633 gene locus_tag LOCUS_06320 5465 3633 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_06320 5756 6067 gene locus_tag LOCUS_06330 5756 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6141 7181 gene locus_tag LOCUS_06340 6141 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence059 943 1443 gene locus_tag LOCUS_06350 943 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 1447 2163 gene locus_tag LOCUS_06360 1447 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2153 2419 gene locus_tag LOCUS_06370 2153 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2412 2837 gene locus_tag LOCUS_06380 2412 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2852 4141 gene locus_tag LOCUS_06390 2852 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4134 4991 gene locus_tag LOCUS_06400 4134 4991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_06400 5017 7683 gene locus_tag LOCUS_06410 5017 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 7841 7917 gene locus_tag LOCUS_t00090 7841 7917 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 1022 198 gene locus_tag LOCUS_06420 gene rsmI 1022 198 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_06420 1765 1019 gene locus_tag LOCUS_06430 1765 1019 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_06430 1901 2659 gene locus_tag LOCUS_06440 1901 2659 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876566.1 protein_id gnl|my_center|LOCUS_06440 2652 4481 gene locus_tag LOCUS_06450 2652 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4733 7747 gene locus_tag LOCUS_06460 4733 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence061 <1 592 gene locus_tag LOCUS_06470 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903281.1:DUF512 domain-containing protein 589 1914 gene locus_tag LOCUS_06480 gene der 589 1914 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_06480 1939 3810 gene locus_tag LOCUS_06490 1939 3810 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762477.1 protein_id gnl|my_center|LOCUS_06490 4573 4388 gene locus_tag LOCUS_06500 gene rpmB 4573 4388 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_06500 4776 5915 gene locus_tag LOCUS_06510 gene recA 4776 5915 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388318.1 protein_id gnl|my_center|LOCUS_06510 5915 6523 gene locus_tag LOCUS_06520 5915 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence062 549 40 gene locus_tag LOCUS_06530 gene dfrA 549 40 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_06530 1460 558 gene locus_tag LOCUS_06540 1460 558 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574972.1 protein_id gnl|my_center|LOCUS_06540 2069 1533 gene locus_tag LOCUS_06550 2069 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2187 3305 gene locus_tag LOCUS_06560 2187 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3302 4375 gene locus_tag LOCUS_06570 gene mnmA 3302 4375 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_06570 5098 4427 gene locus_tag LOCUS_06580 5098 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence063 2999 765 gene locus_tag LOCUS_06590 2999 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3561 3025 gene locus_tag LOCUS_06600 3561 3025 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_06600 3925 3584 gene locus_tag LOCUS_06610 3925 3584 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_06610 6558 3928 gene locus_tag LOCUS_06620 gene alaS 6558 3928 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_06620 6968 7507 gene locus_tag LOCUS_06630 6968 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence064 3539 2238 gene locus_tag LOCUS_06640 gene clpX 3539 2238 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_06640 4123 3542 gene locus_tag LOCUS_06650 gene clpP 4123 3542 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_06650 5496 4219 gene locus_tag LOCUS_06660 gene tig 5496 4219 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_06660 6583 5894 gene locus_tag LOCUS_06670 6583 5894 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_06670 6643 6801 gene locus_tag LOCUS_06680 6643 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 <7593 6859 gene locus_tag LOCUS_06690 <7593 6859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263406.1:threonine synthase >Feature sequence065 3244 4755 gene locus_tag LOCUS_06700 3244 4755 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140695.1 protein_id gnl|my_center|LOCUS_06700 4752 5948 gene locus_tag LOCUS_06710 4752 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 7248 6091 gene locus_tag LOCUS_06720 7248 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence066 <1 1269 gene locus_tag LOCUS_06730 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014017276.1:solute carrier family 23 protein 1396 2145 gene locus_tag LOCUS_06740 gene radC 1396 2145 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881044.1 protein_id gnl|my_center|LOCUS_06740 2792 2190 gene locus_tag LOCUS_06750 2792 2190 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_06750 4317 2785 gene locus_tag LOCUS_06760 4317 2785 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_06760 5102 4314 gene locus_tag LOCUS_06770 5102 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5244 5411 gene locus_tag LOCUS_06780 5244 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5493 6449 gene locus_tag LOCUS_06790 5493 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence067 2147 249 gene locus_tag LOCUS_06800 2147 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3466 2189 gene locus_tag LOCUS_06810 3466 2189 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_06810 4148 3459 gene locus_tag LOCUS_06820 4148 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_06820 4927 4151 gene locus_tag LOCUS_06830 4927 4151 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_06830 5160 6419 gene locus_tag LOCUS_06840 5160 6419 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence068 347 159 gene locus_tag LOCUS_06850 347 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 927 373 gene locus_tag LOCUS_06860 gene gmk 927 373 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002997509.1 protein_id gnl|my_center|LOCUS_06860 1166 924 gene locus_tag LOCUS_06870 1166 924 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_06870 2054 1176 gene locus_tag LOCUS_06880 2054 1176 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_06880 3512 2058 gene locus_tag LOCUS_06890 3512 2058 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635474.1 protein_id gnl|my_center|LOCUS_06890 3864 3523 gene locus_tag LOCUS_06900 3864 3523 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_06900 4274 3894 gene locus_tag LOCUS_06910 4274 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5029 4271 gene locus_tag LOCUS_06920 5029 4271 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_06920 6134 5010 gene locus_tag LOCUS_06930 gene dacB 6134 5010 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_06930 6584 6162 gene locus_tag LOCUS_06940 gene ytfJ 6584 6162 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_06940 7235 6639 gene locus_tag LOCUS_06950 7235 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence069 296 625 gene locus_tag LOCUS_06960 296 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 612 1526 gene locus_tag LOCUS_06970 612 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1542 2678 gene locus_tag LOCUS_06980 1542 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2790 3074 gene locus_tag LOCUS_06990 2790 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3071 3343 gene locus_tag LOCUS_07000 3071 3343 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905918.1 protein_id gnl|my_center|LOCUS_07000 3327 4022 gene locus_tag LOCUS_07010 3327 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4019 4354 gene locus_tag LOCUS_07020 4019 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4634 4559 gene locus_tag LOCUS_t00100 4634 4559 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6051 4957 gene locus_tag LOCUS_07030 gene alr 6051 4957 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_07030 7145 6114 gene locus_tag LOCUS_07040 7145 6114 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence070 2791 443 gene locus_tag LOCUS_07050 2791 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3210 2854 gene locus_tag LOCUS_07060 3210 2854 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_07060 4472 3213 gene locus_tag LOCUS_07070 4472 3213 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_07070 5920 4484 gene locus_tag LOCUS_07080 5920 4484 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_07080 <7094 6029 gene locus_tag LOCUS_07090 <7094 6029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986205.1:magnesium transporter >Feature sequence071 18 1067 gene locus_tag LOCUS_07100 18 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1444 2094 gene locus_tag LOCUS_07110 1444 2094 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_07110 2228 3790 gene locus_tag LOCUS_07120 2228 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4397 3921 gene locus_tag LOCUS_07130 4397 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4567 5739 gene locus_tag LOCUS_07140 4567 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6817 5783 gene locus_tag LOCUS_07150 gene mutY 6817 5783 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171397.1 protein_id gnl|my_center|LOCUS_07150 6968 7060 gene locus_tag LOCUS_t00110 6968 7060 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 616 1761 gene locus_tag LOCUS_07160 616 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1786 2475 gene locus_tag LOCUS_07170 1786 2475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_07170 2468 3967 gene locus_tag LOCUS_07180 2468 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4055 5308 gene locus_tag LOCUS_07190 4055 5308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_07190 6290 5538 gene locus_tag LOCUS_07200 6290 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7007 6441 gene locus_tag LOCUS_07210 7007 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence073 1972 575 gene locus_tag LOCUS_07220 1972 575 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_07220 4216 2003 gene locus_tag LOCUS_07230 4216 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 5309 4236 gene locus_tag LOCUS_07240 gene prfA 5309 4236 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_07240 5519 5334 gene locus_tag LOCUS_07250 5519 5334 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_07250 5717 6634 gene locus_tag LOCUS_07260 5717 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence074 470 781 gene locus_tag LOCUS_07270 470 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1352 2284 gene locus_tag LOCUS_07280 gene prmA 1352 2284 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_07280 2564 2941 gene locus_tag LOCUS_07290 2564 2941 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419333.1 protein_id gnl|my_center|LOCUS_07290 2975 4327 gene locus_tag LOCUS_07300 gene ffh 2975 4327 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_07300 4404 4646 gene locus_tag LOCUS_07310 gene rpsP 4404 4646 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_07310 4684 4917 gene locus_tag LOCUS_07320 4684 4917 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_07320 4992 5507 gene locus_tag LOCUS_07330 gene rimM 4992 5507 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_07330 5497 6240 gene locus_tag LOCUS_07340 gene trmD 5497 6240 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_07340 6492 6755 gene locus_tag LOCUS_07350 6492 6755 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence075 66 329 gene locus_tag LOCUS_07360 66 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 602 366 gene locus_tag LOCUS_07370 602 366 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965253.1 protein_id gnl|my_center|LOCUS_07370 1084 1587 gene locus_tag LOCUS_07380 1084 1587 CDS product DUF5067 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933562.1 protein_id gnl|my_center|LOCUS_07380 2683 1757 gene locus_tag LOCUS_07390 2683 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3429 2683 gene locus_tag LOCUS_07400 3429 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559189.1 protein_id gnl|my_center|LOCUS_07400 4230 3835 gene locus_tag LOCUS_07410 gene rpsI 4230 3835 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_07410 4677 4249 gene locus_tag LOCUS_07420 gene rplM 4677 4249 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_07420 4864 5265 gene locus_tag LOCUS_07430 4864 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 5267 6754 gene locus_tag LOCUS_07440 5267 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence076 1336 194 gene locus_tag LOCUS_07450 1336 194 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836378.1 protein_id gnl|my_center|LOCUS_07450 1856 1431 gene locus_tag LOCUS_07460 1856 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2599 2258 gene locus_tag LOCUS_07470 2599 2258 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387267.1 protein_id gnl|my_center|LOCUS_07470 2675 3006 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtttccaaaaggaaacacttt 4574 3126 gene locus_tag LOCUS_07480 4574 3126 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_07480 4739 5287 gene locus_tag LOCUS_07490 4739 5287 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_07490 6214 5336 gene locus_tag LOCUS_07500 6214 5336 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861199.1 protein_id gnl|my_center|LOCUS_07500 6877 6215 gene locus_tag LOCUS_07510 6877 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence077 616 2469 gene locus_tag LOCUS_07520 616 2469 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_07520 2450 3118 gene locus_tag LOCUS_07530 2450 3118 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_07530 3314 3655 gene locus_tag LOCUS_07540 gene rplS 3314 3655 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_07540 3655 4329 gene locus_tag LOCUS_07550 gene lepB 3655 4329 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_07550 4336 5211 gene locus_tag LOCUS_07560 gene ylqF 4336 5211 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_07560 5208 5813 gene locus_tag LOCUS_07570 5208 5813 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_07570 5810 6175 gene locus_tag LOCUS_07580 5810 6175 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence078 314 1060 gene locus_tag LOCUS_07590 314 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1165 2376 gene locus_tag LOCUS_07600 1165 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3867 2461 gene locus_tag LOCUS_07610 3867 2461 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_07610 5287 3869 gene locus_tag LOCUS_07620 5287 3869 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_07620 5811 5326 gene locus_tag LOCUS_07630 5811 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 6583 5798 gene locus_tag LOCUS_07640 6583 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence079 1871 435 gene locus_tag LOCUS_07650 1871 435 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_07650 3376 2018 gene locus_tag LOCUS_07660 gene mgtE 3376 2018 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_07660 4639 3932 gene locus_tag LOCUS_07670 4639 3932 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_07670 6538 4745 gene locus_tag LOCUS_07680 gene pepF 6538 4745 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence080 292 1155 gene locus_tag LOCUS_07690 gene rsmA 292 1155 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_07690 1255 2433 gene locus_tag LOCUS_07700 gene alr 1255 2433 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_07700 2644 2719 gene locus_tag LOCUS_t00120 2644 2719 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4049 3021 gene locus_tag LOCUS_07710 4049 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4345 4010 gene locus_tag LOCUS_07720 4345 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5381 4416 gene locus_tag LOCUS_07730 5381 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6138 5368 gene locus_tag LOCUS_07740 6138 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence081 1569 1435 gene locus_tag LOCUS_07750 1569 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4534 1583 gene locus_tag LOCUS_07760 4534 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence082 <1 737 gene locus_tag LOCUS_07770 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429190.1:ATP-binding cassette domain-containing protein 755 1678 gene locus_tag LOCUS_07780 755 1678 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_07780 2051 1764 gene locus_tag LOCUS_07790 2051 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07790 3223 2201 gene locus_tag LOCUS_07800 3223 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07800 3640 6366 gene locus_tag LOCUS_07810 3640 6366 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence083 1106 354 gene locus_tag LOCUS_07820 gene dapB 1106 354 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_07820 2020 1127 gene locus_tag LOCUS_07830 gene dapA 2020 1127 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07830 3192 2101 gene locus_tag LOCUS_07840 gene asd 3192 2101 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_07840 3344 4366 gene locus_tag LOCUS_07850 gene queA 3344 4366 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_07850 4445 4711 gene locus_tag LOCUS_07860 4445 4711 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_07860 4704 4982 gene locus_tag LOCUS_07870 4704 4982 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 protein_id gnl|my_center|LOCUS_07870 5101 6228 gene locus_tag LOCUS_07880 gene tgt 5101 6228 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence084 43 786 gene locus_tag LOCUS_07890 43 786 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_07890 1100 6523 gene locus_tag LOCUS_07900 1100 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence085 232 939 gene locus_tag LOCUS_07910 232 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_07910 1422 3203 gene locus_tag LOCUS_07920 1422 3203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 protein_id gnl|my_center|LOCUS_07920 3200 4984 gene locus_tag LOCUS_07930 3200 4984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814582.1 protein_id gnl|my_center|LOCUS_07930 5206 5676 gene locus_tag LOCUS_07940 5206 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence086 1593 196 gene locus_tag LOCUS_07950 1593 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1739 3928 gene locus_tag LOCUS_07960 1739 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 5223 4096 gene locus_tag LOCUS_07970 5223 4096 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261742.1 protein_id gnl|my_center|LOCUS_07970 6074 5412 gene locus_tag LOCUS_07980 6074 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence087 235 606 gene locus_tag LOCUS_07990 235 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 603 734 gene locus_tag LOCUS_08000 603 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 986 1765 gene locus_tag LOCUS_08010 gene proB 986 1765 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_08010 2238 3491 gene locus_tag LOCUS_08020 2238 3491 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385467.1 protein_id gnl|my_center|LOCUS_08020 3492 3758 gene locus_tag LOCUS_08030 3492 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4123 4497 gene locus_tag LOCUS_08040 4123 4497 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_08040 5302 5772 gene locus_tag LOCUS_08050 5302 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence088 <1 908 gene locus_tag LOCUS_08060 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902854.1:N-acetylglucosamine-6-phosphate deacetylase 1103 2935 gene locus_tag LOCUS_08070 gene asnB 1103 2935 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_08070 3553 3005 gene locus_tag LOCUS_08080 3553 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence089 1300 266 gene locus_tag LOCUS_08090 1300 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5147 1326 gene locus_tag LOCUS_08100 5147 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence090 330 968 gene locus_tag LOCUS_08110 330 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1026 1748 gene locus_tag LOCUS_08120 1026 1748 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 protein_id gnl|my_center|LOCUS_08120 1811 2254 gene locus_tag LOCUS_08130 1811 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2289 2660 gene locus_tag LOCUS_08140 2289 2660 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_08140 3711 3175 gene locus_tag LOCUS_08150 3711 3175 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_08150 4268 3735 gene locus_tag LOCUS_08160 4268 3735 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_08160 4439 5884 gene locus_tag LOCUS_08170 4439 5884 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence091 <1 1293 gene locus_tag LOCUS_08180 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861176.1:30S ribosomal protein S12 methylthiotransferase RimO 1620 2273 gene locus_tag LOCUS_08190 gene cysE 1620 2273 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_08190 2279 3667 gene locus_tag LOCUS_08200 gene cysS 2279 3667 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_08200 4064 3861 gene locus_tag LOCUS_08210 4064 3861 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_08210 4307 6340 gene locus_tag LOCUS_08220 4307 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence092 54 521 gene locus_tag LOCUS_08230 gene moaC 54 521 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764132.1 protein_id gnl|my_center|LOCUS_08230 499 1446 gene locus_tag LOCUS_08240 gene moaA 499 1446 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943757.1 protein_id gnl|my_center|LOCUS_08240 1665 2099 gene locus_tag LOCUS_08250 1665 2099 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_08250 2168 2665 gene locus_tag LOCUS_08260 2168 2665 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_08260 2662 3234 gene locus_tag LOCUS_08270 2662 3234 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_08270 3906 3367 gene locus_tag LOCUS_08280 3906 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4133 4399 gene locus_tag LOCUS_08290 4133 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4760 5839 gene locus_tag LOCUS_08300 4760 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence093 137 775 gene locus_tag LOCUS_08310 gene rpe 137 775 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106173.1 protein_id gnl|my_center|LOCUS_08310 1290 769 gene locus_tag LOCUS_08320 1290 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1387 1815 gene locus_tag LOCUS_08330 1387 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1812 3221 gene locus_tag LOCUS_08340 1812 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3404 4390 gene locus_tag LOCUS_08350 3404 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence094 4375 500 gene locus_tag LOCUS_08360 4375 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4374 4562 gene locus_tag LOCUS_08370 4374 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5724 4540 gene locus_tag LOCUS_08380 5724 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence095 <1 1162 gene locus_tag LOCUS_08390 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082978.1:acetate kinase 1220 1879 gene locus_tag LOCUS_08400 1220 1879 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_08400 1968 2837 gene locus_tag LOCUS_08410 1968 2837 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_08410 2809 4083 gene locus_tag LOCUS_08420 2809 4083 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_08420 4076 4750 gene locus_tag LOCUS_08430 gene cmk 4076 4750 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence096 1901 198 gene locus_tag LOCUS_08440 1901 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2013 2699 gene locus_tag LOCUS_08450 2013 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3424 2963 gene locus_tag LOCUS_08460 3424 2963 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_08460 4011 3424 gene locus_tag LOCUS_08470 gene lexA 4011 3424 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_08470 6108 4795 gene locus_tag LOCUS_08480 6108 4795 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775456.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence097 209 2215 gene locus_tag LOCUS_08490 gene gyrB 209 2215 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_08490 2230 4473 gene locus_tag LOCUS_08500 gene gyrA 2230 4473 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_08500 4777 5025 gene locus_tag LOCUS_08510 4777 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5141 5998 gene locus_tag LOCUS_08520 5141 5998 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016729594.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence098 77 1675 gene locus_tag LOCUS_08530 77 1675 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_08530 1918 2868 gene locus_tag LOCUS_08540 1918 2868 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_08540 3202 4341 gene locus_tag LOCUS_08550 3202 4341 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836378.1 protein_id gnl|my_center|LOCUS_08550 4418 5059 gene locus_tag LOCUS_08560 4418 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence099 396 1049 gene locus_tag LOCUS_08570 396 1049 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_08570 1062 1598 gene locus_tag LOCUS_08580 1062 1598 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_08580 1616 3268 gene locus_tag LOCUS_08590 1616 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3240 4478 gene locus_tag LOCUS_08600 3240 4478 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_08600 4607 6016 gene locus_tag LOCUS_08610 gene mrdA 4607 6016 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869951.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence100 364 1302 gene locus_tag LOCUS_08620 gene rfbA 364 1302 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_08620 1547 2110 gene locus_tag LOCUS_08630 gene rfbC 1547 2110 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532726.1 protein_id gnl|my_center|LOCUS_08630 2114 2962 gene locus_tag LOCUS_08640 gene rfbD 2114 2962 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_08640 3188 3724 gene locus_tag LOCUS_08650 gene nrdR 3188 3724 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_08650 3823 4845 gene locus_tag LOCUS_08660 3823 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5167 5931 gene locus_tag LOCUS_08670 gene spo0A 5167 5931 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence101 3557 2151 gene locus_tag LOCUS_08680 3557 2151 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_08680 5036 3588 gene locus_tag LOCUS_08690 5036 3588 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494796.1 protein_id gnl|my_center|LOCUS_08690 5747 5055 gene locus_tag LOCUS_08700 5747 5055 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence102 323 1360 gene locus_tag LOCUS_08710 323 1360 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence103 1099 194 gene locus_tag LOCUS_08720 gene era 1099 194 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_08720 1605 1096 gene locus_tag LOCUS_08730 1605 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2093 1608 gene locus_tag LOCUS_08740 gene ybeY 2093 1608 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_08740 3049 2090 gene locus_tag LOCUS_08750 3049 2090 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_08750 4304 3114 gene locus_tag LOCUS_08760 gene yqfD 4304 3114 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230033.1 protein_id gnl|my_center|LOCUS_08760 4555 4301 gene locus_tag LOCUS_08770 4555 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 4619 5644 gene locus_tag LOCUS_08780 gene ylbJ 4619 5644 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965047.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence104 890 207 gene locus_tag LOCUS_08790 890 207 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_08790 1545 1120 gene locus_tag LOCUS_08800 1545 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2845 2039 gene locus_tag LOCUS_08810 2845 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4079 2856 gene locus_tag LOCUS_08820 4079 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 4324 5478 gene locus_tag LOCUS_08830 4324 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence105 <1 1135 gene locus_tag LOCUS_08840 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869273.1:V-type ATPase 116kDa subunit family protein 1159 1632 gene locus_tag LOCUS_08850 1159 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1639 1941 gene locus_tag LOCUS_08860 1639 1941 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_08860 1986 2582 gene locus_tag LOCUS_08870 1986 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2610 4370 gene locus_tag LOCUS_08880 2610 4370 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_08880 4383 5756 gene locus_tag LOCUS_08890 4383 5756 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence106 887 174 gene locus_tag LOCUS_08900 887 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2907 1768 gene locus_tag LOCUS_08910 2907 1768 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_08910 4299 2917 gene locus_tag LOCUS_08920 4299 2917 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_08920 4804 4310 gene locus_tag LOCUS_08930 4804 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5628 4807 gene locus_tag LOCUS_08940 5628 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence107 232 654 gene locus_tag LOCUS_08950 232 654 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_08950 678 1241 gene locus_tag LOCUS_08960 678 1241 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_08960 2360 1791 gene locus_tag LOCUS_08970 2360 1791 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053025875.1 protein_id gnl|my_center|LOCUS_08970 2519 3355 gene locus_tag LOCUS_08980 2519 3355 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_08980 3509 3862 gene locus_tag LOCUS_08990 3509 3862 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_08990 4138 5607 gene locus_tag LOCUS_09000 4138 5607 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence108 400 197 gene locus_tag LOCUS_09010 400 197 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_09010 685 5412 gene locus_tag LOCUS_09020 685 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence109 1326 367 gene locus_tag LOCUS_09030 1326 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1558 1424 gene locus_tag LOCUS_09040 1558 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1702 2490 gene locus_tag LOCUS_09050 1702 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2487 4019 gene locus_tag LOCUS_09060 2487 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4012 4611 gene locus_tag LOCUS_09070 4012 4611 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_09070 5526 4798 gene locus_tag LOCUS_09080 gene radC 5526 4798 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415038.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence110 169 1551 gene locus_tag LOCUS_09090 gene murC 169 1551 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_09090 1624 2457 gene locus_tag LOCUS_09100 gene dpsA 1624 2457 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_09100 2454 3029 gene locus_tag LOCUS_09110 2454 3029 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_09110 3153 3794 gene locus_tag LOCUS_09120 3153 3794 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_09120 3782 4081 gene locus_tag LOCUS_09130 3782 4081 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_09130 4095 5729 gene locus_tag LOCUS_09140 gene groL 4095 5729 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence111 135 962 gene locus_tag LOCUS_09150 135 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_09150 2220 1003 gene locus_tag LOCUS_09160 2220 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2388 3536 gene locus_tag LOCUS_09170 gene ytvI 2388 3536 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_09170 3660 5399 gene locus_tag LOCUS_09180 3660 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence112 3185 2493 gene locus_tag LOCUS_09190 3185 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3784 3374 gene locus_tag LOCUS_09200 3784 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4523 3903 gene locus_tag LOCUS_09210 4523 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5070 4516 gene locus_tag LOCUS_09220 5070 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence113 1530 703 gene locus_tag LOCUS_09230 1530 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3790 1514 gene locus_tag LOCUS_09240 3790 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4095 3823 gene locus_tag LOCUS_09250 4095 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4406 4095 gene locus_tag LOCUS_09260 4406 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5196 4420 gene locus_tag LOCUS_09270 5196 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5551 5183 gene locus_tag LOCUS_09280 5551 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence114 1955 504 gene locus_tag LOCUS_09290 1955 504 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_09290 4254 1960 gene locus_tag LOCUS_09300 4254 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4730 4374 gene locus_tag LOCUS_09310 4730 4374 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_09310 <5551 4734 gene locus_tag LOCUS_09320 <5551 4734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948740.1:FAD-dependent oxidoreductase >Feature sequence115 780 151 gene locus_tag LOCUS_09330 gene upp 780 151 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_09330 1245 811 gene locus_tag LOCUS_09340 gene rpiB 1245 811 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_09340 1937 1242 gene locus_tag LOCUS_09350 gene tsaB 1937 1242 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_09350 2367 1918 gene locus_tag LOCUS_09360 2367 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2530 4191 gene locus_tag LOCUS_09370 2530 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4333 5469 gene locus_tag LOCUS_09380 gene rodA 4333 5469 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence116 823 566 gene locus_tag LOCUS_09390 823 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1027 2253 gene locus_tag LOCUS_09400 1027 2253 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_09400 2354 3724 gene locus_tag LOCUS_09410 gene argH 2354 3724 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence117 689 5074 gene locus_tag LOCUS_09420 689 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence118 1346 459 gene locus_tag LOCUS_09430 1346 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1607 1738 gene locus_tag LOCUS_09440 1607 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1881 2429 gene locus_tag LOCUS_09450 1881 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2723 2648 gene locus_tag LOCUS_t00130 2723 2648 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3594 2818 gene locus_tag LOCUS_09460 3594 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4374 3604 gene locus_tag LOCUS_09470 4374 3604 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_09470 5122 4376 gene locus_tag LOCUS_09480 5122 4376 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence119 2082 361 gene locus_tag LOCUS_09490 2082 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_09490 2825 2115 gene locus_tag LOCUS_09500 2825 2115 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_09500 3279 2797 gene locus_tag LOCUS_09510 3279 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3424 4770 gene locus_tag LOCUS_09520 gene ypeB 3424 4770 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966179.1 protein_id gnl|my_center|LOCUS_09520 4828 5088 gene locus_tag LOCUS_09530 4828 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence120 1241 567 gene locus_tag LOCUS_09540 gene cmk 1241 567 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_09540 2481 1234 gene locus_tag LOCUS_09550 2481 1234 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_09550 3338 2478 gene locus_tag LOCUS_09560 3338 2478 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_09560 4683 3484 gene locus_tag LOCUS_09570 4683 3484 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence121 351 1070 gene locus_tag LOCUS_09580 351 1070 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167477.1 protein_id gnl|my_center|LOCUS_09580 1067 1387 gene locus_tag LOCUS_09590 1067 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1399 2028 gene locus_tag LOCUS_09600 1399 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2759 2082 gene locus_tag LOCUS_09610 2759 2082 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_09610 3028 5049 gene locus_tag LOCUS_09620 3028 5049 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099371.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence122 580 35 gene locus_tag LOCUS_09630 580 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2924 666 gene locus_tag LOCUS_09640 2924 666 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_09640 4695 3061 gene locus_tag LOCUS_09650 4695 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence123 1266 559 gene locus_tag LOCUS_09660 1266 559 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_09660 3083 1269 gene locus_tag LOCUS_09670 gene pepF 3083 1269 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_09670 3264 4898 gene locus_tag LOCUS_09680 3264 4898 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence124 1250 57 gene locus_tag LOCUS_09690 1250 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2507 2124 gene locus_tag LOCUS_09700 2507 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2799 2512 gene locus_tag LOCUS_09710 2799 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4048 2816 gene locus_tag LOCUS_09720 4048 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4153 4839 gene locus_tag LOCUS_09730 gene sleB 4153 4839 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence125 2051 585 gene locus_tag LOCUS_09740 2051 585 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_09740 2740 2048 gene locus_tag LOCUS_09750 2740 2048 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_09750 4053 2752 gene locus_tag LOCUS_09760 4053 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence126 <1 1172 gene locus_tag LOCUS_09770 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582697.1:glycoside hydrolase family 3 C-terminal domain-containing protein 1505 1421 gene locus_tag LOCUS_t00140 1505 1421 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2749 1577 gene locus_tag LOCUS_09780 2749 1577 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_09780 3567 2746 gene locus_tag LOCUS_09790 3567 2746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_09790 4394 3564 gene locus_tag LOCUS_09800 4394 3564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_09800 <4938 4387 gene locus_tag LOCUS_09810 <4938 4387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437017.1:ABC transporter ATP-binding protein >Feature sequence127 354 442 gene locus_tag LOCUS_t00150 354 442 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2123 852 gene locus_tag LOCUS_09820 gene serS 2123 852 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_09820 3023 2163 gene locus_tag LOCUS_09830 3023 2163 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_09830 3818 3048 gene locus_tag LOCUS_09840 3818 3048 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence128 66 386 gene locus_tag LOCUS_09850 66 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 430 3720 gene locus_tag LOCUS_09860 430 3720 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_09860 <4928 4162 gene locus_tag LOCUS_09870 <4928 4162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439713.1:GGDEF domain-containing protein >Feature sequence129 <1 966 gene locus_tag LOCUS_09880 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810412.1:ferrous iron transport protein B 1111 3093 gene locus_tag LOCUS_09890 gene ligA 1111 3093 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_09890 3107 4489 gene locus_tag LOCUS_09900 gene murC 3107 4489 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence130 449 207 gene locus_tag LOCUS_09910 449 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1816 701 gene locus_tag LOCUS_09920 gene prfB 1816 701 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_09920 2289 3368 gene locus_tag LOCUS_09930 2289 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3518 3805 gene locus_tag LOCUS_09940 gene rpsF 3518 3805 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_09940 3805 4254 gene locus_tag LOCUS_09950 3805 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4283 4522 gene locus_tag LOCUS_09960 gene rpsR 4283 4522 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence131 412 681 gene locus_tag LOCUS_09970 412 681 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 protein_id gnl|my_center|LOCUS_09970 674 982 gene locus_tag LOCUS_09980 674 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1078 1218 gene locus_tag LOCUS_09990 1078 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1327 1590 gene locus_tag LOCUS_10000 1327 1590 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 protein_id gnl|my_center|LOCUS_10000 1590 1904 gene locus_tag LOCUS_10010 1590 1904 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_10010 3048 2047 gene locus_tag LOCUS_10020 3048 2047 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_10020 3755 3063 gene locus_tag LOCUS_10030 3755 3063 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_10030 3932 4618 gene locus_tag LOCUS_10040 3932 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence132 1 354 gene locus_tag LOCUS_10050 1 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 420 1175 gene locus_tag LOCUS_10060 420 1175 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_10060 1259 2431 gene locus_tag LOCUS_10070 1259 2431 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_10070 2974 4350 gene locus_tag LOCUS_10080 2974 4350 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence133 1582 659 gene locus_tag LOCUS_10090 1582 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2516 1644 gene locus_tag LOCUS_10100 2516 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2717 3472 gene locus_tag LOCUS_10110 2717 3472 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence134 1470 100 gene locus_tag LOCUS_10120 1470 100 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_10120 2440 1535 gene locus_tag LOCUS_10130 2440 1535 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_10130 3140 2463 gene locus_tag LOCUS_10140 3140 2463 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_10140 3343 3501 gene locus_tag LOCUS_10150 3343 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4016 3573 gene locus_tag LOCUS_10160 4016 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4197 4493 gene locus_tag LOCUS_10170 4197 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence135 >Feature sequence136 <1 2181 gene locus_tag LOCUS_10180 <1 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989385.1:class 1 internalin InlG >Feature sequence137 606 274 gene locus_tag LOCUS_10190 606 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1370 711 gene locus_tag LOCUS_10200 1370 711 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767382.1 protein_id gnl|my_center|LOCUS_10200 2281 1919 gene locus_tag LOCUS_10210 2281 1919 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_10210 3599 2490 gene locus_tag LOCUS_10220 gene rlmD 3599 2490 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence138 2233 1127 gene locus_tag LOCUS_10230 2233 1127 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350209.1 protein_id gnl|my_center|LOCUS_10230 2990 2262 gene locus_tag LOCUS_10240 2990 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4357 3023 gene locus_tag LOCUS_10250 4357 3023 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence139 1836 1126 gene locus_tag LOCUS_10260 1836 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2440 2264 gene locus_tag LOCUS_10270 2440 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2575 3669 gene locus_tag LOCUS_10280 2575 3669 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_10280 3671 4243 gene locus_tag LOCUS_10290 3671 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence140 1984 440 gene locus_tag LOCUS_10300 1984 440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_10300 3594 2338 gene locus_tag LOCUS_10310 3594 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 <4378 3820 gene locus_tag LOCUS_10320 <4378 3820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000866483.1:xanthine phosphoribosyltransferase >Feature sequence141 204 1241 gene locus_tag LOCUS_10330 gene mutY 204 1241 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284765.1 protein_id gnl|my_center|LOCUS_10330 1569 2963 gene locus_tag LOCUS_10340 gene asnS 1569 2963 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_10340 3605 3303 gene locus_tag LOCUS_10350 3605 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4021 3608 gene locus_tag LOCUS_10360 4021 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence142 1546 392 gene locus_tag LOCUS_10370 1546 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3445 1616 gene locus_tag LOCUS_10380 3445 1616 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_10380 <4341 3776 gene locus_tag LOCUS_10390 <4341 3776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964226.1:tRNA threonylcarbamoyladenosine dehydratase >Feature sequence143 300 2645 gene locus_tag LOCUS_10400 gene feoB 300 2645 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence144 295 1623 gene locus_tag LOCUS_10410 295 1623 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_10410 1735 3006 gene locus_tag LOCUS_10420 1735 3006 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_10420 3045 3986 gene locus_tag LOCUS_10430 gene metA 3045 3986 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence145 153 632 gene locus_tag LOCUS_10440 153 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 633 2126 gene locus_tag LOCUS_10450 633 2126 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016044.1 protein_id gnl|my_center|LOCUS_10450 2151 3761 gene locus_tag LOCUS_10460 2151 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence146 764 186 gene locus_tag LOCUS_10470 764 186 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862458.1 protein_id gnl|my_center|LOCUS_10470 1806 946 gene locus_tag LOCUS_10480 1806 946 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_10480 2206 3984 gene locus_tag LOCUS_10490 2206 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence147 106 867 gene locus_tag LOCUS_10500 106 867 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876566.1 protein_id gnl|my_center|LOCUS_10500 860 2686 gene locus_tag LOCUS_10510 860 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence148 996 172 gene locus_tag LOCUS_10520 996 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1842 1225 gene locus_tag LOCUS_10530 1842 1225 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_10530 3020 1944 gene locus_tag LOCUS_10540 gene plcA 3020 1944 CDS product phosphatidylinositol-specific phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733144.1 protein_id gnl|my_center|LOCUS_10540 3154 4068 gene locus_tag LOCUS_10550 3154 4068 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence149 1154 210 gene locus_tag LOCUS_10560 1154 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3859 1529 gene locus_tag LOCUS_10570 3859 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence150 <1 1893 gene locus_tag LOCUS_10580 <1 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964339.1:radical SAM protein 1908 3809 gene locus_tag LOCUS_10590 1908 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence151 2816 144 gene locus_tag LOCUS_10600 2816 144 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_10600 3962 3411 gene locus_tag LOCUS_10610 gene yfcE 3962 3411 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence152 1517 246 gene locus_tag LOCUS_10620 1517 246 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_10620 2200 1514 gene locus_tag LOCUS_10630 2200 1514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_10630 2975 2295 gene locus_tag LOCUS_10640 2975 2295 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_10640 3711 2968 gene locus_tag LOCUS_10650 3711 2968 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence153 342 2270 gene locus_tag LOCUS_10660 342 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2374 2580 gene locus_tag LOCUS_10670 2374 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2669 3925 gene locus_tag LOCUS_10680 2669 3925 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298157.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence154 324 1505 gene locus_tag LOCUS_10690 gene larC 324 1505 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_10690 1502 2047 gene locus_tag LOCUS_10700 1502 2047 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_10700 2375 3292 gene locus_tag LOCUS_10710 2375 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence155 313 2319 gene locus_tag LOCUS_10720 gene gyrB 313 2319 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence156 684 1298 gene locus_tag LOCUS_10730 684 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1563 1339 gene locus_tag LOCUS_10740 1563 1339 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_10740 1714 2196 gene locus_tag LOCUS_10750 1714 2196 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_10750 2193 3374 gene locus_tag LOCUS_10760 2193 3374 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence157 1 768 gene locus_tag LOCUS_10770 1 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 779 2983 gene locus_tag LOCUS_10780 779 2983 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_10780 2999 3448 gene locus_tag LOCUS_10790 gene dtd 2999 3448 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691400.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence158 1002 325 gene locus_tag LOCUS_10800 1002 325 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_10800 1663 1052 gene locus_tag LOCUS_10810 1663 1052 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_10810 2471 1665 gene locus_tag LOCUS_10820 2471 1665 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence159 1640 648 gene locus_tag LOCUS_10830 1640 648 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_10830 2589 1669 gene locus_tag LOCUS_10840 2589 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 2722 3822 gene locus_tag LOCUS_10850 gene spoIID 2722 3822 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence160 1766 288 gene locus_tag LOCUS_10860 1766 288 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_10860 1957 2853 gene locus_tag LOCUS_10870 1957 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2905 3402 gene locus_tag LOCUS_10880 2905 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence161 2180 144 gene locus_tag LOCUS_10890 gene recG 2180 144 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_10890 3649 2177 gene locus_tag LOCUS_10900 3649 2177 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence162 154 417 gene locus_tag LOCUS_10910 154 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1135 740 gene locus_tag LOCUS_10920 gene rpsI 1135 740 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_10920 1582 1154 gene locus_tag LOCUS_10930 gene rplM 1582 1154 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_10930 1901 2176 gene locus_tag LOCUS_10940 1901 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2192 3673 gene locus_tag LOCUS_10950 2192 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence163 3128 2718 gene locus_tag LOCUS_10960 3128 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 <3775 3269 gene locus_tag LOCUS_10970 <3775 3269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986381.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence164 177 686 gene locus_tag LOCUS_10980 177 686 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_10980 683 1168 gene locus_tag LOCUS_10990 683 1168 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680355.1 protein_id gnl|my_center|LOCUS_10990 1165 1797 gene locus_tag LOCUS_11000 1165 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1800 2726 gene locus_tag LOCUS_11010 1800 2726 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_11010 2726 3571 gene locus_tag LOCUS_11020 2726 3571 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence165 873 145 gene locus_tag LOCUS_11030 873 145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_11030 1076 876 gene locus_tag LOCUS_11040 1076 876 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836789.1 protein_id gnl|my_center|LOCUS_11040 1251 1799 gene locus_tag LOCUS_11050 1251 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2265 1858 gene locus_tag LOCUS_11060 2265 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3210 2479 gene locus_tag LOCUS_11070 3210 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3320 3475 gene locus_tag LOCUS_11080 3320 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence166 376 594 gene locus_tag LOCUS_11090 376 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 619 897 gene locus_tag LOCUS_11100 619 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1089 1298 gene locus_tag LOCUS_11110 1089 1298 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816704.1 protein_id gnl|my_center|LOCUS_11110 1288 1809 gene locus_tag LOCUS_11120 1288 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2252 3661 gene locus_tag LOCUS_11130 2252 3661 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence167 573 1994 gene locus_tag LOCUS_11140 573 1994 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_11140 1996 3489 gene locus_tag LOCUS_11150 1996 3489 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence168 690 256 gene locus_tag LOCUS_11160 690 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1203 781 gene locus_tag LOCUS_11170 1203 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1555 1809 gene locus_tag LOCUS_11180 1555 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 1745 1999 gene locus_tag LOCUS_11190 1745 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 3403 2003 gene locus_tag LOCUS_11200 3403 2003 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence169 <1 640 gene locus_tag LOCUS_11210 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase 1169 762 gene locus_tag LOCUS_11220 1169 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1722 1210 gene locus_tag LOCUS_11230 1722 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2093 3178 gene locus_tag LOCUS_11240 2093 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence170 542 862 gene locus_tag LOCUS_11250 542 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 859 1722 gene locus_tag LOCUS_11260 859 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2699 1782 gene locus_tag LOCUS_11270 2699 1782 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_11270 3434 2706 gene locus_tag LOCUS_11280 3434 2706 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758846.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence171 1531 503 gene locus_tag LOCUS_11290 gene spoIID 1531 503 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_11290 1839 2759 gene locus_tag LOCUS_11300 1839 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence172 1338 604 gene locus_tag LOCUS_11310 1338 604 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_11310 2191 1406 gene locus_tag LOCUS_11320 2191 1406 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_11320 3181 2312 gene locus_tag LOCUS_11330 3181 2312 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence173 728 285 gene locus_tag LOCUS_11340 728 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 988 1992 gene locus_tag LOCUS_11350 988 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2095 2457 gene locus_tag LOCUS_11360 2095 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2488 3480 gene locus_tag LOCUS_11370 2488 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence174 >Feature sequence175 1135 149 gene locus_tag LOCUS_11380 1135 149 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929014.1 protein_id gnl|my_center|LOCUS_11380 1447 1190 gene locus_tag LOCUS_11390 1447 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1581 1829 gene locus_tag LOCUS_11400 1581 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence176 <1 584 gene locus_tag LOCUS_11410 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966478.1:ATP-dependent zinc metalloprotease FtsH 929 666 gene locus_tag LOCUS_11420 929 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1248 3032 gene locus_tag LOCUS_11430 1248 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence177 311 1843 gene locus_tag LOCUS_11440 311 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2420 2983 gene locus_tag LOCUS_11450 2420 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence178 2603 777 gene locus_tag LOCUS_11460 2603 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence179 517 233 gene locus_tag LOCUS_11470 gene rpmA 517 233 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_11470 831 532 gene locus_tag LOCUS_11480 831 532 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732583.1 protein_id gnl|my_center|LOCUS_11480 1145 831 gene locus_tag LOCUS_11490 gene rplU 1145 831 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_11490 2113 1271 gene locus_tag LOCUS_11500 gene folD 2113 1271 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_11500 3260 2100 gene locus_tag LOCUS_11510 3260 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence180 646 461 gene locus_tag LOCUS_11520 gene rpmB 646 461 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_11520 850 1983 gene locus_tag LOCUS_11530 gene recA 850 1983 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_11530 1983 2594 gene locus_tag LOCUS_11540 1983 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3085 3321 gene locus_tag LOCUS_11550 3085 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence181 396 1223 gene locus_tag LOCUS_11560 gene prmC 396 1223 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546726.1 protein_id gnl|my_center|LOCUS_11560 1220 1918 gene locus_tag LOCUS_11570 1220 1918 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_11570 1927 2655 gene locus_tag LOCUS_11580 gene scpA 1927 2655 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_11580 2639 3220 gene locus_tag LOCUS_11590 gene scpB 2639 3220 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence182 1752 241 gene locus_tag LOCUS_11600 1752 241 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_11600 2109 1960 gene locus_tag LOCUS_11610 2109 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3061 2189 gene locus_tag LOCUS_11620 gene rsgA 3061 2189 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986840.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence183 2519 552 gene locus_tag LOCUS_11630 2519 552 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_11630 2627 3352 gene locus_tag LOCUS_11640 2627 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence184 184 900 gene locus_tag LOCUS_11650 184 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 893 1942 gene locus_tag LOCUS_11660 893 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1942 2487 gene locus_tag LOCUS_11670 1942 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2672 3343 gene locus_tag LOCUS_11680 2672 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence185 <1 647 gene locus_tag LOCUS_11690 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905214.1:glycerophosphodiester phosphodiesterase family protein 907 1731 gene locus_tag LOCUS_11700 907 1731 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_11700 2326 2204 gene locus_tag LOCUS_11710 2326 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3102 2428 gene locus_tag LOCUS_11720 3102 2428 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence186 1125 385 gene locus_tag LOCUS_11730 1125 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1742 2875 gene locus_tag LOCUS_11740 1742 2875 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261742.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence187 791 126 gene locus_tag LOCUS_11750 791 126 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 protein_id gnl|my_center|LOCUS_11750 2176 1199 gene locus_tag LOCUS_11760 2176 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2555 2190 gene locus_tag LOCUS_11770 2555 2190 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence188 176 748 gene locus_tag LOCUS_11780 176 748 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_11780 916 1272 gene locus_tag LOCUS_11790 916 1272 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_11790 1428 2735 gene locus_tag LOCUS_11800 1428 2735 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_11800 2779 3189 gene locus_tag LOCUS_11810 2779 3189 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence189 490 218 gene locus_tag LOCUS_11820 490 218 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_11820 1152 487 gene locus_tag LOCUS_11830 1152 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1751 1149 gene locus_tag LOCUS_11840 1751 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2754 1774 gene locus_tag LOCUS_11850 gene srtB 2754 1774 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_11850 3220 2747 gene locus_tag LOCUS_11860 3220 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence190 416 1354 gene locus_tag LOCUS_11870 gene cysK 416 1354 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_11870 1408 2169 gene locus_tag LOCUS_11880 1408 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2195 2926 gene locus_tag LOCUS_11890 2195 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence191 723 190 gene locus_tag LOCUS_11900 gene spoVT 723 190 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_11900 891 1166 gene locus_tag LOCUS_11910 891 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1850 1236 gene locus_tag LOCUS_11920 1850 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2669 1866 gene locus_tag LOCUS_11930 2669 1866 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_11930 2920 2723 gene locus_tag LOCUS_11940 2920 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence192 1369 263 gene locus_tag LOCUS_11950 1369 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2816 1353 gene locus_tag LOCUS_11960 2816 1353 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence193 3100 473 gene locus_tag LOCUS_11970 3100 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence194 2710 266 gene locus_tag LOCUS_11980 2710 266 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence195 477 1010 gene locus_tag LOCUS_11990 477 1010 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_11990 2570 1050 gene locus_tag LOCUS_12000 2570 1050 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860226.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence196 <1 1498 gene locus_tag LOCUS_12010 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_087065956.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1495 2379 gene locus_tag LOCUS_12020 gene rsgA 1495 2379 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence197 647 333 gene locus_tag LOCUS_12030 647 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1133 930 gene locus_tag LOCUS_12040 1133 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1656 2408 gene locus_tag LOCUS_12050 1656 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2447 2998 gene locus_tag LOCUS_12060 2447 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence198 492 2954 gene locus_tag LOCUS_12070 492 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence199 860 96 gene locus_tag LOCUS_12080 860 96 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_12080 2803 860 gene locus_tag LOCUS_12090 gene metG 2803 860 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence200 228 1661 gene locus_tag LOCUS_12100 228 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1697 1897 gene locus_tag LOCUS_12110 1697 1897 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_12110 1952 2863 gene locus_tag LOCUS_12120 1952 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence201 222 1751 gene locus_tag LOCUS_12130 gene guaA 222 1751 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_12130 2351 1848 gene locus_tag LOCUS_12140 2351 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2529 2717 gene locus_tag LOCUS_12150 2529 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence202 2763 2599 gene locus_tag LOCUS_12160 2763 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence203 1756 95 gene locus_tag LOCUS_12170 gene malL 1756 95 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_12170 2559 1759 gene locus_tag LOCUS_12180 gene rlmA 2559 1759 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_12180 2663 2523 gene locus_tag LOCUS_12190 2663 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence204 <1 1124 gene locus_tag LOCUS_12200 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962349.1:leucine-rich repeat domain-containing protein 1121 2011 gene locus_tag LOCUS_12210 1121 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2024 2851 gene locus_tag LOCUS_12220 2024 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence205 2411 483 gene locus_tag LOCUS_12230 2411 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence206 1709 228 gene locus_tag LOCUS_12240 1709 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2448 1693 gene locus_tag LOCUS_12250 2448 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence207 1243 2598 gene locus_tag LOCUS_12260 1243 2598 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence208 416 955 gene locus_tag LOCUS_12270 416 955 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_12270 957 1409 gene locus_tag LOCUS_12280 957 1409 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288165.1 protein_id gnl|my_center|LOCUS_12280 1418 2323 gene locus_tag LOCUS_12290 gene trxB 1418 2323 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_12290 2338 2535 gene locus_tag LOCUS_12300 2338 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence209 295 1554 gene locus_tag LOCUS_12310 295 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1761 2726 gene locus_tag LOCUS_12320 1761 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence210 207 1280 gene locus_tag LOCUS_12330 gene pepQ 207 1280 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_12330 1375 1938 gene locus_tag LOCUS_12340 gene efp 1375 1938 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_12340 1968 2582 gene locus_tag LOCUS_12350 1968 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence211 319 780 gene locus_tag LOCUS_12360 319 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 784 1473 gene locus_tag LOCUS_12370 784 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1473 2630 gene locus_tag LOCUS_12380 1473 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence212 710 162 gene locus_tag LOCUS_12390 710 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1264 710 gene locus_tag LOCUS_12400 1264 710 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_12400 2079 1264 gene locus_tag LOCUS_12410 2079 1264 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_12410 2629 2216 gene locus_tag LOCUS_12420 2629 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence213 965 324 gene locus_tag LOCUS_12430 gene trmB 965 324 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132468.1 protein_id gnl|my_center|LOCUS_12430 1652 1161 gene locus_tag LOCUS_12440 1652 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence214 1427 1561 gene locus_tag LOCUS_12450 1427 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence215 91 333 gene locus_tag LOCUS_12460 gene rpsP 91 333 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_12460 372 605 gene locus_tag LOCUS_12470 372 605 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_12470 672 1187 gene locus_tag LOCUS_12480 gene rimM 672 1187 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_12480 1177 1914 gene locus_tag LOCUS_12490 gene trmD 1177 1914 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 protein_id gnl|my_center|LOCUS_12490 2173 2436 gene locus_tag LOCUS_12500 2173 2436 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence216 <1 1894 gene locus_tag LOCUS_12510 <1 1894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582633.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence217 2285 624 gene locus_tag LOCUS_12520 2285 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence218 >Feature sequence219 180 836 gene locus_tag LOCUS_12530 gene tsaA 180 836 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_12530 2432 891 gene locus_tag LOCUS_12540 2432 891 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence220 <1 570 gene locus_tag LOCUS_12550 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002294013.1:ABC transporter ATP-binding protein 563 2302 gene locus_tag LOCUS_12560 563 2302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence221 1494 1105 gene locus_tag LOCUS_12570 1494 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1682 2476 gene locus_tag LOCUS_12580 1682 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence222 >Feature sequence223 376 242 gene locus_tag LOCUS_12590 376 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2080 473 gene locus_tag LOCUS_12600 2080 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence224 401 1741 gene locus_tag LOCUS_12610 401 1741 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_12610 1741 2469 gene locus_tag LOCUS_12620 1741 2469 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948177.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence225 571 149 gene locus_tag LOCUS_12630 gene ohrR 571 149 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_12630 1685 585 gene locus_tag LOCUS_12640 1685 585 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_12640 2158 1940 gene locus_tag LOCUS_12650 2158 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2349 2274 gene locus_tag LOCUS_t00160 2349 2274 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence226 496 948 gene locus_tag LOCUS_12660 gene mscL 496 948 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_12660 978 1907 gene locus_tag LOCUS_12670 978 1907 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence227 >Feature sequence228 105 1220 gene locus_tag LOCUS_12680 gene murG 105 1220 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286637.1 protein_id gnl|my_center|LOCUS_12680 1223 2263 gene locus_tag LOCUS_12690 1223 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence229 110 1447 gene locus_tag LOCUS_12700 110 1447 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_12700 1522 1941 gene locus_tag LOCUS_12710 1522 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence230 3 524 gene locus_tag LOCUS_12720 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 619 2088 gene locus_tag LOCUS_12730 619 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence231 855 97 gene locus_tag LOCUS_12740 855 97 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_12740 1863 868 gene locus_tag LOCUS_12750 1863 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence232 258 13 gene locus_tag LOCUS_12760 258 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1595 606 gene locus_tag LOCUS_12770 1595 606 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_12770 1857 1654 gene locus_tag LOCUS_12780 1857 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2033 2287 gene locus_tag LOCUS_12790 2033 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence233 235 840 gene locus_tag LOCUS_12800 gene thrH 235 840 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_12800 1252 2313 gene locus_tag LOCUS_12810 1252 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence234 544 2052 gene locus_tag LOCUS_12820 544 2052 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence235 326 1075 gene locus_tag LOCUS_12830 326 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1157 2365 gene locus_tag LOCUS_12840 1157 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence236 2160 1180 gene locus_tag LOCUS_12850 2160 1180 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence237 105 278 gene locus_tag LOCUS_12860 105 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 339 929 gene locus_tag LOCUS_12870 339 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 917 1348 gene locus_tag LOCUS_12880 gene aroQ 917 1348 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460281.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence238 91 537 gene locus_tag LOCUS_12890 91 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 518 751 gene locus_tag LOCUS_12900 518 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 754 945 gene locus_tag LOCUS_12910 754 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1276 2175 gene locus_tag LOCUS_12920 1276 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence239 469 1470 gene locus_tag LOCUS_12930 469 1470 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence240 646 2166 gene locus_tag LOCUS_12940 646 2166 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence241 677 1543 gene locus_tag LOCUS_12950 gene garR 677 1543 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098882.1 protein_id gnl|my_center|LOCUS_12950 1536 2201 gene locus_tag LOCUS_12960 1536 2201 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence242 309 953 gene locus_tag LOCUS_12970 309 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1023 2258 gene locus_tag LOCUS_12980 1023 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence243 431 1015 gene locus_tag LOCUS_12990 431 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 <2312 1081 gene locus_tag LOCUS_13000 <2312 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026199036.1:serine hydroxymethyltransferase >Feature sequence244 1677 322 gene locus_tag LOCUS_13010 1677 322 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence245 >Feature sequence246 233 1447 gene locus_tag LOCUS_13020 233 1447 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_13020 1606 2178 gene locus_tag LOCUS_13030 gene sigH 1606 2178 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence247 1226 927 gene locus_tag LOCUS_13040 1226 927 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809935.1 protein_id gnl|my_center|LOCUS_13040 1955 1326 gene locus_tag LOCUS_13050 1955 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence248 389 1375 gene locus_tag LOCUS_13060 389 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence249 683 150 gene locus_tag LOCUS_13070 683 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 955 1836 gene locus_tag LOCUS_13080 955 1836 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_13080 1839 2090 gene locus_tag LOCUS_13090 1839 2090 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence250 2026 143 gene locus_tag LOCUS_13100 gene htpG 2026 143 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence251 >Feature sequence252 678 79 gene locus_tag LOCUS_13110 678 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1173 736 gene locus_tag LOCUS_13120 1173 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1789 1187 gene locus_tag LOCUS_13130 1789 1187 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence253 1902 616 gene locus_tag LOCUS_13140 1902 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence254 1786 197 gene locus_tag LOCUS_13150 1786 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence255 184 507 gene locus_tag LOCUS_13160 184 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 504 941 gene locus_tag LOCUS_13170 gene spoIIAB 504 941 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_13170 935 1588 gene locus_tag LOCUS_13180 gene sigF 935 1588 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence256 1693 185 gene locus_tag LOCUS_13190 1693 185 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence257 768 61 gene locus_tag LOCUS_13200 768 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence258 >Feature sequence259 205 1671 gene locus_tag LOCUS_13210 205 1671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence260 91 1701 gene locus_tag LOCUS_13220 91 1701 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence261 707 177 gene locus_tag LOCUS_13230 707 177 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434065.1 protein_id gnl|my_center|LOCUS_13230 1803 937 gene locus_tag LOCUS_13240 1803 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence262 >Feature sequence263 1558 1226 gene locus_tag LOCUS_13250 1558 1226 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence264 220 1728 gene locus_tag LOCUS_13260 220 1728 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence265 1060 119 gene locus_tag LOCUS_13270 1060 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1523 1050 gene locus_tag LOCUS_13280 1523 1050 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227398.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence266 1603 638 gene locus_tag LOCUS_13290 1603 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence267 660 43 gene locus_tag LOCUS_13300 660 43 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_13300 782 1543 gene locus_tag LOCUS_13310 782 1543 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898387.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence268 1447 596 gene locus_tag LOCUS_13320 1447 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence269 495 1532 gene locus_tag LOCUS_13330 495 1532 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence270 869 375 gene locus_tag LOCUS_13340 gene trmL 869 375 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence271 >Feature sequence272 629 387 gene locus_tag LOCUS_13350 629 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 <1790 880 gene locus_tag LOCUS_13360 <1790 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153018379.1:peptide chain release factor 2 >Feature sequence273 187 262 gene locus_tag LOCUS_t00170 187 262 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 270 345 gene locus_tag LOCUS_t00180 270 345 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 390 500 gene locus_tag LOCUS_r00010 390 500 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 511 586 gene locus_tag LOCUS_t00190 511 586 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <1786 764 gene locus_tag LOCUS_13370 <1786 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054278179.1:site-specific integrase >Feature sequence274 23 1702 gene locus_tag LOCUS_13380 23 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence275 >Feature sequence276 1556 771 gene locus_tag LOCUS_13390 1556 771 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence277 1689 361 gene locus_tag LOCUS_13400 1689 361 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987064.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence278 354 1661 gene locus_tag LOCUS_13410 354 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence279 <1 639 gene locus_tag LOCUS_13420 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903470.1:aspartate--ammonia ligase 1298 702 gene locus_tag LOCUS_13430 1298 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence280 1388 258 gene locus_tag LOCUS_13440 gene ftsZ 1388 258 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence281 662 330 gene locus_tag LOCUS_13450 662 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 858 655 gene locus_tag LOCUS_13460 858 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 920 1384 gene locus_tag LOCUS_13470 920 1384 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_13470 1381 1584 gene locus_tag LOCUS_13480 1381 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence282 >Feature sequence283 >Feature sequence284 1459 113 gene locus_tag LOCUS_13490 1459 113 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence285 <1652 440 gene locus_tag LOCUS_13500 <1652 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047982.1:YhgE/Pip domain-containing protein >Feature sequence286 1197 190 gene locus_tag LOCUS_13510 1197 190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence287 378 1412 gene locus_tag LOCUS_13520 378 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence288 1102 248 gene locus_tag LOCUS_13530 1102 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence289 944 672 gene locus_tag LOCUS_13540 944 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence290 553 122 gene locus_tag LOCUS_13550 gene aroQ 553 122 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460281.1 protein_id gnl|my_center|LOCUS_13550 1131 541 gene locus_tag LOCUS_13560 1131 541 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_13560 1366 1193 gene locus_tag LOCUS_13570 1366 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence291 1311 202 gene locus_tag LOCUS_13580 1311 202 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964588.1 protein_id gnl|my_center|LOCUS_13580 1584 1372 gene locus_tag LOCUS_13590 1584 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence292 355 942 gene locus_tag LOCUS_13600 gene lexA 355 942 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_13600 942 1406 gene locus_tag LOCUS_13610 942 1406 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence293 1134 298 gene locus_tag LOCUS_13620 1134 298 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence294 397 699 gene locus_tag LOCUS_13630 397 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 902 1213 gene locus_tag LOCUS_13640 902 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence295 577 404 gene locus_tag LOCUS_13650 577 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 891 1190 gene locus_tag LOCUS_13660 891 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence296 <1543 552 gene locus_tag LOCUS_13670 <1543 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048342.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence297 119 1447 gene locus_tag LOCUS_13680 119 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence298 251 1312 gene locus_tag LOCUS_13690 251 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690